Single-cell analysis container and single-cell analysis method using the same

Abstract

To provide a container for single cell analysis that enables a solid phase in a single cell analysis device to be readily and rapidly retrieved into a separate container, can reduce the time for nucleic acid treatment reactions, and enables applying a wide range of nucleic acid treatment reactions, and to provide a single cell analysis method using the same.SOLUTION: A container for single cell analysis 21 comprises: a reaction substrate comprising a cell capture part 7 that captures cells 31 and one or more micro reaction tanks 8 that are disposed directly under the cell capture part 7 and filled with a solid phase; and a cell holding part 7 that has the reaction substrate as its bottom and is configured to hold a solution containing the cells 31.SELECTED DRAWING: Figure 2

Description

Technical Field

[0001] The present invention relates to a container for single cell analysis and a single cell analysis method using the same. The present invention also relates to an automated device for performing single cell analysis using such a container for single cell analysis.

Background Art

[0002] Single cell analysis is a technique for highly accurately detecting and quantifying biomolecules in cells for each single cell. Various techniques for single cell analysis have been developed. In particular, a device that performs single cell analysis of a large number of cells on one device at a time has been developed and commercialized (Non-Patent Document 1). This technique is based on microfluidics using semiconductor patterning, and by constructing a large number of minute flow paths, reaction chambers, and valves in a two-dimensional plane, it is possible to cope with various reactions. In particular, for sample preparation for single cell analysis, a structure for capturing a single cell in a flow path in a two-dimensional plane, a reaction chamber for lysing the cell downstream thereof, a reaction chamber for reverse transcription reaction, and a reaction chamber for PCR amplification are connected in series. When preparing a nucleic acid sample from a cell for single cell analysis by arranging reaction chambers in series in such an in-plane flow path, the number of reaction chambers must be increased according to the number of cells to be processed. On the other hand, there is a limit to reducing the size of the necessary reaction chamber due to the size of the cell and the amount of biomolecules therein, and thus the area of the device increases as the number of cells increases. At this time, since this technique uses semiconductor patterning, there is a problem that the cost is proportional to the device area, and the device cost increases as the number of cells increases.

[0003] To overcome this challenge, a technique has been proposed to increase integration density and reduce device costs by constructing channels perpendicular to the surface of the device substrate, rather than parallel to it (Patent Documents 1-4). The devices described in these documents include a cell capture unit and a nucleic acid capture unit. A single cell is captured and isolated in the cell capture unit, and the mRNA is captured by a tagged DNA immobilized on beads or the surface of a porous material in the nucleic acid capture unit located directly beneath it, thereby inserting a different tag for each cell and each mRNA molecule. Furthermore, by reverse transcription on the device, the tag sequence and gene sequence are synthesized as a single cDNA strand. This cDNA is then amplified and sequenced using a next-generation sequencer. The number of individual cDNA molecules can be counted by counting the measured reads for each cell identification tag and molecular identification tag. In particular, this method has a high conversion efficiency from mRNA to cDNA, enabling highly accurate approximate mRNA counting. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] International Publication No. WO2014 / 020657 [Patent Document 2] International Publication No. WO2016 / 207986 [Patent Document 3] International Publication No. WO2014 / 141386 [Patent Document 4] International Publication WO2019 / 116800 (Japanese Patent Publication No. 2019-103415) [Non-patent literature]

[0005] [Non-Patent Document 1] D. Ramskold et al., Nat Biotechnol, Vol. 30, No. 8, pp. 777-782, 2012 [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] In cancer research, particularly in clinical research on personalized medicine, attention is being drawn to the analysis of the tumor microenvironment. This tumor microenvironment is composed of cancer cells, normal cells, and various immune cells, and single-cell analysis is attracting attention as a means of analyzing the state of genes expressed inside cells in order to analyze the function of these cells. Furthermore, antigen-presenting cells such as dendritic cells that infiltrate the tumor microenvironment migrate to lymph nodes, where cancer antigen-selective immune responses (such as killer T cell proliferation and antibody production) occur. The immune cells that proliferate here are then guided by signaling molecules such as chemokines and return to the cancer tissue. Therefore, it is hoped that changes in the tumor microenvironment can be partially observed, or by observing changes in the state of immune cells in peripheral blood, and this is beginning to attract attention.

[0007] Until now, single-cell analysis devices have often been configured to capture cells on a chip within the device, synthesize complementary cDNA by reverse transcribing the captured mRNA on the surface of beads packed in a micro-reaction vessel (nucleic acid capture section) directly below it within the device, and then perform nucleic acid processing reactions such as PCR within the device (Patent Documents 1 and 2). It is also possible to perform a variety of nucleic acid processing by immersing the chip within the device in a solution in a separate tube (resin container) and suspending the beads in the solution (Patent Documents 3 and 4).

[0008] However, in order to perform nucleic acid processing reactions within a device, it was necessary to develop a device that was specific to the reaction process, which limited the flexibility of nucleic acid processing.

[0009] Furthermore, in order to collect nucleic acids captured on solid phases such as beads and fibers within the device into a separate tube, it was necessary to remove the chip filled with the solid phase (beads) from the device using tweezers or other tools, immerse it in a solution in a container, and then disperse the solid phase (beads) in the solution in the container, which required considerable effort and time.

[0010] Figure 1 shows the configuration and usage of a single-cell analysis device in a conventional technique where beads are dispersed in a separate container from the single-cell analysis device. Figure 1A is a cross-sectional view of the single-cell analysis device. This device consists of an upper plate 3 for forming wells (containers) 2 that hold the cell suspension 1, a lower plate 5 for forming a channel 4 for solution aspiration, and a single-cell analysis chip 6 sandwiched between them. The single-cell analysis chip 6 has multiple through-holes, each with a cell capture section 7 in contact with the cell suspension, and directly below it a nucleic acid capture section 8 filled with beads immobilized with mRNA capture DNA probes. A porous membrane 9, with numerous pores smaller than the bead size, is tightly attached directly below the single-cell analysis chip 6 to hold the beads in the nucleic acid capture section. By connecting a suction pump to the channel 4 and applying negative pressure to the back surface of the single-cell analysis chip 6, the cell suspension 1 is aspirated through the cell capture section 7 and the nucleic acid capture section 8. At this time, cells are captured one by one in one of the cell capture sections 7, which are smaller than the diameter of the cell. When cells are captured, the flow of solution passing through the corresponding cell capture section stops, and the remaining cells are aspirated into the cell capture section 7 that have not yet been captured, and the cells are isolated. All cells are aspirated while the pump is kept running (dispensing so that the number of cells in the cell suspension is less than the number of cell capture sections), and when the cell disruption (lysis) solution is added to the wells, the cells are disrupted, and the cell disruption solution from each cell passes through the nucleic acid capture section. At this time, mRNA is captured by the DNA probe containing the poly-T sequence immobilized on the beads. The DNA probe immobilized on the beads has different sequences (cell identification tags) inserted at each position within the tip of the microreaction vessel (nucleic acid capture section) on the 3' end side of the poly-T sequence. Furthermore, a washing solution for the lysis solution is added, and after washing and draining the lysis solution from the nucleic acid capture section, the pump is stopped, the pressure is returned to atmospheric pressure, and then the reverse transcriptase solution is added, and a syringe is connected to the channel 4 so that the microreaction vessel (nucleic acid capture section) is filled with the reverse transcriptase solution, and negative pressure is applied for a few seconds. To prevent the reverse transcriptase from evaporating, seal the opening at the top of the well with a PCR seal or similar, and maintain the entire device at a temperature suitable for the reverse transcription reaction until the reaction is complete.After the reverse transcription reaction is complete, the device temperature is returned to room temperature, the seal is removed, and channel 4 is reconnected to the pump to completely aspirate any remaining reverse transcription reaction solution in well 2.

[0011] Next, as shown in Figures 1B and 1C, in order to remove the tip, the fixed upper plate 3 is removed, the tip 6 is grasped with tweezers 10, and immersed in the bead suspension recovery buffer 12 in the resin tube 11 for bead recovery. Before removing the tip, the enzyme solution is sufficiently aspirated, so that most of the beads packed in the nucleic acid capture section 8 of the tip are retained in the microreaction vessel (nucleic acid capture section). In order to suspend these beads in the bead suspension buffer, it is necessary to vibrate the tip, but when the tip is not fixed, it moves, making it difficult to apply vibration properly. Furthermore, when using a tip made of highly elastic PDMS (polydimethylsiloxane) that takes into account the enzyme reaction in the nucleic acid capture section, it becomes even more difficult to apply vibration because the tip is flexible. Therefore, the beads are diffused from the nucleic acid capture section into the solution by repeatedly bending and straightening the tip using tweezers, and the beads are collected with a magnet 13, taking advantage of the fact that the beads are magnetic beads. This bending and straightening of the tip not only slows down the diffusion of the beads, but also presents the challenge of contamination between the tips with beads or other substances in the solution, as the tweezers used to remove the tip must be immersed in the bead suspension. [Means for solving the problem]

[0012] The inventors have discovered that in a conventional single-cell analysis device, by using a single-cell analysis chip at the bottom of a container for holding a cell suspension, and attaching a detachable suction port to the underside of the bottom surface of the container (the underside of the chip) for aspirating the solution in the container through the chip, the container can be removed after the reaction on the chip, the contents can be introduced into another container, and the solid phase such as beads can be easily recovered into the other container by applying vibration to the chip.

[0013] Therefore, in one embodiment, the present invention is A reaction substrate including a cell capture unit that captures cells and one or more micro reaction vessels disposed directly below the cell capture unit and filled with a solid phase, A cell holding unit configured to hold a solution containing cells with the reaction substrate as the bottom, A single cell analysis container provided with is provided.

[0014] In another aspect, the present invention is a single cell analysis method using a single cell analysis device, In a single cell analysis device in which the single cell analysis container according to the present invention is fixed, a step of introducing a solution containing cells into the container, A step of capturing cells in the cell capture unit, A step of reacting with respect to the nucleic acid derived from the captured cells in the micro reaction vessel, After the reaction, a step of removing the container from the single cell analysis device, A step of collecting the solid phase from the removed container A method including is provided.

[0015] In yet another aspect, the present invention is an automated single cell analysis device, A single cell analysis device configured to fix the single cell analysis container according to the present invention, A mechanism for removing the container from the single cell analysis device and moving it to another container, A mechanism for vibrating the container in the another container, A control device Equipped with, the control device controls the removal of the container from the single cell analysis device, the movement to the another container, and the vibration of the container in the another container after the reaction in the single cell analysis device, and provides an apparatus.

Effects of the Invention

[0016] The present invention provides a single-cell analysis container for use in a single-cell analysis device, a single-cell analysis method using the same, and an automated single-cell analysis apparatus. According to the present invention, the solid phase in the single-cell analysis device can be easily and quickly recovered into another container, the time for nucleic acid treatment reactions is shortened, and various nucleic acid treatment reactions can be applied. Therefore, the present invention is useful in the fields of single-cell analysis, particularly gene expression analysis, cell function analysis, fields where analysis of biological tissues is desired, disease diagnosis, drug discovery, and the like.

Brief Description of the Drawings

[0017] [Figure 1] Shows the configuration and usage of a single-cell analysis device when beads are dispersed in a container separate from the single-cell analysis device in the prior art. [Figure 2] Shows a specific structural example of the single-cell analysis container according to the present invention and its usage. [Figure 3] Shows a top view of the single-cell analysis container 21 when pulled up from the single-cell analysis device. [Figure 4] It is a view of the single-cell analysis container 21 of Example 1 seen from above. [Figure 5] It is a cross-sectional view of the single-cell analysis container 21 of Example 1 in a state where no cell suspension is contained. [Figure 6] It is a cross-sectional view of the single-cell analysis device of Example 1. [Figure 7] It is a graph showing the results of performing gene expression analysis derived from a single cell using the single-cell analysis container of Example 1. [Figure 8] It is a flowchart showing an example of a flow in an automated apparatus for single-cell analysis using the single-cell analysis container. [Figure 9] It is a diagram showing an example of the device configuration of an automated apparatus for single-cell analysis using the single-cell analysis container. [Figure 10] It is a top view (A) and a cross-sectional view (B) from above the chip 30 of the connecting container 201 which is an example of the single-cell analysis container. [Figure 11]This figure shows another example of an automated single-cell analysis system using a single-cell analysis container. [Modes for carrying out the invention]

[0018] In one embodiment, the present invention is A reaction substrate comprising a cell capture unit for capturing cells, and one or more micro-reaction vessels filled with a solid phase, located directly below the cell capture unit, The cell holding section is configured to hold a solution containing cells, with the reaction substrate as the bottom. This relates to a container for single-cell analysis equipped with the following features.

[0019] A reaction substrate comprising a cell capture unit and a reaction substrate can be a reaction substrate used in single-cell analysis devices known in the art. Such reaction substrates are described, for example, in WO2014 / 020657 (Patent Document 1), WO2014 / 141386 (Patent Document 3), and WO2019 / 116800 (Patent Document 4). In one embodiment, the reaction substrate is made of resin, particularly PDMS (polydimethylsiloxane), cycloolefin, polypropylene, polycarbonate, and polyethylene. The size of the micro-reaction vessel (nucleic acid capture unit) filled with a solid phase (beads, etc.) on the reaction substrate is, for example, 0.5 mm or less in diameter and 0.05 mm or more in depth, with an aspect ratio of 0.1 or more. The solid phase to be filled is not limited and can be, for example, beads (preferably magnetic beads), fibers (mesh, sponge, hollow fiber, etc.). When the solid phase to be filled is beads, the size of the beads is preferably, for example, 3 μm or less. The cell capture section is preferably shaped and sized such that each cell capture section captures a single cell.

[0020] The reaction substrate comprises a layer having through-holes for suction located on the side opposite the cell holding portion. Such a configuration is described in the aforementioned literature and is known to those skilled in the art. By aspirating the solution portion of the cell-containing solution, reagents introduced onto the reaction substrate, washing solution, etc., through the through-holes, the reaction on the reaction substrate can be carried out rapidly and with high precision.

[0021] The cell holding section is configured to hold a solution containing cells, with the reaction substrate described above as its base. The shape of the cell holding section is not particularly limited as long as it is compatible with the single-cell analysis device to be fixed and can hold the solution; it can be any shape such as a cylinder, cone, rectangular prism, or triangular prism. The size of the cell holding section can be appropriately set according to the size of the reaction substrate and the single-cell analysis device, the amount of solution to be introduced, etc. The inner wall of the cell holding section may be treated with a water-repellent coating to prevent adhesion of cells, solution, and reaction reagents introduced onto the reaction substrate.

[0022] The single-cell analysis container according to the present invention is detachably fixed to a single-cell analysis device and can be removed after the reaction. Therefore, in one embodiment, the single-cell analysis container further comprises a fixing device for fixing it to the single-cell analysis device. In particular, it is preferable that the fixing device is such that it does not move during the reaction on the reaction substrate or during cleaning operations before and after the reaction, and can be stably fixed. Such a fixing device is not particularly limited and can be a screw, a projection, a magnet, a detachable adhesive, etc. Also in one embodiment, the single-cell analysis container further comprises an auxiliary device for removing it from the single-cell analysis device. In particular, it is preferable that the auxiliary device is such that the single-cell analysis container can be removed from the device simply and quickly in an automated device. Such an auxiliary device is not particularly limited and can be a projection, a magnet, etc. Even without an auxiliary device, the container can be removed from the single-cell analysis device by using a mechanism to grasp the container from the outside or a mechanism to hold the container by suction, so an auxiliary device is not necessary.

[0023] Figure 2 shows a specific structural example of a single-cell analysis container according to the present invention and how to use it. The lower plate 5 on which the suction channel 4 is located is the same as that of a conventional device (Figure 1). The difference is that the bottom surface of the container 21 for holding the cell suspension 1 is fixed so that it becomes the single-cell analysis chip 30. A membrane 9 for holding beads is tightly attached to the underside of the single-cell analysis chip, and a sealing rubber 25 is inserted between it and the lower plate to prevent air leakage when negative pressure is applied using a suction pump. In addition, in order to prevent air leakage, the container 21 must be positioned in line with the opening of the lower plate, and pressure must be applied toward the lower plate. This is achieved by the upper plate 23, the intermediate plate 22, and the positioning pin 24. Positioning pins 23 and 22 in-plane relative to the lower plate 5 is possible by passing the positioning pins through holes formed in each plate. Then, by screwing screws into the screw holes formed in 5 relative to 23, the upper plate can be tightly attached toward the lower plate, preventing air leakage.

[0024] The operation of the single-cell analysis device is the same as in the conventional method (Figure 1), in which cells 31 in the cell suspension 1 are aspirated and captured in the cell capture unit 7 by connecting a pump to the channel 4 and isolated. Furthermore, the procedures for the reverse transcription reaction, subsequent cooling, and removal of the reverse transcriptase solution are also the same.

[0025] Next, the screws securing the upper plate 23 are loosened and the upper plate 23 is removed. Then, the container lifting rod 27 is hooked onto the rod fixing projection 26 and the container 21 is lifted up. Figure 3 shows a top view of the single-cell analysis container 21 when it has been lifted from the single-cell analysis device. The bottom of the container 21 is the single-cell analysis chip 30. The rod 27 is inserted into the container at an angle of 29 (as shown by the dotted line in Figure 3), rotated to the position of 27, and by lifting the rod, the container 21 can be hooked onto the rod fixing projection 26 and fixed in place.

[0026] The container 21, lifted by the rod 27, is immersed in the bead suspension recovery buffer 12 in the tube 11. Then, the single-cell analysis chip 30 is vibrated with the vibration rod 28. Since the container can be firmly fixed by pressing it against the inner wall of the tube, the chip 30 is firmly fixed, making it possible to efficiently apply the vibration of the vibration rod to the chip 30.

[0027] This allows the nucleic acid capture beads to diffuse into the solution in a short time and be collected using the magnet 13.

[0028] In another embodiment, the present invention relates to a single-cell analysis method using a single-cell analysis device, In a single-cell analysis device in which a single-cell analysis container is fixed according to the present invention, the steps include introducing a solution containing cells into the container, The process of capturing cells in the cell capture unit, The process involves carrying out a reaction in the microreaction vessel with the captured cell-derived nucleic acids, After the reaction, the container is removed from the single-cell analysis device. A step of collecting the solid phase from the container that was removed, Regarding methods including

[0029] In one embodiment, the solid phase collection step includes immersing the single-cell analysis container in another container containing a solution and vibrating the single-cell analysis container. For example, if the solid phase is magnetic beads, the single-cell analysis method according to the present invention includes collecting the solid phase (magnetic beads) in another container using a magnet, either with or after this vibration.

[0030] In a further embodiment, the present invention relates to an automated single-cell analysis device, A single-cell analysis device configured to fix a single-cell analysis container according to the present invention, A mechanism for removing the container from the single-cell analysis device and moving it to another container, A mechanism for vibrating the aforementioned container within the aforementioned other container, Control device and The present invention relates to a device comprising the control device which, after a reaction in the single-cell analysis device, controls the removal of the container from the single-cell analysis device, its transfer to another container, and the vibration of the container within the other container.

[0031] In one embodiment, the control device may be controlled to remove the fixing device that secures the single-cell analysis container to the single-cell analysis device. In another embodiment, the control device may be controlled to prevent air leakage when pressing the single-cell analysis container against the single-cell analysis device and aspirating the reaction solution from the single-cell analysis container.

[0032] The single-cell analysis container and single-cell analysis method using the present invention enable rapid and simple recovery of the solid phase immobilized with cell-derived nucleic acid (mRNA) after the reaction in the single-cell analysis device, and are particularly useful in automated devices as described above. Furthermore, it prevents contamination with substances other than the desired solid phase, enabling more accurate single-cell analysis. [Examples]

[0033] The present invention will be specifically described below with reference to examples, but these examples are provided solely for the purpose of explaining the present invention and are not intended to limit or restrict the scope of the invention disclosed in this application.

[0034] [Example 1] This embodiment describes the structure of a single-cell analysis device incorporating a single-cell analysis container with a single-cell analysis chip forming the base, and a single-cell analysis method using this device.

[0035] (1) Structure of a single-cell analysis device incorporating a single-cell analysis container in which a single-cell analysis chip forms the base. Figure 4 shows a top view of the single-cell analysis container 21 in this embodiment. Here, a cell suspension is placed inside the container, and by applying negative pressure from the back, the solution is aspirated from the cell capture unit 7, and the cells 31 are captured and isolated. Figure 5 is a cross-sectional view of the single-cell analysis container 21 when there is no cell suspension. A nucleic acid capture unit 8 filled with beads is placed directly below the cell capture unit 7, and a channel is formed that penetrates the single-cell analysis chip 30.

[0036] Here, the thickness of the single-cell analysis chip was approximately 100 μm, and the diameter of the cell capture area was approximately 2-5 μm. Furthermore, the size of the nucleic acid capture area was a cylindrical shape with a diameter of 75 μm and a depth of 70 μm. Magnetic beads were packed into this area with a packing rate of 50%-95%. The packing method involved fixing a poly-T sequence-containing RT probe (CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCGTACNNNNNNNTTTTTTTTTTTTTTTTTTVN: Sequence ID No. 1) for capturing mRNA onto the beads (diameter 1 μm). As described in WO2016 / 125251A, a cell identification tag (TCGCGTAC as an example of one of approximately 100 known sequences) and a molecular identification tag sequence (NNNNNNN, N=A, G, C, or T) were also inserted into this RT probe. The processing method from cell dispensing to the reverse transcription reaction is shown below.

[0037] In addition to PDMS, the chip material can also be made from resin materials used in bio-enzyme reactions, such as polycarbonate, polypropylene, polyethylene, polypropylene, and cycloolefin.

[0038] The chip size was 3.4 mm square, and single-cell analysis wells were attached to it using adhesive. The largest well at the top was 4.5 x 4.5 mm square with a height of 3.5 mm. Acrylic was used as the material, but other materials such as polycarbonate, polypropylene, or cycloolefin may also be used.

[0039] Furthermore, the porous membrane used to hold the beads was a track-etch membrane with a pore diameter of 0.8 μm, where the solution flows only perpendicular to the membrane and the pore diameter is smaller than the diameter of the beads. This track-etch membrane adheres tightly to the PDMS chip, preventing bead leakage.

[0040] Figure 6 shows a cross-sectional view of the single-cell analysis device in this embodiment. The names and functions of each part are the same as in Figure 2. Although acrylic was used for the device material, other resin materials may be used, similar to the single-cell analysis container.

[0041] In this embodiment, two chips are connected to two suction channels 4, and four chips are mounted on one device with two suction channels (the other channel is located at the back in Figure 6). However, the number of chips can be increased by increasing the device area. Designed to process one type of sample with one device, if the number of single cells to be analyzed is around 470, 12 chips should be mounted on the device, and if 940 cells are needed, 24 chips should be mounted (allowing analysis of approximately 80% of the cells in the cell capture area). Furthermore, in this embodiment, a single chip was provided with a 7x7 cell capture section and a corresponding nucleic acid capture section. However, by changing this number to 10x10, 20x20, 30x30, and 100x100, it is possible to process approximately 80, 320, 720, and 8000 cells on a single chip, respectively. By creating a device equipped with 12 of these chips, it is possible to analyze 960, 3840, 8640, and 96000 single cells on a single device.

[0042] (2) Cell capture and reverse transcription reaction from cells using a single-cell analysis device In Figure 6, with the single-cell analysis container 21 fixed to the single-cell analysis chip (VFACs) 30, the cell suspension 1 is dispensed into the container, and the suction pump is connected to the suction channel 4. The suction pump is switched on, and pump suction (90 kPa) is applied from below the VFAC to capture individual cells 31 in the 3 μm cell capture section 7 on the VFACs. Subsequently, 8 μL of cell wash buffer (100 mM Tris (pH 8.0), 500 mM NaCl, 5 mM DTT, 0.4 U / μL RNase OUT, 0.1% Tween 20) is added, and pump suction (90 kPa) is applied again to recapture any small number of cells remaining on the surface of the VFACs. Add 1 μL of Cell Lysis buffer (100 mM Tris (pH 8.0), 500 mM NaCl, 10 mM EDTA, 1% SDS, 5 mM DTT, 1.33 U / μL RNase OUT) to lyse the cells, and capture the eluted mRNA with a bead-immobilized RT probe. After the reaction, remove the reagents by pump aspiration (90 kPa). Add 8 μL of Lysis wash buffer (100 mM Tris (pH 8.0), 500 mM NaCl, 5 mM DTT, 0.4 U / μL RNase OUT, 1% Tween 20), then pump aspiration (90 kPa) to remove any residual Cell Lysis Buffer that may inhibit the enzyme reaction. Repeat this procedure twice. Even when a series of pump aspirations are performed at a strength of 90 kPa in this step, cell-derived mRNA (approximately 10) 6 It has been confirmed that no loss of molecules / cells occurs. Both the Cell Lysis buffer and Lysis wash buffer contain a high concentration of 500 mM NaCl, and a sufficient amount (1.5 × 10⁻⁶) 10Because the RT probe (molecule) is immobilized on a magnetic bead, trace amounts of mRNA in cells are efficiently captured. Add 4.5 μL of reverse transcription reagent (1×FS Buffer (Takarabio), 2 mM DTT, 2 mM dNTPs, 3.2 U / μL RNase inhibitor (Takarabio), 10 Unit / μL SmartScribe RT (Takarabio), 0.2% Tween20) to the top surface of each VFAC. Seal the opening on the top surface of the single-cell analysis device (Thermo Fisher, Optical Adhesive Film) and incubate for 60 minutes in a thermostat preheated to 42°C. After incubation for 5 minutes at room temperature, remove the seal from the device and aspirate and remove the reverse transcription reagent with a pump.

[0043] Add the solution to a 0.5 mL tube that has been pre-added with Suspension Buffer (50 mM NaCl, 50 mM Tris (pH 8.0)) in a 100 μL tube.

[0044] Next, loosen the screws securing the upper plate and remove the upper plate 23. Then, hook the container lifting rod 27 onto the rod fixing projection 26 and lift the container 21.

[0045] The container 21, lifted by the rod 27, is immersed in a tube containing the bead suspension recovery buffer 12. Then, the single-cell analysis chip 30 is vibrated with the vibration rod 28. The vibration rod used was a commercially available pen-type vibrator with a carbonate rod (rod) with a diameter of approximately 1 mm fixed to it. The container 21 was vibrated while pressing the rod against the tip portion on the underside of the inner wall of the tube. This made it possible to suspend the beads in the solution in about 2 to 3 seconds per tip. A neodymium magnet was placed close to the bottom of the tube to collect the beads. After that, the container 21 was removed, the beads were washed twice with 50 μL of wash buffer (0.1% Tween 20, 10 mM Tris, pH 8.0), and the bead suspension was transferred to a 0.2 mL PCR tube and the beads were suspended in 1 μL of the same solution.

[0046] (3) Preparation of samples for next-generation sequencing (NGS) analysis by PCR amplification (3-1) 1st multiplex PCR amplification (2) The RT probe on the magnetic bead of the sample prepared in (2) was degraded with Exonuclease I, and then 1st multiplex PCR amplification was performed. Here, a forward primer set consisting of 44 types of oligonucleotides (SEQ ID NOs. 9-52) listed in Table 1 below and one reverse primer (PA primer, CCATCTCATCCCTGCGTGTCT: SEQ ID NO. 2) were used.

[0047] [Table 1] TIFF0007884380000002.tif75129

[0048] The details of the 1st multiplex PCR amplification are as follows: Prepare the Exonuclease I reaction solution (1x Exonuclease I buffer, 0.067 Unit / μL) on ice. Mix 14 μL of this with the sample prepared in (2) and incubate at 37°C for 15 minutes. Wash the beads three times with 50 μL of wash buffer (0.1% Tween 20, 50 mM Tris, pH 8.0), then suspend the beads in 1 μL of 10 mM Tris (pH 8.0). Prepare 9 μL of the 1st Multiplex PCR reagent (1 x Gflex PCR buffer, 0.2 μM 44plex primer mix, 2 μM PA primer, 0.075 Unit / μL Tks Gflex DNA polymerase) on ice. Mix 9 μL of prepared 1st Multiplex PCR reagent with 1 μL of bead sample and perform PCR amplification under appropriate temperature conditions (heat inactivation at 94°C for 1 minute, followed by 14 cycles of 98°C for 10 seconds → 58°C for 3 minutes → 68°C for 25 seconds, then 68°C for 2 minutes, followed by a constant temperature of 4°C). After capturing the beads with a neodymium magnet, collect 10 μL of the supernatant containing the amplification product into a tube, wash the beads with 40 μL of wash buffer (0.1% Tween 20, 10 mM Tris, pH 8.0), and mix the supernatant with the amplification product to a total of 50 μL. Add and mix 35 μL of Ampure XP, equivalent to 0.7 times the volume of the sample, and purify according to the manufacturer's recommended protocol. Finally, elute with 35 μL of wash buffer (10 mM Tris (pH 8.0), 0.1% Tween 20) and collect the supernatant in a separate tube.

[0049] (3-2) 2nd Multiplex PCR amplification The 1st Multiplex PCR product (product for gene analysis) obtained in (3-1) is amplified using a 2nd Multiplex PCR with a set of 44 forward primers (Table 2, SEQ ID NOs. 53-96) to which R2SP (Illumina's common sequence for NGS) has been added, and one reverse primer (PA primer, SEQ ID NO. 2). This amplifies the DNA for gene expression analysis.

[0050] [Table 2] TIFF0007884380000004.tif241155TIFF0007884380000005.tif86155

[0051] The details of the 2nd multiplex PCR amplification are as follows: Mix 13 μL of 2nd Multiplex PCR reagent (1x Multiplex PCR Plus, 0.3 μM 2nd R2SP-added 44plex primer mix, 3 μM PA primer) with 7 μL of 1st Multiplex PCR product, and amplify under appropriate temperature conditions (heat inactivation at 95°C for 5 minutes, followed by 3 cycles of 95°C for 30 seconds → 61°C for 5 minutes → 72°C for 30 seconds, followed by 3 cycles of 95°C for 30 seconds → 59°C for 5 minutes → 72°C for 30 seconds, followed by 3 cycles of 95°C for 30 seconds → 57°C for 5 minutes → 72°C for 30 seconds, followed by 3 cycles of 95°C for 30 seconds → 55°C for 5 minutes → 72°C for 30 seconds, then 72°C for 2 minutes, followed by a constant temperature of 4°C). Add 30 μL of 0.1% Tween 20 (10 mM Tris, pH 8.0) to 20 μL of 2nd Multiplex PCR product (total 50 μL). Add and mix 35 μL of Ampure XP, equivalent to 0.7 times the volume of the sample, and purify according to the manufacturer's recommended protocol. Finally, elute with 40 μL of wash buffer (10 mM Tris (pH 8.0), 0.1% Tween 20), and collect the supernatant in a separate tube.

[0052] (3-3) Third PCR for NGS library preparation Using the 2nd Multiplex PCR product obtained in (3-2) as a template, 3rd PCR amplification is performed to introduce common sequences necessary for Illumina's NGS (next-generation sequencing) analysis (P5-R1SP (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT: SEQ ID NO: 3), P7-R2SP (CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT: SEQ ID NO: 4)), and a Chip Tag (CT) sequence that identifies VFAC (TGACATA is one example from the 64 known sequences). Detailed conditions are shown below.

[0053] Prepare 22 μL of 3rd PCR reagent (1 x Gflex PCR buffer, 0.23 μM P5_R1SP_CT_PA primer (including one example of 64 types of CT, AATGATAACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACATACCATCTCATCCCTGCGTGTCTC: SEQ ID NO: 5), 0.23 μM P7_R2SP primer (CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGT: SEQ ID NO: 6), 0.01 μM P5 primer (AATGATACGGCGACCACCGAGATCTACAC: SEQ ID NO: 7), 0.01 μM P7 primer (CAAGCAGAAGACGGCATACGAGAT: SEQ ID NO: 8), 0.045 Units / μL Tks Gflex DNA polymerase) on ice and mix with 8 μL of the 2nd Multiplex PCR product obtained in (3-2). Amplification is performed under appropriate temperature conditions (after thermal deactivation at 94°C for 1 minute, followed by a cycle of 98°C for 10 seconds → 61°C for 1 minute → 68°C for 25 seconds, then a second cycle of 98°C for 10 seconds → 59°C for 1 minute → 68°C for 25 seconds, then a second cycle of 98°C for 10 seconds → 57°C for 1 minute → 68°C for 25 seconds, followed by a second cycle of 98°C for 10 seconds → 55°C for 1 minute → 68°C for 25 seconds, and finally a constant temperature of 4°C after 2 minutes at 68°C). To 30 μL of the amplification product, 20 μL of 0.1% Tween 20 (10 mM Tris, pH 8.0) was added to make up 50 μL. Then, 35 μL of Ampure XP, equivalent to 0.7 times the volume of the sample, was added and mixed, and the product was purified according to the manufacturer's recommended protocol. Finally, it was eluted with 40 μL of wash buffer (10 mM Tris (pH 8.0), 0.1% Tween 20), and the supernatant was collected in a separate tube. 1 μL of the 3rd PCR amplification product was analyzed by tip electrophoresis to determine the amplification product size (bp) and concentration (pmol / L), and then NGS analysis (Illumina, Miseq) was performed.By separating the data after NGS analysis into tag sequences (tip tags, cell identification tags, molecular identification tags) and mapping them to publicly available sequences of 44 genes in a public database, it becomes possible to count the number of mRNA molecules and obtain gene sequence data for each cell. The results are shown in Figure 7. As shown in the results, it has been demonstrated that gene expression analysis derived from single cells can be performed by using the single-cell analysis container of this embodiment.

[0054] [Example 2] This embodiment describes an automated system for single-cell analysis using a single-cell analysis container, including the process up to bead retrieval. Figure 8 shows a flowchart of the automated process.

[0055] Next, the functions of the system that realizes the automation of this process will be explained using the apparatus configuration diagram shown in Figure 9. First, a device 101 similar to the single-cell analysis device used in Example 1 is fixed onto the XY-axis movable stage 102. However, for automation purposes, the upper plate of the single-cell analysis device 101 fixed here is not fixed with screws (the screws are not attached), and the lower plate is fixed to the stage. At this time, the cell suspension containing the cells to be analyzed is dispensed into the single-cell analysis container 21 in advance. When the program is started to begin the process, the single-cell analysis tip is pressed against the lower plate, and the XZ-axis movable stage 102 and the Y-axis movable stage 103 are moved so that the upper plate is pressed against the upper plate removal blade (the ▲ part of 105) from below to prevent air leakage during aspiration. At this time, the position of the single-cell analysis device is adjusted using the XZ-axis movable stage so that the opening of the single-cell analysis well is not hidden by the blade. The blade was triangular and plate-shaped, and a 3mm thick SUS material was used to prevent the blade from bending even when the required pressure of the single-cell analysis device was applied. The pressure intensity was monitored by placing a pressure sensor on the underside of the single-cell analysis device. In this state, the desired pressure was maintained, and suction was started by the suction pump 104 to isolate the cells. After visually confirming that the cell suspension had been removed from the container, lysis buffer and lysis washing solution were introduced as in Example 1, and after confirming that the solution had been removed, the pump was switched off. In this example, the solution was dispensed manually, but it is also possible to use a known robotic dispensing mechanism.

[0056] After confirming that atmospheric pressure has returned, the reverse transcriptase is manually dispensed into the containers as in Example 1, and the pump is turned on for a short time of about 2 seconds to fill the nucleic acid capture section (micro-reaction vessel) of the single-cell analysis chip with the solution (reverse transcription reagent). After confirming that enzyme solution remains in each container, the openings are manually sealed. Then, the plate-shaped heater 102 placed under the single-cell analysis device on the XZ-axis movable stage is switched on to raise the device to 42°C as in Example 1, and the reverse transcription reaction is initiated. After the reaction time is complete, the device is cooled to room temperature, the seals are removed, and the pump is switched on to aspirate the reagent (enzyme solution) remaining in the containers.

[0057] Next, in order to remove the upper plate, the XZ-axis movable stage 102 is lowered once to reduce the pressure to zero, and then the XZ-axis movable stage 102 and the Y-axis movable stage 103 are controlled so that the blade is inserted between the upper plate and the intermediate plate. After insertion, the Z-axis movable stage is lowered further to separate the single-cell analysis container and the intermediate plate from the upper plate.

[0058] Next, using stages 102 and 103, the single-cell analysis device is moved to an area accessible by the container lifting rod. The container lifting rod, connected to a pickup arm 107 which is connected to stages 113 and 114 and positions the container lifting rod appropriately, is lowered and hooked onto a projection on the single-cell analysis container. Here, a screw structure is formed on the projection 26 so that the rod rotates simply by pushing it in to hook onto it. Next, the rod is lifted using stages 113 and 114 and moved to directly above the 96-well plate 115, and the container is immersed in the pre-dispensed buffer. Next, while maintaining the immersion state, the vibration rod 108 is brought into contact with the single-cell analysis chip using the Z-axis movable stage 112 (at this time, the Y-axis and X-axis are pre-adjusted so that they do not need to be moved). Simultaneously with switching on the vibrator 109, the magnet plate 117 (with magnets positioned in the center of one in four wells of the 96-well plate) is pushed up toward the 96-well plate 115 using the Z-axis movable stage 118. This allows the dispersed beads to be collected. At this time, the damper 110 is a rubber block that prevents the vibration of the vibrator from being transmitted to the entire device. Furthermore, it is connected to a Y-axis movable stage 111 for positioning the vibrator appropriately. 116 is a block that fixes the plate so that it does not move upward, and may have a built-in vibrator for automating the bead washing process (automation of the buffer dispensing mechanism is necessary for automation). 106 is a controller for controlling stages 102, 103 and the vibrator 109, etc., according to control from a PC.

[0059] Wait approximately 10 seconds for the beads to be collected, then remove the single-cell analysis container and vibration rod from the plate to complete the process.

[0060] Furthermore, there are other methods for lifting single-cell analysis containers and immersing (at least) a portion of a container in the solution of the wells in a 96-well plate 115 for bead collection. In particular, an effective method is to connect multiple containers and lift and immerse the connected single-cell analysis containers 201 together. The structure of a container that realizes this method is shown in Figure 10, and an example of the apparatus configuration is shown in Figure 11. Figure 10A shows a top view of only the connected container 201 from the top surface of the tip 30, and Figure 10B shows a cross-sectional view from the side with the container 201 inserted into the 96-well plate 115. In this embodiment, there are eight connected containers spaced 9 mm apart so that they can be inserted into the 96-well plate, and stainless steel magnetic fixing blocks 205 are provided at both ends so that the connected containers 201 can be lifted using magnets and inserted into the wells of the plate. At this time, the connecting parts 202 for fixing the spacing of the containers are also made of the same resin as the resin containers. Of course, a 384 plate (4.5 mm spacing) or an 8-tube system (9 mm spacing) can be used instead of a 96-hole plate. In addition to magnets, the containers can be secured by using the protrusions such as holes (206) at both ends of the connected containers to hook the claw-like projections and lift them up. Alternatively, a robotic hand (arm) capable of electrically gripping can be used to secure and move the connected containers.

[0061] When collecting beads using the apparatus, the linked container 201 is inserted into each well 207 of the plate 15, and the volume of the buffer (solution) for bead suspension collection is adjusted (approximately 150-200 μL) so that it comes into contact with the single-cell analysis chip 30. The container is lifted and immersed in the plate wells using the magnetic fixing arm 301 in the apparatus configuration diagram 11, with the magnet (neodymium magnet) 302 at the end of the arm magnetically fixed to the magnet fixing block 205. After immersing the linked container 201, a vibrator rod with a disposable tip is brought into contact with the tip, and the tip 30 is vibrated using the vibrator 109 to collect the beads 204 in the buffer 12 using the magnet 13 (Figure 10B). The magnets are fixed on the magnet plate 117, with one magnet assigned to every four wells 207 on the plate. After collecting the beads, the container was separated from the 96-well plate by lifting the arm 301, and the magnet plate 117 was further moved relative to the 96-well plate to allow the beads to be resuspended in the solution.

[0062] Furthermore, this container lifting method may also be used for containers that are not connected to each other. Furthermore, this connected container structure may also be applied to the device structure of Example 1, which does not use an automated reactor. [Explanation of Symbols]

[0063] 1: Cell suspension 2: Container for holding cell suspension 3: Upper plate 4: Suction channel 5: Lower plate 6. Single-cell analysis chips (VFACs: Vertical Flow Array Chips) 7:Cell capture part 8: Nucleic acid capture unit (micro-reaction vessel) 9: Porous membrane for bead retention 10: Tweezers 11: Resin tubes for bead collection (PCR tubes) 12: Buffer (solution) for bead suspension recovery 13: (Neodymium) Magnet 21: Container for single-cell analysis 22: Intermediate plate for in-plane positioning of container for single-cell analysis 23: Upper plate for pressing container for single-cell analysis 24: Positioning pin 25: Rubber for single-cell analysis chip seals 26: Rod fixing projection 27: Single-cell analysis container lifting rod 28: Vibration rod 29: The state in which the rod is inserted. 30: Single-cell analysis chips (VFACs: Vertical Flow Array Chips) 31: Cells (captured on the chip) 101: Single-cell analysis device 102: XZ-axis movable stage + plate-type heater (up to 50°C) for single-cell analysis device 103: Y-axis movable stage for single-cell analysis device 104: Suction pump 105: Blade and blade holder for removing the top plate 106: Stage, pump, vibration exciter, etc. controllers 107: Pickup arm (rod) for single-cell analysis containers 108: Vibrator rod with disposable tip (vibration rod) 109: Vibrator (vibration exciter) 110: Damper (prevents vibration transmission to the system) 111: Y-axis movable stage for vibrator rod 112: Z-axis movable stage for vibrator rod 113: Z-axis stage for container lifting 114: Y-axis stage for container transfer 115:96 well plate (or 0.5 mL / 1.5 mL tube array) 116: 96-hole plate fixing block (with vibrator) 117: Magnetic Plate Z-axis stage with Peltier cooler for 118:96 plates 201: Connected single-cell analysis containers 202: Inter-container connecting parts (made of resin) 204: Beads 205: Magnetic fixing block 206: Pickup hole 207: Well 301: Magnetic fixing arm 302: Magnet (Neodymium Magnet) [Sequence Listing Free Text]

[0064] Sequence IDs 1-96: Artificial (synthetic oligonucleotides)

Claims

1. A reaction substrate comprising a cell capture unit for capturing cells, and one or more micro-reaction vessels filled with a solid phase, located directly below the cell capture unit, The cell holding section, which has the reaction substrate as its bottom and is configured to hold a solution containing cells, Fixation device for immobilizing to a single-cell analysis device and A container for single-cell analysis, equipped with the following features: The container is fixed to the single-cell analysis device and can be removed from the single-cell analysis device.

2. The container according to claim 1, further comprising an auxiliary tool for removal from a single-cell analysis device.

3. The container according to claim 1, wherein the solid phase is beads.

4. The container according to claim 1, wherein the solid phase is magnetic beads.

5. The container according to claim 1, wherein each cell-capturing section captures a single cell.

6. The container according to claim 1, wherein the reaction substrate comprises a layer having through-holes for suction provided on the side opposite to the cell holding portion.

7. A single-cell analysis method using a single-cell analysis device, A single-cell analysis device with a fixed container according to claim 1, comprising the steps of introducing a solution containing cells into the container, The process of capturing cells in the cell capture unit, The process involves carrying out a reaction in the microreaction vessel with the captured cell-derived nucleic acids, After the reaction, the container is removed from the single-cell analysis device. A step of collecting the solid phase from the container that was removed, A method that includes this.

8. The method according to claim 7, wherein the solid phase collection step includes immersing the container in another container containing a solution and vibrating the container.

9. The method according to claim 8, wherein the solid phase is magnetic beads, and the method includes collecting the solid phase in the other container by a magnet, either with or after the vibration.

10. An automated single-cell analysis device, A single-cell analysis device configured to fix the container described in claim 1, A mechanism for removing the container from the single-cell analysis device and moving it to another container, A mechanism for vibrating the aforementioned container within the aforementioned other container, Control device and A device comprising, wherein the control device controls, after a reaction in the single-cell analysis device, the removal of the container from the single-cell analysis device, its transfer to another container, and the vibration of the container within the other container.

11. The apparatus according to claim 10, wherein the control device controls the removal of the fixing device that secures the container to the single-cell analysis device.

12. The apparatus according to claim 10, wherein the control device presses the container against the single-cell analysis device and controls the device to prevent air leakage when aspirating the reaction solution from the container.

Images