A method for producing DNA-edited eukaryotic cells, and a kit used in the said method.

Abstract

To establish a CRISPR-Cas3 system in a eukaryotic cell.SOLUTION: A method for manufacturing a DNA-edited eukaryotic cell comprises introducing a CRISPR-Cas3 system into a eukaryotic cell, where the CRISPR-Cas3 system includes the following (A)-(C): (A) a Cas3 protein, a polynucleotide encoding the protein, or an expression vector including the polynucleotide; (B) a cascade protein, a polynucleotide encoding the protein, or an expression vector including the polynucleotide; and (C) a crRNA, a polynucleotide encoding the crRNA, or an expression vector including the polynucleotide.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a method for producing eukaryotic cells, animals, and plants in which DNA is edited, and a kit used in the method.

Background Art

[0002] Bacteria and archaea have an adaptive immune mechanism that specifically recognizes and eliminates organisms such as phages that attempt to invade from the outside. This system, called the CRISPR-Cas system, first incorporates the genomic information of foreign organisms into its own genome (adaptation). Then, when the same foreign organism attempts to invade again, it uses the complementarity between the information incorporated into its own genome and the genomic sequence to cleave and eliminate the foreign genome (interference).

[0003] Recently, a genome editing (DNA editing) technique using the above CRISPR-Cas system as a "tool for DNA editing" has been developed (Non-Patent Document 1).

[0004] The effector that functions in the process of cleaving DNA in the CRISPR-Cas system is roughly classified into "class 1" consisting of multiple Cas and "class 2" consisting of a single Cas. In particular, as the class 1 CRISPR-Cas system, "type I" in which Cas3 and a Cascade complex (meaning a complex of Cascade and crRNA; the same applies hereinafter) are involved is widely known, and as the class 2 CRISPR-Cas system, "type II" in which Cas9 is involved is widely known (hereinafter, regarding the CRISPR-Cas system, "class 1 type I" and "class 2 type II" may also be simply referred to as "type I" and "type II", respectively). And, the CRISPR-Cas system of class 2 in which Cas9 is involved has been widely used in DNA editing techniques so far (hereinafter, sometimes referred to as the "CRISPR-Cas9 system"). For example, Non-Patent Document 1 reports a class 2 CRISPR-Cas system that cleaves DNA using Cas9.

[0005] On the other hand, despite numerous efforts, no successful genome editing cases have been reported in eukaryotic cells using Class 1 CRISPR-Cas systems (hereinafter sometimes referred to as "CRISPR-Cas3 systems") that cleave DNA using Cas3 and the cascade complex. For example, Non-Patent Documents 2 and 3 simply report that target DNA was completely degraded in a cell-free system and that specific E. coli strains could be selectively removed by using the CRISPR-Cas3 system, but these do not constitute successful genome editing, and have not been demonstrated in eukaryotic cells. Furthermore, Patent Document 1 suggests that because the CRISPR-Cas3 system degrades target DNA in E. coli due to the helicase and exonuclease activity of Cas3 (Example 5, Figure 6), genome editing should be performed using FokI nuclease instead of Cas3 in eukaryotic cells (Example 7, Figure 7, Figure 11). Furthermore, Patent Document 2 proposes that the CRISPR-Cas3 system degrades target DNA in E. coli (Figure 4), and therefore, by deleting Cas3 or using inactivated Cas3 (Cas3' and Cas3''), it can be repurposed for programmable gene repression (for example, Example 15, Claim 4(e)). [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Special Publication No. 2015-503535 [Patent Document 2] Special Publication No. 2017-512481 [Non-patent literature]

[0007] [Non-Patent Document 1] Jinek M et al. (2012) A Programmable Dual-RNA Guided DNA Endonuclease in Adaptive Bacterial Immunity, Science, Vol.337 (Issue 6096), pp.816-821 [Non-Patent Document 2] Mulepati S & Bailey S (2013) In Vitro Reconstitution of an Escherichia coli RNA-guided Immune System Reveals Unidirectional, ATP-dependent Degradation of DNA Target, Journal of Biological Chemistry, Vol.288 (No.31), pp.22184-22192 [Non-Patent Document 3] Ahmed A. Gomaa et al. (2014) Programmable Reomoval of Bacterial Strains by Use of Genome Targeting CRISPR-Cas Systems, mbio. asm. org, Volume 5, Issue 1, e00928-13 [Overview of the project] [Problems that the invention aims to solve]

[0008] This invention has been made in view of these circumstances, and its purpose is to establish the CRISPR-Cas3 system in eukaryotic cells. [Means for solving the problem]

[0009] The inventors, after diligent research to achieve the above objective, have finally succeeded in establishing a CRISPR-Cas3 system in eukaryotic cells. The most widely used CRISPR-Cas9 system has successfully performed genome editing in various eukaryotic cells, but this system typically uses mature crRNA as the crRNA. However, surprisingly, with the CRISPR-Cas3 system, genome editing was difficult in eukaryotic cells when mature crRNA was used, and efficient genome editing was only possible by using pre-crRNA, which is not normally used as a component of the system. In other words, it was found that cleavage of crRNA by proteins constituting the cascade is important for the CRISPR-Cas3 system to function in eukaryotic cells. This CRISPR-Cas3 system using pre-crRNA could be widely applied not only to type IE systems but also to type IF and type IG systems. Furthermore, by adding a nuclear localization signal, particularly a bipartite nuclear localization signal, to Cas3, the genome editing efficiency of the CRISPR-Cas3 system in eukaryotic cells could be further improved. Furthermore, the inventors have discovered that, unlike the CRISPR-Cas9 system, the CRISPR-Cas3 system can cause significant deletions in the PAM sequence or in its upstream region, and have thus completed the present invention.

[0010] In other words, the present invention relates to the CRISPR-Cas3 system in eukaryotic cells, and more specifically, provides the following invention.

[0011] [1] A method for producing DNA-edited eukaryotic cells, comprising introducing a CRISPR-Cas3 system into eukaryotic cells, wherein the CRISPR-Cas3 system comprises (A) to (C) below. (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, polynucleotide encoding the protein, or expression vector containing the polynucleotide, and (C) crRNA, polynucleotide encoding the crRNA, or expression vector containing the polynucleotide

[0012] [2] A method for producing an animal (except human) or plant in which DNA is edited, comprising introducing the CRISPR-Cas3 system into an animal (except human) or plant, wherein the CRISPR-Cas3 system comprises the following (A) to (C). (A) Cas3 protein, polynucleotide encoding the protein, or expression vector containing the polynucleotide, (B) Cascade protein, polynucleotide encoding the protein, or expression vector containing the polynucleotide, and (C) crRNA, polynucleotide encoding the crRNA, or expression vector containing the polynucleotide

[0013] [3] The method according to [1] or [2], comprising a step of cleaving crRNA by a protein constituting the Cascade protein after introducing the CRISPR-Cas3 system into a eukaryotic cell.

[0014] [4] The method according to [1] or [2], wherein the crRNA is pre-crRNA.

[0015] [5] The method according to any one of [1] to [4], wherein a nuclear localization signal is added to the Cas3 protein and / or the Cascade protein.

[0016] [6] The method according to [5], wherein the nuclear localization signal is a bipartite nuclear localization signal.

[0017] [7] A kit for use in the method according to any one of [1] to [6], comprising the following (A) and (B). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide

[0018] [8] The kit according to [7], further comprising a crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide.

[0019] [9] The kit according to [8], wherein the crRNA is pre-crRNA.

[0020]

[10] The kit according to any one of [7] to [9], wherein a nuclear localization signal is added to the Cas3 protein and / or the Cascade protein.

[0021]

[11] The kit according to

[10] , wherein the nuclear localization signal is a bipartite nuclear localization signal.

[0022] In the present specification, the term "polynucleotide" is intended to mean a polymer of nucleotides and is used synonymously with the terms "gene", "nucleic acid" or "nucleic acid molecule". The polynucleotide can exist in the form of DNA (for example, cDNA or genomic DNA) or in the form of RNA (for example, mRNA). Further, the term "protein" is used synonymously with "peptide" or "polypeptide".

Effects of the Invention

[0023] By using the CRISPR-Cas3 system of the present invention, it has become possible to edit DNA in eukaryotic cells.

Brief Description of the Drawings

[0024] [Figure 1] It is the result of the SSA assay measuring the cleavage activity against exogenous DNA. [Figure 2]This is a schematic diagram showing the location of the target sequence within the CCR5 gene. [Figure 3A] This figure shows the CCR5 gene (clone 1) with a portion of its base sequence deleted using the CRISPR-Cas3 system. [Figure 3B] This figure shows the CCR5 gene (clone 2) with a portion of its base sequence deleted using the CRISPR-Cas3 system. [Figure 3C] This diagram shows the CCR5 gene (clone 3) with a portion of its base sequence deleted using the CRISPR-Cas3 system. [Figure 3D] This figure shows the CCR5 gene (clone 4) with a portion of its base sequence deleted using the CRISPR-Cas3 system. [Figure 4] (a) is a schematic diagram representing the structure of a cascade plasmid. (b) is a schematic diagram representing the structure of a Cas3 plasmid. (c) is a schematic diagram representing the structure of a precrRNA plasmid. (d) is a schematic diagram representing the structure of a reporter vector (containing the target sequence). [Figure 5] This is a schematic diagram showing the location of the target sequence within the EMX1 gene. [Figure 6A] This figure shows the EMX1 gene (clone 1) with a portion of its base sequence deleted using the CRISPR-Cas3 system. [Figure 6B] This figure shows the EMX1 gene (clone 2) with a portion of the nucleotide sequence deleted using the CRISPR-Cas3 system. [Figure 7] This is a schematic diagram showing the structure of a Cas3 / cascade plasmid with bpNLS appended. [Figure 8] This is a schematic diagram showing the structure of a cascade (2A) plasmid. [Figure 9] This is the result of an SSA assay that measured the cleavage activity against exogenous DNA. [Figure 10A]This figure shows the structures of the pre-crRNA (LRSR and RSR) and mature crRNA used in this embodiment. In the figure, the underlined part indicates the 5' handle (Cas5 handle), and the double underlined part indicates the 3' handle (Cas6 handle). [Figure 10B] This figure shows the results of an SSA assay performed using pre-crRNA (LRSR and RSR) and mature crRNA. [Figure 11] This figure shows the results of SSA assays performed using one NLS or two NLSs (bpNLS) in a plasmid for Cas3 / cascade gene expression. [Figure 12] This figure illustrates the effect of the PAM sequence on the DNA cleavage activity of the CRISPR-Cas3 system. [Figure 13] This figure illustrates the effect of a single mismatch spacer on the DNA cleavage activity of the CRISPR-Cas3 system. [Figure 14] This figure illustrates the effects of Cas3 mutations in the HD nuclease domain (H74A), SF2 helicase domain motif 1 (K320A), and motif 3 (S483 / T485A). [Figure 15] This figure shows a comparison of the DNA cleavage activity of CRISPR-Cas3 systems of type IE, type IF, and type IG. [Figure 16] This figure shows the magnitude of deletions detected by the CRISPR-Cas3 system through sequencing of TA cloning samples of PCR products. [Figure 17] This figure shows the locations of deletions detected by the CRISPR-Cas3 system through a large-scale processing sequence of TA clones (n=49). [Figure 18A] This figure shows the number of deletions detected by the CRISPR-Cas3 system for each deletion size, using a microarray-based capture sequence of more than 1000kb around the targeted EMX1 gene locus. [Figure 18B]This figure shows the number of deletions detected per deletion size by the CRISPR-Cas3 system, using a microarray-based capture sequence of more than 1000kb around the targeted CCR5 locus. [Modes for carrying out the invention]

[0025] [1] Methods for producing DNA-edited eukaryotic cells, animals, and plants The present invention relates to a method comprising introducing a CRISPR-Cas3 system into eukaryotic cells, wherein the CRISPR-Cas3 system comprises the following (A) to (C). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, polynucleotide encoding the protein, or expression vector containing the polynucleotide, and (C) crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide

[0026] Class 1 CRISPR-Cas systems are classified into types I and III. Type I is further classified into six types—type IA, type IB, type IC, type ID, type IE, and type IF—depending on the type of protein that makes up the cascade (hereinafter simply referred to as "cascade" or "cascade protein"), as well as type IG, a subtype of type IB (see, for example, [van der Oost J et al. (2014) Unravelling the structural and mechanistic basis of CRISPR-Cas systems, Nature Reviews Microbiologym, Vol.12 (No.7), pp.479-492] and [Jackson RN et al. (2014) Fitting CRISPR-associated Cas3 into the Helicase Family Tree, Current Opinion in Structural Biology, Vol.24, pp.106-114]).

[0027] The Type I CRISPR-Cas system has the function of cleaving DNA through the cooperation of Cas3 (a protein with nuclease and helicase activity), a cascade, and crRNA. Since Cas3 is used as the nuclease, this system is referred to as the "CRISPR-Cas3 system" in this invention.

[0028] By using the CRISPR-Cas3 system of the present invention, the following advantages can be obtained, for example:

[0029] First, the crRNA used in the CRISPR-Cas3 system generally recognizes target sequences of 32-37 bases (Ming Li et al., Nucleic Acids Res. 2017 May 5; 45(8): 4642-4654). In contrast, the crRNA used in the CRISPR-Cas9 system generally recognizes target sequences of 18-24 bases. Therefore, the CRISPR-Cas3 system is thought to be able to recognize target sequences more accurately than the CRISPR-Cas9 system.

[0030] Furthermore, the PAM sequence of the CRISPR-Cas9 system, a Class 2 Type II system, is "NGG (N is any base)" adjacent to the 3' side of the target sequence. Similarly, the PAM sequence of the CRISPR-Cpf1 system, a Class 2 Type V system, is "AA" adjacent to the 5' side of the target sequence. In contrast, the PAM sequence of the CRISPR-Cas3 system of the present invention is "AAG" or a similar base sequence (e.g., "AGG", "GAG", "TAC", "ATG", "TAG", etc.) adjacent to the 5' side of the target sequence (Figure 12). Therefore, it is believed that the CRISPR-Cas3 system of the present invention can be used to target DNA editing regions that could not be recognized by conventional methods.

[0031] Furthermore, unlike the Class 2 CRISPR-Cas systems described above, the CRISPR-Cas3 system causes DNA breaks at multiple locations. Therefore, using the CRISPR-Cas3 system of the present invention, it is possible to induce widespread deletion mutations ranging from hundreds to thousands of base pairs, and in some cases even more (Figures 3, 6, 16-18). This functionality makes it possible to use the system for knocking out long genomic regions or knocking in long DNA sequences. In the case of knock-in, donor DNA is typically used, and this donor DNA also constitutes a molecule in the CRISPR-Cas3 system of the present invention.

[0032] In this specification, "Cas3" simply refers to the "Cas3 protein." The same applies to cascade proteins.

[0033] The CRISPR-Cas3 system of the present invention encompasses all six subtypes of type I. That is, the proteins constituting the CRISPR-Cas3 system may differ slightly in composition depending on the subtype (for example, the proteins constituting the cascade may differ), but the present invention encompasses all of these proteins. In fact, in this embodiment, it was found that genome editing is possible not only with type IE but also with type 1-G and type IF systems (Figure 15).

[0034] In the type IE CRISPR-Cas3 system, which is common among type I CRISPR-Cas3 systems, crRNA cleaves DNA in cooperation with Cas3 and its cascade (Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7).

[0035] In Type IA systems, Cas8a1, Csa5 (Cas11), Cas5, Cas6, and Cas7 are used as cascade components; in Type IB systems, Cas8b1, Cas5, Cas6, and Cas7 are used as cascade components; in Type IC systems, Cas8c, Cas5, and Cas7 are used as cascade components; in Type ID systems, Cas10d, Csc1 (Cas5), Cas6, and Csc2 (Cas7) are used as cascade components; in Type IF systems, Csy1 (Cas8f), Csy2 (Cas5), Cas6, and Csy3 (Cas7) are used as cascade components; and in Type IG systems, Cst1 (Cas8a1), Cas5, Cas6, and Cst2 (Cas7) are used as cascade components. In this invention, Cas3 and the cascade are collectively referred to as the "Cas protein group."

[0036] The following explanation uses a Type IE CRISPR-Cas3 system as a representative example, but for other types of CRISPR-Cas3 systems, you should appropriately substitute the cascade components that make up the system.

[0037] -Cas protein group- In the CRISPR-Cas3 system of the present invention, the Cas protein group can be introduced into eukaryotic cells in the form of proteins, in the form of polynucleotides encoding those proteins, or in the form of expression vectors containing those polynucleotides. When introducing the Cas protein group into eukaryotic cells in the form of proteins, the amount of each protein can be adjusted as appropriate, which is advantageous from a handling standpoint. Furthermore, considering the cleavage efficiency within the cell, the Cas protein group can be formed first and then introduced into eukaryotic cells.

[0038] In the present invention, it is preferable to add a nuclear localization signal to the Cas protein group. The nuclear localization signal can be added to the N-terminal and / or C-terminal side of the Cas protein group (the 5' and / or 3' ends of the polynucleotide encoding each Cas protein group). By adding a nuclear localization signal to the Cas protein group in this way, localization to the nucleus in the cell is promoted, which has the advantage of enabling efficient DNA editing.

[0039] The nuclear localization signals described above are peptide sequences consisting of several to tens of basic amino acids, and the sequence is not particularly limited as long as it is capable of translocating proteins into the nucleus. Specific examples of such nuclear localization signals are described, for example, in [Wu J et al. (2009) The Intracellular Mobility of Nuclear Import Receptors and NLS Cargoes, Biophysical journal, Vol.96 (Issue 9), pp.3840-3849], and any nuclear localization signal commonly used in the art can be used in the present invention.

[0040] The nuclear localization signal may be, for example, PKKKRKV (SEQ ID NO: 52) (encoded by the nucleotide sequence CCCAAGAAGAAGCGGAAGGTG (SEQ ID NO: 53)). When using the above nuclear localization signal, it is preferable to place a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 53 at the 5' end of each polynucleotide encoding the Cas protein group. Alternatively, the nuclear localization signal may be, for example, KRTADGSEFESPKKKRKVE (SEQ ID NO: 54) (encoded by the nucleotide sequence AAGCGGACTGCTGATGGCAGTGAATTTGAGTCCCCAAAGAAGAAGAGAAAGGTGGAA (SEQ ID NO: 55)). When using the above nuclear localization signal, it is preferable to place polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 55 at both ends of each polynucleotide encoding the Cas protein group (i.e., to use a "bipartite nuclear localization signal (bpNLS)").

[0041] These modifications, combined with the use of pre-crRNA described later, are important for the efficient expression and function of the CRISPR-Cas3 system of the present invention in eukaryotic cells.

[0042] One preferred embodiment of the Cas protein group used in the present invention is as follows: Cas3; a protein encoded by polynucleotides consisting of the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 7. Cse1 (Cas8); a protein encoded by a polynucleotide consisting of the base sequence shown in SEQ ID NO: 2 or SEQ ID NO: 8. Cse2 (Cas11); a protein encoded by a polynucleotide consisting of the base sequence shown in SEQ ID NO: 3 or SEQ ID NO: 9. Cas5; a protein encoded by polynucleotides consisting of the base sequence shown in SEQ ID NO: 4 or SEQ ID NO: 10. Cas6; a protein encoded by polynucleotides consisting of the base sequence shown in SEQ ID NO: 5 or SEQ ID NO: 11. Cas7; a protein encoded by a polynucleotide consisting of the base sequence shown in SEQ ID NO: 6 or SEQ ID NO: 12. The above Cas protein group consists of (1) proteins in which PKKKRKV (SEQ ID NO: 52) is added to the N-terminus of wild-type E. coli Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7 as a nuclear localization signal, or (2) proteins in which KRTADGSEFESPKKKRKVE (SEQ ID NO: 54) is added to the N-terminus and C-terminus of wild-type E. coli Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7 as a nuclear localization signal. By creating proteins with such amino acid sequences, the above Cas protein group can be translocated into the nucleus of eukaryotic cells. Once translocated into the nucleus, the above Cas protein group cleaves target DNA. Furthermore, it becomes possible to edit target DNA even in DNA regions with strong structures (such as heterochromatin), which is considered difficult with the CRISPAR-Cas9 system.

[0043] Another embodiment of each protein in the Cas protein group used in the present invention is a protein encoded by a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of the above Cas protein group. Another embodiment of each protein in the Cas protein group used in the present invention is a protein encoded by a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of the above Cas protein group. Each of the above proteins has DNA cleavage activity when it forms a complex with other proteins that constitute the Cas protein group. The meanings of terms such as "sequence identity" and "stringent conditions" will be explained later.

[0044] -Polynucleotides encoding the Cas protein group- The polynucleotides encoding wild-type proteins that constitute the type IE CRISPR-Cas system include polynucleotides that have been modified for efficient expression in eukaryotic cells. That is, modified polynucleotides encoding the Cas protein family can be used. One preferred embodiment of polynucleotide modification is modification to a base sequence suitable for expression in eukaryotic cells, for example, by optimizing codons for expression in eukaryotic cells.

[0045] One preferred embodiment of the polynucleotide encoding the Cas protein group used in the present invention is as follows: Cas3; a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 7. Cse1(Cas8); a polynucleotide consisting of the base sequence shown in SEQ ID NO: 2 or SEQ ID NO: 8. Cse2 (Cas11); a polynucleotide consisting of the base sequence shown in SEQ ID NO: 3 or SEQ ID NO: 9 Cas5; a polynucleotide consisting of the base sequence shown in SEQ ID NO: 4 or SEQ ID NO: 10 Cas6; a polynucleotide consisting of the base sequence shown in SEQ ID NO: 5 or SEQ ID NO: 11. Cas7; a polynucleotide consisting of the base sequence shown in SEQ ID NO: 6 or SEQ ID NO: 12. These are polynucleotides that have been artificially modified to enable expression and function in mammalian cells by modifying the base sequences that encode the wild-type Cas proteins of E. coli (Cas3; SEQ ID NO: 13, Cse1 (Cas8); SEQ ID NO: 14, Cse2 (Cas11); SEQ ID NO: 15, Cas5; SEQ ID NO: 16, Cas6; SEQ ID NO: 17, Cas7; SEQ ID NO: 18).

[0046] The artificial modification of the polynucleotides described above involves altering the base sequence to one suitable for expression in eukaryotic cells and adding a nuclear localization signal. The base sequence modification and addition of the nuclear localization signal are as described above. This is expected to lead to a greater increase in the expression level and enhanced function of the Cas protein group.

[0047] Another embodiment of the polynucleotide encoding the Cas protein group used in the present invention is a polynucleotide obtained by modifying the base sequence encoding the wild-type Cas protein group, consisting of a base sequence having 90% or more sequence identity with the base sequence of the Cas protein group described above. The proteins expressed from each of these polynucleotides have DNA cleavage activity when they form a complex with proteins expressed from other polynucleotides that constitute the Cas protein group.

[0048] Sequence identity of the nucleotide sequence can be at least 90%, more preferably 95% (e.g., 95%, 96%, 97%, 98%, 99% or higher) in the entire nucleotide sequence (or the region encoding the part necessary for the function of Cse3). Sequence identity can be determined using a program such as BLASTN (see [Altschul SF (1990) Basic local alignment search tool, Journal of Molecular Biology, Vol.215 (Issue 3), pp.403-410]). An example of parameters when analyzing the nucleotide sequence with BLASTN is setting score=100 and wordlength=12. Specific methods for performing analysis with BLASTN are known to those skilled in the art. Additions or deletions (such as gaps) may be allowed to align the comparison nucleotide sequence to an optimal state.

[0049] Furthermore, "having DNA cleavage activity" means that it is capable of cleaving a polynucleotide chain at at least one site.

[0050] The CRISPR-Cas3 system of the present invention preferably specifically recognizes a target sequence and cleaves DNA. Whether or not the CRISPR-Cas3 system specifically recognizes a target sequence can be determined, for example, by the dual-Luciferase assay described in Example A-1.

[0051] Another aspect of the polynucleotide encoding the Cas protein group used in the present invention is a polynucleotide that hybridizes under stringent conditions with a polynucleotide having a base sequence complementary to the base sequence of the Cas protein group. The proteins expressed from each of these polynucleotides have DNA cleavage activity when they form a complex with proteins expressed from other polynucleotides that constitute the Cas protein group.

[0052] Here, "stringent conditions" refer to conditions in which two polynucleotide chains form a double-stranded polynucleotide specific to the base sequence, but do not form a non-specific double-stranded polynucleotide. "Hybridizing under stringent conditions" can be rephrased as conditions in which hybridization is possible within a temperature range of 15°C lower, preferably 10°C lower, and more preferably 5°C lower, than the melting temperature (Tm value) of nucleic acids with high sequence identity (for example, perfectly matched hybrids).

[0053] An example of stringent conditions is as follows: First, two types of polynucleotides are hybridized for 16 to 24 hours at 60 to 68°C (preferably 65°C, more preferably 68°C) in a buffer solution (pH 7.2) consisting of 0.25 M Na2HPO4, 7% SDS, 1 mM EDTA, and 1 × Denhardt's solution. Then, two washes are performed for 15 minutes each in a buffer solution (pH 7.2) consisting of 20 mM Na2HPO4, 1% SDS, and 1 mM EDTA at 60 to 68°C (preferably 65°C, more preferably 68°C).

[0054] Another example is the following method: First, pre-hybridization is performed overnight at 42°C in a hybridization solution containing 25% formamide (50% formamide under more stringent conditions), 4×SSC (sodium chloride / sodium citrate), 50 mM Hepes (pH 7.0), 10× Denhardt's solution, and 20 μg / mL denatured salmon sperm DNA. Then, the labeled probe is added and the mixture is incubated overnight at 42°C to perform hybridization of two types of polynucleotides.

[0055] Next, perform cleaning under one of the following conditions: Normal conditions; clean with 1×SSC and 0.1% SDS as the cleaning solution at approximately 37°C. Severe conditions; clean with 0.5×SSC and 0.1% SDS as the cleaning solution at approximately 42°C. Even more severe conditions; clean with 0.2×SSC and 0.1% SDS as the cleaning solution at approximately 65°C.

[0056] Thus, the stricter the washing conditions for hybridization, the more specific the hybridization becomes. Note that the above combinations of SSC, SDS, and temperature conditions are merely examples. Similar stringency can be achieved by appropriately combining the aforementioned elements that determine hybridization stringency, or other elements (e.g., probe concentration, probe length, hybridization reaction time, etc.). This is described, for example, in [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed., New York: Cold Spring Harbor Laboratory Press, 2001].

[0057] -An expression vector containing polynucleotides encoding the Cas protein group- In this invention, an expression vector can be used to express the Cas protein group. As a base vector, various commonly used vectors can be used, and can be appropriately selected depending on the cells to which the expression vector is introduced or the method of introduction. Specifically, plasmids, phages, cosmids, etc., can be used. The specific type of vector is not particularly limited; any vector that can be expressed in host cells should be appropriately selected.

[0058] Examples of expression vectors mentioned above include phage vectors, plasmid vectors, viral vectors, retroviral vectors, chromosome vectors, episome vectors, and virus-derived vectors (bacterial plasmids, bacteriophages, yeast episomes, etc.), yeast chromosome elements and viruses (baculoviruses, papovaviruses, vaccinia viruses, adenoviruses, tripoxviruses, pseudorabies viruses, herpesviruses, lentiviruses, retroviruses, etc.), and vectors derived from combinations thereof (cosmids, phagemids, etc.).

[0059] The expression vector preferably further includes sites for transcription initiation and termination, and preferably contains a ribosome-binding site within the transcription region. The coding portion of the mature transcript in the vector will include a transcription initiation codon AUG at the beginning of the polypeptide to be translated, and a appropriately positioned stop codon at the end.

[0060] In the present invention, the expression vector for expressing the Cas protein group may include a promoter sequence. The promoter sequence may be appropriately selected depending on the type of eukaryotic cell used as the host. The expression vector may also include a sequence for enhancing transcription from DNA, such as an enhancer sequence. Examples of enhancers include the SV40 enhancer (located 100-270 bp downstream of the origin of replication), the initial promoter enhancer of cytomegalovirus, the polyoma enhancer located downstream of the origin of replication, and the adenovirus enhancer. The expression vector may also include a sequence for stabilizing the transcribed RNA, such as a poly-A addition sequence (polyadenylation sequence, polyA). Examples of poly-A addition sequences include poly-A addition sequences derived from growth hormone genes, poly-A addition sequences derived from bovine growth hormone genes, poly-A addition sequences derived from human growth hormone genes, poly-A addition sequences derived from SV40 virus, and poly-A addition sequences derived from human or rabbit β-globin genes.

[0061] The number of polynucleotides encoding Cas proteins incorporated into the same vector is not particularly limited, as long as the CRISPR-Cas system can function within the host cell into which the expression vector is introduced. For example, it is possible to design a system in which polynucleotides encoding Cas proteins are loaded into one type (identical) vector, and furthermore, it is possible to design a system in which all or some of the polynucleotides encoding each Cas protein are loaded into separate vectors. For example, it is possible to design a system in which polynucleotides encoding cascade proteins are loaded into one type (identical) vector, and polynucleotides encoding Cas3 are loaded into a separate vector. Preferably, from the viewpoint of expression efficiency, a method is used in which polynucleotides encoding each Cas protein are loaded into six different vectors.

[0062] Furthermore, multiple polynucleotides encoding the same protein may be included in the same vector for purposes such as regulating expression levels. For example, it is possible to design a vector in which polynucleotides encoding Cas3 are placed in two locations within the same vector.

[0063] Alternatively, an expression vector may be used that contains multiple base sequences encoding Cas proteins, with base sequences encoding amino acid sequences (such as 2A peptide) that are cleaved by intracellular proteases inserted between these base sequences (see, for example, the vector structure in Figure 8). When a polynucleotide having such a base sequence is transcribed and translated, a single linked polypeptide chain is expressed in the cell. Subsequently, the Cas proteins are separated by the action of intracellular proteases, becoming individual proteins that then form a complex and function. This allows for adjustment of the quantitative ratio of Cas proteins expressed in the cell. For example, an expression vector containing one base sequence encoding Cas3 and one base sequence encoding Cse1 (Cas8) is expected to express Cas3 and Cse1 (Cas8) in equal amounts. Furthermore, since it is possible to express multiple Cas proteins with a single expression vector, it is advantageous in terms of handling. On the other hand, from the viewpoint of high DNA cleavage activity, it is usually preferable to express each Cas protein using different expression vectors.

[0064] The expression vectors used in this invention can be prepared by known methods. Such methods include those described in the implementation manual included with the vector preparation kit, as well as those described in various manuals. For example, [Joseph Sambrook & David W. Russell, Molecular cloning: a laboratory manual 3rd Ed., New York: Cold Spring Harbor Laboratory Press, 2001] is a comprehensive manual.

[0065] -crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide- The CRISPR-Cas3 system of the present invention includes a crRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide for targeting DNA to be edited.

[0066] crRNA is an RNA that forms part of the CRISPR-Cas system and has a base sequence complementary to the target sequence. The CRISPR-Cas3 system of the present invention enables the specific recognition of the target sequence and cleavage of that sequence using crRNA. In CRISPR-Cas systems, such as the CRISPR-Cas9 system, mature crRNA has typically been used as the cRNA. However, when the CRISPR-Cas3 system functions in eukaryotic cells, it has become clear that the use of mature crRNA is unsuitable, although the reason is not clear. Surprisingly, it has been found that genome editing can be performed with high efficiency in eukaryotic cells by using precrRNA instead of mature crRNA. This fact is clear from comparative experiments between mature crRNA and precrRNA (Figure 10). Therefore, it is particularly preferable to use precrRNA as the crRNA in the present invention.

[0067] The precrRNA used in the present invention typically has a structure of "leader sequence-repeat sequence-spacer sequence-repeat sequence (LRSR structure)" or "repeat sequence-spacer sequence-repeat sequence (RSR structure)". The leader sequence is an AT-rich sequence that functions as a promoter for expressing the precrRNA. The repeat sequence is a sequence that is repeated via a spacer sequence, and the spacer sequence is a sequence designed in the present invention as a sequence complementary to the target DNA (originally, it is a sequence derived from foreign DNA that was incorporated during the adaptation process). The precrRNA becomes a mature crRNA when it is cleaved by a protein that constitutes the cascade (for example, Cas6 for types IA, B, D~E, and Cas5 for type IC).

[0068] Typically, the leader sequence has a chain length of 86 bases, and the repeat sequence has a chain length of 29 bases. The spacer sequence has a chain length of, for example, 10 to 60 bases, preferably 20 to 50 bases, more preferably 25 to 40 bases, and typically 32 to 37 bases. Therefore, the chain length of the precrRNA used in the present invention is, for example, 154 to 204 bases, preferably 164 to 194 bases, more preferably 169 to 184 bases, and typically 176 to 181 bases in the case of an LRSR structure. In the case of an RSR structure, it is, for example, 68 to 118 bases, preferably 78 to 108 bases, more preferably 83 to 98 bases, and typically 90 to 95 bases.

[0069] For the CRISPR-Cas3 system of the present invention to function in eukaryotic cells, the process by which the repeat sequence of the pre-crRNA is cleaved by the proteins constituting the cascade is considered important. Therefore, it should be understood that the repeat sequence may be shorter or longer than the chain length, as long as such cleavage occurs. In other words, the pre-crRNA can be described as a crRNA in which sequences sufficient for cleavage by the proteins constituting the cascade are added to both ends of the mature crRNA described later. A preferred embodiment of the method of the present invention includes the step of cleaving the crRNA by the proteins constituting the cascade after introducing the CRISPR-Cas3 system into eukaryotic cells.

[0070] On the other hand, mature crRNA, which is generated when precrRNA is cleaved, has a "5' handle sequence - spacer sequence - 3' handle sequence" structure. Typically, the 5' handle sequence consists of 8 bases from positions 22 to 29 of the repeat sequence and is held by Cas5. Also, typically, the 3' handle sequence consists of 21 bases from positions 1 to 21 of the repeat sequence, and forms a stem-loop structure at bases 6 to 21, which is held by Cas6. Therefore, the chain length of mature crRNA is usually 61 to 66 bases. However, depending on the type of CRISPR-Cas3 system, some mature crRNAs do not have a 3' handle sequence, in which case the chain length is 21 bases shorter.

[0071] The RNA sequence can be appropriately designed according to the target sequence for which DNA editing is desired. Furthermore, RNA synthesis can be carried out using any method known in the field.

[0072] -Eukaryotic cells- In this invention, "eukaryotic cells" include, for example, animal cells, plant cells, algal cells, and fungal cells. Animal cells include, for example, mammalian cells, as well as cells of fish, birds, reptiles, amphibians, and insects.

[0073] "Animal cells" include, for example, cells that make up an animal, cells that make up organs and tissues extracted from an animal, and cultured cells derived from animal tissue. Specifically, examples include germ cells such as oocytes and sperm; embryonic cells of each stage of the embryo (e.g., 1-cell stage embryo, 2-cell stage embryo, 4-cell stage embryo, 8-cell stage embryo, 16-cell stage embryo, morula stage embryo, etc.); stem cells such as induced pluripotent stem (iPS) cells and embryonic stem (ES) cells; and somatic cells such as fibroblasts, hematopoietic cells, neurons, muscle cells, osteocytes, hepatocytes, pancreatic cells, brain cells, and kidney cells. For oocytes used in the creation of genome-edited animals, pre-fertilization and post-fertilization oocytes can be used, but post-fertilization oocytes, i.e., fertilized eggs, are preferred. Particularly preferred are fertilized eggs from the pronuclear stage embryo. Oocytes can be used after being frozen and thawed.

[0074] In this invention, "mammal" is a concept that includes both humans and non-human mammals. Examples of non-human mammals include even-toed ungulates such as cattle, wild boars, pigs, sheep, and goats; odd-toed ungulates such as horses; rodents such as mice, rats, guinea pigs, hamsters, and squirrels; lagomorphs such as rabbits; and carnivores such as dogs, cats, and ferrets. The above-mentioned non-human mammals may be livestock or companion animals, or they may be wild animals.

[0075] Examples of "plant cells" include cells from grains, oil crops, fodder crops, fruits, and vegetables. "Plant cells" also include cells that make up an entire plant, cells that make up organs and tissues separated from a plant, and cultured cells derived from plant tissues. Examples of plant organs and tissues include leaves, stems, shoot apex (growth point), roots, tubers, and callus. Examples of plants include rice, corn, bananas, peanuts, sunflowers, tomatoes, rapeseed, tobacco, wheat, barley, potatoes, soybeans, cotton, and carnations, and also include their reproductive materials (e.g., seeds, tubers, and rhizomes).

[0076] -DNA editing- In the present invention, "editing the DNA of eukaryotic cells" may refer to a process of editing the DNA of eukaryotic cells in vivo or in vitro. Furthermore, "editing DNA" refers to operations (including combinations thereof) exemplified by the following types.

[0077] In this specification, the term "DNA" as used in the above context includes not only DNA present in the cell nucleus, but also DNA present outside the cell nucleus, such as mitochondrial DNA, and exogenous DNA. 1. The DNA strand is cleaved at the target site. 2. Delete a base from the DNA strand at the target site. 3. Insert a base into the DNA strand at the target site. 4. Substitute the bases of the DNA strand at the target site. 5. Modify the bases of the DNA strand at the target site. 6. Regulates the transcription of DNA (genes) at target sites.

[0078] In one embodiment of the CRISPR-Cas3 system of the present invention, a protein having enzymatic activity to modify target DNA in a manner other than introducing DNA cleavage is utilized. This embodiment can be achieved, for example, by fusing Cas3 or Cascade with a heterologous protein having desired enzymatic activity to form a chimeric protein. Therefore, "Cas3" and "Cascade" in the present invention also include such fusion proteins. The enzymatic activity of the fused protein includes, but is not limited to, deaminase activity (e.g., cytidine deaminase activity, adenosine deaminase activity), methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, photorecovery enzyme activity, and glycosylase activity. In this case, since Cas3 nuclease activity and helicase activity are not necessarily required, mutants of Cas3 in which some or all of these activities are deleted can be used (for example, a mutant of the D domain H74A (dnCas3), a mutant of the SF2 domain motif 1 K320N (dhCas3), and a double mutant of the SF2 domain motif 3 S483A / T485A (dh2Cas3)). For example, by using a fusion protein of a Cas3 mutant in which some or all of the nuclease activity is lost and a deaminase as a component of the CRISPR-Cas3 system of the present invention, precise genome editing becomes possible by substituting bases without causing a large deletion at the target site. The method for applying deaminase to the CRISPR-Cas system is well known (Nishida K. et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems, Science, DOI: 10.1126 / science.aaf8729, (2016)), and this method can be applied to the CRISPR-Cas3 system of the present invention.

[0079] In another embodiment of the CRISPR-Cas3 system of the present invention, transcription of a gene at the binding site of the system is regulated without DNA cleavage. This embodiment can be achieved, for example, by fusing Cas3 or Cascade with a desired transcription regulatory protein to form a chimeric protein. Therefore, "Cas3" and "Cascade" in the present invention also include such fusion proteins. Examples of transcription regulatory proteins include, but are not limited to, photoinducible transcription regulators, small molecule / drug-responsive transcription regulators, transcription factors, and transcription repressors. In this case, nuclease activity or helicase activity of Cas3 is not necessarily required, so as Cas3, mutants in which some or all of these activities are deleted (for example, a mutant of the D domain H74A (dnCas3), a mutant of the SF2 domain motif 1 K320N (dhCas3), and a double mutant of the SF2 domain motif 3 S483A / T485A (dh2Cas3)) can be used. Methods for applying transcriptional regulatory proteins to the CRISPR-Cas system are known to those skilled in the art.

[0080] Furthermore, in the CRISPR-Cas3 system of the present invention, if a mutant is used in which some or all of the nuclease activity of Cas3 is deleted, other proteins having nuclease activity may be fused with Cas3 or the cascade. Such embodiments are also included in the present invention.

[0081] Furthermore, in the CRISPR-Cas3 system of the present invention, if a mutant of Cas3 in which some or all of the nuclease activity is deleted is used, and the activity of other proteins is used in DNA editing, then "DNA cleavage activity" as used herein shall be interpreted as any of the various activities possessed by the other protein.

[0082] Furthermore, DNA editing may be performed on DNA contained in specific cells within an individual. Such DNA editing can, for example, target specific cells among the cells that make up an individual plant or animal.

[0083] The method for introducing the molecules constituting the CRISPR-Cas3 system of the present invention into eukaryotic cells in the form of a polynucleotide or an expression vector containing said polynucleotide is not particularly limited. Examples include electroporation, calcium phosphate method, liposome method, DEAE dextran method, microinjection method, cationic lipid-mediated transfection, electroporation, transduction, and infection using a viral vector. Such methods are described in many standard laboratory manuals, such as "Leonard G. Davis et al., Basic methods in molecular biology, New York: Elsevier, 1986".

[0084] The method for introducing the CRISPR-Cas3 system of the present invention into eukaryotic cells in the form of a protein is not particularly limited. Examples include electroporation, cationic lipid-mediated transfection, and microinjection.

[0085] The DNA editing method according to the present invention can be applied to a variety of fields. These applications include, for example, gene therapy, plant breeding, creation of transgenic animals or cells, production of useful substances, and life science research.

[0086] Known methods can be used to create non-human individuals from cells. When creating non-human individuals from cells in animals, germ cells or pluripotent stem cells are usually used. For example, molecules constituting the CRISPR-Cas3 system of the present invention are introduced into oocytes, and the resulting oocytes are then transplanted into the uterus of a female non-human mammal in a pseudopregnancy state, after which offspring are obtained. Transplantation can be performed with fertilized eggs at the 1-cell stage, 2-cell stage, 4-cell stage, 8-cell stage, 16-cell stage, or morula stage. Oocytes can be cultured under appropriate conditions until transplantation, if necessary. Transplantation and culture of oocytes can be performed based on conventionally known methods (Nagy A. et al., Manipulating the Mouse Embryo. Cold Spring Harbour, New York: Cold Spring Harbour Laboratory Press, 2003). Offspring or clones with desired DNA editing can also be obtained from the resulting non-human individuals.

[0087] Furthermore, it has long been known that the somatic cells of plants possess totipotency, and methods for regenerating plant bodies from plant cells have been established for various plant species. Therefore, for example, by introducing the molecules constituting the CRISPR-Cas3 system of the present invention into plant cells and regenerating a plant body from the resulting plant cells, a plant body with desired DNA knocked in can be obtained. From the obtained plant body, offspring, clones, or reproductive materials with the desired DNA edited can also be obtained. As a method for obtaining an individual by redifferentiating plant tissue through tissue culture, methods established in this art can be used (Transformation Protocols [Plants], edited by Yutaka Tabei, Kagaku Dojin, pp. 340-347 (2012)).

[0088] [2] Kits used in the CRISPR-Cas3 system The kit used in the CRISPR-Cas3 system of the present invention includes the following (A) and (B).

[0089] (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide Furthermore, the expression vector may include crRNA, a polynucleotide encoding the crRNA, or the polynucleotide.

[0090] The components of the kit of the present invention may be a mixture of all or some of them, or each may be independent.

[0091] The kit of the present invention can be used in fields such as pharmaceuticals, food, livestock farming, fisheries, industry, bioengineering, and life science research.

[0092] The following description of the kit of the present invention assumes its use as a pharmaceutical (drug) product. However, when using the above kit in fields such as livestock farming, bioengineering, or life science research, the following description can be appropriately modified based on the common technical knowledge of those fields.

[0093] Pharmaceuticals for editing the DNA of animal cells, including human cells, using the CRISPR-Cas3 system of the present invention can be prepared by conventional methods. More specifically, the molecules constituting the CRISPR-Cas3 system of the present invention can be prepared, for example, by compounding them with pharmaceutical excipients.

[0094] Here, "pharmaceutical additives" refers to substances other than the active ingredients contained in pharmaceuticals. Pharmaceutical additives are substances included in pharmaceuticals for purposes such as facilitating formulation, stabilizing quality, and enhancing usefulness. For example, the above-mentioned pharmaceutical additives may include excipients, binders, disintegrants, lubricants, fluidizers (solidifying agents), colorants, capsule coatings, coating agents, plasticizers, flavoring agents, sweeteners, flavoring agents, solvents, solubilizers, emulsifiers, suspending agents (adhesives), viscosity modifiers, pH adjusters (acidifiers, alkalizers, buffers), wetting agents (solubilizers), antimicrobial preservatives, chelating agents, suppository bases, ointment bases, curing agents, softening agents, medical water, propellants, stabilizers, and preservatives. These pharmaceutical additives can be readily selected by those skilled in the art in accordance with the intended dosage form and route of administration, as well as standard pharmaceutical practice.

[0095] Furthermore, the pharmaceuticals for editing the DNA of animal cells using the CRISPR-Cas3 system of the present invention may contain additional active ingredients. These additional active ingredients are not particularly limited and can be appropriately designed by those skilled in the art.

[0096] Specific examples of active ingredients and pharmaceutical additives described above can be found, for example, in standards established by the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA), and the Japanese Ministry of Health, Labour and Welfare.

[0097] Methods for delivering pharmaceuticals to desired cells include, for example, methods using viral vectors that target those cells (adenovirus vectors, adeno-associated virus vectors, lentiviral vectors, Sendai virus vectors, etc.) or antibodies that specifically recognize those cells. Pharmaceuticals can take any dosage form depending on the purpose. These pharmaceuticals are prescribed as appropriate by physicians or healthcare professionals.

[0098] Preferably, the kit of the present invention further includes instructions for use. [Examples]

[0099] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following examples.

[0100] A. Establishment of the CRISPR-Cas3 system in eukaryotic cells [Materials and Methods] [1] Preparation of a reporter vector containing the target sequence The target sequences were a sequence derived from the human CCR5 gene (SEQ ID NO: 19) and a CRISPR spacer sequence from E. coli (SEQ ID NO: 22).

[0101] To insert the target sequence into the vector, we prepared a synthetic polynucleotide (SEQ ID NO: 20) containing the target sequence (SEQ ID NO: 19) derived from the human CCR5 gene, and a synthetic polynucleotide (SEQ ID NO: 21) containing a sequence complementary to the target sequence (SEQ ID NO: 19). Similarly, we prepared a synthetic polynucleotide (SEQ ID NO: 23) containing the target sequence (SEQ ID NO: 22) derived from the CRISPR spacer sequence of E. coli, and a synthetic polynucleotide (SEQ ID NO: 24) containing a sequence complementary to the target sequence (SEQ ID NO: 22). All of the above synthetic polynucleotides were obtained from Hokkaido System Science Co., Ltd.

[0102] The above polynucleotides were inserted into a reporter vector using the method described in [Sakuma T et al. (2013) Efficient TALEN construction and evaluation methods for human cell and animal applications, Genes to Cells, Vol.18 (Issue 4), pp.315-326]. A summary of the procedure is as follows: First, polynucleotides with complementary sequences (polynucleotide of SEQ ID NO: 20 and polynucleotide of SEQ ID NO: 21; polynucleotide of SEQ ID NO: 23 and polynucleotide of SEQ ID NO: 24) were heated at 95°C for 5 minutes, then cooled to room temperature to hybridize. A block incubator (BI-515A, Astec Corporation) was used for this process. Next, the hybridized polynucleotides, which formed a double-stranded structure, were inserted into a base vector to create the reporter vector.

[0103] The sequences of the constructed reporter vectors are shown in SEQ ID NO: 31 (reporter vector containing a target sequence derived from the human CCR5 gene) and SEQ ID NO: 32 (reporter vector containing a target sequence derived from the CRISPR spacer sequence of E. coli). The structure of the reporter vectors is shown in Figure 4(d).

[0104] [2] Construction of Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, Cas7 and crRNA expression vectors [Insert amplification and preparation] For polynucleotides with modified base sequences encoding Cse1(Cas8), Cse2(Cas11), Cas5, Cas6, and Cas7 (SEQ ID NOs. 2, 3, 4, 5, and 6, respectively), we first commissioned GenScript to manufacture and obtain polynucleotides linked in the order of SEQ ID NOs. 2-3-6-4-5 (polynucleotides in which the base sequences encoding each protein were linked in the order of Cse1(Cas8)-Cse2(Cas11)-Cas7-Cas5-Cas6). The base sequences encoding each of the Cse1(Cas8)-Cse2(Cas11)-Cas7-Cas5-Cas6 proteins were linked with a 2A peptide (amino acid sequence: GSGATNFSLLKQAGDVEENPGP (SEQ ID NOs. 58)).

[0105] The base sequences encoding the 2A peptide differed slightly depending on the Cas protein ligation site, as follows: Sequence between Cse1 (Cas8) and Cse2 (Cas11): GGAAGCGGAGCAACCAACTTCAGCCTGCTGAAGCAGGCCGGCGATGTGGAGGAGAATCCAGGCCCC (Sequence ID 59). Sequence between Cse2 (Cas11) and Cas7: GGCTCCGGCGCCACCAATTTTTCTCTGCTGAAGCAGGCAGGCGATGTGGAGGAGAACCCAGGACCT (Sequence ID 60). Sequence between Cas7 and Cas5: GGATCTGGAGCCACCAATTTCAGCCTGCTGAAGCAAGCAGGCGACGTGGAAGAAAACCCAGGACCA (Sequence ID 61). Sequence between Cas5 and Cas6: GGATCTGGGGCTACTAATTTTTCTCTGCTGAAGCAAGCCGGCGACGTGGAAGAGAATCCAGGACCG (Sequence ID 62).

[0106] Next, each polynucleotide was amplified under the PCR conditions (primers and time course) shown in the table below. A 2720 Thermal Cycler (Applied Biosystems) was used for PCR.

[0107] [Table 1]

[0108] We obtained polynucleotides with the following complementary sequences, which are polynucleotides containing the base sequence necessary for expressing crRNA. 1. Polynucleotides for expressing crRNA corresponding to the sequence derived from the human CCR5 gene (SEQ ID NOs. 25 and 26, obtained from Hokkaido System Science Co., Ltd.) 2. Polynucleotides for expressing crRNA corresponding to the spacer sequence of E. coli (SEQ ID NOs. 27 and 28, obtained from Hokkaido System Science Co., Ltd.) 3. Polynucleotides for expressing crRNA corresponding to the sequence derived from the human EMX1 gene (SEQ ID NOs. 29 and 30, available from Fasmac).

[0109] [Ligation and transformation] pPB-CAG-EBNXN (provided by Sanger Center) was used as the substrate plasmid. 1.6 μg of the substrate plasmid was mixed with 1 μl of restriction enzyme BglII (New England Biolabs) and 0.5 μl of XhoI (New England Biolabs) in NEB buffer and reacted at 37°C for 2 hours. The cleaved substrate plasmid was purified using a gel extraction kit (Qiagen).

[0110] The substrate plasmid and insert prepared in this manner were ligated using the Gibson Assembly System. Ligation was performed according to the Gibson Assembly System protocol, with a substrate plasmid-to-insert ratio of 1:1 (25 minutes at 50°C, total reaction volume: 8 μL).

[0111] Next, transformation was performed using 6 μL of the plasmid solution (ligation reaction solution) obtained above and competent cells (prepared by the Takeda Laboratory) in a standard manner.

[0112] Subsequently, plasmid vectors were purified from transformed E. coli using the alkaline prep method. In short, plasmid vectors were recovered using the QIAprep Spin Miniprep Kit (Qiagen), purified by ethanol precipitation, and then prepared in TE buffer to a concentration of 1 μg / μL.

[0113] The structures of each plasmid vector are shown in Figures 4(a) to 4(c). The nucleotide sequences of the precrRNA expression vectors are shown for SEQ ID NO: 33 (expression vector expressing crRNA corresponding to a sequence derived from the human CCR5 gene), SEQ ID NO: 34 (expression vector expressing crRNA corresponding to the CRISPR spacer sequence of E. coli), and SEQ ID NO: 35 (expression vector expressing crRNA corresponding to a sequence derived from the human EMX1 gene).

[0114] [3] Construction of Cas3 expression vector The modified polynucleotide (SEQ ID NO: 1) encoding Cas3 was obtained from Genscript. Specifically, the pUC57 vector incorporating the above polynucleotide was obtained from Genscript.

[0115] The above vector was digested with the restriction enzyme NotI. Next, the ends of the fragments were smoothed using 2U of Klenow Fragment (Takara Bio Inc.) and 1μL of 2.5mM dNTP Mixture (Takara Bio Inc.). Subsequently, the fragments were purified using gel extraction (Qiagen Inc.). The purified fragments were further digested with the restriction enzyme XhoI and purified using gel extraction (Qiagen Inc.).

[0116] The purified fragments were ligated using a substrate plasmid (pTL2-CAG-IRES-NEO vector, prepared by the Takeda Laboratory) and a ligation kit (Mighty Mix, Takara Bio). Transformation and purification were then performed using the same procedure as in [2]. The recovered plasmid vectors were prepared in TE buffer to a concentration of 1 μg / μL.

[0117] [4] Production of plasmid vectors containing BPNLS Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7 expression vectors were constructed by ligating BPNLS to the 5' and 3' ends (see Figure 7).

[0118] The preparation of inserts for each Cas protein group containing BPNLS at both ends was commissioned to Thermo Fisher Scientific. The specific sequence of the above insert is (AGATCTTAATACGACTCACTATAGGGAGAGCCGCCACCATGGCC: SEQ ID NO: 56)-(one of SEQ ID NOs. 7-12)-(TAATATCCTCGAG: SEQ ID NO: 57). SEQ ID NO: 56 is a sequence with a cleavage site by BgIII. SEQ ID NO: 57 is a sequence with a cleavage site by XhoI.

[0119] The pMK vector incorporating the above sequence was cleaved with restriction enzymes BgIII and XhoI and purified using gel extraction (Qiagen). The purified fragments were ligated using a substrate plasmid (pPB-CAG-EBNXN, provided by Sanger Center) and a ligation kit (Mighty Mix, Takara Bio). Transformation and purification were then performed using the same procedure as in [2]. The recovered plasmid vector was prepared to a concentration of 1 μg / μL in TE buffer.

[0120] [5] Construction of plasmid vectors including cascade (2A) Expression vectors were constructed in which Cse1 (Cas8), Cse2 (Cas11), Cas7, Cas5, and Cas6 were linked in this order. More specifically, an expression vector was constructed in the order (NLS-Cse1(Cas8):SEQ ID NO: 2)-2A-(NLS-Cse2(Cas11):SEQ ID NO: 3)-2A-(NLS-Cas7:SEQ ID NO: 6)-2A-(NLS-Cas5:SEQ ID NO: 4)-2A-(NLS-Cas6:SEQ ID NO: 5) (see Figure 8). The amino acid sequence of NLS is PKKKRKV (SEQ ID NO: 52), and its nucleotide sequence is CCCAAGAAGAAGCGGAAGGTG (SEQ ID NO: 53). The amino acid sequence of the 2A peptide is GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 58) (the corresponding nucleotide sequences are SEQ ID NOs: 59-62, respectively).

[0121] A polypeptide having the above-described nucleotide sequence was obtained from GenScript. The pUC57 vector incorporating the above sequence was cleaved with the restriction enzyme EcoRI-HF and purified using gel extraction (Qiagen). The purified fragment was ligated using a base plasmid (pTL2-CAG-IRES-Puro vector, prepared by the Takeda Laboratory) and a ligation kit (Mighty Mix, Takara Bio). Subsequently, transformation and purification were performed using the same procedure as in [2]. The recovered plasmid vector was prepared to a concentration of 1 μg / μL in TE buffer.

[0122] [Example A-1] We expressed modified Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7 with added nuclear localization signals, along with their crRNAs, in HEK (human embryonic kidney) 293T cells and evaluated their cleavage activity against target sequences of exogenous DNA.

[0123] Prior to transfection, HEK293T cells were cultured in 10 cm dishes. HEK293T cells were cultured in EF medium (GIBCO) at 37°C under a 5% CO2 atmosphere. The density of HEK293T cells in EF medium was 3 × 10⁶. 4 Prepared in 100 μL volumes.

[0124] Furthermore, 100 ng of the above reporter vector; 200 ng each of Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid, Cas7 plasmid, and crRNA plasmid; 60 ng of pRL-TK vector (capable of expressing reniral cyferase, Promega); and 300 ng of pBluecscriptII KS(+) vector (Agilent Technologies) were mixed in 25 μL of Opti-MEM (Thermo Fisher Scientific). The condition using a reporter vector with a target sequence derived from CCR5 corresponds to 1 in Figure 1, and the condition using a reporter vector with a CRISPR spacer sequence from E. coli corresponds to 10 in Figure 1.

[0125] 1.5 μL of Lipofectamine 2000 (Thermo Fisher Scientific) and 25 μL of OptiMEM (Thermo Fisher Scientific) were mixed and incubated at room temperature for 5 minutes. Then, the plasmid + OptiMEM mixture and the Lipofectamine 2000 + OptiMEM mixture were mixed and incubated at room temperature for 20 minutes. The resulting mixtures were mixed with 1 mL of the above EF medium containing HEK293T cells and seeded in a 96-well plate (one well for each vector combination, for a total of 12 wells).

[0126] After incubation at 37°C under a 5% CO2 atmosphere for 24 hours, a dual-Luciferase assay was performed according to the protocol of the Dual-Glo Luciferase assay system (Promega). Centro XS was used to measure luciferase and renyraluciferase. 3 We used the LB 960 (BERTHOLD TECHNOLOGIES).

[0127] As a control experiment, a similar experiment was conducted under the following conditions. 1. Instead of one of the following plasmids—Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid, or Cas7 plasmid—an equal amount of pBluecscriptII KS(+) vector (Agilent Technologies) was mixed and expressed (Figure 1, 2-7). 2. Instead of the crRNA plasmid used in the above procedure, plasmids expressing crRNAs not complementary to the target sequence were mixed in. Specifically, for target sequences derived from the CCR5 gene, plasmids expressing crRNAs corresponding to the CRISPR spacer sequence in E. coli were mixed in (Figure 1, 8), and when targeting the CRISPR spacer sequence in E. coli, plasmids expressing crRNAs corresponding to the sequence derived from the CCR5 gene were mixed in and expressed (Figure 1, 11). 3. As negative controls, only reporter vectors containing the target sequence derived from CCR5 (Figure 1, 9) and only reporter vectors containing the CRISPR spacer sequence from E. coli (Figure 1, 12) were expressed.

[0128] (result) The results of the dual-Luciferase assay are shown in the graph at the top of Figure 1, and the experimental conditions are shown in the table at the bottom of Figure 1. In Figure 1(b), "CCR5-target" and "spacer-target" represent the target sequence derived from CCR5 and the CRISPR spacer sequence from E. coli, respectively. Also, "CCR5-crRNA" and "spacer-crRNA" represent the sequence complementary to the CCR5-target and the sequence complementary to the spacer-target, respectively.

[0129] In Figure 1, systems into which all of the Cas3 plasmid, Cse1 (Cas8) plasmid, Cse2 (Cas11) plasmid, Cas5 plasmid, Cas6 plasmid, and Cas7 plasmid were introduced along with a crRNA plasmid complementary to the target sequence showed higher cleavage activity compared to other systems (comparison of 1 with 2-8, and 10 with 11, respectively). Therefore, it was found that it is possible to express Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7 in human cells by using an expression vector according to one embodiment of the present invention.

[0130] Furthermore, it was suggested that introducing the above expression vector into human cells leads to the formation of a complex of Cas3, cascade, and crRNA within the human cells, which then cleaves the target sequence.

[0131] Furthermore, comparing 8 and 9, and 11 and 12 in Figure 1, the cleavage activity in the system expressing crRNA not complementary to the target sequence was at the same level as the negative control. This suggests that the CRISPR-Cas3 system of the present invention can specifically cleave sequences complementary to crRNA in mammalian cells.

[0132] [Example A-2] Using the same method as in Example A-1, we conducted experiments to evaluate whether endogenous DNA in human cells could be cleaved using a type I CRISPR-Cas system.

[0133] Specifically, we expressed Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7, which had their base sequences modified and nuclear localization signals added, along with precrRNA, in human cells, and evaluated whether or not the endogenous CCR5 gene sequence in these cells was cleaved.

[0134] The same HEK239T cells as in Example A-1 were used, 1 × 10⁶ 5 Seeds were seeded at a density of one cell per well in a 24-well plate and incubated for 24 hours.

[0135] 1 μg of Cas3 plasmid, 1.3 μg of Cse1 (Cas8) plasmid, 1.3 μg of Cse2 (Cas11) plasmid, 1.1 μg of Cas5 plasmid, 0.8 μg of Cas6 plasmid, 0.3 μg of Cas7 plasmid, and 1 μg of crRNA plasmid were mixed in 50 μL of Opti-MEM (Thermo Fisher Scientific). Next, a mixture of 5 μL of Lipofectamine® 2000 (Thermo Fisher Scientific), 50 μL of Opti-MEM (Thermo Fisher Scientific), and 1 mL of EF medium was added to the above DNA mixture. Then, 1 mL of the resulting mixture was added to the above 24-well plate.

[0136] After culturing at 37°C under a 5% CO2 atmosphere for 24 hours, the medium was changed with 1 mL of EF medium. 48 hours after transfection (24 hours after medium change), cells were harvested and 1 × 10⁶ cells were incubated in PBS. 4 The concentration was adjusted to 1 / 5μL.

[0137] The cells described above were heated at 95°C for 10 minutes. Next, 10 mg of proteinase K was added and incubated at 55°C for 70 minutes. Finally, the cells were heated at 95°C for another 10 minutes and used as a template for PCR.

[0138] The above template (10 μL) was amplified by 35 cycles of two-step PCR. Primers with sequences 47 and 48 were used for the PCR. KOD FX (Toyobo Co., Ltd.) was used as the DNA polymerase, and the two-step PCR procedure followed the protocol provided with KOD FX. The amplified product was purified using the QIAquick PCR Purification Kit (QIAGEN). The specific procedure followed the protocol provided with the kit.

[0139] Using rTaq DNA polymerase (Toyobo Co., Ltd.), dA was added to the 3' end of the purified DNA. The purified DNA was subjected to electrophoresis in a 2% agarose gel, and a band of approximately 500-700 bp was excised. Then, the DNA was extracted and purified from the excised gel using a Gel extraction kit (QIAGEN). Next, TA cloning was performed using pGEM-T easy vector Systems (Promega), and the above DNA was cloned. Finally, the cloned DNA was extracted by alkaline prep and analyzed by Sanger sequencing. For the analysis, BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific) were used.

[0140] The endogenous CCR5 gene sequence targeted by the CRISPR-Cas system in this embodiment is outlined based on Figure 2. In Figure 2, exons are represented by uppercase letters and introns by lowercase letters.

[0141] In this example, the target was a sequence within the CCR5 gene located in region P21 of the short arm (P) of chromosome 3 (Figure 2; the full sequence of CCR5 is shown in SEQ ID NO: 46). Specifically, the target sequence was a sequence within exon 3 of the CCR5 gene. As a control, the target sequence of Cas9 was also placed in approximately the same position. That is, the entire underlined sequence is the target sequence of the type I CRISPR-Cas system (AAG and the following 32 bases), and the double-underlined sequence is the target sequence of Cas9 (CGG and the 20 bases preceding it). The crRNA sequence was designed to allow guidance to the target sequence of the type I CRISPR-Cas system (AAG and the following 32 bases).

[0142] (result) As a result of the above experiment, clone 1 was obtained with a deletion of 401 bp, clone 2 with a deletion of 341 bp, clone 3 with a deletion of 268 bp, and clone 4 with a deletion of 344 bp compared to the original base sequence (Figures 3A-D). This demonstrates that the CRISPR-Cas3 system of the present invention can delete endogenous DNA in human cells. In other words, it is suggested that the above CRISPR-Cas system can be used to edit the DNA of human cells.

[0143] In this example, clones lacking base pairs were observed. This fact supports the idea that DNA breaks occur at multiple locations according to the CRISPR-Cas3 system of the present invention.

[0144] The CRISPR-Cas3 system of the present invention resulted in the deletion of several hundred base pairs (268-401 bp) of DNA. This deletion was more extensive than the deletions obtained by CRISPR-Cas systems using Cas9 (which typically involve cleavage at only one site on the DNA).

[0145] [Example A-3] Using the same method as in Example A-1, we conducted experiments to evaluate whether the CRISPR-Cas3 system could cleave endogenous DNA in human cells.

[0146] Specifically, we expressed Cas3, Cse1 (Cas8), Cse2 (Cas11), Cas5, Cas6, and Cas7, whose base sequences were modified and to which nuclear localization signals were added, along with precrRNA, in human cells, and evaluated whether or not the endogenous EMX1 gene sequence in the above cells was cleaved.

[0147] The same HEK293T cells as in Example A-1 were used, 1 × 10⁶ 5 Seeds were seeded at a density of one cell per well in a 24-well plate and incubated for 24 hours.

[0148] 500 ng of Cas3 plasmid, 500 ng of Cse1 (Cas8) plasmid, 1 μg of Cse2 (Cas11) plasmid, 1 μg of Cas5 plasmid, 1 μg of Cas6 plasmid, 3 μg of Cas7 plasmid, and 500 μg of crRNA plasmid were mixed in 50 μL of Opti-MEM (Thermo Fisher Scientific). To the above mixture, 4 μL of Lipofectamine® 2000 (Thermo Fisher Scientific) and 50 μL of Opti-MEM (Thermo Fisher Scientific) were added and mixed. The resulting mixture was incubated at room temperature for 20 minutes and then added to the HEK293T cells.

[0149] Here, Figure 7 shows the structure of the Cas protein expression vector used in Example A-3. As shown in Figure 7, the expression vector has the sequence encoding the Cas protein group flanked by BPNLS (bipartite NLS) (see [Suzuki K et al. (2016) In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration, Nature, Vol.540 (Issue 7631), pp.144-149]). The amino acid sequence of BPNLS is KRTADGSEFESPKKKRKVE (SEQ ID NO: 54), and the nucleotide sequence is AAGCGGACTGCTGATGGCAGTGAATTTGAGTCCCCAAAGAAGAAGAGAAAGGTGGAA (SEQ ID NO: 55).

[0150] The HEK293T cells described above were cultured at 37°C under a 5% CO2 atmosphere for 24 hours, after which the medium was replaced with 1 mL of EF medium (1 mL per well). 48 hours after transfection (24 hours after medium change), the cells were harvested and 1 × 10⁶ cells were placed in PBS. 4 The concentration was adjusted to 1 / 5μL.

[0151] The cells described above were heated at 95°C for 10 minutes. Next, 10 mg of proteinase K was added and incubated at 55°C for 70 minutes. Finally, the cells were heated at 95°C for another 10 minutes and used as a template for PCR.

[0152] 10 μL of the above template was amplified by 40 cycles of 3-step PCR. Primers with sequences 50 and 51 were used for the PCR. Hotstartaq (QIAGEN) was used as the DNA polymerase, and the 3-step PCR procedure followed the protocol provided with Hotstartaq. The amplified product was subjected to electrophoresis in a 2% agarose gel, and a band of approximately 900-1100 bp was excised. DNA was then extracted and purified from the excised gel using a Gel extraction kit (QIAGEN). The specific procedure followed the protocol provided with the kit.

[0153] Next, TA cloning was performed using pGEM-T easy vector Systems (Promega), and the above DNA was cloned. Finally, the cloned DNA was extracted by alkaline prep and analyzed by Sanger sequencing. For the analysis, BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific) were used.

[0154] The endogenous EMX1 gene sequence, which is targeted by the CRISPR-Cas3 system in Example A-3, is outlined based on Figure 5. In Figure 5, exons are represented by uppercase letters and introns by lowercase letters.

[0155] In Example A-3, the target was a sequence within the EMX1 gene located in region P13 of the short arm (P) of chromosome 2 (Figure 5; the full sequence of EMX1 is shown in SEQ ID NO: 49). Specifically, the target sequence was a sequence within exon 3 of the EMX1 gene. As a control, the target sequence of Cas9 was also placed in approximately the same position. That is, the underlined sequence further upstream is the target sequence of the type I CRISPR-Cas system (AAG and the following 32 bases), and the underlined sequence further downstream is the target sequence of Cas9 (TGG and the 20 bases preceding it). The crRNA sequence used in Example A-3 was designed to allow guidance to the target sequence of the CRISPR-Cas3 system (AAG and the following 32 bases).

[0156] (result) As a result of the above experiment, clone 1 was obtained with two deletions at 513 bp and 363 bp compared to the original base sequence, and clone 2 had a deletion at 694 bp (Figure 6A, B). This experimental result also demonstrated that the CRISPR-Cas3 system of the present invention can delete endogenous DNA in human cells. In other words, it was suggested that the above CRISPR-Cas3 system can edit the DNA of human cells.

[0157] Furthermore, the occurrence of breaks in two or more locations within the double-stranded DNA, as well as the deletion of several hundred base pairs of DNA, were similar to those in Example A-2. Therefore, the results of Example A-3 provide stronger support for the implications obtained from Example A-2.

[0158] [Example A-4] We expressed a modified CRISPR-Cas3 system, further modified by linking it to a cascade protein-coding sequence, in HEK293T cells and evaluated its cleavage activity of target sequences in exogenous DNA.

[0159] In Example A-4, 100 ng of reporter vector; 200 ng each of Cas3 plasmid, Cascade (2A) plasmid, and crRNA plasmid; 60 ng of pRL-TK vector (capable of expressing reniral cyferase, Promega); and 300 ng of pBluecscriptII KS(+) vector (Agilent Technologies) were mixed in 25 μL of Opti-MEM (Thermo Fisher Scientific). The condition using a reporter vector with a target sequence derived from CCR5 corresponds to 1 in Figure 9(b), and the condition using a reporter vector with a CRISPR spacer sequence from E. coli corresponds to 6 in Figure 9(b).

[0160] Here, the reporter vectors used were the two types of reporter vectors prepared in [1] of the [Production Example] (i.e., vectors with the structure shown in Figure 4(d)). The cascade (2A) plasmid used was the expression vector prepared in [4] of the [Production Example] (i.e., vectors with the structure shown in Figure 8).

[0161] The dual-Luciferase assay was performed using the same method as in Example A-1, except that the expression vector described above was used.

[0162] In addition, a similar experiment was conducted under the following conditions as a control experiment. 1. Instead of either the Cas3 plasmid or the Cascade (2A) plasmid, equal amounts of pBluscriptII KS(+) vector (Agilent Technologies) were mixed and expressed (Figures 9-2 and 9-3). 2. Instead of the crRNA plasmid used in the above procedure, plasmids expressing crRNAs not complementary to the target sequence were mixed in. Specifically, for target sequences derived from the CCR5 gene, plasmids expressing crRNAs corresponding to the CRISPR spacer sequence in E. coli were mixed in (Figure 9, 4), and when targeting the CRISPR spacer sequence in E. coli, plasmids expressing gRNAs corresponding to sequences derived from the CCR5 gene were mixed in and expressed (Figure 9, 7). 3. As negative controls, only reporter vectors containing the target sequence derived from CCR5 (Figure 9, 5) and only reporter vectors containing the CRISPR spacer sequence from E. coli (Figure 9, 8) were expressed.

[0163] (result) The results of the dual-Luciferase assay are shown in the graph at the top of Figure 9, and the experimental conditions are shown in the table at the bottom of Figure 9. In Figure 9, "CCR5-target" and "spacer-target" represent the target sequence derived from CCR5 and the CRISPR spacer sequence from E. coli, respectively. Also, "CCR5-crRNA" and "spacer-crRNA" represent the sequence complementary to the CCR5-target and the sequence complementary to the spacer-target, respectively.

[0164] As shown in Figure 9, systems introducing both the Cas3 plasmid and the cascade (2A) plasmid, along with a crRNA plasmid complementary to the target sequence, exhibited significantly higher cleavage activity compared to other systems (comparing 1 with 2-5 and 6 with 7-8, respectively). This suggests that, even in systems expressing a ligated nucleotide sequence encoding the cascade protein, the CRISPR-Cas system according to one embodiment of the present invention can specifically cleave sequences complementary to crRNA in mammalian cells.

[0165] B. Verification of factors influencing genome editing by the CRISPR-Cas3 system in eukaryotic cells. [Materials and Methods] [1] Composition of Cas gene and crRNA Cas3 and its cascade constituent genes (Cse1, Cse2, Cas5, Cas6, Cas7) derived from E. coli strain K-12 were designed with bpNLS appended to the 5' and 3' ends of each gene, and cloned into mammalian cells by gene synthesis after codon optimization. These genes were subcloned downstream of the CAG promoter in the pPB-CAG.EBNXN plasmid donated by the Sanger Institute. Cas3 mutants such as H74A (dead nickase; dn), K320N (dead helicase; dh), and a double mutant of S483A and T485A (dead helicase ver.2; dh2) were generated by self-ligating the PCR product of PrimeSTAR MAX. For crRNA expression plasmids, crRNA sequences with two BbsI restriction enzyme sites at the spacer position under the U6 promoter were synthesized. All crRNA expression plasmids were constructed by inserting a 32-base pair double-stranded oligonucleotide of the target sequence into the BbsI restriction enzyme site.

[0166] The Cas9-sgRNA expression plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 was obtained from Addgene. To design the gRNA, the CRISPR web tool, CRISPR design tool, and / or CRISPRdirect were used to predict a unique target site in the human genome. The target sequence was cloned into the pX330 sgRNA scaffold according to the Feng Zhang Institute protocol.

[0167] An SSA reporter plasmid containing two BsaI restriction enzyme sites was donated by Professor Takashi Yamamoto of Hiroshima University. The target sequence of the genomic region was inserted into the BsaI site. pRL-TK (Promega) was obtained as the reniral cyferase vector. All plasmids were prepared using the PureLink HiPure Plasmid Purification Kit (Thermo Fisher) by midiprep or maxiprep method.

[0168] [2] Evaluation of DNA cleavage activity in HEK293T cells To detect DNA cleavage activity in mammalian cells, an SSA assay was performed as in Example A. HEK293T cells were cultured at 37°C under 5% CO2 in high-glucose Dulbecco's modified Eagle's medium (Thermo Fisher) supplemented with 10% fetal bovine serum. 0.5 × 10⁻⁶ 4 The cells were seeded in the wells of a 96-well plate, and 24 hours later, HEK293T cells were transfected with Cas3, Cse1, Cse2, Cas7, Cas5, Cas6, crRNA expression plasmids (100 ng each), an SSA reporter vector (100 ng), and a reniral luciferase vector (60 ng) using lipofectamine2000 and OptiMEM (Life Technologies) according to a slightly modified protocol. 24 hours after transfection, a dual luciferase assay was performed using a Dual-Glo luciferase assay system (Promega) according to the protocol.

[0169] [3] Detection of indels in HEK293T cells 2.5x10 4Twenty-four hours after seeding individual cells into 24-well plates, HEK293T cells were transfected with Cas3, Cse1, Cse2, Cas7, Cas5, Cas6, and crRNA expression plasmids (250 ng each) using lipofectamine 2000 and OptiMEM (Life Technologies) according to a slightly modified protocol. Two days after transfection, total DNA was extracted from the recovered cells using the Tissue XS kit (Takara-bio) according to the protocol. Target loci were amplified using Gflex (Takara bio) or Quick Taq HS DyeMix (TOYOBO) and subjected to agarose gel electrophoresis. To detect small insertion / deletion mutations in the PCR products, the SURVEYOR Mutation Detection Kit (Integrated DNA Technologies) was used according to the protocol. For TA cloning, the pCR4Blunt-TOPO plasmid vector (Life Technologies) was used according to the protocol. For sequencing analysis, we used the BigDye Terminator Cycle Sequencing Kit and the ABI PRISM 3130 Genetic Analyzer (Life Technologies).

[0170] To detect various rare mutations, DNA libraries of PCR amplification products were prepared using the TruSeq Nano DNA Library Prep Kit (Illumina), and amplicon sequencing was performed using MiSeq (2 x 150 bp) according to Macrogen's standard procedure. Raw reads from each sample were mapped to the human genome hg38 using BWA-MEM. Coverage data were visualized using Integrative Genomics Viewer (IGV), and histograms of target regions were extracted.

[0171] Reporter HEK293T cells carrying mCherry-P2A-EGFP c321C>G were donated by Professor Shinichiro Nakata for the detection of SNP-KI (snip knock-in) in mammalian cells. Reporter cells were cultured in 1 μg / ml puromycin. 500 ng of donor plasmid or single-stranded DNA was co-transfected with CRISPR-Cas3 using the method described above. All cells were harvested 5 days after transfection and FACS analysis was performed using AriaIIIu (BD). GFP-positive cells were sorted and total DNA was extracted using the method described above. SNP exchange in the genome was detected by PCR amplification using HiDi DNA polymerase (myPOLS Biotec).

[0172] [4] Detection of off-target site candidates Off-target candidates for type IE CRISPR were detected in the human genome hg38 using GGGenome with two different procedures. Following previous reports (Leenay, RT, et al. Mol. Cell 62, 137-147 (2016), Jung, et al. Mol. Cell. 2017, Jung et al., Cell 170, 35-47 (2017)), AAG, ATG, AGG, GAG, TAG, and AAC were selected as candidate PAM sequences. Since positions that are multiples of 6 have been reported not to be recognized as target sites (Kunne et al., Molecular Cell 63, 1-13 (2016)), the first approach selected the 32 base pairs of the target sequence with the fewest mismatches, excluding these positions. In the next approach, regions that perfectly matched the PAM-side 5' end of the target sequence were detected and listed in descending order of matching.

[0173] [5] Deep sequencing of off-target analysis For whole-genome sequencing, genomic DNA was extracted from transfected HEK293T cells and digested using a Covaris sonicator. A DNA library was prepared using the TruSeq DNA PCR-Free LT Library Prep Kit (Illumina), and genome sequencing was performed using HiSeq X (2×150bp) according to Takara Bio's standard procedure. Raw reads from each sample were mapped to the human genome hg38 using BWA-MEM and cleaned using the Trimmomatic program. Discordant read pairs and split reads were removed using samtools and Lumpy-sv, respectively. To detect only large deletions on the same chromosome, read pairs mapped to different chromosomes were removed using the BadMateFilter in the Genome Analysis Toolkit program. The total number of discordant read pairs or split reads in each 100kb region was counted using Bedtools, and the error rate compared to the negative control was calculated. To enrich the off-target candidates before sequencing, SureSelectXT custom DNA probes were designed by SureDesign under moderately stringent conditions and manufactured by Agilent Technologies. The target regions were selected as follows: Probes near the target regions covered 800kb upstream and 200kb downstream of the PAM. Near the off-target region of CRISPR-Cas3, probes covered 9kb upstream and 1kb downstream of the PAM candidate. Near the off-target region of CRISPR-Cas9, probes covered 1kb upstream and 1kb downstream of the PAM. After preparing the DNA library using the SureSelectXT reagent kit and custom probe kit, genome sequencing was performed using a Hiseq 2500 (2×150bp) according to Takara Bio's standard procedure. Discordant read pairs and split reads on the same chromosome were excluded using the method described above.The total number of discrete read pairs or split reads in each 10kb region was counted using Bedtools, and the error rate compared to the negative control was calculated.

[0174] [Example B-1] Effect of crRNA and nuclear localization signal type on DNA cleavage activity In Example A, we coincidentally succeeded in genome editing in eukaryotic cells using a CRISPR-Cas3 system that included pre-crRNA (LRSR; leader sequence-repeat sequence-spacer sequence-repeat sequence) as the crRNA. The inventors hypothesized that the reason why genome editing in eukaryotic cells using the CRISPR-Cas3 system had not been successful for many years might be because mature crRNA had been used as the crRNA. Therefore, in addition to pre-crRNA (LRSR), we prepared pre-crRNA (RSR; repeat sequence-spacer sequence-repeat sequence) and mature crRNA (5' handle sequence-spacer sequence-3' handle sequence) as crRNAs, and verified the genome editing efficiency using the reporter system from Example A (Figures 10A, B). The base sequences of pre-crRNA (LRSR), pre-crRNA (RSR), and mature crRNA are shown in SEQ ID NOs: 63, 64, and 65, respectively.

[0175] As a result, no target DNA cleavage activity was observed in the CRISPR-Cas3 system using mature crRNA. Surprisingly, however, very high target DNA cleavage activity was observed when pre-crRNA (LRSR, RSR) was used. This result in the CRISPR-Cas3 system is in contrast to the CRISPR-Cas9 system, which shows high DNA cleavage activity when using mature crRNA. Furthermore, this fact suggests that one of the main reasons why genome editing in eukaryotic cells has not been successful with the CRISPR-Cas3 system until now is the use of mature crRNA.

[0176] Furthermore, we also investigated the use of SV40 nuclear localization signals and bipartite nuclear localization signals as nuclear localization signals to be attached to Cas3 (Figure 11). As a result, higher target DNA cleavage activity was observed when using the bipartite nuclear localization signal.

[0177] Therefore, in subsequent experiments, pre-crRNA (LRSR) was used as the crRNA, and bipartite nuclear localization signaling was used as the nuclear localization signaling signal.

[0178] [Example B-2] Effect of PAM sequence on DNA cleavage activity To confirm the target specificity of the CRISPR-Cas3 system, the effects of various PAM sequences on DNA cleavage activity were investigated (Figure 12). In the SSA assay, different PAM sequences yielded diverse results in DNA cleavage activity. 5'-AAG PAM showed the highest activity, while AGG, GAG, TAC, ATG, and TAG also showed noteworthy activity.

[0179] [Example B-3] Effect of crRNA-spacer sequence mismatch on DNA cleavage activity Previous studies of the crystal structure of the E. coli cascade have shown that a 5-base compartment heteroduplex is formed between crRNA and spacer DNA, due to the disruption of base pairing at every 6th position by the Cas7 effector's sum element (Figure 13). The effect of crRNA-spacer sequence mismatch on DNA cleavage activity was evaluated (Figure 1g). Except for bases not recognized as targets (position 6), any single mismatch in the seed region (positions 1-8) dramatically reduced cleavage activity.

[0180] [Example B-4] Verification of the necessity of each Cas3 domain in DNA cleavage activity In vitro characterization of the catalytic properties of the Cas3 protein revealed that the N-terminal HD nuclease domain cleaves the single-strand region of the DNA substrate, followed by the C-terminal SF2 helicase domain, which, in an ATP-dependent manner, proceeds from 3' to 5' along the target DNA to unwind it. Three Cas3 mutants were created—a mutant of the HD domain H74A (dnCas3), a mutant of SF2 domain motif 1 K320N (dhCas3), and a double mutant of SF2 domain motif 3 S483A / T485A (dh2Cas3)—to verify whether the Cas3 domain is necessary for DNA cleavage (Figure 14). As a result, DNA cleavage activity was completely abolished in all three Cas3 protein mutants, indicating that Cas3 can cleave target DNA through both the HD nuclease domain and the SF2 helicase domain.

[0181] [Example B-5] Verification of DNA cleavage activity in various types of CRISPR-Cas3 systems Type 1 CRISPR-Cas3 systems are highly diversified (seven types, A-G). In the above example, the DNA cleavage activity of the type IE CRISPR-Cas3 system in eukaryotic cells was verified. In this example, the DNA cleavage activity of other type 1 CRISPR-Cas3 systems (type IF and type IG) was verified. Specifically, Cas3, Cas5-7 from type IF Shewanella putrefasiens and Cas5-8 from type IG Purococcus phryus were codon-optimized and cloned (Figure 15). As a result, although there were differences in the strength of DNA cleavage activity, DNA cleavage activity was observed in these type 1 CRISPR-Cas3 systems in an SSA assay using 293T cells.

[0182] [Example B-6] Verification of mutations introduced into endogenous genes using the CRISPR-Cas3 system Mutations introduced into endogenous genes by the CRISPR-Cas3 system were validated using a type IE system. EMX1 and CCR5 genes were selected as target genes, and pre-crRNA (LRSR) plasmids were prepared. Lipofection of 293T cells with the pre-crRNA and plasmids encoding six Cas(3,5-8,11) effectors revealed that CRISPR-Cas3 caused deletions of several hundred to several thousand base pairs, primarily upstream of the 5'PAM of the spacer sequence in the target region (Figure 16). Microhomology of 5-10 base pairs was observed at the repaired junction, suggesting that this may have occurred via complementary strand annealing through an annealing-dependent repair pathway. No genome editing was observed in the EMX1 and CCR5 regions in the mature crRNA plasmids.

[0183] To better characterize Cas3-mediated genome editing, 96 TA clones were selected from PCR products and sequenced using TA cloning and Sanger sequencing, and compared to the wild-type EMX1 sequence (Figure 17). Of the 49 clones in which sequence insertions could be confirmed, 24 clones showed deletions ranging from a minimum of 596 base pairs to a maximum of 1447 base pairs, with an average of 985 base pairs (46.3% efficiency). Half of the clones (n=12) created large deletions involving PAM and spacer sequences, while the other half had deletions upstream of the PAM.

[0184] Further characterization of Cas3 was achieved through next-generation sequencing of PCR amplification products using primer sets in broader regions, such as 3.8kb of the EMX1 gene and 9.7kb of CCR5. Multiple PAM sites (AAG, ATG, TTT) were also examined for targeting with type IE CRISPR. Amplicon sequencing showed significantly reduced coverage in broad genomic regions upstream of PAM sites: 38.2% for AAG and 56.4% for ATG, compared to 86.4% for TTT and 86.4% for Cas9 targeting EMX1. This reduced coverage was similar when targeting the CCR5 region. In contrast, Cas9 induced small insertions and deletions (indels) at the target site, while Cas3 produced no small indel mutations at the PAM or target site. These results suggest that the CRISPR-Cas3 system induces deletions in broad regions upstream of the target site in human cells.

[0185] Considering the limitations of PCR analysis, such as amplification of less than 10kb and a strong bias favoring shorter PCR fragments, we utilized microarray-based capture sequencing of over 1000kb around the targeted EMX1 and CCR5 loci (Figure 18A, B). We observed deletions of up to 24kb at the EMX1 locus and up to 43kb at the CCR5 locus, but 90% of the mutations in EMX1 and 95% in CCR5 were less than 10kb. These results suggest that the CRISPR-Cas3 system can possess potent nuclease and helicase activity even in eukaryotic cell genomes.

[0186] Furthermore, as demonstrated by the CRISPR-Cas9 system, the possibility of inducing undesirable off-target mutations in non-target genomic regions is a major concern, especially regarding clinical application. However, no significant off-target effects were observed with the CRISPR-Cas3 system. [Industrial applicability]

[0187] The CRISPR-Cas3 system of the present invention can edit the DNA of eukaryotic cells, and therefore can be widely used in fields where genome editing is desired, such as medicine, agriculture, forestry and fisheries, industry, life sciences, biotechnology, and gene therapy.

Claims

1. A method for producing DNA-edited eukaryotic cells (excluding cells in the state present in the human body, human germ cells, and human embryonic cells) or animals (excluding humans), comprising introducing a CRISPR-Cas3 system capable of editing DNA within eukaryotic cells or animals into eukaryotic cells (excluding cells in the state present in the human body, human germ cells, and human embryonic cells) or animals (excluding humans), wherein the CRISPR-Cas3 system comprises the following (A) to (C) (except when the CRISPR-Cas3 system is of type I to D). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (C) PrecrRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide

2. A method for producing a DNA-edited plant, comprising introducing a CRISPR-Cas3 system capable of editing DNA within the plant into the plant, wherein the CRISPR-Cas3 system comprises (A) to (C) below (except when the CRISPR-Cas3 system is of type I to D). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (C) PrecrRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide

3. The method according to claim 1 or 2, comprising the step of introducing the CRISPR-Cas3 system into eukaryotic cells, animals, or plants, followed by the cleavage of crRNA by proteins constituting the cascade protein.

4. The method according to any one of claims 1 to 3, wherein a nuclear localization signal is attached to the Cas3 protein and / or cascade protein.

5. The method according to claim 4, wherein the nuclear localization signal is a bipartite nuclear localization signal.

6. A kit for use in the production of DNA-edited eukaryotic cells or animals, comprising the following (A) to (C) which constitute a CRISPR-Cas3 system capable of editing DNA within eukaryotic cells or animals (except when the CRISPR-Cas3 system is of type I-D). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (C) PrecrRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide

7. A kit for use in the production of DNA-edited plants, comprising the following (A) to (C) which constitute a CRISPR-Cas3 system capable of editing DNA within a plant (except when the CRISPR-Cas3 system is of type I-D). (A) Cas3 protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide (B) Cascade protein, a polynucleotide encoding the protein, or an expression vector containing the polynucleotide, and (C) PrecrRNA, a polynucleotide encoding the crRNA, or an expression vector containing the polynucleotide

8. The kit according to claim 6 or 7, wherein a nuclear localization signal is attached to the Cas3 protein and / or cascade protein.

9. The kit according to claim 8, wherein the nuclear localization signal is a bipartite nuclear localization signal.

Images