Intelligent DNA hydrogel for on-demand release of VEGF-responsive glycyrrhizin coumarin and preparation method and application thereof
By constructing a VEGF-responsive smart DNA hydrogel, the on-demand release of glycyrrhizin and the blocking of angiogenesis were achieved, solving the problems of targeting and uncontrollable release in the treatment of hepatocellular carcinoma, and realizing safe, precise and efficient treatment of hepatocellular carcinoma.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LIAOCHENG UNIV
- Filing Date
- 2026-04-22
- Publication Date
- 2026-06-26
AI Technical Summary
Current treatments for hepatocellular carcinoma suffer from limitations such as lack of targeted therapy, uncontrollable release, significant toxic side effects, and limited efficacy of single treatment modalities. The lack of a delivery system for the natural anti-tumor drug glycyrrhizin further restricts its therapeutic effects.
A VEGF-responsive smart DNA hydrogel was constructed, which enables the on-demand release of glycyrrhizin through the specific binding of VEGF aptamers and blocks angiogenesis. Combined with targeted drug killing and anti-angiogenesis, it forms a dual synergistic anti-tumor effect.
This approach enables safe, precise, and efficient treatment of hepatocellular carcinoma, improves drug utilization efficiency, reduces systemic toxicity and side effects, and enhances the precision and effectiveness of treatment.
Smart Images

Figure CN122272484A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of DNA hydrogel technology, specifically relating to a VEGF-responsive smart DNA hydrogel that releases glycyrrhizin on demand, its preparation method, and its application. Background Technology
[0002] Hepatocellular carcinoma (HCC), a highly prevalent malignant digestive system tumor worldwide, is characterized by its insidious onset, rapid progression, high recurrence and metastasis rates, and extremely poor prognosis, making it one of the leading causes of cancer-related deaths globally. Currently, mainstream clinical treatments for HCC include surgical resection, liver transplantation, local ablation, traditional chemotherapy, and targeted therapy. However, all of these have significant limitations in clinical application: early-stage HCC patients have a persistently high recurrence rate after surgical resection, while patients with mid-to-late-stage HCC lose the opportunity for radical surgical treatment; traditional chemotherapy drugs suffer from poor targeting, significant systemic toxicity, and low drug accumulation at the tumor site, easily causing adverse reactions such as bone marrow suppression and liver and kidney damage, and are difficult to effectively inhibit tumor invasion and metastasis; while existing anti-angiogenic targeted drugs can block tumor nutrient supply to some extent, long-term use easily leads to drug resistance, and they lack precise release regulation at the lesion site, resulting in non-specific systemic drug distribution that can cause complications such as bleeding and hypertension, making it difficult to achieve safe, efficient, and individualized tumor treatment. Therefore, developing novel drug delivery systems with targeted enrichment, precise controlled release, low toxicity, and high efficiency has become a key research direction for breaking through existing bottlenecks in the clinical treatment of hepatocellular carcinoma.
[0003] Tumor microenvironment-responsive intelligent delivery carriers, with their advantage of on-demand drug release based on specific signals at the lesion site, have become a research hotspot in targeted cancer therapy. Vascular endothelial growth factor (VEGF) is a core pro-angiogenic factor in the tumor microenvironment, exhibiting abnormally high expression in hepatocellular carcinoma (HCC) tissues, with concentrations far exceeding those in normal liver tissues. It directly mediates the abnormal proliferation and maturation of tumor angiogenesis, providing ample nutrition and metabolic pathways for tumor cell growth, invasion, and distant metastasis. It is a key regulatory factor in the development and progression of HCC and has become an important biomarker for targeted liver cancer therapy. Based on the specific recognition of VEGF aptamers, responsive delivery carriers can be constructed to precisely target the highly expressed VEGF in the tumor microenvironment. This allows for controlled drug release at the lesion site and, through the specific binding of the aptamer to VEGF, neutralizes and blocks its pro-angiogenic effects. This synergistic anti-tumor approach, combining drug killing and angiogenesis inhibition, significantly improves the precision and effectiveness of treatment.
[0004] Among various biomedical delivery carriers, DNA hydrogels have emerged as promising intelligent delivery carriers due to their unique biocompatibility, sequence programmability, structural designability, and excellent biodegradability. Compared to traditional polymer hydrogels, DNA hydrogels form a stable three-dimensional network structure through specific base complementary pairing, enabling efficient encapsulation of both hydrophobic and hydrophilic drugs. The carrier itself is non-immunogenic and has no toxic side effects, allowing it to adapt to the in vivo biological microenvironment and avoid triggering severe inflammatory responses and tissue damage. Furthermore, by precisely designing DNA sequences, target-specific responsive units can be introduced to achieve sensitive responses to tumor microenvironment signals, solving the core challenges of explosive drug release, uncontrollable release, and insufficient targeting in traditional carriers. Currently, conventional DNA hydrogels still suffer from limitations in liver cancer treatment, including limited functionality, lack of precise response to the specific microenvironment of liver cancer, and insufficient drug delivery efficiency. There is an urgent need to construct novel DNA hydrogel systems that combine VEGF responsiveness, efficient drug loading, and synergistic anti-tumor functions.
[0005] Glycyrrhizin, a natural active ingredient extracted from licorice, a traditional Chinese medicinal herb, possesses definite anti-tumor activity. It exerts its anti-hepatocellular carcinoma effects through multiple pathways, including inhibiting tumor cell proliferation, inducing tumor cell apoptosis, and blocking tumor angiogenesis. Compared to chemically synthesized anti-tumor drugs, it has advantages such as natural origin, low toxicity and side effects, and high biocompatibility, demonstrating good potential for clinical translation. However, glycyrrhizin itself suffers from poor water solubility, poor in vivo stability, weak tumor targeting after systemic administration, and rapid metabolism and clearance. Direct administration makes it difficult to achieve effective therapeutic concentrations at the tumor site, limiting therapeutic efficacy. Therefore, there is an urgent need to utilize suitable delivery carriers to achieve stable in vivo delivery and precise release to lesions.
[0006] In summary, existing treatments and drug delivery systems for hepatocellular carcinoma have many shortcomings, such as lack of targeting, uncontrollable release, significant toxic side effects, and limited effectiveness of single treatment modalities. The clinical application of the natural anti-tumor drug glycyrrhizin is also limited by the lack of a delivery system. Summary of the Invention
[0007] To address the problems existing in the prior art, this invention provides a VEGF-responsive, on-demand release smart DNA hydrogel, its preparation method, and its applications. This invention constructs a VEGF-responsive smart DNA hydrogel that efficiently encapsulates glycyrrhizin within a three-dimensional gel network. It utilizes the high expression of VEGF in the tumor microenvironment to trigger on-demand drug release, while simultaneously blocking tumor angiogenesis through specific binding of VEGF aptamers. This achieves a dual synergistic anti-tumor effect of targeted drug killing and anti-angiogenesis, exhibiting excellent biocompatibility and therapeutic controllability. It provides a novel strategy and technical support for the safe, precise, and efficient treatment of hepatocellular carcinoma.
[0008] A VEGF-responsive smart DNA hydrogel that releases glycyrrhizin on demand includes glycyrrhizin and a VEGF-responsive DNA hydrogel, wherein the DNA hydrogel comprises a polyacrylamide polymer using DNA as a crosslinking unit.
[0009] The polyacrylamide polymer with DNA as the crosslinking unit is composed of Acrydite-DNA (1) chain, Acrydite-DNA (2) chain, and VEGF aptamer.
[0010] The Acrydite-DNA (1) strand sequence is shown in SEQ ID NO: 1, which is 5'-acrydite-AAACCCCACATCTCT-3'; The Acrydite-DNA (2) strand sequence is shown in SEQ ID NO: 2, which is 5'-acrydite-AAATCACAGATGAGT-3'; The VEGF aptamer sequence is shown in SEQ ID NO: 3, which is ACTCATCTGTGAAGAGATGTGGGGGTGGACGGGCCGGGTAGA The preparation method of the above-mentioned VEGF-responsive smart DNA hydrogel that releases glycyrrhizin on demand is as follows: (1) Acrydite-DNA (1) strand, Acrydite-DNA (2) strand and acrylamide were dissolved together in Tris-HCl buffer solution (pH 8.0), and after deoxygenation by bubbling with nitrogen, solution A was obtained; (2) Initiators were added to solution A in sequence, nitrogen was bubbled to remove oxygen, and then the mixture was polymerized at 4°C for 12 h to obtain DNA hydrogel intermediate; (3) The DNA hydrogel intermediate was purified by using a 10 kD ultrafiltration tube to remove unreacted small molecule impurities in the system; then the DNA hydrogel intermediate was redissolved with glycyrrhizin (75 μM) and VEGF aptamer (1 mM) solution to finally prepare a smart DNA hydrogel that releases glycyrrhizin on demand in response to VEGF.
[0011] Preferably, the volume fraction of acrylamide in the buffer solution in step (1) is 2%.
[0012] Preferably, the concentration of the Tris-HCl buffer solution in step (1) is (10 mM, pH 8.0).
[0013] Preferably, the nitrogen bubbling deoxygenation time in steps (1) and (2) is 5 min.
[0014] Preferably, in step (1), the mass concentration of both Acrydite-DNA (1) strand and Acrydite-DNA (2) strand is 1 mM.
[0015] Preferably, the initiator in step (2) is 0.5% APS and 0.25% TEMED.
[0016] This invention also provides the application of the above-mentioned VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel in the preparation of drugs for treating hepatocellular carcinoma.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: Leveraging the specific recognition and programmable properties of DNA molecules, and using VEGF (vascular endothelial growth factor) as a specific stimulating signal, this system enables concentration-dependent VEGF release. In the high-VEGF lesion environment of hepatocellular carcinoma, it triggers the depolymerization of the hydrogel structure, achieving precise and on-demand release of glycyrrhizin, significantly improving drug utilization efficiency and reducing systemic toxicity. Simultaneously, the VEGF aptamer introduced into the system can specifically bind to and neutralize free VEGF, blocking angiogenesis, cutting off tumor nutrient supply, and further inhibiting tumor proliferation and progression, achieving a synergistic effect of intelligent drug delivery and anti-angiogenesis. Attached Figure Description
[0018] Figure 1 This is a photograph of the DNA hydrogel obtained in Example 1; Figure 2 This is a gel electrophoresis image of the DNA obtained in Example 1; Figure 3 The response of the DNA hydrogel obtained in Example 1 to VEGF; Figure 4 A scanning electron microscope image of the DNA hydrogel obtained in Example 1; Figure 5 Photographs showing the injectability properties of the DNA hydrogel obtained in Example 1; Figure 6 This is a blood compatibility photograph of the DNA hydrogel obtained in Example 1. Detailed Implementation
[0019] The present invention will be further illustrated below with reference to specific embodiments. These examples are merely illustrative and not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0020] Example 1 A method for preparing a VEGF-responsive, on-demand release of glycyrrhizin coumarin smart DNA hydrogel for hepatocellular carcinoma treatment is described below. The specific process is as follows: 1 mM DNA (1), 1 mM DNA (2), and 2% acrylamide are dissolved together in 10 mM Tris-HCl buffer solution (pH 8.0). After nitrogen bubbling for 5 min to remove oxygen, 0.5% APS and 0.25% TEMED initiators are added sequentially, and nitrogen bubbling for further deoxygenation is continued for 5 min. The mixture is then polymerized at 4℃ for 12 h to obtain a DNA hydrogel intermediate. The gel is purified using a 10 kD ultrafiltration tube to remove unreacted small molecule impurities. The glycyrrhizin coumarin and VEGF aptamer solutions are then redissolved in the DNA intermediate to finally prepare a VEGF-responsive, on-demand release of glycyrrhizin smart DNA hydrogel. Figure 1 As shown. The Acrydite-DNA (1) strand sequence is shown in SEQ ID NO: 1, which is 5'-acrydite-AAACCCCACATCTCT-3'; the Acrydite-DNA (2) strand sequence is shown in SEQ ID NO: 2, which is 5'-acrydite-AAATCACAGATGAGT-3'; the VEGF aptamer sequence is shown in SEQ ID NO: 3, which is ACTCATCTGTGAAGAGATGTGGGGGTGGACGGGCCGGGTAGA.
[0021] Experimental Example 1 The DNA used in Example 1 was characterized by gel electrophoresis: The first Acrydite-DNA strand, the second Acrydite-DNA strand, and the VEGF aptamer sequence were mixed and annealed at 95°C. Polyacrylamide gel electrophoresis was then performed. 12 mL of acrylamide / methylenebisacrylamide 30% solution (19:1) was mixed with TAE solution, and APS solution and TEMED were added. The mixture was then rapidly injected into a pre-assembled glass plate, a comb was inserted, and the plate was allowed to stand for 1 hour. The prepared double-stranded complex was mixed with loading buffer, and 12 μL of sample solution was loaded into each well. After gel electrophoresis at 125 V, the polyacrylamide gel was stained in Gel Green solution for 25 min, and then photographed using a gel imaging system. The results are shown below. Figure 2 As shown, the results indicate that the first Acrydite-DNA strand, the second Acrydite-DNA strand, and the VEGF aptamer sequence successfully complemented each other to form a double-stranded complex.
[0022] Experimental Example 2 VEGF responsiveness testing was performed on the smart responsive DNA hydrogel of Example 1: VEGF was added to the smart responsive DNA hydrogel, and the mixture was incubated at 37°C for 15 min. The responsiveness to VEGF was then observed, and the results are as follows: Figure 3 As shown, the results revealed that the DNA hydrogel changed from a gel state to a solution state, indicating that the DNA hydrogel has good responsiveness to VEGF.
[0023] Experimental Example 3 Scanning tests were performed on the smart responsive DNA hydrogel of Example 1: 10 μL of DNA hydrogel was frozen in liquid nitrogen for 30 min and then lyophilized. The lyophilized sample was sputter-coated with gold and its microstructure was observed using a scanning electron microscope. Figure 4 As shown, the prepared DNA hydrogel has a uniform and interconnected three-dimensional network structure, indicating that this structure can play a key role in the loading and controlled release of anticancer drugs.
[0024] Test Example 4 The injectable behavior of the smart responsive DNA hydrogel of Example 1 was tested: The DNA hydrogel loaded with glycyrrhizin was placed in an insulin syringe and ejected, as follows: Figure 5 As shown, the results indicate that the DNA hydrogel exhibits excellent injectability. Furthermore, the DNA hydrogel retains its hydrogel state after ejection.
[0025] Experimental Example 5 Hemolytic performance test was conducted on the smart responsive DNA hydrogel material of Example 1: To evaluate the blood compatibility of the prepared DNA hydrogel, its hemolytic properties were systematically tested according to national standards and standard in vitro hemolysis procedures. Fresh anticoagulated sheep blood was selected and diluted with physiological saline according to standard ratios to prepare red blood cell suspensions.
[0026] A distilled water positive control group, a physiological saline negative control group, a control DNA GEL group (without glycyrrhizin-coumarin GCM, the rest of the preparation method is the same as in Example 1), a GCM group, and a DNA GEL+GCM group (a VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel obtained in Example 1). Equal volumes of hydrogel sample suspension were co-incubated with diluted red blood cell suspension at a constant temperature of 37 ℃ for a predetermined time, avoiding violent shaking during incubation. After incubation, the samples were centrifuged at low speed, and the supernatant from each group was carefully aspirated. The absorbance at 540 nm was measured using a UV-Vis spectrophotometer. The hemolysis rate was calculated according to the formula to determine the hemolysis risk of the hydrogel. The results are as follows: Figure 6 As shown, the results indicate that neither the DNA hydrogel nor glycyrrhizin poses a risk of hemolysis and demonstrates good biocompatibility.
[0027] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments that can be applied to other fields. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel, characterized in that, The smart DNA hydrogel includes glycyrrhizin and VEGF-responsive DNA hydrogel; the DNA hydrogel includes a polyacrylamide polymer using DNA as a crosslinking unit; The polyacrylamide polymer with DNA as the crosslinking unit is composed of Acrydite-DNA (1) chain, Acrydite-DNA (2) chain, and VEGF aptamer; the Acrydite-DNA (1) chain sequence is shown in SEQ ID NO: 1; the Acrydite-DNA (2) chain sequence is shown in SEQ ID NO: 2; and the VEGF aptamer sequence is shown in SEQ ID NO:
3.
2. The method for preparing the VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel as described in claim 1, characterized in that, The preparation method steps are as follows: (1) Acrydite-DNA (1) strand, Acrydite-DNA (2) strand and acrylamide were dissolved together in Tris-HCl buffer solution, and after deoxygenation by bubbling with nitrogen, solution A was obtained; (2) Initiator was added to solution A in sequence, nitrogen was bubbled to remove oxygen, and then polymerized at 4°C for 12 h to obtain DNA hydrogel intermediate; (3) The DNA hydrogel intermediate was purified by using a 10 kD ultrafiltration tube to remove unreacted small molecule impurities in the system; then the DNA hydrogel intermediate was redissolved with glycyrrhizin and VEGF aptamer solution to finally prepare a smart DNA hydrogel that releases glycyrrhizin on demand in response to VEGF.
3. The preparation method according to claim 2, characterized in that, In step (1), the volume fraction of acrylamide in the buffer solution is 2%.
4. The preparation method according to claim 2, characterized in that, In step (1), the concentration of the Tris-HCl buffer solution is 10 mM and the pH is 8.
0.
5. The preparation method according to claim 2, characterized in that, The nitrogen bubbling deoxygenation time in steps (1) and (2) is 5 min.
6. The preparation method according to claim 2, characterized in that, In step (1), the concentrations of Acrydite-DNA (1) and Acrydite-DNA (2) chains are both 1 mM.
7. The preparation method according to claim 2, characterized in that, In step (2), the initiator is 0.5% APS and 0.25% TEMED.
8. The preparation method according to claim 2, characterized in that, In step (3), the concentration of glycyrrhizin is 75 μM and the concentration of VEGF aptamer is 1 mM.
9. The application of the VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel as described in claim 1 in the preparation of drugs for treating hepatocellular carcinoma.
10. The application of the VEGF-responsive, on-demand glycyrrhizin-releasing smart DNA hydrogel obtained by the preparation method according to any one of claims 2-8 in the preparation of drugs for treating hepatocellular carcinoma.