Methods and compositions relating to adenosine receptors

Antibodies with specific sequences effectively activate T cells by binding to adenosine 2A receptors, addressing the challenge of low expression and instability of G protein-coupled receptors, enabling effective therapeutic interventions.

JP7886340B2Active Publication Date: 2026-07-07TWIST BIOSCIENCE CORP

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
TWIST BIOSCIENCE CORP
Filing Date
2022-01-20
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

G protein-coupled receptors, such as adenosine receptors, are expressed at low levels in cells and are highly unstable during purification, making it difficult to obtain appropriate antigens and thus challenging to produce antibodies against them, which hinders the development of effective therapeutic interventions.

Method used

Development of antibodies or antibody fragments with specific sequences, including monoclonal, polyclonal, bispecific, and humanized antibodies, that bind to the adenosine 2A receptor with high affinity and specificity, activating T cells effectively.

Benefits of technology

The antibodies or antibody fragments achieve efficient activation of T cells with low dissociation constants and IC50 values, providing a robust mechanism for therapeutic interventions targeting adenosine receptors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007886340000037
    Figure 0007886340000037
  • Figure 0007886340000038
    Figure 0007886340000038
  • Figure 0007886340000039
    Figure 0007886340000039
Patent Text Reader

Abstract

Provided herein are methods and compositions relating to an adenosine A2A receptor library having nucleic acids encoding scaffolds comprising adenosine A2A binding domains. The adenosine A2A receptor library described herein encodes immunoglobulins such as antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims the interests of U.S. Patent Application No. 63 / 140,201 filed on 21 January 2021, U.S. Patent Application No. 63 / 209,892 filed on 11 June 2021, and U.S. Patent Application No. 63 / 244,976 filed on 16 September 2021, the contents of which are incorporated herein by reference. [Background technology]

[0002] G protein-coupled receptors (GPCRs), such as adenosine receptors, are involved in a wide variety of diseases. GPCRs are often expressed at low levels in cells and are highly unstable during purification, making it difficult to obtain appropriate antigens and thus challenging to produce antibodies against them. Therefore, improved drugs targeting adenosine receptors are needed for therapeutic interventions.

[0003] Reference All publications, patents, and patent applications referenced herein are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated herein. [Overview of the project]

[0004] Compositions and methods for activating T cells are provided herein.

[0005] A method for activating T cells is provided herein, comprising the step of administering an antibody or antibody fragment containing a sequence that is at least about 90% identical to the sequences described in SEQ ID NOs. Further provided herein is a method for activating T cells, wherein the antibody or antibody fragment contains an amino acid sequence that is at least about 95% identical to the amino acid sequence described in any one of SEQ ID NOs. Further provided herein is a method for activating T cells, wherein the antibody or antibody fragment contains an amino acid sequence described in any one of SEQ ID NOs. 35 to 44. The antibodies include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, grafted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv), single-chain antibodies, Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, single-domain antibodies, isolated complementarity-determining regions (CDRs), diabodies, T cells consisting only of a single monomer variable domain, disulfide-linked Fv(sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or ab antigen-binding fragments thereof. Methods for activating T cells are further provided herein. The antibodies or antibody fragments are K D Methods for activating T cells by binding to the adenosine 2A receptor are further provided herein. The antibody or antibody fragment has a K content of less than approximately 50 nM. D Methods for activating T cells by binding to the adenosine 2A receptor are further provided herein. The antibody or antibody fragment has a K content of less than approximately 25 nM. D A method for activating T cells by binding to the adenosine 2A receptor is further provided herein. The antibody or antibody fragment has a molecular weight of less than approximately 10 nM. D Methods for activating T cells by binding to the adenosine 2A receptor are further provided herein. The antibody or antibody fragment has an IC50 of less than approximately 20 nM in the T cell activation assay. 50 Methods for activating T cells, including the antibody or antibody fragment, are further provided herein. 50Methods for activating T cells, including the antibody or antibody fragment, are further provided herein. 50 Methods for activating T cells, including the antibody or antibody fragment, are further provided herein. 50 Methods for activating T cells, including the above, are further provided herein.

[0006] Antibodies or antibody fragments are provided herein that contain a sequence that is at least about 90% identical to the sequences described in SEQ ID NOs. 6 to 717. Further antibodies or antibody fragments are provided herein that contain an amino acid sequence that is at least about 95% identical to the amino acid sequence described in any one of SEQ ID NOs. 35 to 44. Further antibodies or antibody fragments are provided herein that contain an amino acid sequence described in any one of SEQ ID NOs. 35 to 44. Antibodies or antibody fragments are further provided herein, including monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, grafted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv), single-chain antibodies, Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, single-domain antibodies, isolated complementarity-determining regions (CDRs), diabodies, T cells consisting only of a single monomer variable domain, disulfide-linked Fv(sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or ab antigen-binding fragments thereof. Antibodies or antibody fragments are further provided herein, which bind to the adenosine 2A receptor with a KD of less than approximately 75 nM. Antibodies or antibody fragments are further provided herein, which bind to the adenosine 2A receptor with a KD of less than approximately 50 nM. Further antibodies or antibody fragments are provided herein, which bind to the adenosine 2A receptor with a KD of less than 25 nM. Further antibodies or antibody fragments are provided herein, which bind to the adenosine 2A receptor with a KD of less than 10 nM. Further antibodies or antibody fragments are provided herein, which contain an IC50 of less than 20 nM in a T cell activation assay. Further antibodies or antibody fragments are provided herein, which contain an IC50 of less than 10 nM in a T cell activation assay.Further antibodies or antibody fragments are provided herein, each containing an IC50 of less than approximately 7.5 nM in a T-cell activation assay. Further antibodies or antibody fragments are provided herein, each containing an IC50 of less than approximately 5 nM in a T-cell activation assay. [Brief explanation of the drawing]

[0007] [Figure 1A] This represents the first schematic diagram of an immunoglobulin scaffold. [Figure 1B] This shows a second schematic diagram of an immunoglobulin scaffold. [Figure 2] This represents a schematic diagram of the motif to be placed on the scaffold. [Figure 3] A diagram illustrating a typical process workflow for gene synthesis as disclosed herein is presented. [Figure 4] Let's illustrate this with an example of a computer system. [Figure 5] This is a block diagram illustrating the structure of a computer system. [Figure 6] This diagram illustrates a network configured to incorporate multiple computer systems, multiple mobile phones and personal digital assistants, and network-attached storage (NAS). [Figure 7] This is a block diagram of a multiprocessor computer system using a shared virtual address memory space. [Figure 8A] This diagram shows a schematic representation of an immunoglobulin scaffold containing a VH domain attached to a VL domain using a linker. [Figure 8B] The linker, leader sequence, and pIII sequence are used to illustrate the complete domain structure of the immunoglobulin scaffold, including the VH domain attached to the VL domain. [Figure 8C]This diagram shows the four framework elements (FW1, FW2, FW3, FW4) and the variable 3CDR elements (L1, L2, L3) for VL domains or VH domains. [Figure 9A] This shows the structure of glucagon-like peptide 1 (GLP-1, enclosed in a square), i.e., PDB entry 5VAI, which forms a complex with the GLP-1 receptor (GLP-1R). [Figure 9B] This shows the crystal structure of the CXCR4 chemokine receptor, i.e., PDB entry 3OR0, which forms a complex with the cyclic peptide antagonist CVX15 (enclosed in a square). [Figure 9C] This image shows the crystal structure of human smoothed, PDB entry 5L7D, which has a transmembrane domain and an extracellular domain (ECD) (enclosed in a square). The ECD is in contact with the TMD via extracellular loop 3 (ECL3). [Figure 9D] This shows the structure of GLP-1R, i.e., PDB entry 6LN2, which forms a complex with Fab (enclosed in a square). [Figure 9E] This image shows the crystal structure of CXCR4, also known as PDB entry 4RWS, which forms a complex with the viral chemokine antagonist viral macrophage inflammatory protein 2 (vMIP-II, enclosed in a square). [Figure 10] This diagram illustrates a library design focused on GPCRs. It includes two germline heavy chains, VH1-69 and VH3-30, four germline light chains, IGKV1-39 and IGKV3-15, and IGLV1-51 and IGLV2-14. [Figure 11] This graph shows the length distribution of HCDR3 from a GPCR-focused library compared to the length distribution of HCDR3 in a B cell population from three healthy adult donors. In total, 2,444,718 unique VH sequences from the GPCR library and 2,481,511 unique VH sequences from the human B cell repertoire were analyzed to generate the length distribution plots. The Y-axis is labeled with frequencies from 0.000 to 0.1400 at 0.0200 unit intervals, and the X-axis is labeled with lengths from 0 to 57 at 3-amino acid intervals. [Figure 12] This shows the clone, ELISA values, library, ProA values, and KD values ​​for VHH-Fc. [Figure 13] This diagram shows a schematic representation of the design of the phage-displayed advanced immunology library generated in this specification. [Figure 14A] This graph shows the dose curve for A2AR-90-007. [Figure 14B] This graph shows the FACS analysis results for A2AR-90-007. [Figure 15A] This shows a schematic diagram of the heavy-chain IGHV3-23 design. [Figure 15B] This shows a schematic diagram of the heavy-chain IGHV1-69 design. [Figure 15C] This shows schematic diagrams of the light chain designs IGKV2-28 and IGLV1-51. [Figure 15D] This diagram illustrates the theoretical and final diversity of GPCR libraries. [Figure 16A] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A90. [Figure 16B] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A91. [Figure 16C] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A92. [Figure 16D] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A93. [Figure 16E] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A94. [Figure 16F] This represents flow cytometry data using variant A2A receptor immunoglobulin A2A1. [Figure 16G] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A95. [Figure 16H]This represents flow cytometry data using variant A2A receptor immunoglobulin A2A2. [Figure 16I] This represents flow cytometry data using variant A2A receptor immunoglobulin A2A3. [Figure 16J] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A4. [Figure 16K] This represents flow cytometry data using variant A2A receptor immunoglobulin A2A5. [Figure 16L] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A6. [Figure 16M] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A96. [Figure 16N] This shows flow cytometry data using variant A2A receptor immunoglobulin A2A7. [Figure 16O] This represents flow cytometry data using a control. [Figure 17A] This graph shows the binding curve using variant A2A receptor immunoglobulin A2A-94. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17B] This graph shows the binding curve using variant A2A receptor immunoglobulin A2A1. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17C] This graph shows the binding curves using variant A2A receptor immunoglobulin A2A3. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17D] This graph shows the binding curve using variant A2A receptor immunoglobulin A2A4. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17E]This graph shows the binding curve using variant A2A receptor immunoglobulin A2A5. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17F] This graph shows the binding curve using variant A2A receptor immunoglobulin A2A6. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17G] This graph shows the binding curve using variant A2A receptor immunoglobulin A2A7. The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17H] The graph shows the binding curve using the control (Figure 17H). The binding curve is plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 18A] This graph shows the binding curves using variant A2A97 from a mouse immunotherapy library. [Figure 18B] This graph shows the binding curves using variant A2A98 from a mouse immunotherapy library. [Figure 18C] This graph shows the binding curves using variant A2A99 from a mouse immunotherapy library. [Figure 18D] This graph shows the binding curves using variant A2A100 from a mouse immunotherapy library. [Figure 18E] This graph shows the binding curves using variant A2A101 from a mouse immunotherapy library. [Figure 18F] This graph shows the binding curves using variant A2A102 from a mouse immunotherapy library. [Figure 18G] This graph shows the binding curves using variant A2A103 from a mouse immunotherapy library. [Figure 18H] This graph shows the binding curves using variant A2A104 from a mouse immunotherapy library. [Figure 18I] This graph shows the binding curves using variant A2A9 from a mouse immunotherapy library. [Figure 18J]This graph shows the binding curves using variant A2A10 from a mouse immunotherapy library. [Figure 18K] This graph shows the binding curves using variant A2A11 from a mouse immunotherapy library. [Figure 18L] This graph shows the binding curves using variant A2A12 from a mouse immunotherapy library. [Figure 18M] This graph shows the binding curves using variant A2A13 from a mouse immunotherapy library. [Figure 18N] This graph shows the binding curves using variant A2A14 from a mouse immunotherapy library. [Figure 18O] This graph shows the combined curves using a contrasting element. [Figure 19A] This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A-9. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19B] This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A10. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19C] This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A11. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19D] This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A12. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19E] This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A13. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19F]This graph shows cell binding between adenosine A2aR monoclonal (MAB9497) and the selected variant A2A15. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19G] This graph shows cell binding to adenosine A2aR monoclonal (MAB9497) and a control. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 20A] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of the synthetic library to the A2a protein. [Figure 20B] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of the synthetic library to the A2a protein + ZM241385. [Figure 20C] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of the humanized synthetic library to the A2a protein. [Figure 20D] This graph shows cell binding in a titration assay starting from 100 nM. The graph shows the cell binding of the humanized synthetic library to the A2a protein + ZM241385. [Figure 20E] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of the immunotherapy library to the A2a protein. [Figure 20F] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of the immunotherapy library to the A2a protein + ZM241385. [Figure 20G] This graph shows cell binding in a titration assay starting from 100 nM. The graph represents the cell binding of a mouse immune library to the A2a protein. [Figure 21] This represents data from an agonist dose-response assay measured using the cAMP assay. [Figure 22] This represents data from an antagonist dose-response assay measured using a cAMP assay. [Figure 23]This shows the results of a cAMP antagonist titration assay. [Figure 24] This shows data for variants A2A-1 and A2A-9 from the cAMP assay. [Figure 25] This represents data for variant A2A9 using the cAMP assay. [Figure 26] This shows data for variant A2A9 using a cAMP antagonist titration assay. [Figure 27A] This shows the variant A2A receptor immunoglobulin data in the antagonist cAMP assay. [Figure 27B] This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 27C] This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 28A] This represents variant A2A receptor immunoglobulin data in an allosteric cAMP assay. [Figure 28B] This represents further variant A2A receptor immunoglobulin data in allosteric cAMP assays. [Figure 28C] This represents further variant A2A receptor immunoglobulin data in allosteric cAMP assays. [Figure 29A] This shows the variant A2A receptor immunoglobulin data in the antagonist cAMP assay. [Figure 29B] This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 29C] This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 30A] This shows the variant A2A receptor immunoglobulin data in the antagonist cAMP assay. [Figure 30B]This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 30C] This represents data on further variant A2A receptor immunoglobulins in antagonist cAMP assays. [Figure 31A] This represents affinity data for variant A2A-77. [Figure 31B] This shows further affinity data for variant A2A-77. [Figure 31C] This represents the specificity data for variant A2A-77. [Figure 31D] This represents A2A-77, which binds to cynomolgus monkey PBMC. [Figure 32A] This represents T cell activation for variants A2A-81, A2A-51, A2A-53, A2A-77, A2A-31, A2A-24, A2A-78, A2A-74, A2A-75, A2A-52, and A2A-36. [Figure 32B] This represents T cell activation of variants A2A-81, A2A-51, A2A-53, A2A-77, A2A-31, and A2A-78. [Figure 32C] This represents T cell activation data for variant A2A-77. [Figure 32D] This shows T cell activation data for variants A2A-81, A2A-51, A2A-77, and A2A-28. [Figure 32E] This shows T cell activation data for variants A2A-81, A2A-51, A2A-77, and A2A-28. [Figure 32F] This shows T cell activation data for variants A2A-81, A2A-51, A2A-77, and A2A-28. [Figure 32G] This shows T cell activation data for variants A2A-81, A2A-51, A2A-77, and A2A-28. [Figure 32H] This shows T cell activation data for variants A2A-81, A2A-51, A2A-77, and A2A-28. [Figure 33A]This shows the results of cell binding assays for variants A2A-77 and A2A-81. [Figure 33B] This shows the results of the A2A antagonist cAMP assay for variants A2A-77 and A2A-81. [Figure 33C] This shows the specificity data for variants A2A-77 and A2A-81 in addition to the control A2a. [Figure 33D] This shows T cell activation data for variants A2A-77 and A2A-81. [Figure 34A] The mean tumor volume over time (Figures 34A and 34C) and relative tumor volume over time (Figures 34B and 34D) of mice treated with variants A2A-77 and A2A-81 are shown. [Figure 34B] The mean tumor volume over time (Figures 34A and 34C) and relative tumor volume over time (Figures 34B and 34D) of mice treated with variants A2A-77 and A2A-81 are shown. [Figure 34C] The mean tumor volume over time (Figures 34A and 34C) and relative tumor volume over time (Figures 34B and 34D) of mice treated with variants A2A-77 and A2A-81 are shown. [Figure 34D] The mean tumor volume over time (Figures 34A and 34C) and relative tumor volume over time (Figures 34B and 34D) of mice treated with variants A2A-77 and A2A-81 are shown. [Figure 34E] This outlines the combination therapy experiment. [Figure 34F] This represents data from a colon cancer model. [Figure 34G] This represents data from a colon cancer model. [Figure 34H] This represents data from a colon cancer model. [Figure 34I] This represents data from a colon cancer model. [Figure 34J] This represents data from a colon cancer model. [Figure 34K] This represents data from a colon cancer model. [Figure 35A]This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the number of TIL CD45+ cells as a percentage of all detected viable cells. [Figure 35B] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of T cells. [Figure 35C] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of CD4+ cells. [Figure 35D] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of CD8+ cells. [Figure 35E] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of regulatory T cells (Tregs). [Figure 35F] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 35G] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of M2 TAMs. [Figure 35H] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the number of TIL CD45+ cells as a percentage of all detected viable cells. [Figure 35I] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of T cells. [Figure 35J] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of CD4+ cells. [Figure 35K] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of CD8+ cells. [Figure 35L] This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of regulatory T cells (Tregs). [Figure 35M]This represents the percentage of cells detected in mice in each of the four treatment groups. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 36A] This shows the cell profile of the lysed whole blood intermediate sample versus the final sample. The percentage of CD45+ cells is expressed as the percentage of viable cells. [Figure 36B] This shows the cell profiles of intermediate versus final samples of lysed whole blood. The amounts of CD3+ (Figure 36B) and CD3- (Figure 36C) cells are expressed as a percentage of CD45+ cells. [Figure 36C] This shows the cell profiles of intermediate versus final samples of lysed whole blood. The amounts of CD3+ (Figure 36B) and CD3- (Figure 36C) cells are expressed as a percentage of CD45+ cells. [Figure 37A] This represents the percentage of cells detected in mice in each of the four treatment groups within the intermediate-lysed whole blood sample. The number of TIL CD45+ cells is expressed as the percentage of all detected viable cells. [Figure 37B] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of T cells. [Figure 37C] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 37D] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 37E] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of regulatory T cells (Tregs). [Figure 37F] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 37G]This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M2 TAMs. [Figure 38A] This represents the percentage of cells detected in mice in each of the four treatment groups within the intermediate-lysed whole blood sample. The number of TIL CD45+ cells is expressed as the percentage of all detected viable cells. [Figure 38B] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of T cells. [Figure 38C] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 38D] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 38E] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of regulatory T cells (Tregs). [Figure 38F] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 38G] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M2 TAMs. [Figure 39] This represents the cytokine levels in peripheral blood after T cell activation. [Figure 40A] This represents the level of interferon-γ detected in the final blood sample. [Figure 40B] This represents the level of interleukin-2 detected in the final blood sample. [Figure 40C] This represents the level of interleukin-4 detected in the final blood sample. [Figure 40D] This represents the level of interleukin-6 detected in the final blood sample. [Figure 40E]This represents the level of interleukin-8 detected in the final blood sample. [Figure 40F] This represents the level of interleukin-10 detected in the final blood sample. [Figure 40G] This represents the level of TNFα detected in the final blood sample. [Figure 41A] This shows the cell profile of the lysed whole blood intermediate sample versus the final sample. The percentage of CD45+ cells is expressed as the percentage of viable cells. [Figure 41B] This shows the cell profiles of intermediate versus final samples of lysed whole blood. The amounts of CD3+ (Figure 41B) and CD3- (Figure 41C) cells are expressed as a percentage of CD45+ cells. [Figure 41C] This shows the cell profiles of intermediate versus final samples of lysed whole blood. The amounts of CD3+ (Figure 41B) and CD3- (Figure 41C) cells are expressed as a percentage of CD45+ cells. [Figure 42A] This represents the percentage of cells detected in mice in each of the four treatment groups within the intermediate-lysed whole blood sample. It also represents the number of TIL CD45+ cells as a percentage of all detected viable cells. [Figure 42B] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of T cells. [Figure 42C] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 42D] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 42E] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of regulatory T cells (Tregs). [Figure 42F]This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 42G] This represents the percentage of cells detected in mice in each of the four treatment groups in the intermediate-lysed whole blood sample. It also represents the total number of M2 TAMs. [Figure 43A] This represents the percentage of cells detected in mice in each of the four treatment groups in the final lysed whole blood sample. It also represents the number of TIL CD45+ cells as a percentage of all detected viable cells. [Figure 43B] This represents the percentage of cells detected in mice in each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of T cells. [Figure 43C] This represents the percentage of cells detected in mice in each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 43D] This represents the percentage of cells detected in mice in each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 43E] This represents the percentage of cells detected in mice from each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of regulatory T cells (Tregs). [Figure 43F] This represents the percentage of cells detected in mice from each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of M1 tumor-associated macrophages (TAMs). [Figure 43G] This represents the percentage of cells detected in mice in each of the four treatment groups in the final lysed whole blood sample. It also represents the total number of M2 TAMs. [Figure 44A] This represents the level of interferon-γ detected in the final blood sample. [Figure 44B] This represents the level of interleukin-2 detected in the final blood sample. [Figure 44C] This represents the level of interleukin-4 detected in the final blood sample. [Figure 44D]This represents the level of interleukin-6 detected in the final blood sample. [Figure 44E] This represents the level of interleukin-8 detected in the final blood sample. [Figure 44F] This represents the level of interleukin-10 detected in the final blood sample. [Figure 44G] This represents the level of TNFα detected in the final blood sample. [Figure 45] This represents the hA2b cross-binding activity in HEK293T cells. [Figure 46] This represents a functional cAMP assay used to test the activity of A2b antibodies. [Figure 47A] This shows the results of the A2b functional cAMP assay. [Figure 47B] This shows the results of the A2b functional cAMP assay. [Figure 47C] This shows the results of the A2b functional cAMP assay. [Figure 47D] This shows the results of the A2b functional cAMP assay. [Figure 48A] This study demonstrates primary T cell activation (cytokine release) in response to reformatting antibodies (IgG1 or IgG4). [Figure 48B] This study demonstrates primary T cell activation (cytokine release) in response to reformatting antibodies (IgG1 or IgG4). [Figure 48C] This study demonstrates primary T cell activation (cytokine release) in response to reformatting antibodies (IgG1 or IgG4). [Figure 48D] This study demonstrates primary T cell activation (cytokine release) in response to reformatting antibodies (IgG1 or IgG4). [Figure 48E] This study demonstrates primary T cell activation (cytokine release) in response to reformatting antibodies (IgG1 or IgG4). [Figure 49A]This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the number of LWB CD45+ cells as a percentage of all detected viable cells. [Figure 49B] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD3+ cells. [Figure 49C] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 49D] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 49E] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD3-non-T cells. [Figure 49F] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of Treg cells. [Figure 49G] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of proliferating T cells. [Figure 49H] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of proliferative Treg cells. [Figure 49I] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD11b+ cells. [Figure 49J] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of CD11c+ cells. [Figure 49K] This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of M1 macrophages. [Figure 49L]This represents the percentage of cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. It also represents the total number of M2 macrophages. [Figure 50A] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the number of LWB CD45+ cells as a percentage of all detected viable cells. [Figure 50B] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+ cells. [Figure 50C] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 50D] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 50E] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD3-non-T cells. [Figure 50F] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of Treg cells. [Figure 50G] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of proliferating T cells. [Figure 50H] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of proliferative Treg cells. [Figure 50I] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD11b+ cells. [Figure 50J] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD11c+ cells. [Figure 50K]This represents the percentage of cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of M1 macrophages. [Figure 50L] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of M2 macrophages. [Figure 51A] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the number of TIL CD45+ cells as a percentage of all detected viable cells. [Figure 51B] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+ cells. [Figure 51C] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD4+ cells. [Figure 51D] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD8+ cells. [Figure 51E] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD3-non-T cells. [Figure 51F] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of Treg cells. [Figure 51G] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of proliferating T cells. [Figure 51H] This represents the percentage of cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of proliferative Treg cells. [Figure 51I] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD11b+ cells. [Figure 51J]This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of CD11c+ cells. [Figure 51K] This represents the percentage of cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of M1 macrophages. [Figure 51L] This represents the percentage of cells detected in mice from each treatment group in the final lysed whole blood sample. It also represents the total number of M2 macrophages. [Figure 51M] This represents the ratio of TIL M1 / M2 macrophages in the final lysed whole blood sample from mice. [Figure 52A] This represents the percentage of LWB CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the number of LWB CD3+ cells as a percentage of all detected CD45+ cells. [Figure 52B] This represents the percentage of LWB CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+ TNFα+ cells as a percentage of all detected CD3+ cells. [Figure 52C] This represents the percentage of LWB CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+IFNg+ cells as a percentage of all detected CD3+ cells. [Figure 52D] This represents the percentage of LWB CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+ IL6+ cells as a percentage of all detected CD3+ cells. [Figure 52E] This represents the percentage of LWB CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of CD3+ IL8+ cells as a percentage of all detected CD3+ cells. [Figure 53A]This represents the percentage of LWB CD4+ cells detected in mice in each treatment group within the final lysed whole blood sample. The number of LWB CD4+ cells is expressed as a percentage of all detected CD3+ cells. [Figure 53B] This represents the percentage of LWB CD4+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD4+TNFa+ cells as a percentage of all detected CD4+ cells. [Figure 53C] This represents the percentage of LWB CD4+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD4+IFNg+ cells as a percentage of all detected CD4+ cells. [Figure 53D] This represents the percentage of LWB CD4+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD4+ IL6+ cells as a percentage of all detected CD4+ cells. [Figure 53E] This represents the percentage of LWB CD4+ cells detected in mice in each treatment group in the final lysed whole blood sample. It also represents the total number of CD4+ IL8+ cells as a percentage of all detected CD4+ cells. [Figure 54A] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the final lysed whole blood sample. The number of LWB CD8+ cells is expressed as a percentage of all detected CD3+ cells. [Figure 54B] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD8+ TNFa+ cells as a percentage of all detected CD8+ cells. [Figure 54C] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD8+IFNg+ cells as a percentage of all detected CD8+ cells. [Figure 54D]This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD8+ IL6+ cells as a percentage of all detected CD8+ cells. [Figure 54E] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the final lysed whole blood sample. It also represents the total number of CD8+IL8+ cells as a percentage of all detected CD8+ cells. [Figure 55A] This represents the amount of MFI CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD3+ TNFa+ cells is represented as the difference between all detected MFI cells. [Figure 55B] This represents the amount of MFI CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD3+IFNg+ cells is represented as the difference between all detected MFI cells. [Figure 55C] This represents the amount of MFI CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD3+IL6+ cells is represented as the difference between all detected MFI cells. [Figure 55D] This represents the amount of MFI CD3+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD3+ IL8+ cells is represented as the difference between all detected MFI cells. [Figure 56A] This represents the amount of MFI CD4+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD4+TNFa+ cells is represented as the difference between all detected MFI cells. [Figure 56B] This represents the amount of MFI CD4+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD4+IFNg+ cells is represented as the difference between all detected MFI cells. [Figure 56C] This represents the amount of MFI CD4+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD4+IL6+ cells is represented as the difference between all detected MFI cells. [Figure 56D] This represents the amount of MFI CD4+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD4+IL8+ cells is represented as the difference between all detected MFI cells. [Figure 57A] This represents the amount of MFI CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD8+ TNFa+ cells is represented as the difference between all detected MFI cells. [Figure 57B] This represents the amount of MFI CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD8+IFNg+ cells is represented as the difference between all detected MFI cells. [Figure 57C] This represents the amount of MFI CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD8+ IL6+ cells is represented as the difference between all detected MFI cells. [Figure 57D] This represents the amount of MFI CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The total number of CD8+IL8+ cells is represented as the difference between all detected MFI cells. [Figure 58A] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. The number of CD8+ cells is expressed as the percentage of CD45+ cells. [Figure 58B] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group within the intermediate-lysed whole blood sample. The percentage of CD45+ cells represents the number of Treg cells. [Figure 58C] This represents the ratio of LWB CD8+ / Treg cells in intermediate-lysed whole blood samples from mice. [Figure 59A] This represents the percentage of LWB CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The number of CD8+ cells is expressed as the percentage of CD45+ cells. [Figure 59B]This represents the percentage of LWB CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The percentage of CD45+ cells represents the number of Treg cells. [Figure 59C] This represents the ratio of LWB CD8+ / Treg cells in the final lysed whole blood sample from mice. [Figure 60A] This represents the percentage of TIL CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The number of CD8+ cells is expressed as the percentage of CD45+ cells. [Figure 60B] This represents the percentage of TIL CD8+ cells detected in mice in each treatment group in the final lysed whole blood sample. The number of Treg cells is represented as the percentage of CD45+ cells. [Figure 60C] This represents the ratio of TIL CD8+ / Treg cells in the final lysed whole blood sample from mice. [Modes for carrying out the invention]

[0008] This disclosure employs conventional molecular biological techniques within the scope of the art, unless otherwise specified. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art.

[0009] definition

[0010] Throughout this disclosure, various embodiments are presented in the form of scopes. It should be understood that the scope form is merely for convenience and brevity and should not be interpreted as a firm limitation on the scope of any embodiment. Accordingly, unless otherwise specified in the context, scope descriptions should be understood to specifically disclose all possible sub-scopes and the individual numerical values ​​within those scopes to two decimal places of the lower limit. For example, a scope description such as 1-6 should be understood to specifically disclose sub-scopes such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and the individual numerical values ​​within those scopes, such as 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the scope. These intervening upper and lower limits of scopes may independently be contained within smaller scopes and are incorporated within this disclosure according to any specifically excluded limits within the defined scope. If a defined range includes one or both of the upper and lower limits, the range excluding either or both of these included upper and lower limits is also included in this disclosure unless explicitly indicated by the context.

[0011] The terms used herein are for the purpose of describing specific embodiments only and are not intended to limit any embodiment. When used herein, the singular forms “a,” “an,” and “the” are also intended to include the plural forms unless the context otherwise expressly indicates. It should be further understood that the terms “including” and / or “including,” when used herein, identify the presence of a specified feature, integer, process, operation, element, and / or component, but do not exclude the presence or addition of one or more other features, integers, processes, operations, elements, components, and / or groups thereof. When used herein, the terms “and / or” include any combination of one or more of the enumerated items relating to the subject.

[0012] Unless otherwise specified or the context makes clear, when used herein, the term “about” in relation to a number or range of numbers should be understood to mean the specified number plus or minus 10%, or, for any enumerated range of values, 10% or less of the enumerated lower limit and 10% or more of the enumerated lower limit.

[0013] Unless otherwise specified, the term “nucleic acid” as used herein includes double-stranded or triple-stranded nucleic acids as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands do not need to have the same extent (i.e., a double-stranded nucleic acid does not need to be double-stranded along the entire length of both strands). Nucleic acid sequences, where provided, are written in the 5' to 3' direction unless otherwise stated. The methods described herein provide the production of isolated nucleic acids. The methods described herein further provide the production of isolated and purified nucleic acids. When used herein, “nucleic acid” may include at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more base lengths. Furthermore, the following methods are provided herein for the synthesis of any number of polypeptide segments encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide synthase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins such as antibodies, non-coding DNA or RNA such as regulatory sequences, for example, small nucleolar RNAs derived from promoters, transcription factors, enhancers, siRNAs, shRNAs, RNAi, miRNAs, microRNAs, or any functional or structural DNA or RNA unit of interest.The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, intergenetic DNA, loci (gene loci) determined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), and nucleolar small RNA, ribozymes, complementary DNA (cDNA), which is the DNA presentation of mRNA typically obtained by reverse transcription or amplification of messenger RNA (mRNA); synthetically produced or amplified DNA molecules, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A cDNA encoding a gene or gene fragment as referred to herein may include at least one region encoding an exon sequence without intervening intron sequences in an equivalent genomic sequence.

[0014] Adenosine A2A and A2B Receptor Library

[0015] Methods and compositions relating to a G protein-coupled receptor (GPCR) binding library for adenosine A2A receptor (ADORA2), comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, are provided herein. The scaffold described herein can stably support the adenosine A2A receptor-binding domain. The adenosine A2A receptor-binding domain may be designed based on the surface interaction between an adenosine A2A receptor ligand and the adenosine A2A receptor. Methods and compositions relating to a G protein-coupled receptor (GPCR) binding library for adenosine A2B receptor (ADORA2B), comprising nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain, are further provided herein. The scaffold described herein can stably support the adenosine A2B receptor-binding domain. The adenosine A2B receptor-binding domain may be designed based on the surface interaction between an adenosine A2B receptor ligand and the adenosine A2B receptor. The libraries described herein may be further diversified to provide variant libraries containing nucleic acids, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. Furthermore, protein libraries that may be produced when the nucleic acid libraries are translated are described herein. In some examples, the nucleic acid libraries described herein are introduced into cells to produce cellular libraries. Furthermore, downstream applications of libraries synthesized using the methods described herein are provided herein. Downstream applications include the identification of variant nucleic acids or protein sequences with enhanced biologically relevant functions, e.g., improved stability, affinity, binding, and functional activity, as well as the treatment or prevention of disease conditions related to adenosine A2A receptor signaling, adenosine A2B receptor signaling, or both adenosine A2A and adenosine A2B receptor signaling.

[0016] The methods, compositions, and systems described herein for the optimization of adenosine A2A receptor immunoglobulins or antibodies, adenosine A2B receptor immunoglobulins or antibodies, or both, include a ratio-variant approach that reflects the natural diversity of antibody sequences. In some examples, a library of optimized adenosine A2A receptor immunoglobulins or antibodies includes a sequence of variant adenosine A2A receptor immunoglobulins or antibodies. In some examples, a sequence of variant adenosine A2A receptor immunoglobulins or antibodies is designed to include a variant CDR region. In some examples, a sequence of variant adenosine A2A receptor immunoglobulins or antibodies including a variant CDR region is generated by shuffling natural CDR sequences in a llama framework, a humanization framework, or a chimeric framework. In some examples, a library of optimized adenosine A2B receptor immunoglobulins or antibodies includes a sequence of variant adenosine A2B receptor immunoglobulins or antibodies. In some cases, the sequence of a variant adenosine A2B receptor immunoglobulin or antibody is designed to include a variant CDR region. In some cases, the sequence of a variant adenosine A2B receptor immunoglobulin or antibody containing a variant CDR region is generated by shuffling native CDR sequences in a llama framework, a humanized framework, or a chimeric framework. In some cases, such a library is synthesized, cloned into an expression vector, and the translation product (antibody) is evaluated for activity. In some cases, fragments of the sequence are synthesized and then assembled. In some cases, the expression vector is used to display and enrich a desired antibody, such as in phage display. In some cases, the phage vector is a Fab phagemide vector. The selection pressures used during enrichment in some cases include binding affinity, toxicity, immune tolerance, stability, or other factors. Such an expression vector makes it possible to select ("panning") antibodies with specific properties, and subsequent propagation or amplification of such sequences enriches the library with these sequences.The panning rounds may be repeated any number of times, such as 1, 2, 3, 4, 5, 6, 7, or more than 7 rounds. In some examples, each round of panning includes a number of washes. In some examples, each round of panning includes at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 washes.

[0017] Methods and systems for in silico library design are described herein. Libraries as described herein are, in some examples, designed based on databases containing various antibody sequences. In some examples, the database contains multiple variant antibody sequences against various targets. In some examples, the database contains at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some examples, the database contains naive B cell receptor sequences and memory B cell receptor sequences. In some examples, the naive B cell receptor sequences and memory B cell receptor sequences are human, mouse, or primate sequences. In some examples, the naive B cell receptor sequences and memory B cell receptor sequences are human sequences. In some examples, the database is analyzed for position-specific variability. In some examples, the antibodies described herein contain position-specific variability in the CDR regions. In some examples, the CDR regions contain multiple sites for variability.

[0018] Scaffold library

[0019] A library containing nucleic acids encoding scaffolds is provided herein, where the sequence of adenosine A2A receptor-binding domains is positioned within the scaffold. The scaffolds described herein enable improved stability of sequences encoding a series of adenosine A2A receptor-binding domains when inserted into the scaffold, compared to unmodified scaffolds. Exemplary scaffolds include, but are not limited to, proteins, peptides, immunoglobulins, their derivatives, or combinations thereof. In some examples, the scaffold is an immunoglobulin. Scaffolds as described herein include improvements in functional activity, structural stability, expression, specificity, or combinations thereof. In some examples, the scaffold includes a long region for supporting the adenosine A2A receptor-binding domains.

[0020] A library containing nucleic acids encoding scaffolds is provided herein, where the sequence of adenosine A2B receptor-binding domains is positioned within the scaffold. The scaffolds described herein enable improved stability of the sequence encoding a series of adenosine A2B receptor-binding domains when inserted into the scaffold, compared to an unmodified scaffold. Exemplary scaffolds include, but are not limited to, proteins, peptides, immunoglobulins, their derivatives, or combinations thereof. In some examples, the scaffold is an immunoglobulin. Scaffolds as described herein include improvements in functional activity, structural stability, expression, specificity, or combinations thereof. In some examples, the scaffold includes a long region for supporting the adenosine A2B receptor-binding domains.

[0021] A library containing nucleic acids encoding scaffolds is provided herein, where the scaffold is an immunoglobulin. In some examples, immunoglobulins are antibodies. As used herein, the term antibody is understood to include a protein having the characteristic Y-shape of two arms of a typical antibody molecule and one or more fragments of the antibody that retain the ability to specifically bind to an antigen. Exemplary antibodies include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, grafted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv) (containing fragments in which VL and VH are linked using synthetic or natural linker recombination methods that allow the VL and VH regions to pair up to form a monovalent molecule containing single-chain Fab and scFab), single-chain antibodies, Fab fragments (containing monovalent fragments containing VL, VH, CL, and CH1 domains), F(ab')2 fragments (containing a bivalent fragment containing two Fab fragments linked by disulfide crosslinking in the hinge region) Examples include, but are not limited to, Fv fragments (including fragments containing VH and CH1 fragments), Fv fragments (including fragments containing VL and VH domains of a single arm of the antibody), single-domain antibodies (dAb or sdAb) (including fragments containing a VH domain), isolated complementarity-determining regions (CDRs), diabodies (including fragments containing bivalent dimers such as two VL and VH domains that bind to each other and recognize two different antigens), fragments consisting of only a single monomeric variable domain, disulfide-linked Fv (sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or their ab antigen-binding fragments. In some examples, the libraries disclosed herein include nucleic acids encoding a scaffold, the scaffold being an Fv antibody comprising a minimal antibody fragment containing a complete antigen recognition and antigen-binding site.In some embodiments, the Fv antibody consists of a dimer of one tightly non-covalently bonded heavy chain and one light chain variable domain, with three hypervariable regions of each variable domain interacting to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, six hypervariable regions confer antigen-binding specificity to the antibody. In some embodiments, a single variable domain (or half of the Fv containing only three antigen-specific hypervariable regions, including a single-domain antibody isolated from a camelid animal containing one heavy chain variable domain or heavy chain variable region, such as a VHH antibody or nanobody) has the ability to recognize and bind to an antigen. In some examples, the libraries disclosed herein contain nucleic acids encoding a scaffold, the scaffold being a single-chain Fv or scFv containing an antibody fragment containing the VH, VL, or both VH and VL domains, both domains present in a single polypeptide chain. In some embodiments, the Fv polypeptide further includes a polypeptide linker between the VH and VL domains, enabling the scFv to form a desired structure for antigen binding. In some examples, scFv is linked to an Fc fragment, or VHH is linked to an Fc fragment (including a minibody). In some examples, the antibody comprises an immunoglobulin molecule and an immunoactive fragment of the immunoglobulin molecule, e.g., a molecule containing an antigen-binding site. The immunoglobulin molecule can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1, and IgA 2), or subclass.

[0022] In some embodiments, the library contains immunoglobulins adapted to the species of the intended therapeutic target. Generally, these methods involve “mammalization” and include methods for transferring donor antigen-binding information to less immunogenic mammalian antibody receptors in order to produce useful therapeutic treatments. In some examples, mammals are mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, and humans. In some examples, libraries and methods for felinization and caninization of antibodies are provided herein.

[0023] The "humanization" of a non-human antibody can be a chimeric antibody containing minimal sequences derived from the non-human antibody. A humanized antibody is generally a human antibody (recipient antibody) in which one or more residues from a CDR (Chronic Distribution Range) are replaced with one or more residues from a CDR of a non-human antibody (donor antibody). The donor antibody can be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody, possessing the desired specificity, affinity, or biological effect. In some cases, selected framework region residues of the recipient antibody are replaced with corresponding framework region residues from the donor antibody. The humanized antibody may also contain residues not found in either the recipient or donor antibody. In some cases, these modifications are made to further refine the antibody's performance.

[0024] "Canine transformation" may include methods for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody receptor in order to generate therapeutic methods useful in dogs. In some examples, the canine transformation of non-canine antibodies provided herein is a chimeric antibody containing minimal sequences derived from the non-canine antibody. In some examples, the canine antibody is a canine antibody sequence ("receptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced with hypervariable region residues from a non-canine species ("donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or artificial sequence with desired properties. In some examples, framework region (FR) residues of the canine antibody are replaced with corresponding non-canine FR residues. In some examples, the canine antibody contains residues not found in the recipient or donor antibody. In some cases, these modifications are made to further refine the performance of the antibody. Canine-modified antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of the canine antibody.

[0025] "Felineization" may include methods for transferring non-feline antigen-binding information from a donor antibody to a less immunogenic feline antibody receptor in order to generate therapeutic methods useful in cats. In some examples, the felineized form of a non-feline antibody provided herein is a chimeric antibody containing minimal sequences derived from the non-feline antibody. In some examples, the felineized antibody is a feline antibody sequence ("receptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced with hypervariable region residues from a non-feline species ("donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or artificial sequences with desired properties. In some examples, framework region (FR) residues of the feline antibody are replaced with corresponding non-feline FR residues. In some examples, the felineized antibody contains residues not found in the recipient or donor antibody. In some examples, these modifications are made to further refine the performance of the antibody. The feline antibody may further include at least a portion of the immunoglobulin constant region (Fc) of the feline antibody.

[0026] A library containing nucleic acids encoding scaffolds is provided herein, where the scaffolds are non-immunoglobulins. In some examples, the scaffolds are non-immunoglobulin-binding domains. For example, the scaffolds are antibody mimetics. Exemplary antibody mimetics include, but are not limited to, antikalin, affilin, affibody molecules, affimers, afitins, alphabodies, avimers, atrimers, DARPins, finomers, Knitz domain-based proteins, monobodies, antikalin, Notchin, armadillo repeat protein-based proteins, and bicyclic peptides.

[0027] A library described herein, comprising a nucleic acid encoding a scaffold, wherein the scaffold is an immunoglobulin, includes a variation in at least one region of the immunoglobulin. Exemplary regions of the antibody relating to the variation include, but are not limited to, a complementation-determining region (CDR), a variable domain, or a constant domain. In some examples, the CDR is CDR1, CDR2, or CDR3. In some examples, the CDR is a heavy chain domain containing, but not limited to, CDRH1, CDRH2, and CDRH3. In some examples, the CDR is a light chain domain containing, but not limited to, CDRL1, CDRL2, and CDRL3. In some examples, the variable domain is a variable domain, light chain (VL) or a variable domain, heavy chain (VH). In some examples, the VL domain contains a κ chain or a λ chain. In some examples, the constant domain is a constant domain, light chain (CL) or a constant domain, heavy chain (CH).

[0028] The methods described herein provide the synthesis of a library containing nucleic acids encoding a scaffold, each nucleic acid encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library contains sequences encoding variations of at least one codon so that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some examples, the scaffold library contains a variety of nucleic acids that collectively encode variations at multiple positions. In some examples, the variant library contains sequences encoding variations of at least one codon in the domains of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH. In some examples, the variant library contains sequences encoding variations of multiple codons in the domains of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH. In some examples, a variant library contains an array that codes for variations of multiple codons in framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). Exemplary numbers of codons for variations include, but are not limited to, at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0029] In some cases, at least one region of the immunoglobulin for the variation originates from the heavy chain V gene family, the heavy chain D gene family, the heavy chain J gene family, the light chain V gene family, or the light chain J gene family. In some cases, the light chain V gene family includes the immunoglobulin kappa (IGK) gene or the immunoglobulin lambda (IGL) gene. Exemplary genes include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some cases, the genes are IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the genes are IGHV1-69 and IGHV3-30. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, or IGHJ4.

[0030] Libraries containing nucleic acids encoding immunoglobulin scaffolds are provided herein, and the libraries are synthesized with varying numbers of fragments. In some examples, the fragments contain the domains CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH. In some examples, the fragments contain framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some examples, the scaffold libraries are synthesized with at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length of each nucleic acid fragment, or the average length of the synthesized nucleic acid, may be at least or approximately 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some examples, the lengths are approximately 50–600, 75–575, 100–550, 125–525, 150–500, 175–475, 200–450, 225–425, 250–400, 275–375, or 300–350 base pairs.

[0031] Libraries containing nucleic acids encoding immunoglobulin scaffolds as described herein contain amino acids of varying lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some examples, amino acid lengths are approximately 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95. In some examples, amino acid lengths are approximately 22 to 75 amino acids. In some examples, immunoglobulin scaffolds contain at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0032] Numerous variant sequences for at least one region of an immunoglobulin for variation are de novo synthesized using methods such as those described herein. In some examples, the numerous variant sequences are de novo synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some examples, the numerous variant sequences are de novo synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). The number of variant sequences may be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some examples, the number of variant sequences is at least or approximately 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000. In some examples, the number of variant sequences is approximately 10-500, 25-475, 50-450, 75-425, 100-400, 125-375, 150-350, 175-325, 200-300, 225-375, 250-350, or 275-325.

[0033] Variant sequences for at least one region of an immunoglobulin differ in length or sequence in some instances. In some instances, at least one region that is de novo synthesized is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some instances, at least one region that is de novo synthesized is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some instances, a variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more variant nucleotides or amino acids compared to the wild type. In some instances, a variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some instances, a variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids compared to the wild type. In some instances, the library contains at least or about 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 or 10 10 or more variants.

[0034] Following the synthesis of the scaffold library, it may be used for screening and analysis. For example, the scaffold library may be assayed for library manifestability and panning. In some examples, manifestability is assayed using selectable tags. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some examples, the tags are histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some examples, the scaffold library may be assayed by sequencing using a variety of methods, including, but not limited to, single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electron sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.

[0035] In some cases, scaffold libraries are assayed for functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or a combination thereof. In some cases, scaffold libraries are assayed for the scaffolds themselves that are capable of folding. In some cases, regions of antibodies are assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof. For example, the VH region or VL region is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.

[0036] Adenosine A2A Receptor Library

[0037] An adenosine A2A receptor-binding library is provided herein, comprising nucleic acids encoding a scaffold containing a sequence for an adenosine A2A receptor-binding domain. In some examples, the scaffold is an immunoglobulin. In some examples, the scaffold containing the sequence for the adenosine A2A receptor-binding domain is determined by the interaction between the adenosine A2A receptor-binding domain and the adenosine A2A receptor.

[0038] A library is provided herein containing nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain being designed based on surface interactions on the adenosine A2A receptor. In some examples, the adenosine A2A receptor-binding domain contains a sequence such as that defined by Sequence ID No. 1. In some examples, the adenosine A2A receptor-binding domain interacts with the amino-terminus or carboxy-terminus of the adenosine A2A receptor. In some examples, the adenosine A2A receptor-binding domain interacts with at least one transmembrane domain, including but not limited to transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7). In some examples, the adenosine A2A receptor-binding domain interacts with the intracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one intracellular loop, including but not limited to intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3). In some examples, the adenosine A2A receptor-binding domain interacts with the extracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one extracellular domain (ECD) or extracellular loop (ECL) of the adenosine A2A receptor. Extracellular loops include, but are not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).

[0039] The adenosine A2A receptor binding domain is described herein and is designed based on the interaction between an adenosine A2A receptor ligand and the adenosine A2A receptor. In some examples, the ligand is a peptide. In some examples, the ligand is an adenosine A2A receptor agonist. In some examples, the ligand is an adenosine A2A receptor antagonist. In some examples, the ligand is an adenosine A2A receptor allosteric modulator. In some examples, the allosteric modulator is a negative allosteric modulator. In some examples, the allosteric modulator is a positive allosteric modulator. Exemplary ligands of the adenosine A2A receptor include, but are not limited to, DU172, PSB36, ZM241385, XAC, caffeine, T4G, T4E, 6DY, 6DZ, 6DX, 6DV, 8D1b, theophylline, UK-432097, adenosine, NECA, and CGS21680.

[0040] The sequence of the adenosine A2A receptor binding domain based on the surface interaction between an adenosine A2A receptor ligand and the adenosine A2A receptor is analyzed using various methods. For example, multiple types of computer analyses are performed. In some examples, structural analysis is performed. In some examples, sequence analysis is performed. Sequence analysis can be carried out using databases known in the art. Non-limiting examples of databases include, but are not limited to, NCBI BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi), UCSC Genome Browser (genome.ucsc.edu / ), UniProt (www.uniprot.org / ), and IUPHAR / BPS Guide to PHARMACOLOGY (guidetopharmacology.org / ).

[0041] A2A receptor-binding domains designed based on sequence analysis in various organisms are described herein. For example, sequence analysis is performed to identify homologous sequences in different organisms. Exemplary organisms include, but are not limited to, mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, fish, flies, and humans.

[0042] Following the identification of the adenosine A2A receptor-binding domain, a library containing nucleic acids encoding the adenosine A2A receptor-binding domain can be generated. In some examples, the library of adenosine A2A receptor-binding domains may include sequences of the adenosine A2A receptor-binding domain designed based on conformational-ligand interactions, peptide-ligand interactions, small molecule-ligand interactions, the extracellular domain of the adenosine A2A receptor, or antibodies targeting the adenosine A2A receptor. In some examples, the library of adenosine A2A receptor-binding domains may include sequences of the adenosine A2A receptor-binding domain designed based on peptide-ligand interactions. In some examples, the ligand is not an antibody ligand. The library of adenosine A2A receptor-binding domains may be translated to generate a protein library. In some examples, the library of adenosine A2A receptor-binding domains is translated to generate a peptide library, an immunoglobulin library, their derivatives, or a combination thereof. In some examples, the library of adenosine A2A receptor-binding domains is translated to generate a protein library that is further modified to generate a peptide-mimicking library. In some cases, a library of adenosine A2A receptor-binding domains is translated to generate a protein library used to produce small molecules.

[0043] The methods described herein provide for the synthesis of a library of adenosine A2A receptor-binding domains, each comprising nucleic acids encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding variations of at least one codon, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acids are generated by a standard translation process. In some examples, the library of adenosine A2A receptor-binding domains comprises diverse nucleic acids that collectively encode variations at multiple positions. In some examples, the variant library comprises sequences encoding variations of at least one codon of the adenosine A2A receptor-binding domain. In some examples, the variant library comprises sequences encoding variations of multiple codons of the adenosine A2A receptor-binding domain. Exemplary numbers of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0044] The methods described herein provide for the synthesis of a library comprising nucleic acids encoding an adenosine A2A receptor-binding domain, wherein the library comprises sequences encoding variations in the length of the adenosine A2A receptor-binding domain. In some examples, the library comprises sequences encoding variations in length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons compared to a predetermined reference sequence. In some examples, the library includes sequences that code for variations of a length with at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons, compared to a predetermined reference sequence.

[0045] Following the identification of the adenosine A2A receptor-binding domain, it may be positioned on a scaffold as described herein. In some examples, the scaffold is an immunoglobulin. In some examples, the adenosine A2A receptor-binding domain is positioned in the CDRH3 region. The adenosine A2A receptor-binding domain that can be positioned on a scaffold may also be referred to as a motif. Scaffolds containing the adenosine A2A receptor-binding domain may be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some examples, scaffolds containing the adenosine A2A receptor-binding domain enable contact with the adenosine A2A receptor. In some examples, scaffolds containing the adenosine A2A receptor-binding domain enable high-affinity binding to the adenosine A2A receptor. Exemplary amino acid sequences of the adenosine A2A receptor-binding domain are listed in Table 1.

[0046] [Table 1]

[0047] A scaffold or immunoglobulin containing an adenosine A2A receptor-binding domain is provided herein, and the sequence of the adenosine A2A receptor-binding domain supports interaction with the adenosine A2A receptor. The sequence may be homologous or identical to the sequence of an adenosine A2A receptor ligand. In some examples, the sequence of the adenosine A2A receptor-binding domain contains at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 1. In some examples, the sequence of the adenosine A2A receptor-binding domain contains at least or about 95% homology with respect to SEQ ID NO: 1. In some examples, the sequence of the adenosine A2A receptor-binding domain contains at least or about 97% homology with respect to SEQ ID NO: 1. In some cases, the sequence of the adenosine A2A receptor-binding domain contains at least or approximately 99% homology to SEQ ID NO: 1. In some cases, the sequence of the adenosine A2A receptor-binding domain contains at least or approximately 100% homology to SEQ ID NO: 1. In some examples, the sequence of the adenosine A2A receptor-binding domain includes at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of SEQ ID NO: 1.

[0048] Antibodies or immunoglobulins are provided herein, and the antibodies or immunoglobulins contain a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 540–717. In some examples, the sequence of an antibody or immunoglobulin contains at least or about 95% sequence identity to any one of SEQ ID NOs. 540–717. In some examples, the sequence of an antibody or immunoglobulin contains at least or about 97% sequence identity to any one of SEQ ID NOs. 540–717. In some examples, the sequence of an antibody or immunoglobulin contains at least or about 99% sequence identity to any one of SEQ ID NOs. 540–717. In some examples, the sequence of an antibody or immunoglobulin contains at least or about 100% sequence identity to any one of SEQ ID NOs. 540–717. In some examples, the sequence of an antibody or immunoglobulin contains at least a portion of one of sequence numbers 540-717 having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or more than 110 amino acids.

[0049] In some embodiments, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing sequences listed in Tables 15-16. In some embodiments, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 6-539. In some examples, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 95% homology to any one of SEQ ID NOs. 6-539. In some examples, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 97% homology to any one of SEQ ID NOs. 6-539. In some cases, the sequence of the antibody or immunoglobulin contains a complementation-determining region (CDR) that has at least or approximately 99% homology to any one of SEQ ID NOs. 6-539. In some cases, the sequence of the antibody or immunoglobulin contains a complementation-determining region (CDR) that has at least or approximately 100% homology to any one of SEQ ID NOs. 6-539. In some cases, the sequence of the antibody or immunoglobulin contains a complementation-determining region (CDR) that has at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 6-539.

[0050] In some embodiments, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one of SEQ ID NOs. 6-94 or 273-361. In some examples, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 95% homology to one of SEQ ID NOs. 6-94 and 273-361. 6-9 examples, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 97% homology to one of SEQ ID NOs. 6-94 or 273-361. 6-9 examples, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 99% homology to one of SEQ ID NOs. 6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence contains a CDR1 having at least or approximately 100% homology to one of the sequence numbers 6-270 or 273-537. In some cases, the antibody or immunoglobulin sequence contains a CDR1 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids to one of the sequence numbers 6-94 or 273-361.

[0051] In some embodiments, the sequence of the antibody or immunoglobulin includes a CDR2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs. 95-183 and 362-450. In some examples, the sequence of the antibody or immunoglobulin includes a CDR2 having at least or about 95% homology with any one of SEQ ID NOs. 95-183 and 362-450. 95% homology with any one of SEQ ID NOs. 795-183 and 362-450. 95% homology with any one of SEQ ID NOs. 795-183 and 362-450. In some cases, the antibody or immunoglobulin sequence contains a CDR2 having at least or approximately 100% homology to one of the sequence numbers 95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence contains a CDR2 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids to one of the sequence numbers 95-183 and 362-450.

[0052] In some embodiments, the sequence of the antibody or immunoglobulin includes a CDR3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs. 184-272 and 451-539. In some examples, the sequence of the antibody or immunoglobulin includes a CDR3 having at least or about 95% homology with any one of SEQ ID NOs. 184-272 and 451-539. In some examples, the sequence of the antibody or immunoglobulin includes a CDR3 having at least or about 97% homology with any one of SEQ ID NOs. 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence contains a CDR3 having at least or approximately 100% homology to one of sequence numbers 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence contains a CDR3 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids to one of sequence numbers 184-272 and 451-539.

[0053] In some embodiments, the sequence of the antibody or immunoglobulin includes CDRH1 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% sequence identity to any one of SEQ ID NOs. 6-94, and at least or about 70%, 80%, and 85% sequence identity to any one of SEQ ID NOs. 95-183. CDRH2 containing 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, and CDRH3 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity for any one of sequence numbers 184-272. In some examples, the antibody or immunoglobulin sequence includes CDRH1, which has at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 6–94; CDRH2, which has at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 95–183; and CDRH3, which has at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 184–272. In some examples, the antibody or immunoglobulin sequence includes CDRH1, which comprises at least a portion of SEQ ID NOs. 6-94 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; CDRH2, which comprises at least a portion of SEQ ID NOs. 95-183 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; and CDRH3, which comprises at least a portion of SEQ ID NOs. 184-272 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids.

[0054] In some embodiments, the sequence of the antibody or immunoglobulin includes CDRL1 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs. 273-361 and at least or about 70%, 80%, 85% sequence identity to SEQ ID NOs. 362-450. It includes CDRL2 containing 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, and CDRL3 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity for sequence numbers 451-539. In some examples, the antibody or immunoglobulin sequence includes CDRL1, which has at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 273–361; CDRL2, which has at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 362–450; and CDRL3, which has at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 451–539. In some examples, the antibody or immunoglobulin sequence includes CDRL1, which comprises at least a portion of SEQ ID NOs. 273-361 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; CDRL2, which comprises at least a portion of SEQ ID NOs. 362-450 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; and CDRL3, which comprises at least a portion of SEQ ID NOs. 451-539 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids.

[0055] In some embodiments, the sequence of the antibody or immunoglobulin includes CDRH1 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% sequence identity to any one of SEQ ID NOs. 6-94, and at least or about 70%, 80% sequence identity to any one of SEQ ID NOs. 95-183. CDRH2 containing sequence identity of %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, and at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% for any one of sequence numbers 184-272. CDRH3 containing and CDRL1 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of sequence numbers 273-362 and CDRH3 containing at least or approximately 70%, 80%, 85%, 90%, or 91% sequence identity to any one of sequence numbers 362-450 A CDRL2 containing sequence identity of %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, and a CDRL3 containing sequence identity of at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% for any one of sequence numbers 451-539.In some cases, the sequence of an antibody or immunoglobulin contains at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 6-94, CDRH1 contains at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 95-183, and CDRH2 contains at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 184-272. The CDRL includes CDRH3 containing, CDRL1 containing at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 273-362, CDRL2 containing at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 362-450, and CDRL3 containing at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 451-539. In some examples, the antibody or immunoglobulin sequence includes CDRH1, which contains at least one portion of any one of SEQ ID NOs: 6-94 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; CDRH2, which contains at least one portion of any one of SEQ ID NOs: 95-183 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; and at least one portion of any one of SEQ ID NOs: 184-272 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids. The compound comprises CDRH3 containing, CDRL1 containing at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 273-362, CDRL2 containing at least a portion having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 362-450, and CDRL3 containing at least a portion having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 451-539.

[0056] In some embodiments, antibodies or immunoglobulins that bind to the adenosine A2A receptor are described herein. In some examples, the sequence of the adenosine A2A receptor antibody or immunoglobulin includes a heavy chain variable domain having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 540–628. In some examples, the sequence of the adenosine A2A receptor antibody or immunoglobulin includes a heavy chain variable domain having at least or about 95% sequence identity to any one of SEQ ID NOs. 540–628. In some examples, the sequence of the adenosine A2A receptor antibody or immunoglobulin includes a heavy chain variable domain having at least or about 97% sequence identity to any one of SEQ ID NOs. 540–628. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a heavy chain variable domain with at least or approximately 99% sequence identity to any one of SEQ ID NOs. 540–628. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a heavy chain variable domain with at least or approximately 100% sequence identity to any one of SEQ ID NOs. 540–628. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a heavy chain variable domain with at least a portion having at least or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or more than 110 amino acids from SEQ ID NOs. 540–628.

[0057] In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a light chain variable domain with at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 629–717. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a light chain variable domain with at least or approximately 95% sequence identity to any one of SEQ ID NOs. 629–717. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a light chain variable domain with at least or approximately 97% sequence identity to any one of SEQ ID NOs. 629–717. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a light chain variable domain with at least or approximately 99% sequence identity to one of sequence numbers 629–717. In some cases, the sequence of an adenosine A2A receptor antibody or immunoglobulin contains a light chain variable domain with at least or approximately 100% sequence identity to one of sequence numbers 629–717. In some examples, the sequences of adenosine A2A receptor antibodies or immunoglobulins include a light chain variable domain containing at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids, as of sequence numbers 629-717.

[0058] In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 540, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 629. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 541, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 630. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 542, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 631. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 543, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 632. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 544, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 633. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 545, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 634. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 546, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 635. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 547, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 636.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 548, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 637. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 549, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 638. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 550, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 639. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 551, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 640. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 552, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 641. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 553, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 642. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 554, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 643. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 555, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 644.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 556, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 645. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 557, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 646. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 558, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 647. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 559, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 648. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 560, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 649. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 561, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 650. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 562, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 651. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 563, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 652.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 564, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 653. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 565, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 654. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 566, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 655. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 567, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 656. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 568, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 657. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 569, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 658. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 570, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 659. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 571, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 660.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 572, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 661. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 573, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 662. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 574, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 663. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 575, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 664. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 576, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 665. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 577, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 666. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 578, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 667. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 579, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 668.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 580, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 669. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 581. The immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 670. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 582, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 671. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 583, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 672. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 584, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO. 673. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 585, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 674. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 586, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 675. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 587, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 676. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 588, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 677.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 589, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 678. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 590, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 679. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 591, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 680. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 592, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 681. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 593, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 682. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 594, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 683. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 595, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 684. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 596, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 685.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 597, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 686. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 598, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 687. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 599, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 688. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 600, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 689. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 601, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 690. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 602, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 691. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 603, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 692. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 604, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 693.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 605, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 694. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 606, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 695. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 607, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 696. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 608, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 697. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 609, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 698. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 610, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 699. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 611, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 700. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 612, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 701.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 613, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 702. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 614, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 703. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 615, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 704. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 616, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 705. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 617, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 706. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 618, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 707. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 619, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 708. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 620, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 709.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 621, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 710. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 622, and the immunoglobulin... The phosphate light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 711. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 623, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 712. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 624, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 713. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 625, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 714. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 626, and the immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 715. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 627, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 716. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 628, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence described in SEQ ID NO: 717.

[0059] This specification provides adenosine A2A receptor-binding libraries comprising a scaffold or nucleic acid encoding an immunoglobulin, which includes an adenosine A2A receptor-binding domain, including variations in domain type, domain length, or residue variations. In some examples, the domain is a region in the scaffold containing the adenosine A2A receptor-binding domain. For example, the region is a VH, CDRH3, or VL domain. In some examples, the domain is an adenosine A2A receptor-binding domain.

[0060] The methods described herein provide for the synthesis of an adenosine A2A receptor-binding library of nucleic acids, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding variations of at least one codon, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some examples, the adenosine A2A receptor-binding library includes a variety of nucleic acids that collectively encode variations at multiple positions. In some examples, the variant library includes sequences encoding variations of at least one codon in the VH, CDRH3, or VL domain. In some examples, the variant library includes sequences encoding variations of at least one codon in the adenosine A2A receptor-binding domain. For example, at least one single codon in the adenosine A2A receptor-binding domain is altered, as listed in Table 1. In some examples, the variant library includes sequences encoding variations of multiple codons in the VH, CDRH3, or VL domain. In some examples, variant libraries contain sequences encoding variations of multiple codons in the adenosine A2A receptor-binding domain. Exemplary numbers of codons for variations include, but are not limited to, at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0061] The methods described herein provide for the synthesis of adenosine A2A receptor-binding libraries of nucleic acids, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence, wherein the adenosine A2A receptor-binding library comprises a sequence encoding a variation in domain length. In some examples, the domain is the VH, CDRH3, or VL domain. In some examples, the domain is the adenosine A2A receptor-binding domain. In some examples, the library comprises a sequence encoding a variation in length with at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons compared to the predetermined reference sequence. In some examples, the library includes sequences that code for variations of a length with at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons, compared to a predetermined reference sequence.

[0062] An adenosine A2A receptor-binding library is provided herein, comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, and the adenosine A2A receptor-binding library is synthesized with varying numbers of fragments. In some examples, the fragments contain VH, CDRH3, or VL domains. In some examples, the adenosine A2A receptor-binding library is synthesized with at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length of each nucleic acid fragment or the average length of the synthesized nucleic acid may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some examples, the base pairs are approximately 50–600, 75–575, 100–550, 125–525, 150–500, 175–475, 200–450, 225–425, 250–400, 275–375, or 300–350 in length.

[0063] An adenosine A2A receptor-binding library containing nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, as described herein, contains amino acids of varying lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some examples, amino acid lengths are approximately 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95. In some examples, amino acid lengths are approximately 22-75.

[0064] An adenosine A2A receptor-binding library containing de novo-synthesized variant sequences encoding a scaffold containing an adenosine A2A receptor-binding domain includes numerous variant sequences. In some examples, numerous variant sequences are de novo-synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some examples, numerous variant sequences are de novo-synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some examples, numerous variant sequences are de novo-synthesized for the adenosine A2A receptor-binding domain. For example, the number of variant sequences is approximately 1 to 10 for the VH domain and approximately 10 for the adenosine A2A receptor-binding domain. 8 The sequence and, for the VK domain, the sequence number is approximately 1 to 44. The number of variant sequences may be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some examples, the number of variant sequences is approximately 10 to 300, 25 to 275, 50 to 250, 75 to 225, 100 to 200, or 125 to 150.

[0065] Adenosine A2A receptor-binding libraries, including de novo-synthesized variant sequences encoding scaffolds containing adenosine A2A receptor-binding domains, exhibit improved diversity. For example, variants are generated by placing an adenosine A2A receptor-binding domain variant into a variant of an immunoglobulin scaffold containing N-terminal CDRH3 and C-terminal CDRH3 variations. In some examples, variants include affinity-mature variants. Alternatively or in combination, variants include variants in other regions of immunoglobulins, including but not limited to CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3. In some examples, the number of variants in an adenosine A2A receptor-binding library is at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 These are non-identical sequences exceeding 10. For example, a library containing approximately 10 variant sequences in the VH region, approximately 237 variant sequences in the CDRH3 region, and approximately 43 variant sequences in the VL and CDRL3 regions is 10 5 Includes non-identical sequences (10×237×43).

[0066] A library is provided herein comprising nucleic acids encoding an adenosine A2A receptor antibody, wherein the region is a CDR region, and the region is a CDR region. In some examples, the adenosine A2A receptor antibody is a single-domain antibody, e.g., a VHH antibody, comprising one heavy chain variable domain. In some examples, the VHH antibody contains variations in one or more CDR regions. In some examples, the libraries described herein contain at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3. In some examples, the libraries described herein include at least or about 10 CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 2000 sequences for CDR1, at least 1200 sequences for CDR2, and at least 1600 sequences for CDR3. In some examples, the sequences are not identical.

[0067] In some examples, CDR1, CDR2, or CDR3 are of the light chain variable domain (VL). The CDR1, CDR2, or CDR3 of the light chain variable domain (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. In some examples, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of the CDR1, CDR2, or CDR3 of the VL. In some examples, the libraries described herein include at least or about 10 VL CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 20 sequences of VL's CDR1, at least 4 sequences of VL's CDR2, and at least 140 sequences of VL's CDR3. In some examples, the library includes at least 2 sequences of VL's CDR1, at least 1 sequence of VL's CDR2, and at least 3000 sequences of VL's CDR3. In some examples, VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1. In some examples, VL is IGKV2-28. In some examples, VL is IGLV1-51.

[0068] In some examples, CDR1, CDR2, or CDR3 is of the variable domain, heavy chain (VH). CDR1, CDR2, or CDR3 of the variable domain, heavy chain (VH) can be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some examples, the libraries described herein include at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3 of VH. In some examples, the libraries described herein include at least or about 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or 10 20 or more than 10 sequences. For example, the library includes at least 30 sequences of CDR1 of VH, at least 570 sequences of CDR2 of VH, and at least 10 8 sequences of CDR3 of VH. In some examples, the library includes at least 30 sequences of CDR1 of VH, at least 860 sequences of CDR2 of VH, and at least 10 7The sequence includes IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59 / 61. In some cases, VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, VH is IGHV1-69 and IGHV3-30. In some cases, VH is IGHV3-23.

[0069] In some embodiments, a library as described herein includes CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 of varying lengths. In some examples, the lengths of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acid lengths. For example, CDRH3 includes at least or about 12, 15, 16, 17, 20, 21, or 23 amino acid lengths. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include amino acid length ranges of approximately 1 to 10, 5 to 15, 10 to 20, or 15 to 30.

[0070] A library containing nucleic acids encoding antibodies having variant CDR sequences as described herein contains amino acids of varying lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some examples, amino acid lengths are approximately 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95. In some examples, amino acid lengths are approximately 22 to 75 amino acids. In some examples, antibodies contain at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0071] The length ratios of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 can vary in the libraries described herein. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 containing an amino acid length of at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids comprise about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the library. For example, CDRH3 containing an amino acid length of about 23 amino acids is present at 40% in the library, CDRH3 containing an amino acid length of about 21 amino acids is present at 30% in the library, CDRH3 containing an amino acid length of about 17 amino acids is present at 20% in the library, and CDRH3 containing an amino acid length of about 12 amino acids is present at 10% in the library. In some examples, CDRH3 containing an amino acid length of about 20 amino acids is present at 40% in the library, CDRH3 containing an amino acid length of about 16 amino acids is present at 30% in the library, CDRH3 containing an amino acid length of about 15 amino acids is present at 20% in the library, and CDRH3 containing an amino acid length of about 12 amino acids is present at 10% in the library.

[0072] Libraries as described herein encoding VHH antibodies comprise shuffled variant CDR sequences to generate libraries having a theoretical diversity of at least or about 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 10 20 or more than 10 7 10 8 109 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It has the ultimate library diversity of sequences exceeding [a certain value].

[0073] A library of adenosine A2A receptor-binding immunoglobulins is provided herein. In some examples, the adenosine A2A receptor immunoglobulin is an antibody. In some examples, the adenosine A2A receptor immunoglobulin is a VHH antibody. In some examples, the adenosine A2A receptor immunoglobulin has a binding affinity to the adenosine A2A receptor (e.g., K) of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. D ) includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 1 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 1.2 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 2 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 5 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 10 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 13.5 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 15 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 20 nM. DThis includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 25 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 30 nM. D Includes.

[0074] In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor agonist. In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor antagonist. In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor allosteric modulator. In some cases, the allosteric modulator is a negative allosteric modulator. In some cases, the allosteric modulator is a positive allosteric modulator. In some cases, adenosine A2A receptor immunoglobulins produce agonist, antagonist, or allosteric effects at concentrations of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or above 1000 nM. In some cases, adenosine A2A receptor immunoglobulins are negative allosteric modulators. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or above 100 nM. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations ranging from about 0.001 to about 100, 0.01 to about 90, about 0.1 to about 80, 1 to about 50, about 10 to about 40 nM, or about 1 to about 10 nM. In some cases, adenosine A2A receptor immunoglobulins contain an EC50 or IC50 greater than or equal to at least 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.06, 0.07, 0.08, 0.9, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or 6 nM.In some cases, adenosine A2A receptor immunoglobulins contain an EC50 or IC50 of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or greater than 100 nM.

[0075] Adenosine A2A receptor immunoglobulins as described herein may have improved properties. In some cases, adenosine A2A receptor immunoglobulins are monomers. In some cases, adenosine A2A receptor immunoglobulins are less prone to aggregation. In some cases, at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of adenosine A2A receptor immunoglobulins are monomers. In some cases, adenosine A2A receptor immunoglobulins are thermally stable. In some cases, adenosine A2A receptor immunoglobulins result in reduced nonspecific binding.

[0076] Following the synthesis of an adenosine A2A receptor-binding library containing nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, the library can be used for screening and analysis. For example, the library may be assayed for library manifestability and panning. In some examples, manifestability is assayed using selectable tags. Exemplary tags include, but are not limited to, radiolabels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some examples, the tags may be histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. The adenosine A2A receptor-binding library may contain nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain with multiple tags, such as GFP, FLAG, Lucy, and DNA barcodes. In some examples, libraries are assayed by sequencing using a variety of methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electron sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.

[0077] Adenosine A2B Receptor Library

[0078] An adenosine A2B receptor-binding library is provided herein, comprising nucleic acids encoding a scaffold containing a sequence for an adenosine A2B receptor-binding domain. In some examples, the scaffold is an immunoglobulin. In some examples, the scaffold containing the sequence for the adenosine A2B receptor-binding domain is determined by the interaction between the adenosine A2B receptor-binding domain and the adenosine A2B receptor.

[0079] A library is provided herein containing nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain, the adenosine A2B receptor-binding domain being designed based on surface interactions on the adenosine A2B receptor. In some examples, the adenosine A2B receptor-binding domain interacts with the amino-terminus or carboxy-terminus of the adenosine A2B receptor. In some examples, the adenosine A2B receptor-binding domain interacts with at least one transmembrane domain, including but not limited to transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7). In some examples, the adenosine A2B receptor-binding domain interacts with the intracellular surface of the adenosine A2B receptor. For example, the adenosine A2B receptor-binding domain interacts with at least one intracellular loop, including but not limited to intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3). In some examples, the adenosine A2B receptor-binding domain interacts with the extracellular surface of the adenosine A2B receptor. For example, the adenosine A2B receptor-binding domain interacts with at least one extracellular domain (ECD) or extracellular loop (ECL) of the adenosine A2B receptor. Extracellular loops include, but are not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).

[0080] Adenosine A2B receptor-binding domains are described herein, and these domains are designed based on the interaction between an adenosine A2B receptor ligand and an adenosine A2B receptor. In some examples, the ligand is a peptide. In some examples, the ligand is an adenosine A2B receptor agonist. In some examples, the ligand is an adenosine A2B receptor antagonist. In some examples, the ligand is an adenosine A2B receptor allosteric modulator. In some examples, the allosteric modulator is a negative allosteric modulator. In some examples, the allosteric modulator is a positive allosteric modulator. Exemplary ligands for the adenosine A2B receptor include, but are not limited to, DU172, PSB36, ZM241385, XAC, caffeine, T4G, T4E, 6DY, 6DZ, 6DX, 6DV, 8D1b, theophylline, UK-432097, adenosine, NECA, and CGS21680.

[0081] The sequence of the adenosine A2B receptor-binding domain, based on the surface interaction between the adenosine A2B receptor ligand and the adenosine A2B receptor, is analyzed using various methods. For example, various computer analyses are performed. In some cases, structural analysis is performed. In some cases, sequence analysis is performed. Sequence analysis can be performed using databases known in the art. Non-exclusive examples of databases include, but are not limited to, NCBI BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi), UCSC Genome Browser (genome.ucsc.edu / ), UniProt (www.uniprot.org / ), and IUPHAR / BPS Guide to PHARMACOLOGY (guidetopharmacology.org / ).

[0082] A2B receptor-binding domains designed based on sequence analysis in various organisms are described herein. For example, sequence analysis is performed to identify homologous sequences in different organisms. Exemplary organisms include, but are not limited to, mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, fish, flies, and humans.

[0083] Following the identification of the adenosine A2B receptor-binding domain, a library containing nucleic acids encoding the adenosine A2B receptor-binding domain can be generated. In some examples, the library of adenosine A2B receptor-binding domains may include sequences of the adenosine A2B receptor-binding domain designed based on conformational-ligand interactions, peptide-ligand interactions, small molecule-ligand interactions, the extracellular domain of the adenosine A2B receptor, or antibodies targeting the adenosine A2B receptor. In some examples, the library of adenosine A2B receptor-binding domains may include sequences of the adenosine A2B receptor-binding domain designed based on peptide-ligand interactions. In some examples, the ligand is not an antibody ligand. The library of adenosine A2B receptor-binding domains may be translated to generate a protein library. In some examples, the library of adenosine A2B receptor-binding domains is translated to generate a peptide library, an immunoglobulin library, their derivatives, or a combination thereof. In some examples, the library of adenosine A2B receptor-binding domains is translated to generate a protein library that is further modified to generate a peptide-mimicking library. In some cases, a library of adenosine A2B receptor-binding domains is translated to generate a protein library used to produce small molecules.

[0084] The methods described herein provide for the synthesis of a library of adenosine A2B receptor-binding domains, each comprising nucleic acids encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding variations of at least a single codon, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acids are generated by a standard translation process. In some examples, the library of adenosine A2B receptor-binding domains comprises diverse nucleic acids that collectively encode variations at multiple positions. In some examples, the variant library comprises sequences encoding variations of at least a single codon of the adenosine A2B receptor-binding domain. In some examples, the variant library comprises sequences encoding variations of multiple codons of the adenosine A2B receptor-binding domain. Exemplary numbers of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0085] The methods described herein provide for the synthesis of a library comprising nucleic acids encoding an adenosine A2B receptor-binding domain, wherein the library comprises sequences encoding variations in the length of the adenosine A2B receptor-binding domain. In some examples, the library comprises sequences encoding variations in length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons compared to a predetermined reference sequence. In some examples, the library includes sequences that code for variations of a length with at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons, compared to a predetermined reference sequence.

[0086] Following the identification of the adenosine A2B receptor-binding domain, the adenosine A2B receptor-binding domain may be positioned on a scaffold as described herein. In some examples, the scaffold is an immunoglobulin. In some examples, the adenosine A2B receptor-binding domain is positioned in the CDRH3 region. The adenosine A2B receptor-binding domain that can be positioned on a scaffold may also be referred to as a motif. Scaffolds containing the adenosine A2B receptor-binding domain may be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some examples, scaffolds containing the adenosine A2B receptor-binding domain enable contact with the adenosine A2B receptor. In some examples, scaffolds containing the adenosine A2B receptor-binding domain enable high-affinity binding to the adenosine A2B receptor.

[0087] In some embodiments, antibodies or immunoglobulins that bind to the adenosine A2B receptor are described herein.

[0088] This specification provides adenosine A2B receptor-binding libraries comprising a scaffold or nucleic acid encoding an immunoglobulin, which includes an adenosine A2B receptor-binding domain, including variations in domain type, domain length, or residue variations. In some examples, the domain is a region in the scaffold containing the adenosine A2B receptor-binding domain. For example, the region is a VH, CDRH3, or VL domain. In some examples, the domain is an adenosine A2B receptor-binding domain.

[0089] The methods described herein provide for the synthesis of an adenosine A2B receptor-binding library of nucleic acids, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library includes sequences encoding variations of at least a single codon, such that multiple different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some examples, the adenosine A2B receptor-binding library includes a variety of nucleic acids that collectively encode variations at multiple positions. In some examples, the variant library includes sequences encoding variations of at least a single codon in the VH, CDRH3, or VL domain. In some examples, the variant library includes sequences encoding variations of at least a single codon in the adenosine A2B receptor-binding domain. In some examples, the variant library includes sequences encoding variations of multiple codons in the VH, CDRH3, or VL domain. In some examples, the variant library includes sequences encoding variations of multiple codons in the adenosine A2B receptor-binding domain. Exemplary numbers of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0090] The methods described herein provide for the synthesis of adenosine A2B receptor-binding libraries of nucleic acids, each encoding a predetermined variant of at least one predetermined reference nucleic acid sequence, wherein the adenosine A2B receptor-binding library comprises a sequence encoding a variation in domain length. In some examples, the domain is the VH, CDRH3, or VL domain. In some examples, the domain is the adenosine A2B receptor-binding domain. In some examples, the library comprises a sequence encoding a variation in length with at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons compared to the predetermined reference sequence. In some examples, the library includes sequences that code for variations of a length with at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons, compared to a predetermined reference sequence.

[0091] An adenosine A2B receptor-binding library is provided herein, comprising nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain, and the adenosine A2B receptor-binding library is synthesized with varying numbers of fragments. In some examples, the fragments contain VH, CDRH3, or VL domains. In some examples, the adenosine A2B receptor-binding library is synthesized with at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length of each nucleic acid fragment or the average length of the synthesized nucleic acid may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some examples, the base pairs are approximately 50–600, 75–575, 100–550, 125–525, 150–500, 175–475, 200–450, 225–425, 250–400, 275–375, or 300–350 in length.

[0092] An adenosine A2B receptor-binding library containing nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain, as described herein, contains amino acids of varying lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some examples, amino acid lengths are approximately 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95. In some examples, amino acid lengths are approximately 22-75.

[0093] An adenosine A2B receptor-binding library containing de novo-synthesized variant sequences encoding a scaffold containing an adenosine A2B receptor-binding domain includes a large number of variant sequences. In some examples, the numerous variant sequences are de novo-synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some examples, the numerous variant sequences are de novo-synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some examples, the numerous variant sequences are de novo-synthesized for the adenosine A2B receptor-binding domain. For example, the number of variant sequences is approximately 1 to 10 for the VH domain, approximately 108 for the adenosine A2B receptor-binding domain, and approximately 1 to 44 for the VK domain. The number of variant sequences may be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some examples, the number of variant sequences is approximately 10–300, 25–275, 50–250, 75–225, 100–200, or 125–150.

[0094] Adenosine A2B receptor-binding libraries, including de novo-synthesized variant sequences encoding scaffolds containing adenosine A2B receptor-binding domains, exhibit improved diversity. For example, variants are generated by placing an adenosine A2B receptor-binding domain variant into a variant of an immunoglobulin scaffold containing N-terminal CDRH3 and C-terminal CDRH3 variations. In some examples, variants include affinity-mature variants. Alternatively or in combination, variants include variants in other regions of immunoglobulins, including but not limited to CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3. In some examples, the number of variants in an adenosine A2B receptor-binding library is at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 These are non-identical sequences exceeding 10. For example, a library containing approximately 10 variant sequences in the VH region, approximately 237 variant sequences in the CDRH3 region, and approximately 43 variant sequences in the VL and CDRL3 regions is 10 5 Includes non-identical sequences (10×237×43).

[0095] A library is provided herein comprising nucleic acids encoding an adenosine A2B receptor antibody, wherein the region is a CDR region, and the region is a CDR region. In some examples, the adenosine A2B receptor antibody is a single-domain antibody, e.g., a VHH antibody, comprising one heavy chain variable domain. In some examples, the VHH antibody contains variations in one or more CDR regions. In some examples, the libraries described herein contain at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3. In some examples, the libraries described herein include at least or about 10 CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 2000 sequences for CDR1, at least 1200 sequences for CDR2, and at least 1600 sequences for CDR3. In some examples, the sequences are not identical.

[0096] In some examples, CDR1, CDR2, or CDR3 are of the light chain variable domain (VL). The CDR1, CDR2, or CDR3 of the light chain variable domain (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. In some examples, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of the CDR1, CDR2, or CDR3 of the VL. In some examples, the libraries described herein include at least or about 10 VL CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 20 sequences of VL's CDR1, at least 4 sequences of VL's CDR2, and at least 140 sequences of VL's CDR3. In some examples, the library includes at least 2 sequences of VL's CDR1, at least 1 sequence of VL's CDR2, and at least 3000 sequences of VL's CDR3. In some examples, VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1. In some examples, VL is IGKV2-28. In some examples, VL is IGLV1-51.

[0097] In some examples, CDR1, CDR2, or CDR3 are of the variable domain, heavy chain (VH). The variable domain, heavy chain (VH) CDR1, CDR2, or CDR3 may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some examples, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of VH CDR1, CDR2, or CDR3. In some examples, the libraries described herein contain at least or about 10 VH CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 30 sequences of VH's CDR1, at least 570 sequences of VH's CDR2, and at least 10 sequences of VH's CDR3. 8 The library includes the sequence of VH's CDR1, the sequence of VH's CDR2, and the sequence of VH's CDR3. 7The sequence includes IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59 / 61. In some cases, VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, VH is IGHV1-69 and IGHV3-30. In some cases, VH is IGHV3-23.

[0098] In some embodiments, a library as described herein includes CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 of varying lengths. In some examples, the lengths of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acid lengths. For example, CDRH3 includes at least or about 12, 15, 16, 17, 20, 21, or 23 amino acid lengths. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include amino acid length ranges of approximately 1 to 10, 5 to 15, 10 to 20, or 15 to 30.

[0099] A library containing nucleic acids encoding antibodies having variant CDR sequences as described herein contains amino acids of varying lengths at translation. In some examples, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some examples, amino acid lengths are approximately 15–150, 20–145, 25–140, 30–135, 35–130, 40–125, 45–120, 50–115, 55–110, 60–110, 65–105, 70–100, or 75–95. In some examples, amino acid lengths are approximately 22 to 75 amino acids. In some examples, antibodies contain at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0100] The ratio of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 lengths may vary in the libraries described herein. In some examples, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 containing amino acid lengths of at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more constitute about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more than 90% of the library. For example, CDRH3 containing approximately 23 amino acids makes up 40% of the library, CDRH3 containing approximately 21 amino acids makes up 30%, CDRH3 containing approximately 17 amino acids makes up 20%, and CDRH3 containing approximately 12 amino acids makes up 10%. In some cases, CDRH3 containing approximately 20 amino acids makes up 40% of the library, CDRH3 containing approximately 16 amino acids makes up 30%, CDRH3 containing approximately 15 amino acids makes up 20%, and CDRH3 containing approximately 12 amino acids makes up 10%.

[0101] Libraries such as those described herein that encode VHH antibodies include at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes shuffled variant CDR sequences to generate a library with theoretical sequence diversity exceeding 10. In some examples, the library contains at least or about 10 7 , 10 8 , 109 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It has the ultimate library diversity of sequences exceeding [a certain value].

[0102] A library of adenosine A2B receptor-binding immunoglobulins is provided herein. In some examples, the adenosine A2B receptor immunoglobulin is an antibody. In some examples, the adenosine A2B receptor immunoglobulin is a VHH antibody. In some examples, the adenosine A2B receptor immunoglobulin has a binding affinity to the adenosine A2A receptor (e.g., K) of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. D ) includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 1 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 1.2 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 2 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 5 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 10 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 13.5 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 15 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 20 nM. DThis includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 25 nM. D This includes. In some cases, adenosine A2B receptor immunoglobulin has a K content of less than 30 nM. D Includes.

[0103] In some cases, adenosine A2B receptor immunoglobulin is an adenosine A2B receptor agonist. In some cases, adenosine A2B receptor immunoglobulin is an adenosine A2B receptor antagonist. In some cases, adenosine A2B receptor immunoglobulin is an adenosine A2B receptor allosteric modulator. In some cases, the allosteric modulator is a negative allosteric modulator. In some cases, the allosteric modulator is a positive allosteric modulator. In some cases, adenosine A2B receptor immunoglobulins produce agonist, antagonist, or allosteric effects at concentrations of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or above 1000 nM. In some cases, adenosine A2B receptor immunoglobulins are negative allosteric modulators. In some cases, adenosine A2B receptor immunoglobulin is a negative allosteric modulator at concentrations of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or above 100 nM. In some cases, adenosine A2B receptor immunoglobulin is a negative allosteric modulator at concentrations ranging from about 0.001 to about 100, 0.01 to about 90, about 0.1 to about 80, 1 to about 50, about 10 to about 40 nM, or about 1 to about 10 nM. In some cases, adenosine A2B receptor immunoglobulins contain an EC50 or IC50 greater than or equal to at least 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.06, 0.07, 0.08, 0.9, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or 6 nM.In some cases, adenosine A2B receptor immunoglobulins contain an EC50 or IC50 of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or greater than 100 nM.

[0104] Adenosine A2B receptor immunoglobulins as described herein may have improved properties. In some cases, the adenosine A2B receptor immunoglobulin is monomeric. In some cases, the adenosine A2B receptor immunoglobulin is less prone to aggregation. In some cases, at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the adenosine A2B receptor immunoglobulin is monomeric. In some cases, the adenosine A2B receptor immunoglobulin is thermally stable. In some cases, the adenosine A2B receptor immunoglobulin results in reduced nonspecific binding.

[0105] Following the synthesis of an adenosine A2B receptor-binding library containing nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain, the library can be used for screening and analysis. For example, the library may be assayed for library manifestability and panning. In some examples, manifestability is assayed using selectable tags. Exemplary tags include, but are not limited to, radiolabels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other labels or tags known in the art. In some examples, the tags may be histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. The adenosine A2B receptor-binding library may contain nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain with multiple tags, such as GFP, FLAG, Lucy, and DNA barcodes. In some examples, libraries are assayed by sequencing using a variety of methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electron sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.

[0106] Expression system

[0107] Libraries comprising nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domains, adenosine A2B receptor-binding domains, or combinations thereof are provided herein, and the libraries have improved specificity, stability, expression, folding, or downstream activity. In some examples, the libraries described herein are used for screening and analysis.

[0108] Libraries containing nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domain, adenosine A2B receptor-binding domain, or combinations thereof are provided herein, and the nucleic acid libraries are used for screening and analysis. In some examples, the screening and analysis include in vitro, in vivo, or ex vivo assays. Cells for screening include major cells obtained from living subjects or cell lines. Cells may be from prokaryotic cells (e.g., bacteria and fungi) and eukaryotic cells (e.g., plants and animals). Typical animal cells include, but are not limited to, those from mice, rabbits, primates, and insects. In some examples, cells for screening include, but are not limited to, cell lines such as Chinese hamster ovary (CHO) cell line, human embryonic kidney (HEK) cell line, or baby hamster kidney (BHK) cell line. In some examples, the nucleic acid libraries described herein may also be delivered to multicellular organisms. Typical multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0109] The nucleic acid libraries or the protein libraries encoded herein may be screened for a variety of pharmacological or pharmacokinetic properties. In some embodiments, the libraries are screened using in vitro assays, in vivo assays, or ex vivo assays. For example, in vitro pharmacological or pharmacokinetic properties to be screened include, but are not limited to, binding affinity, binding specificity, and binding avidity. Exemplary in vitro pharmacological or pharmacokinetic properties of the libraries described herein to be screened include, but are not limited to, therapeutic effect, activity, preclinical toxicity properties, clinical effect properties, clinical toxicity properties, immunogenicity, potency, and clinical safety properties.

[0110] The pharmacological or pharmacokinetic properties that can be screened include, but are not limited to, cell binding affinity and cell activity. For example, cell binding affinity assays or cell activity assays are performed to determine the agonist, antagonist, or allosteric effects of the libraries described herein. In some examples, the cell activity assay is a cAMP assay. In some examples, libraries such as those described herein are compared to the cell binding or cell activity of adenosine A2A receptor, adenosine A2B receptor, or both a ligand for the adenosine A2A receptor and the adenosine A2B receptor.

[0111] Libraries such as those described herein may be screened in cell-based assays or non-cell-based assays. Examples of non-cell-based assays include, but are not limited to, the use of viral particles, in vitro translational proteins, and proteoliposomes having adenosine A2A receptors, adenosine A2B receptors, or both adenosine A2A and adenosine A2B receptors.

[0112] Nucleic acid libraries as described herein may be screened by sequencing. In some cases, next-generation sequencing is used to determine sequence enrichment of adenosine A2A receptor-binding variants, adenosine A2B receptor-binding variants, or combinations thereof. In some cases, V gene distribution, J gene distribution, V gene family, CDR3 count per length, or combinations thereof are determined. In some cases, clone frequency, clone accumulation, lineage accumulation, or combinations thereof are determined. In some cases, the number of sequences, sequences with VH clones, clones, clones greater than 1, chronotypes, chronotypes greater than 1, lineages, Simpson, or combinations thereof are determined. In some cases, the proportion of non-identical CDR3s is determined. For example, the proportion of non-identical CDR3s is calculated by dividing the number of non-identical CDR3s in the sample by the total number of sequences in the sample that contained CDR3s.

[0113] Nucleic acid libraries are provided herein, and these nucleic acid libraries can be expressed in vectors. Expression vectors for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Typical expression vectors, but are not limited to, mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 Vector, pEF1a-tdTomato Vectors include pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; and yeast expression vectors: pTYB21 and pKLAC2; as well as insect vectors: pAc5.1 / V5-His A and pDEST8. In some examples, the vector is pcDNA3 or pcDNA3.1.

[0114] Nucleic acid libraries expressed in a vector to generate constructs comprising scaffolds containing sequences of adenosine A2A receptor-binding domains, adenosine A2B receptor-binding domains, or combinations thereof are described herein. In some examples, the size of the constructs varies. In some examples, the constructs contain at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases.In some examples, the structures are approximately 300-1,000, 300-2,000, 300-3,000, 300-4,000, 300-5,000, 300-6,000, 300-7,000, 300-8,000, 300-9,000, 300-10,000, 1,000-2,000, 1,000-3,000, 1,000-4,000, 1,000-5,000, and 1,000. ~6,000, 1,000~7,000, 1,000~8,000, 1,000~9,000, 1,000~10,000, 2,000~3,000, 2,000~, 4,000, 2,000~5,000, 2,000~6,000, 2,000~7,000, 2,000~8,000, 2,000~9,000, 2,000~10,000, 3,000~4,000, 3,000 0-5,000, 3,000-6,000, 3,000-7,000, 3,000-8,000, 3,000-9,000, 3,000-10,000, 4,000-5,000, 4,000-6,000, 4,000-7,000, 4,000-8,000, 4,000-9,000, 4,000-10,000, 5,000-6,000, 5,000-7,000, 5,0 This includes the ranges of bases 00-8,000, 5,000-9,000, 5,000-10,000, 6,000-7,000, 6,000-8,000, 6,000-9,000, 6,000-10,000, 7,000-8,000, 7,000-9,000, 7,000-10,000, 8,000-9,000, 8,000-10,000, or 9,000-10,000.

[0115] A library is provided herein comprising nucleic acids encoding scaffolds containing an adenosine A2A receptor-binding domain, an adenosine A2B receptor domain, or a combination thereof, wherein the nucleic acid library is expressed in cells. In some examples, the library is synthesized to express a reporter gene. Examples of reporter genes include, but are not limited to, acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta-galactosidase (LacZ), beta-glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), cerulean fluorescent protein, citrin fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopalin synthase (NOS), octopine synthase (OCS), luciferase, and their derivatives. Methods for determining the regulation of reporter genes are well known in the art and include, but are not limited to, fluorescence measurement methods (e.g., fluorescence spectroscopy, fluorescence-activated cell sorting (FACS), fluorescence microscopy) and antibiotic resistance measurements.

[0116] Diseases and Disabilities

[0117] A2A receptor-binding libraries are provided herein, comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain that may have therapeutic effects. Also provided herein are A2B receptor-binding libraries, comprising nucleic acids encoding a scaffold containing an adenosine A2B receptor-binding domain that may have therapeutic effects. In some cases, the adenosine A2A receptor-binding libraries and adenosine A2B receptor libraries yield, at translation, proteins used to treat a disease or disorder. In some cases, the proteins are immunoglobulins. In some cases, the proteins are peptide mimes. Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or disorders, metabolic diseases or disorders, cardiovascular diseases or disorders, respiratory diseases or disorders, pain, gastrointestinal diseases or disorders, reproductive diseases or disorders, endocrine diseases or disorders, or neurological diseases or disorders. In some cases, inhibitors of adenosine A2A receptors, adenosine A2B receptors, or combinations thereof, as described herein, are used to treat diseases or disorders of the central nervous system, kidneys, intestines, lungs, hair, skin, bones, or cartilage. In some cases, inhibitors of adenosine A2A receptors, adenosine A2B receptors, or combinations thereof, as described herein, are used to regulate sleep, promote angiogenesis, or modulate the immune system.

[0118] In some cases, the A2AR immunoglobulin, A2BR immunoglobulin, or combination thereof described herein is used to treat a disorder or illness of the nervous system. In some cases, the disorder or illness of the nervous system is a neurodegenerative disorder. In some cases, the disorder or illness of the nervous system is Parkinson's disease, Alzheimer's disease, or multiple sclerosis.

[0119] In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein are used to treat cancer. In some cases, the cancer is a solid tumor or a hematological cancer. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein are used as monotherapy for cancer treatment. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein are used in combination with other therapeutic agents for cancer treatment. In some embodiments, the cancer is lung cancer, colorectal cancer, or prostate cancer. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein enhance tumor vaccines, checkpoint blockades, and adoptive T-cell therapies. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof target immune cells and block immunosuppression to treat cancer.

[0120] In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein reduce tumor size by at least or more than 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95% compared to a comparator antibody (e.g., pembrolizumab or nivolumab) or a control. In some cases, the control group is either untreated or given a placebo.

[0121] In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase the number of cells in lymphoid or myeloid compartments. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase tumor-infiltrating lymphocytes (TILs) CD45+ cells, total T cells, CD4+ cells, CD8+ cells, regulatory T cells (Tregs), M1 tumor-associated macrophages (TAMs), or combinations thereof by at least or about 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase tumor-infiltrating lymphocytes (TILs) CD45+ cells, total T cells, CD4+ cells, CD8+ cells, regulatory T cells (Tregs), M1 tumor-associated macrophages (TAMs), or combinations thereof by at least or about 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95% compared to a comparator antibody (e.g., pembrolizumab or nivolumab) or a control. In some cases, the control is untreated or placebo.

[0122] In some examples, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase cytokine expression. In some embodiments, the cytokines are interferon-γ, interleukin-2, interleukin-4, interleukin-6, interleukin-8, interleukin-10, or TNFα. In some embodiments, the cytokines are interleukin-1β, interleukin-1Rα, GM-CSF, interleukin-2, interleukin-7, interleukin-15, interleukin-6, interleukin-6, interleukin-10, interferon-γ, or TNFα. In some examples, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase cytokine expression by at least or about 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%. In some cases, the A2AR immunoglobulins, A2BR immunoglobulins, or combinations thereof described herein increase cytokine expression by at least or about 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95% compared to a comparator antibody (e.g., pembrolizumab or nivolumab) or a control. In some cases, the control is untreated or placebo.

[0123] In some cases, the subject is a mammal. In some cases, the subject is a mouse, rabbit, dog, or human. The subject treated by the methods described herein may be an infant, an adult, or a child. Pharmaceutical compositions comprising antibodies or antibody fragments as described herein may be administered intravenously or subcutaneously.

[0124] Variant Library

[0125] Codon Variations

[0126] The variant nucleic acid libraries described herein may contain multiple nucleic acids, each encoding a variant codon sequence compared to a reference nucleic acid sequence. In some examples, each nucleic acid in the first nucleic acid population contains a variant at a single variant site. In some examples, the first nucleic acid population contains multiple variants at a single variant site, such that the same variant site contains more than one variant. The first nucleic acid population may contain nucleic acids that collectively encode multiple codon variants at the same variant site. The first nucleic acid population may contain nucleic acids that collectively encode up to 19 or more codons at the same location. The first nucleic acid population may contain nucleic acids that collectively encode up to 60 variant triplets at the same location, or the first nucleic acid population may contain nucleic acids that collectively encode up to 61 different codon triplets at the same location. Each variant may encode a codon that results in a different amino acid during translation. Table 2 provides a list of possible codons (and representative amino acids) for different sites.

[0127] [Table 2-1]

[0128] [Table 2-2]

[0129] A nucleic acid population may contain diverse nucleic acids that collectively encode up to 20 codon variations at multiple positions. In such cases, each nucleic acid in the population contains codon variations at more than one position within the same nucleic acid. In some examples, each nucleic acid in the population contains codon variations at codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more within a single nucleic acid. In some examples, each variant's long nucleic acid contains codon variations at codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more within a single long nucleic acid. In some examples, a variant nucleic acid population contains codon variations in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons within a single nucleic acid. In some examples, a variant nucleic acid population contains codon variations in at least approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons within a single nucleic acid.

[0130] Highly parallel nucleic acid synthesis

[0131] To create an innovative synthesis platform, a platform approach is provided herein that leverages miniaturization, parallelization, and vertical integration of an end-to-end process from polynucleotide synthesis to gene assembly within nanowells on silicon. The devices described herein provide a silicon synthesis platform that, with the same footprint as a 96-well plate, can increase throughput by up to 1,000 times or more compared to conventional synthesis methods, producing up to approximately 1,000,000 or more polynucleotides, or 10,000 or more genes, in a single highly parallelized run.

[0132] With the advent of next-generation sequencing, high-resolution genomic data has become a crucial factor in research that deeply explores the biological roles of various genes in both normal ecology and pathogenesis. At the heart of this research are the central dogma of molecular biology and the concept of "residue-to-residue transfer of sequence information." Genomic information encoded in DNA is transcribed into messages, which are then translated into proteins—active products within specific biological pathways.

[0133] Another exciting area of ​​research concerns the discovery, development, and manufacture of therapeutic molecules focused on highly specific cellular targets. Highly diverse DNA sequence libraries are central to the development pipeline for targeted therapies. Gene variants are used to express proteins in the protein engineering cycle for design, structure, and testing, ideally becoming genes optimized for high expression of proteins with high affinity to therapeutic targets. Consider the receptor binding pocket as an example. The ability to simultaneously test all sequence rearrangements of all residues within the binding pocket allows for thorough examination, increasing the chances of success. Saturated mutagenesis, in which researchers attempt to induce any possible mutation at a specific site within the receptor, represents one approach to this development challenge. Although expensive, time-consuming, and labor-intensive, it allows for the introduction of each variant to each location. In contrast, combinatorial mutagenesis, where a small number of selected sites or short extensions of DNA can be extensively modified, generates an incomplete repertoire of variants with biased representation.

[0134] To accelerate the drug development pipeline, a library containing desired variants available at the intended frequency and in the correct location for testing—in other words, a precision library—can reduce screening time in addition to lowering costs. A method for synthesizing nucleic acid synthetic variant libraries that result in the precise introduction of each intended variant at the desired frequency is provided herein. For end-users, this translates to the ability to not only thoroughly sample sequence space but also to test these hypotheses in an efficient manner, reducing costs and screening time. Whole-genome editing can elucidate libraries in which key pathways, each variant, and sequence rearrangement can be tested for optimal functionality, thousands of genes can be used to reconstruct the entire pathway, and the genome can be used to redesign the biological system for drug discovery.

[0135] In the first embodiment, the drug itself can be optimized using the methods described herein. For example, to improve a specified function of an antibody, a variant polynucleotide library encoding a portion of the antibody is designed and synthesized. Subsequently, the variant nucleic acid library for the antibody can be produced by the processes described herein (e.g., PCR mutagenesis and subsequent insertion into a vector). The antibody is then expressed in a production cell line and screened for enhancement of activity. Examples of screening include examining binding affinity to an antigen, stability, or modulation of effector function (e.g., ADCC, complement, or apoptosis). Typical regions for antibody optimization include the Fc region, Fab region, variable region of the Fab region, constant region of the Fab region, and variable domains (V) of the heavy or light chain. H or V L ), and V H or V L Examples include, but are not limited to, specific complementarity-determining regions (CDRs).

[0136] Nucleic acid libraries synthesized by the methods described herein can be expressed in a variety of cells associated with disease conditions. These disease-associated cells include cell lines from a subject, tissue samples, primary cells, cultured cells grown from a subject, or cells in model systems. Typical model systems include, but are not limited to, plant and animal models of disease conditions.

[0137] To identify variant molecules associated with the prevention, reduction, or treatment of a disease state, the variant nucleic acid libraries described herein are expressed in cells associated with the disease state or in cells that can be induced to induce the disease state. In some cases, drugs are used to induce the disease state in cells. Typical tools for inducing a disease state include, but are not limited to, Cre / Lox recombinant systems, LPS pro-inflammatory agents, and streptozotocin to induce hypoglycemia. Cells associated with a disease state may be cells from model systems or cultured cells, and cells from subjects with a specific disease state. Typical diseases include bacterial, fungal, viral, autoimmune, or proliferative disorders (e.g., cancer). In some cases, the variant nucleic acid libraries are expressed in model systems, cell lines, or primary cells derived from subjects and screened for changes in at least one cellular activity. Typical cellular activities include, but are not limited to, proliferation, cycle progression, cell death, adhesion, migration, reproduction, cell signaling, energy production, oxygen utilization, metabolic activity, and aging, response to free radical damage, or any combination thereof.

[0138] substrate

[0139] The devices used as surfaces for polynucleotide synthesis may be, but are not limited to, in the form of substrates including homogeneous array surfaces, patterned array surfaces, channels, beads, gels, etc. Substrates comprising multiple clusters are provided herein, where each cluster comprises multiple sites supporting the attachment and synthesis of polynucleotides. In some examples, the substrate comprises a homogeneous array surface. For example, a homogeneous array surface is a homogeneous plate. The term “site” as used herein refers to a discrete structural region that provides support for a polynucleotide encoding a single predetermined sequence to extend from the surface. In some examples, the sites are on a two-dimensional surface, e.g., a substantially flat surface. In some examples, the sites are on a three-dimensional surface, e.g., a well, microwell, channel, or post. In some examples, the surface of a site contains a substance that is actively functionalized to bind at least one nucleotide for polynucleotide synthesis, or preferably, a population of identical nucleotides for the synthesis of a population of polynucleotides. In some examples, polynucleotide refers to a population of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate encompasses one or more surfaces of the substrate. The average error rates for polynucleotides synthesized in the libraries described herein using the provided systems and methods are often less than 1 / 1000, less than 1 / 2000, and less than 1 / 3000, without error correction.

[0140] A surface supporting the parallel synthesis of multiple polynucleotides having different predetermined sequences at addressable positions on a common support is provided herein. In some examples, the substrates are 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1, It provides support for the synthesis of non-identical polynucleotides exceeding 000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more. In some cases, the surface codes for different sequences: 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 90 It provides support for the synthesis of polynucleotides of 0,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more. In some examples, at least a portion of the polynucleotides have the same sequence or are configured to be synthesized with the same sequence. In some examples, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more bases.

[0141] Methods for polynucleotide synthesis on separate sites of a substrate are provided herein, each site supporting the synthesis of a population of polynucleotides. In some cases, each site supports the synthesis of a population of polynucleotides having a different sequence from the population of polynucleotides grown on the other site. In some examples, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9, or more overlaps across different sites within the same cluster of sites on the surface for polynucleotide synthesis. In some examples, the substrate sites are located within multiple clusters. In some examples, the substrate includes at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000, or more clusters. In some examples, the substrates are 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2,000,0 This includes 00, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, or 10,000,000 or more separate locations. In some examples, the substrate contains approximately 10,000 separate locations. The number of locations within a single cluster varies in different examples. In some cases, each cluster may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, or more locations.In some examples, each cluster contains approximately 50–500 locations. In some examples, each cluster contains approximately 100–200 locations. In some examples, each cluster contains approximately 100–150 locations. In some examples, each cluster contains approximately 109, 121, 130, or 137 locations. In some examples, each cluster contains approximately 19, 20, 61, 64, or more locations. Alternatively or in combination, polynucleotide synthesis occurs on a homogeneous array surface.

[0142] In some examples, the number of separate polynucleotides synthesized on the substrate depends on the number of separate locations available in the substrate. In some examples, the density of locations within a substrate cluster or on the surface is 1 mm 2 The locations are at least or approximately 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000, or more per unit area. In some cases, the substrate is 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm. 2 This includes: In some examples, the distance between the centers of two adjacent locations within a cluster or on a surface is approximately 100–500, approximately 10–200, or approximately 10–100 μm. In some examples, the distance between the centers of two adjacent locations is greater than approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some examples, the distance between the centers of two adjacent locations is less than approximately 200, 150, 100, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some examples, each location has a width of approximately 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, each location has a width of approximately 0.5–100, 0.5–50, 10–75, or 0.5–50 μm.

[0143] In some examples, the density of clusters within the substrate is 100 mm 2 At least or approximately one cluster per 10mm cluster.2 At least or approximately 1 cluster per 5mm cluster 2 At least or approximately 1 cluster per 4mm cluster 2 At least or approximately 1 cluster per 3mm cluster 2 At least or approximately 1 cluster, 2 mm per cluster. 2 At least or approximately 1 cluster per 1 mm 2 At least or approximately 1 cluster per 1 mm 2 At least or approximately 2 clusters per 1 mm 2 At least or approximately 3 clusters per 1 mm 2 At least or approximately 4 clusters per 1 mm 2 At least or approximately 5 clusters per 1 mm 2 At least or approximately 10 clusters per 1 mm 2 There are 50 clusters or more per unit. In some examples, the substrate is 10 mm 2 Approximately 1 cluster to 1 mm per cluster 2Each cluster contains approximately 10 clusters. In some examples, the distance between the centers of two adjacent clusters is at least or approximately 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is between approximately 50–100, 50–200, 50–300, 50–500, and 100–2000 μm. In some cases, the distance between the centers of two adjacent clusters is between approximately 0.05–50, 0.05–10, 0.05–5, 0.05–4, 0.05–3, 0.05–2, 0.1–10, 0.2–10, 0.3–10, 0.4–10, 0.5–10, 0.5–5, or 0.5–2 mm. In some cases, each cluster has a cross-section of approximately 0.5 to 2 mm, approximately 0.5 to 1 mm, or approximately 1 to 2 mm. In some cases, each cluster has a cross-section of approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some cases, each cluster has an internal cross-section of approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0144] In some cases, the substrate is approximately the size of a standard 96-well plate, for example, about 100-200 mm x 50-150 mm. In some cases, the substrate has a diameter of approximately 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm or less. In some cases, the substrate diameter is between approximately 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some cases, the substrate has a diameter of at least approximately 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, or 50,000 mm. 2 It has a planar surface area of ​​50-2000 mm or more. In some examples, the thickness of the substrate is between approximately 50-2000 mm, 50-1000 mm, 100-1000 mm, 200-1000 mm, or 250-1000 mm.

[0145] surface material

[0146] The substrates, devices, and reactors provided herein are fabricated from any variety of materials suitable for the methods, compositions, and systems described herein. In certain examples, the substrate material is fabricated to exhibit low levels of nucleotide bonding. In some examples, the substrate material is modified to produce separate surfaces exhibiting high levels of nucleotide bonding. In some examples, the substrate material is transparent to visible and / or UV light. In some examples, the substrate material is sufficiently conductive, for example, to form a uniform electric field across all or part of the substrate. In some examples, the conductive material is connected to electric ground. In some examples, the substrate is thermally conductive or insulated. In some examples, the material is chemically and heat-resistant to support chemical or biochemical reactions, for example, polynucleotide synthesis reaction processes. In some examples, the substrate includes flexible materials. Flexible materials may include, but are not limited to, modified and unmodified nylon, nitrocellulose, and polypropylene. In some examples, the substrate includes rigid materials. Rigid materials may include, but are not limited to, glass, quartz glass (fuse silica), silicon, plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and mixtures thereof), and metals (e.g., gold, platinum). The substrate, solid support, or reactor may be manufactured from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic acid polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. The substrate / solid support or its microstructure, the reactor may be manufactured from a combination of the materials listed herein, or from any other suitable material known in the art.

[0147] surface structure

[0148] Substrates for the methods, compositions, and systems described herein are provided herein, and the substrates have a surface structure suitable for the methods, compositions, and systems described herein. In some examples, the substrate includes raised and / or recessed features. One advantage of having such features is the increased surface area that supports polynucleotide synthesis. In some examples, substrates having raised and / or recessed features are called three-dimensional substrates. In some cases, the three-dimensional substrate includes one or more channels. In some cases, one or more locations include channels. In some cases, the channels are available for the deposition of reagents by deposition devices such as material deposition devices. In some cases, reagents and / or fluids accumulate in larger wells through fluid communication with one or more channels. For example, the substrate includes multiple channels corresponding to clusters and multiple locations, and the multiple channels are in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized at multiple locations of the cluster.

[0149] Substrates for the methods, compositions, and systems described herein are provided herein, and the substrates are configured for polynucleotide synthesis. In some examples, the structure is configured to allow control of flow and mass transfer pathways with respect to polynucleotide synthesis on a surface. In some examples, the substrate configuration allows control of mass transfer pathways, chemical exposure time, and / or washing effect during polynucleotide synthesis, as well as their uniform distribution. In some examples, the substrate configuration allows for increased efficiency by providing sufficient volume for polynucleotide growth such that the volume excluded by the growing polynucleotide does not occupy more than, for example, 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% of the initially available volume available or suitable for polynucleotide growth. In some examples, the three-dimensional structure allows for control of fluid flow to enable rapid exchange of chemical exposure.

[0150] Substrates for the methods, compositions, and systems described herein are provided herein, and the substrates encompass structures suitable for the methods, compositions, and systems described herein. In some examples, separation is achieved by physical structure. In some examples, separation is achieved by differential functionalization of the surface, which generates active and passive regions for polynucleotide synthesis. In some examples, differential functionalization is achieved by altering the hydrophobicity across the substrate surface, thereby creating the effect of a water contact angle that causes deposited reagents to bead together or become wet. By utilizing larger structures, splashing and cross-contamination of separate polynucleotide synthesis sites by reagents from adjacent spots can be reduced. In some cases, devices such as material deposition devices are used to deposit reagents at separate polynucleotide synthesis sites. Substrates with three-dimensional features are constructed in a way that enables the synthesis of a large number of polynucleotides (e.g., more than approximately 10,000) with a low error rate (e.g., less than approximately 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some examples, the substrate is 1 mm 2 Each feature contains approximately 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 or more features.

[0151] Wells of the substrate may have the same or different width, height, and / or volume as other wells of the substrate. Channels of the substrate may have the same or different width, height, and / or volume as other channels of the substrate. In some examples, the diameter of the clusters or the diameter of the wells containing the clusters, or both, are between approximately 0.05–50, 0.05–10, 0.05–5, 0.05–4, 0.05–3, 0.05–2, 0.05–1, 0.05–0.5, 0.05–0.1, 0.1–10, 0.2–10, 0.3–10, 0.4–10, 0.5–10, 0.5–5, or 0.5–2 mm. In some examples, the diameter of the cluster or well, or both, is approximately 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm or less. In some examples, the diameter of the cluster or well, or both, is between approximately 1.0 and 1.3 mm. In some examples, the diameter of the cluster or well, or both, is approximately 1.150 mm. In some examples, the diameter of the cluster or well, or both, is approximately 0.08 mm. The cluster diameter refers to the cluster within a two-dimensional or three-dimensional substrate.

[0152] In some examples, well heights are approximately 20–1000, 50–1000, 100–1000, 200–1000, 300–1000, 400–1000, or 500–1000 μm. In some cases, well heights are approximately 1000, 900, 800, 700, or less than 600 μm.

[0153] In some examples, the substrate contains multiple channels corresponding to multiple locations within the cluster, where the channel height or depth is 5–500, 5–400, 5–300, 5–200, 5–100, 5–50, or 10–50 μm. In some cases, the channel height is less than 100, 80, 60, 40, or 20 μm.

[0154] In some examples, the diameters of channels, locations (e.g., in a substantially planar substrate), or both channels and locations (e.g., in a three-dimensional substrate where a location corresponds to a channel) are approximately 1–1000, 1–500, 1–200, 1–100, 5–100, or 10–100 μm, e.g., approximately 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some examples, the diameters of channels, locations, or both channels and locations are approximately 100, 90, 80, 70, 60, 50, 40, 30, 20, or less than 10 μm. In some examples, the distance between the centers of two adjacent channels, locations, or channels and locations is approximately 1–500, 1–200, 1–100, 5–200, 5–100, 5–50, or 5–30, e.g., approximately 20 μm.

[0155] surface modification

[0156] Methods for the synthesis of polynucleotides on a surface are provided herein, the surface including various surface modifications. In some examples, surface modification is utilized for chemical and / or physical modification of a surface by additive or subtractive processes to alter one or more chemical and / or physical properties of the substrate surface, or of selected sites or regions of the substrate surface. For example, surface modification includes, but is not limited to, (1) altering the wettability of the surface; (2) functionalizing the surface, i.e., providing, modifying, or substituting surface functional groups; (3) defunctionalizing the surface, i.e., removing surface functional groups; (4) altering the chemical composition of the surface, otherwise, for example, by etching; (5) increasing or decreasing surface roughness; (6) providing a coating on the surface, e.g., a coating exhibiting a different wettability from the surface; and / or (7) depositing particles on the surface.

[0157] In some cases, the addition of a top layer of chemical material (called an adhesion promoter) to the surface facilitates the structured patterning of locations on the substrate surface. Typical surfaces to which adhesion promoters are applied include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some examples, a second chemical layer is deposited on the substrate surface. In some cases, the second chemical layer has low surface energy. In some cases, the surface energy of the chemical layer coated on the surface supports the localization of droplets on the surface. The area of ​​fluid contact at locations and / or locations can be modified by the selected patterning arrangement.

[0158] In some examples, for instance, for polynucleotide synthesis, the substrate surface or degraded area on which nucleic acids or other parts are deposited may be smooth or substantially planar (e.g., two-dimensional), or have irregularities such as raised or recessed features (e.g., three-dimensional features). In some examples, the substrate surface is modified with one or more different layers of compounds. Such modifying layers in question may include, but are not limited to, inorganic and organic layers such as metals, metal oxides, polymers, and small organic molecules.

[0159] In some examples, the degraded sites of a substrate are functionalized with one or more moieties that increase and / or decrease the surface energy. In some cases, the moieties are chemically inert. In some cases, the moieties are configured to support one or more processes in a desired chemical reaction, e.g., polynucleotide synthesis. The surface energy, i.e., hydrophobicity, of the surface is a factor for determining the affinity of nucleotides bound to the surface. In some examples, methods for functionalizing a substrate include (a) providing a substrate having a surface containing silicon dioxide, and (b) silane-treating the surface using a suitable silanizing agent described herein or otherwise known in the art, e.g., an organofunctionalized alkoxysilane molecule. The methods and functionalizing agents are described in U.S. Patent No. 5,474,796, which is incorporated herein by reference in whole.

[0160] In some cases, the substrate surface is functionalized by contact with a derivatization composition containing a mixture of silanes under reaction conditions effective for linking silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface. Silane treatment generally involves coating the surface with organofunctionalized alkoxysilane molecules via self-assembly. As is currently known in the art, various siloxanes can also be used as functionalizing reagents, for example, to decrease or increase the surface energy. Organofunctionalized alkoxysilanes are classified according to their organofunctional groups.

[0161] Polynucleotide synthesis

[0162] The methods of polynucleotide synthesis according to this disclosure may include processes involving phosphoramidite chemistry. In some examples, polynucleotide synthesis includes binding a base to a phosphoramidite. Polynucleotide synthesis may also include binding a base by depositing a phosphoramidite under binding conditions, and the same base may optionally be deposited with the phosphoramidite more than once, i.e., in a double bond. Polynucleotide synthesis may include capping of unreacted sites. In some examples, capping is optional. Polynucleotide synthesis may include oxidation, or one oxidation step, or multiple oxidation steps. Polynucleotide synthesis may include deblocking, detritylation, and sulfidation. In some examples, polynucleotide synthesis includes either oxidation or sulfidation. In some examples, during one or between steps in the polynucleotide synthesis reaction, the device is washed with, for example, tetrazole or acetonitrile. The time frame for any single step in the phosphoramidite synthesis method may be approximately 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds, and less than 10 seconds.

[0163] Polynucleotide synthesis using the phosphoramidite method may involve the subsequent addition of phosphoramidite building blocks (e.g., nucleoside phosphoramidites) to a growing polynucleotide chain for the formation of phosphite triester bonds. Phosphoramidite polynucleotide synthesis proceeds from the 3' direction to the 5' direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthetic cycle. In some examples, each synthetic cycle includes a binding step. Phosphoramidite binding involves the formation of a phosphite triester bond between an activated nucleoside phosphoramidite and a nucleoside bound to a substrate, for example, via a linker. In some examples, the nucleoside phosphoramidite is supplied to an activated device. In some examples, the nucleoside phosphoramidite is supplied to the device along with an activator. In some examples, the nucleoside phosphoramidite is supplied to the device in an excess amount of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 times, or more, compared to the nucleoside bound to the substrate. In some examples, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment, for example, in anhydrous acetonitrile. After the addition of the nucleoside phosphoramidite, the device is optionally washed. In some examples, the binding step is optionally repeated with one or more additions, along with a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some examples, the polynucleotide synthesis method used herein includes one, two, three, or more consecutive binding steps. Before bonding, the nucleoside bonded to the device is often deprotected by the removal of a protecting group, which functions to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).

[0164] After binding, the phosphoramidite polynucleotide synthesis method optionally includes a capping step. In the capping step, the growing polynucleotide is treated with a capping agent. The capping step is useful for blocking the 5'-OH group bound to the unreacted substrate after binding from further chain elongation, thereby preventing the formation of polynucleotides with internal base deletions. Furthermore, phosphoramidites activated with 1H-tetrazole can react to the O6 position of guanosine to a limited extent. Without being bound by theory, this byproduct may also undergo depurination by oxidation with I2 / water, possibly via O6-N7 migration. The depurination site is eventually cleaved during the final deprotection of the polynucleotide, thus reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping reagent before oxidation with I2 / water. In some examples, including a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. As an example, the capping step involves treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. After the capping step, the device is optionally washed.

[0165] In some cases, the growing nucleic acids bound to the device are oxidized after the addition of nucleoside phosphoramidite and, optionally, after capping and one or more washing steps. The oxidation step involves oxidizing the phosphite triester to tetracoordinate phosphate triester, which is a protected precursor of the spontaneously occurring phosphate diester nucleoside bond. In some cases, the oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, colidine). Oxidation can be carried out under anhydrous conditions using, for example, tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, the capping step is performed after oxidation. The second capping step allows for drying of the device because residual water from potentially persistent oxidation can inhibit subsequent binding. After oxidation, the device and the growing polynucleotide are optionally washed. In some examples, the oxidation step is replaced with a sulfurization step to obtain polynucleotide phosphorothioates, where any capping step can be performed after sulfurization. Many reagents, including but not limited to 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide (also known as Beaucage's reagent), and N,N,N'N'-tetraethylthiuram disulfide (TETD), can perform efficient sulfur transfer.

[0166] To allow the subsequent cycle of nucleoside incorporation to occur via binding, the protected 5' end of the growing polynucleotide bound to the device is removed, resulting in the primary hydroxyl group reacting with the next nucleoside phosphoramidite. In some examples, the protecting group is DMT, and deblocking occurs with trichloroacetic acid in dichloromethane. Prolonged or more potent detritylation than the recommended acid solution can increase the depurination of the polynucleotide bound to the solid support, thus reducing the yield of the desired full-length product. The methods and compositions of this disclosure described herein provide controlled deblocking conditions that limit undesirable depurination reactions. In some examples, the polynucleotide bound to the device is washed after deblocking. In some examples, efficient washing after deblocking contributes to synthesized polynucleotides with a low error rate.

[0167] Methods for the synthesis of polynucleotides typically involve a series of iterating steps: application of a protected monomer to an actively functionalized surface (e.g., a locus) for binding to an activated surface, linker, or previously deprotected monomer; deprotection of the applied monomer so as to react with a subsequently applied protected monomer; and application of another protected monomer for binding. One or more intermediate steps involve oxidation or sulfurization. In some examples, one or more washing steps precede or follow one or all of the steps.

[0168] Methods for the synthesis of phosphoramidite-based polynucleotides involve a series of chemical steps. In some examples, one or more steps of the synthesis method involve the cycling of reagents, where one or more steps of the method involve the application of reagents useful for the process to a device. For example, the reagents are circulated by a series of liquid deposition and vacuum drying steps. For substrates containing three-dimensional features such as wells, microwells, and channels, the reagents optionally pass through one or more regions of the device via wells and / or channels.

[0169] The methods and systems described herein relate to polynucleotide synthesis devices for the synthesis of polynucleotides. Synthesis can be carried out in parallel. For example, at least or approximately at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000, or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel may be between 2–100,000, 3–50,000, 4–10,000, 5–1,000, 6–900, 7–850, 8–800, 9–750, 10–700, 11–650, 12–600, 13–550, 14–500, 15–450, 16–400, 17–350, 18–300, 19–250, 20–200, 21–150, 22–100, 23–50, 24–45, 25–40, and 30–35. Those skilled in the art will recognize that the total number of polynucleotides synthesized in parallel may fall within any range (e.g., 25–100) constrained by any of these values. The total number of polynucleotides synthesized in parallel may fall within any range defined by any of the values ​​that act as the endpoints of the range. The total molar mass of polynucleotides synthesized within the device, or the molar mass of each polynucleotide, may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles, or more. The length of each polynucleotide within the device, or the average length of polynucleotides, may be at least or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.The length of each polynucleotide in the device, or the average length of the polynucleotides, may be at most or at most about 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each polynucleotide in the device, or the average length of the polynucleotides, may fall between 10 and 500, 9 and 400, 11 and 300, 12 and 200, 13 and 150, 14 and 100, 15 and 50, 16 and 45, 17 and 40, 18 and 35, and 19 and 25. A person skilled in the art will recognize that the length of each polynucleotide in the device, or the average length of the polynucleotides, may fall within any range (e.g., 100 and 300) constrained by any of these values. The length of each polynucleotide within the device, or the average length of the polynucleotides, may fall within any range defined by any value that acts as the range endpoint.

[0170] The methods for surface-based polynucleotide synthesis provided herein enable rapid synthesis. For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides or more are synthesized per hour. The nucleotides include building blocks of adenine, guanine, thymine, cytosine, uridine, or their analogs / modified versions. In some examples, libraries of polynucleotides are synthesized in parallel on the substrate. For example, a device containing approximately or at least approximately 100, 1,000, 10,000, 30,000, 75,000, 100,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, or 5,000,000 degraded sites can support the synthesis of at least the same number of distinct polynucleotides, where the polynucleotides encoding distinct sequences are synthesized at the degraded sites. In some examples, libraries of polynucleotides are synthesized on the device in approximately 3 months, 2 months, 1 month, 3 weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or less than 24 hours with the low error rates described herein. In some examples, large nucleic acids assembled from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein can be prepared in approximately 3 months, 2 months, 1 month, 3 weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, and less than 24 hours.

[0171] In some examples, the methods described herein provide the generation of a library of nucleic acids containing variant nucleic acids that differ at multiple codon sites. In some examples, the nucleic acids may have one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, sixteen, sixteen, eighteen, eighteen, nineteen, twenty, thirty, forty, fifteen, fifteen, or more variant codon sites.

[0172] In some cases, one or more variant codon sites may be adjacent. In some cases, one or more variant codon sites may not be adjacent, and may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.

[0173] In some cases, nucleic acids may contain multiple variant codon sites, where all variant codon sites are adjacent to each other and form a continuous variant codon site. In some cases, nucleic acids may contain multiple variant codon sites, where the variant codon sites are not adjacent to each other. In some cases, nucleic acids may contain multiple variant codon sites, where some variant codon sites are adjacent to each other and form a continuous variant codon site, while some variant codon sites are not adjacent to each other.

[0174] Referring to the diagram, Figure 3 shows an exemplary process workflow for the synthesis of nucleic acids (e.g., genes) from shorter nucleic acids. The workflow is typically divided into the following stages: (1) de novo synthesis of a single-stranded nucleic acid library, (2) binding of nucleic acids to form a larger fragment, (3) error correction, (4) quality control, and (5) transport. Prior to de novo synthesis, the intended nucleic acid sequence or group of nucleic acid sequences is pre-selected. For example, a group of genes is pre-selected for production.

[0175] Once a larger nucleic acid is selected for synthesis, a predetermined library of nucleic acids is designed for de novo synthesis. Various suitable methods are known for generating high-density polynucleotide arrays. In the example workflow, a surface of a device is provided. In this example, the surface chemistry is modified to improve the polynucleotide synthesis process. Low surface energy regions are generated to repel liquids, while high surface energy regions are generated to attract liquids. The surface itself may be in the form of a flat surface, or it may include morphological modifications such as protrusions or microwells that increase the surface area. In the example workflow, as disclosed in whole in International Patent Application No. 2015 / 021080, incorporated herein by reference, the selected high surface energy molecules perform a dual function to support the chemistry of the DNA.

[0176] In-situ preparations of polynucleotide arrays are generated on a solid support and utilize a single nucleotide elongation process to elongate multiple oligomers in parallel. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner such that multiple polynucleotides elongate one residue at a time in parallel, thereby generating oligomers with predetermined nucleic acid sequences (302). In some examples, the polynucleotides are cleaved from the surface at this stage. Cleavage includes, for example, gas cleavage with ammonia or methylamine.

[0177] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also referred to as a “nanoractor”) is a silicon-coated well containing PCR reagents, which are lowered over the polynucleotide library (303). Before or after sealing the polynucleotides (304), reagents are added to release the polynucleotides from the substrate. In this exemplary workflow, the polynucleotides are released after sealing the nanoreactor (305). Once released, the single-stranded polynucleotide fragments hybridize to span the full-length range of DNA sequences. Partial hybridization (305) is possible because each synthesized polynucleotide is designed to have a small portion that overlaps with at least one other polynucleotide in the pool.

[0178] Following hybridization, the PCA reaction begins. During the polymerase cycle, polynucleotides are annealed to complementary fragments, and gaps are filled by polymerase. Each cycle increases the length of various fragments, depending randomly on which polynucleotides are found together. The complementarity between fragments allows for the formation of complete, large-span double-stranded DNA (306).

[0179] After PCA is complete, the nanoreactor is separated from the device (307) and positioned for interaction with the device equipped with primers for PCR (308). After sealing, the nanoreactor is subjected to PCR (309) to amplify larger nucleic acids. Following PCR (310), the nanochamber is opened (311), error correction reagent is added (312), the chamber is sealed (313), and the error correction reaction takes place to remove poorly complementar mismatched base pairs and / or strands from the double-stranded PCR amplification product (314). The nanoreactor is opened and separated (315). The error-corrected product is then subjected to additional processing steps such as PCR and molecular barcoding, and then packaged for transport (323) (322).

[0180] In some cases, quality control measures are taken. After error correction, the quality control process includes, for example, interacting with a wafer having sequencing primers for amplification of the error-corrected product (316), sealing the wafer in a chamber containing the error-corrected amplified product (317), and performing an additional round of amplification (318). The nanoreactor is opened (319), the product is pooled (320), and sequenced (321). After an acceptable quality control decision is made, the packaged product (322) is authorized for transport (323).

[0181] In some examples, nucleic acids generated by workflows such as those shown in Figure 3 are subjected to mutagenesis using duplicate primers disclosed herein. In some examples, the primer library is generated by in-situ preparation on a solid support and utilizes a single nucleotide elongation process to elongate multiple oligomers in parallel. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner such that multiple polynucleotides elongate one residue at a time in parallel, thereby generating oligomers with predetermined nucleic acid sequences (302).

[0182] Computer system

[0183] Any system described herein may be operably connected to a computer and may be operated locally or remotely via the computer. In various examples, the methods and systems of this disclosure may further include software programs on a computer system and their use. Thus, computer control for the synchronization of distribution / decompression / refilling functions, such as organizing and synchronizing the operation, distribution act, and decompression operation of a material deposition device, is within the scope of this disclosure. The computer system is programmed to interfere between a user-specified base sequence and the position of the material deposition device in order to deliver the correct reagent to a specified area of ​​the substrate.

[0184] The computer system (400) shown in Figure 4 can be understood as a logic device capable of reading instructions from a medium (411) and / or a network port (405) (which may optionally be connected to a server (409) having a fixed medium (412)). A system such as that shown in Figure 4 may include an optional CPU (401), a disk drive (403), an optional input device such as a keyboard (415) and / or a mouse (416), and an optional monitor (407). Data communication may be achieved to a server at a local or remote location via the indicated communication medium. The communication medium may include any means for transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection may provide communication over the World Wide Web. It is assumed that data relating to this disclosure may be transmitted by such a network or connection for receipt and / or consideration by a party (422), as illustrated in Figure 4.

[0185] As shown in Figure 5, the high-speed cache (504) can be connected to or incorporated into the processor (502) to provide high-speed memory for instructions or data that have been used or are frequently used by the processor (502) in recent years. The processor (502) is connected to the northbridge (506) by the processor bus (508). The northbridge (506) is connected to the random access memory (RAM) (510) by the memory bus (512), which manages the processor (502)'s access to the RAM (510). The northbridge (506) is also connected to the southbridge (514) by the chipset bus (516). The southbridge (514) is then connected to the peripheral bus (518). The peripheral bus may be, for example, PCI, PCI-X, PCI Express, or other peripheral buses. The northbridge and southbridge are often referred to as the processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus (518). In some alternative architectures, the functionality of the northbridge may be integrated into the processor instead of using a separate northbridge chip. In some examples, the system (500) may include an accelerator card (522) attached to the peripheral bus (518). The accelerator may include a field-programmable gate array (FPGA) or other hardware to facilitate specific processing. For example, the accelerator may be used for reconstructing adaptive data or for evaluating algebraic expressions used in extended configuration processing.

[0186] Software and data can be stored in external storage (524) and loaded into RAM (510) and / or cache (504) used by the processor. The system (500) includes an operating system for managing system resources, and non-exclusive examples of operating systems include Linux, Windows®, MACOS®, BlackBerry OS®, iOS®, and other functionally equivalent operating systems, as well as application software that runs on the operating system to manage data storage and optimization in accordance with the examples of this disclosure. In this example, the system (500) further includes network interface cards (NICs) (520) and (521) connected to a peripheral bus to provide a network interface to external storage devices such as network-attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0187] Figure 6 is a schematic diagram showing a network (600) comprising multiple computer systems (602a) and (602b), multiple mobile phones and personal digital assistants (602c), and network-attached storage (NAS) (604a) and (604b). In this example, systems (602a), (602b), and (602c) can manage data storage and optimize data access to data stored in network-attached storage (NAS) (604a) and (604b). Mathematical models are available for this data and can be evaluated using distributed parallel processing across computer systems (602a) and (602b), as well as mobile phones and personal digital assistant systems (602c). Computer systems (602a) and (602b), as well as mobile phones and personal digital assistant systems (602c), can also provide parallel processing for adaptive data reconstruction of data stored in network-attached storage (NAS) (604a) and (604b). Figure 6 shows only one example, and various other computer architectures and systems may be used with the various examples of this disclosure. For example, a blade server can be used to provide parallel processing. Processor blades can be connected via a backplane to provide parallel processing. Storage can also be connected to the backplane or as network-attached storage (NAS) via another network interface. In some examples, processors can maintain a separate memory space and transmit data via a network interface, backplane, or other connectors for parallel processing by other processors. In other examples, some or all of the processors can use a shared virtual address memory space.

[0188] Figure 7 is a block diagram of a multiprocessor computer system (700) using a shared virtual address memory space according to an example. The system includes multiple processors (702a-702f) that can access a shared memory subsystem (704). The system incorporates multiple programmable hardware memory algorithm processors (MAPs) (706a-706f) into the memory subsystem (704). Each MAP (706a-706f) may include memory (708a-708f) and one or more field-programmable gate arrays (FPGAs) (710a-710f). The MAPs provide configurable functional units, and specific algorithms or parts of algorithms may be provided to FPGAs (710a-710f) for processing in close cooperation with their respective processors. For example, a MAP can be used to evaluate algebraic expressions relating to a data model and to reconstruct adaptive data in the example. In this example, each MAP is accessible from around the world by all processors for such purposes. In one configuration, each MAP can use direct memory access (DMA) to access its associated memory (708a-708f), thereby enabling it to execute tasks independently and asynchronously from its respective microprocessor (702a-702f). In this configuration, a MAP can directly feed results to another MAP for algorithm pipeline processing and parallel execution.

[0189] The computer architectures and systems described above are merely examples, and various other computer, mobile phone, and personal information terminal architectures and systems can be used in conjunction with examples that include systems using common processors, coprocessors, FPGAs and other programmable logic devices, systems on a chip (SOC), application-specific integrated circuits (ASICs), and any other combination of processing elements and logic elements. In some examples, all or part of the computer system can be implemented in software or hardware. Various data storage media can be used in conjunction with examples that include random access memory, hard drives, flash memory, tape drives, disk arrays, network-attached storage (NAS), and other local or distributed data storage devices and systems.

[0190] In the example, a computer system can be implemented using software modules that run on any of the above or other computer architectures and systems. In other examples, the functionality of the system can be partially or completely implemented in firmware, programmable logic devices such as field-programmable gate arrays (FPGAs) as mentioned in Figure 5, systems-on-chip (SOCs), application-specific integrated circuits (ASICs), or other processing elements and logic elements. For example, set processors and optimizers can be implemented with hardware acceleration through the use of hardware accelerator cards, such as the accelerator card (522) illustrated in Figure 5.

[0191] The following examples are provided to those skilled in the art to more clearly illustrate the principles and practices of the embodiments disclosed herein and are not intended to limit the scope of any claimed embodiment. Unless otherwise expressly stated, all parts and percentages are by weight. [Examples]

[0192] The following embodiments are given for illustrative purposes to illustrate various embodiments of the Disclosure and are not intended to limit the Disclosure in any way. These embodiments, along with the methods described herein, are representative and illustrative of currently preferred embodiments and are not intended to limit the scope of the Disclosure. Modifications and other uses therein that are encompassed within the spirit of the Disclosure as defined by the claims will be conspicuous to those skilled in the art.

[0193] Example 1: Functionalization of device surface

[0194] The device was functionalized to assist in the attachment and synthesis of polynucleotide libraries. The device surface was first wet-washed for 20 minutes using a piranha solution containing 90% H2SO4 and 10% H2O2. The device was then rinsed in multiple beakers with DI water, held under a gooseneck tap of DI water for 5 minutes, and dried with N2. Subsequently, the device was immersed in NH4OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a hand gun, immersed in three consecutive beakers of DI water for 1 minute each, and rinsed again with DI water using a hand gun. The device surface was then plasma-cleaned by exposing it to O2. Using a SAMCO PC-300 instrument, O2 was plasma-etched at 250 watts for 1 minute in downstream mode.

[0195] The following parameters were used: the cleaned device surface was actively functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutylamide using a YES-1224P deposition oven system with a vaporizer at 135°C, 0.5-1 Torr, 60 minutes, and 70°C. The device surface was resist-coated using a Brewer Science 200X spin coater. SPR(trademark)3612 photoresist was spin-coated onto the device at 2500 rpm for 40 seconds. The device was pre-baked on a Brewer hot plate at 90°C for 30 minutes. The device was exposed to photolithography using a Karl Suss MA6 mask aligner apparatus. The device was exposed for 2.2 seconds and developed in MSF 26A for 1 minute. The remaining developer was rinsed off with a handgun, and the device was immersed in water for 5 minutes. The devices were baked in a 100°C oven for 30 minutes, after which lithographic defects were visually inspected using a Nikon L200. The residual resist was removed using the Descam process with a SAMCO PC-300 instrument, followed by O2 plasma etching at 250 watts for 1 minute.

[0196] The device surface was passively functionalized with a 100 μL perfluorooctyltrichlorosilane solution mixed with 10 μL of light mineral oil. The device was placed in a chamber and pumped for 10 minutes, then the valve was closed relative to the pump and left for 10 minutes. The chamber was vented. The resist was stripped by immersing the device in 500 mL of NMP at 70°C for 5 minutes twice while sonicating at maximum power (9 on the Crest system). Next, the device was immersed in 500 mL of isopropanol at room temperature for 5 minutes while sonicating at maximum power. The device was then immersed in 300 mL of 200 proof ethanol and air-dried with N2. The functionalized surface was activated to function as a support for polynucleotide synthesis.

[0197] Example 2: Synthesis of a 50-mer sequence on an alkyl synthesis device

[0198] A two-dimensional oligonucleotide synthesis device was incorporated into a flow cell and connected to an Applied Biosystems (ABI394 DNA Synthesizer) flow cell. The two-dimensional oligonucleotide synthesis device was homogenized with N-(3-triethoxysilylpropyl)-4-hydroxybutylamide (Gelest), and a 50 bp exemplary polynucleotide ("50-mer polynucleotide") was synthesized using the polynucleotide synthesis method described herein.

[0199] The sequence of the 50-mer was as described in Sequence ID No. 2: 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (Sequence ID No. 2), where # represents thymidine succinyl hexamide CED phosphoramidite (CLP-2244 of ChemGenes), which is a cleavable linker that allows for the release of oligos from the surface during deprotection.

[0200] Synthesis was performed using standard DNA synthesis chemistry (binding, capping, oxidation, and deblocking) according to the protocols and ABI synthesizers shown in Table 3.

[0201] [Table 3-1]

[0202] [Table 3-2]

[0203] The phosphoramidite / activator combination was delivered in the same manner as bulk reagents delivered via a flow cell. No drying steps were performed because the environment remained "moist" throughout due to the reagents.

[0204] The ABI394 synthesizer was modified by removing the flora restrictor, allowing for faster flow. Without a flora restrictor, the flow rates for amidite (0.1 M in ACN), activator (0.25 M benzoylthiotetrazole ("BTT"; Glen Research 30-3070-xx) in ACN), and Ox (20% pyridine, 10% water, and 0.02 M I2 in 70% THF) were approximately 100 uL / sec; for acetonitrile ("ACN") and capping reagent (a 1:1 mixture of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% 1-methylimidiso in THF), it was approximately 200 uL / sec; and for Deblock (3% dichloroacetic acid in toluene), it was approximately 300 uL / sec (compared to approximately 50 uL / sec for all reagents with a flora restrictor). The time required to completely flush out the oxidizer was observed, and the chemical flow times were adjusted accordingly, with extra ACN washing introduced between different chemicals. After polynucleotide synthesis, the tips were deprotected in gaseous ammonia overnight at 75 psi. Polynucleotides were recovered by applying 5 drops of water to the surface. The recovered polynucleotides were then analyzed using a BioAnalyzer small RNA tip.

[0205] Example 3: Synthesis of a 100-mer sequence on an alkyl synthesis device

[0206] The same process described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer polynucleotide ("100-mer polynucleotide"; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3', where # represents thymidine-succinylhexamide CED phosphoramidite (CLP-2244 of ChemGenes); SEQ ID NO: 3) on two different silicon chips: the first silicon chip was homogeneously functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutylamide, and the second silicon chip was functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane. The polynucleotides extracted from the surface were analyzed using a BioAnalyzer instrument.

[0207] The following thermal cycling programs: 98℃, 30 seconds Repeat 12 cycles: 98°C for 10 seconds; 63°C for 10 seconds; 72°C for 10 seconds. 72℃, 2 minutes Using a 50 μL PCR mixture (25 μL NEB Q5 mastermix, 2.5 μL 10 μM forward primer, 2.5 μL 10 μM reverse primer, 1 μL polynucleotide extracted from the surface, and up to 50 μL of water), all 10 samples from the two chips were further amplified using the forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO: 4) and the reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO: 5).

[0208] The PCR products were also run on a BioAnalyzer, demonstrating a sharp peak at the 100-mer position. Next, the PCR-amplified samples were cloned and Sanger sequenced. Table 4 summarizes the results obtained from Sanger sequencing of samples obtained from spots 1-5 from tip 1 and from spots 6-10 from tip 2.

[0209] [Table 4]

[0210] Thus, the high quality and uniformity of the synthesized polynucleotides were repeated on two chips with different interfacial chemical properties. Overall, 89% of the sequenced 100-mers were error-free and complete sequences, corresponding to 233 out of 262.

[0211] Table 5 summarizes the error characteristics of the sequences obtained from the polynucleotide samples at spots 1-10.

[0212] [Table 5]

[0213] Example 4: Design of an antibody scaffold

[0214] To generate scaffolds, we performed specific analyses of datasets for structural analysis, heavy chain repertoire sequencing analysis, and heterodimer high-throughput sequencing. Each heavy chain was associated with each light chain scaffold. Five different long CDRH3 loop options were assigned to each heavy chain scaffold. Five different L3 scaffolds were assigned to each light chain scaffold. Heavy chain CDRH3 stems were selected from frequently observed long H3 loop stems (10 amino acids on the N-terminus and C-terminus) found across both individual and V gene segments. Light chain scaffold L3 was selected from heterodimers containing long H3. Direct heterodimers based on information from the Protein Databank (PDB) and deep sequencing datasets with fixed CDR H1, H2, L1, L2, L3, and CDRH3 stems were used. The various scaffolds were then formatted for display on phages and expression was evaluated.

[0215] structural analysis

[0216] Approximately 2,017 antibody structures were analyzed, and 22 structures with long CDRH3 molecules of at least 25 amino acids were observed. The heavy chains included IGHV1-69, IGHV3-30, IGHV4-49, and IGHV3-21. The identified light chains included IGLV3-21, IGKV3-11, IGKV2-28, IGKV1-5, IGLV1-51, IGLV1-44, and IGKV1-13. In the analysis, four heterodimer combinations, including IGHV4-59 / 61-IGLV3-21, IGHV3-21-IGKV2-28, IGHV1-69-IGKV3-11, and IGHV1-69-IGKV1-5, were observed multiple times. Sequence and structural analysis identified intracellular disulfide bonds in CDRH3 in several structures with bulky side chain packing, such as tyrosine, in the stem, providing support for the stability of the long H3. Secondary structures, including β-turn-β-sheet and "hammerhead" subdomains, were also observed.

[0217] Repertoire Analysis

[0218] Repertory analysis was performed on 1,083,875 IgM+ / CD27 naive B-cell receptor (BCR) sequences and 1,433,011 CD27+ sequences obtained from 12 healthy controls by unbiased 5'RACE. The 12 healthy controls included an equal number of males and females and consisted of 4 Caucasian, 4 Asian, and 4 Hispanic individuals. Repertory analysis demonstrated that less than 1% of the human repertoire contained BCRs with CDRH3 longer than 21 amino acids. A V gene bias was observed in the long CDR3 subrepertoire, with IGHV1-69, IGHV4-34, IGHV1-18, and IGHV1-8 showing preferential enrichment in BCRs with long H3 loops. For IGHV3-23, IGHV4-59 / 61, IGHV5-51, IGHV3-48, IGHV3-53 / 66, IGHV3-15, IGHV3-74, IGHV3-73, IGHV3-72, and IGHV2-70, a bias toward long loops was observed. The IGHV4-34 scaffold was demonstrated to be self-reactive and have a short half-life.

[0219] Viable N-terminal and C-terminal CDRH3 scaffold variations for long loops were also designed based on the 5'RACE reference repertoire. Approximately 81,065 CDRH3s with amino acid lengths of 22 amino acids or more were observed. By comparing across V gene scaffolds, scaffold-specific H3 stem variations were avoided, allowing scaffold diversity to be cloned into multiple scaffold references.

[0220] Heterodimer analysis

[0221] Heterodimer analysis was performed on the scaffold. The variant sequences and lengths of the scaffolds were assayed.

[0222] structural analysis

[0223] Structural analysis and length assay were performed using GPCR scaffolds of variant sequences.

[0224] Example 5: Generation of a GPCR antibody library

[0225] Libraries were designed and de novo synthesized based on the GPCR ligand interaction surface and scaffold configuration. See Example 4. Ten variant sequences were designed for the variable domain and heavy chain, 237 variant sequences were designed for the heavy chain complementarity determination region 3, and 44 variant sequences were designed for the variable domain and light chain. The fragments were synthesized as three fragments according to the same method as described in Examples 1-3.

[0226] Following de novo synthesis, 10 variant sequences were generated for the variable domain and heavy chain, 236 variant sequences were generated for the heavy chain complementarity determination region 3, 43 variant sequences were designed for the variable domain, light chain, and region containing CDRL3, and 9 variants were designed for the variable domain and light chain. This resulted in approximately 10 5 A library with a diversity of 10 × 236 × 43 was obtained. This was confirmed with 16 million reads using next-generation sequencing (NGS).

[0227] Subsequently, various light and heavy chains were tested for expression and protein folding. Ten variant sequences of the variable domain and heavy chain included IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, and IGHV4-59 / 61. Of the ten variant sequences, IGHV1-18, IGHV1-69, and IGHV3-30 / 33rn showed improved characteristics, such as improved thermal stability. The nine variant sequences of the variable domain and light chain included IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, and IGLV2-14. Of the nine variant sequences, IGKV1-39, IGKV3-15, IGLV1-51, and IGLV2-14 showed improved characteristics, such as improved thermal stability.

[0228] Example 6: GPCR Library

[0229] This example describes the generation of a GPCR library.

[0230] material and method

[0231] Stable cell line and phage library generation

[0232] A full-length human GLP-1R gene (UniProt-P43220) with an N-terminal FLAG tag and a C-terminal GFP tag, cloned into a pCDNA3.1(+) vector (ThermoFisher), was transfected into a Chinese hamster ovary (CHO) cell suspension to generate a stable cell line expressing GLP-1R. Target expression was confirmed by FACS. Subsequently, cells expressing over 80% GLP-1R via GFP were directly used for cell-based selection.

[0233] Combinations of germline heavy chains IGHV1-69, IGHV3-30, and germline light chains IGKV1-39, IGKV3-15, IGLV1-51, IGLV2-14 were used in a display library for GPCR-focused phages, and all six CDR diversityes were encoded by oligopools synthesized as in Examples 1-3 above. The CDRs were also screened to ensure they did not contain manufacturability responsibilities, potential splice sites, or commonly used nucleotide restriction sites. The heavy chain variable regions (VH) and light chain variable regions (VL) were ligated with a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene library was cloned into a phage display vector in pADL 22-2c (Antibody Design Labs) by NotI restriction enzyme digestion and electroporated into TG1 electrocompetent E. coli cells (Lucigen). The final library was validated by NGS with a resolution of 1.1 × 10⁶. 10 It has a variety of sizes.

[0234] Panning and screening strategies used to isolate the agonist GLP-1R scFv clone

[0235] Before panning on GLP-1R-expressing CHO cells, phage particles were blocked with 5% BSA / PBS to deplete nonspecific binding agents on the CHO parent cells. To deplete the CHO parent cells, the introduced phage alicoats were left at room temperature (RT) for 1 × 10⁶ days. 8 The cells were rotated at 14 rpm / min for 1 hour together with the CHO parent cells. The cells were then pelletized by centrifugation at 1,200 rpm for 10 minutes in a benchtop Eppendorf 5920RS / 4×1000 rotor to deplete the nonspecific CHO cell binding agent. The phage supernatant, depleted of the CHO cell binding agent, was then processed into 1×10⁶ phage supernatant. 8The phages were transferred to GLP-1R-expressing CHO cells. The phage supernatant and GLP-1R-expressing CHO cells were rotated at 14 rpm / min for 1 hour at RT to select for GLP-1R binding. After incubation, the cells were washed several times with 1×PBS / 0.5% Tween to remove unbound clones. To elute phages bound to GLP-1R cells, the cells were incubated with trypsin in PBS buffer at 37°C for 30 minutes. The cells were pelleted by centrifugation at 1,200 rpm for 10 minutes. The efflux supernatant rich in GLP-1R-bound clones was amplified in TG1 E. coli cells and used as input phages for selection in the next round. This selection strategy was repeated for 5 rounds. All rounds were depleted against the CHO parent background. The amplified efflux phage from one round was used as input phages for the next round, and the stringency of washing increased with each subsequent round of selection, involving more washing. After selecting from 5 rounds, 500 clones from rounds 4 and 5 were Sanger-sequenced to identify unique clones.

[0236] Next-generation sequencing analysis

[0237] Phagemid DNA was miniprepped from exfoliated bacterial stocks from all panning rounds. Variable heavy chains (VH) were PCR amplified from phagemid DNA using forward primer ACAGAATTCATTAAAGAGGAGAAATTAACC and reverse primer TGAACCGCCTCCACCGCTAG. The PCR products were used directly for library preparation using the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, product no. KK8514). To add diversity to the library, 15% PhiX Control purchased from Illumina (product no. FC-110-3001) was added to the samples. The library was then loaded into Illumina's 600-cycle MiSeq Reagent Kit v3 (Illumina, product no. MS-102-3003) and run on a MiSeq instrument.

[0238] Reformatting and High-Throughput (HT) IgG Purification

[0239] Expi293 cells were transfected with heavy and light chain DNA in a 2:1 ratio using Expifectamine (ThermoFisher, A14524). After harvesting the supernatant 4 days after transfection, cell viability decreased to less than 80%. Purification was performed using either King Fisher (ThermoFisher) or Phynexus Protein A column tips (Hamilton) with Protein A magnetic beads. For large-scale production of IgG clones evaluated in in vivo mouse studies, the Akta HPLC purification system (GE) was used.

[0240] IgG characterization and quality control. Purified IgG with a positive GLP-1R binder (hit) was characterized for purity using the LabChip GXII Touch HT Protein Express high-sensitivity assay. IgG was reduced to VH and VL using dithiothreitol (DTT). IgG concentration was measured using Lunatic (UnChain). IgG for in vivo mouse studies was further characterized by HPLC and tested for endotoxin levels at doses of less than 5 EU per kg (Endosafe® nexgen-PTS® Endotoxin Testing, Charles River).

[0241] Binding assays and flow cytometry

[0242] GLP-1R IgG clones were tested in a binding assay combined with flow cytometry analysis as follows: FLAG-GLP-1R-GFP expressing CHO cells (CHO-GLP-1R) and CHO parent cells were incubated with 100 nM IgG on ice for 1 hour, washed three times, incubated with Alexa 647 conjugate goat anti-human antibody (1:200) (Jackson ImmunoResearch Laboratories, 109-605-044) on ice for 30 minutes, washed three times, and pelleted between each washing step by centrifugation. All incubation and washing were performed in buffer containing PBS + 1% BSA. For titration, IgG was serially diluted 1:3 from 100 nM to 0.046 nM. Cells were analyzed by flow cytometry to identify hits (hits are IgG that specifically binds to CHO-GLP-1R) by measuring the GFP signal against the Alexa 647 signal. Flow cytometry data from binding assays using 100 nM IgG are presented as dot plots. Analysis of binding assays by IgG titration is presented as binding curves plotting IgG concentration against MFI (mean fluorescence intensity).

[0243] Ligand competition assay

[0244] The ligand competition assay involved co-incubating primary IgG with 1 μM GLP-1 (7-36). For each data point, IgG (600 nM) was prepared in Flow buffer (PBS + 1% BSA) and diluted 1:3 over 8 titration points. Peptide GLP-1 7-36 (2 μM) was similarly prepared in Flow buffer (PBS + 1% BSA). Each well contained 100,000 cells and was mixed with 50 μL of IgG and 50 μL of peptide (= plus) or buffer without peptide (= minus). The cells and IgG / peptide mixture were incubated on ice for 1 hour, washed, and then a secondary antibody (goat anti-human APC, Jackson ImmunoResearch Laboratories, product no. 109-605-044) diluted 1:200 in PBS + 1% BSA was added. This was incubated on ice for 30 minutes (50 μL per well), then washed and resuspended in 60 μL of buffer. Finally, assay readings were measured on an Intellicyt® IQue3 Screener at a rate of 4 seconds per well.

[0245] result

[0246] The design of antibody libraries focused on GPCRs is based on GPCR-binding motifs and GPCR antibodies.

[0247] We analyzed all known GPCR interactions, including interactions between GPCRs and ligands, peptides, antibodies, endogenous extracellular loops, and small molecules, to map GPCR-binding molecular determinants. Using the crystal structures of approximately 150 peptides, ligands, or antibodies bound to the ECD of approximately 50 GPCRs (http: / / www.gpcrdb.org), we identified GPCR-binding motifs. From this analysis, we extracted over 1000 GPCR-binding motifs. Furthermore, analysis of all elucidated GPCR structures (zhanglab.ccmb.med.umich.edu / GPCR-EXP / ) identified over 2000 binding motifs from the endogenous extracellular loops of GPCRs. Finally, by analyzing the structures of over 100 small molecule ligands bound to GPCRs, we identified a reduced amino acid library of five amino acids (Tyr, Phe, His, Pro, and Gly) that could potentially reproduce many of the structural contacts of these ligands. This sublibrary with reduced amino acid diversity was placed within the CxxxxxC motif. In total, we identified over 5000 GPCR binding motifs (Figures 9A-9E). These binding motifs were located in one of five different stem regions: CARDRELECEEWTxxxxxSRGPCVDPRGVAGSFDVW, CARDMYYDFxxxxxEVVPADDAFDIW, CARDGRGSLPRPKGGPxxxxxYDSSEDSGGAFDIW, CARANQHFxxxxxGYHYYGMDVW, and CAKHMSMQxxxxxRADLVGDAFDVW.

[0248] These stem regions were selected from structural antibodies containing extra-long HCDR3s. Antibody germline cells were specifically selected to tolerate these extra-long HCDR3s. Structural and sequence analysis of human antibodies longer than 21 amino acids revealed V gene bias in antibodies with long CDR3s. Finally, germline IGHV (IGHV1-69 and IGHV3-30), IGKV (IGKV1-39 and IGKV3-15), and IGLV (IGLV1-51 and IGLV2-14) genes were selected based on this analysis.

[0249] In addition to HCDR3 diversity, limited diversity was also introduced into the other five CDRs. The IGHV1-69 domain contained 416 HCDR1 and 258 HCDR2 variants; the IGHV3-30 domain contained 535 HCDR1 and 416 HCDR2 variants; the IGKV1-39 domain contained 490 LCDR1, 420 LCDR2, and 824 LCDR3 variants; the IGKV3-15 domain contained 490 LCDR1, 265 LCDR2, and 907 LCDR3 variants; the IGLV1-51 domain contained 184 LCDR1, 151 LCDR2, and 824 LCDR3 variants; and the IGLV2-14 domain contained 967 LCDR1, 535 LCDR2, and 922 LCDR3 variants (Figure 10). These CDR variants were selected by comparing germline CDRs to the near-germline space of single, double, and triple mutations observed in CDRs within the V gene repertoire of at least two of 12 human donors. All CDRs were pre-screened to remove manufacturability responsibilities, potential splice sites, or nucleotide restriction sites. CDRs were synthesized as oligopools and incorporated into selected antibody scfolds. The heavy chain (VH) and light chain (VL) genes were ligated with a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene pool was cloned into a phagemide display vector at the N-terminus of the M13 gene-3 minor coat protein. The final size of the GPCR library was 1 × 10⁶ in scFv format. 10 Next-generation sequencing (NGS) was performed on the final phage library, and the HCDR3 length distribution within the library was analyzed and compared to the HCDR3 length distribution in a B cell population from three healthy adult donors. The HCDR3 sequences from the three healthy donors used were obtained from a publicly available database containing over 37 million B cell receptor sequences. 31The length of HCDR3 in GPCR libraries is much longer than the length of HCDR3 observed in B cell repertoire sequences. On average, the median length of HCDR3 in GPCR libraries (showing a biphasic distribution pattern) is two or three times longer (33 to 44 amino acids) than the median length observed in native B cell repertoire sequences (15 to 17 amino acids) (Figure 11). The biphasic length distribution of HCDR3 in GPCR libraries is mainly caused by two groups of stems used to present motifs within HCDR3: (8aa, 9aaxxxxx10aa, 12aa) and (14aa, 16aaxxxxx18aa, 14aa).

[0250] Example 7: VHH Library

[0251] We developed a synthetic VHH library. For the "VHH Ratio" library, which adjusts for CDR diversity, we used Clustal Omega to align 2391 VHH sequences (iCAN database) to determine the consensus at each position, and derived a framework from the consensus at each position. We analyzed all CDRs of the 2391 sequences for position-specific mutations and incorporated this diversity into the library design. For the "VHH Shuffle" library, which shuffles CDR diversity, we scanned the iCAN database for unique CDRs within nanobody sequences. We identified 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s, and derived a framework from the consensus at each framework position among the 2391 sequences in the iCAN database. By individually synthesizing each unique CDR and shuffling them using the consensus framework, we achieved a theoretical diversity of 3.2 × 10⁻⁶. 9A library was generated. Subsequently, the library was cloned into a phagemide vector using restriction enzyme digestion. For the "VHH hShuffle" library (a synthetic "human" VHH library with shuffled CDR diversity), the iCAN database was scanned to find unique CDRs within the nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, and frameworks 1, 3, and 4 were derived from the human germline DP-47 framework. Framework 2 was derived from the consensus at each framework's position among 2391 sequences in the iCAN database. By synthesizing each unique CDR individually and shuffling them with partially humanized frameworks using the NUGE tool, a theoretical diversity of 3.2 × 10⁶ was achieved. 9 A library was generated. This library was cloned into a phagemid vector using the NUGE tool.

[0252] The binding affinity and affinity distribution of the VHH-Fc variant were evaluated using the Carterra SPR system. VHH-Fc exhibited an affinity range for TIGIT, with the lower limit being 12 nM K D The upper limit is 1685nM K D (Data not shown). Figure 12 shows ELISA, protein A (mg / ml), and K D This shows the specific values ​​for VHH-Fc clones relative to (nM).

[0253] Example 8: High-level immunoglobulin library for A2A receptors

[0254] A highly immunoglobulin (IgG) library was prepared using a method similar to that described in Example 7. In short, the highly immunoglobulin IgG library was generated from the analysis of a database of human naive and memory B cell receptor sequences consisting of over 37 million unique IgH sequences from each of three healthy donors. Over 2 million CDRH3 sequences were collected from the analysis and individually constructed using a method similar to that described in Examples 1-3. The CDRH3 sequences were incorporated into the VHH hShuffle library described in Example 9. The final library diversity was 1.3 × 10⁶. 10 It was decided that this was the case. A schematic diagram of the design is shown in Figure 13.

[0255] Of the 88 unique clones, 73 had a target cell MFI value twice that of the parent cell. Of the 88 unique clones, 15 had a target cell MFI value 20 times that of the parent cell. Data for the adenosine A2A receptor variant A2AR-90-007 are shown in Figures 14A and 14B.

[0256] This example demonstrates high affinity and K in the sub-nanomole range. D This demonstrates the generation of a VHH library for A2ARs that have values.

[0257] Example 9. GPCR library with various CDRs

[0258] We created a GPCR library using a CDR randomization scheme.

[0259] In short, we designed a GPCR library based on GPCR antibody sequences. We analyzed over 60 different GPCR antibodies and modified the sequences from these GPCRs using a CDR randomization scheme.

[0260] The design of the heavy chain IGHV3-23 is shown in Figure 15A. As shown in Figure 15A, IGHV3-23 CDRH3 has four characteristic lengths: 23 amino acids, 21 amino acids, 17 amino acids, and 12 amino acids, each length exhibiting residue diversity. The ratios of the four lengths were as follows: 40% for 23-amino acid CDRH3, 30% for 21-amino acid CDRH3, 20% for 17-amino acid CDRH3, and 10% for 12-amino acid CDRH3. The diversity of CDRH3 is 9.3 × 10⁻⁶. 8 It was determined that the diversity of the complete heavy chain IGHV3-23 is 1.9 × 10⁻⁶. 13 That was the case.

[0261] The design of the heavy chain IGHV1-69 is shown in Figure 15B. As shown in Figure 15B, IGHV1-69 CDRH3 has four characteristic lengths: 20 amino acids, 16 amino acids, 15 amino acids, and 12 amino acids, each length exhibiting residue diversity. The ratios of the four lengths were as follows: 40% for 20-amino acid CDRH3, 30% for 16-amino acid CDRH3, 20% for 15-amino acid CDRH3, and 10% for 12-amino acid CDRH3. The diversity of CDRH3 is 9 × 10⁻⁶. 7 It was determined that the diversity of full-heavy-chain IGHV-69 is 4.1 × 10⁻⁶. 12 That is the case.

[0262] The designs of light chains IGKV2-28 and IGLV1-51 are shown in Figure 15C. The antibody light chain CDR sequences were analyzed for position-specific variation. The two light chain frameworks were selected with fixed CDR lengths. The theoretical variability was determined to be 13800 and 5180 for the kappa chain and light chain, respectively.

[0263] The final theoretical diversity is 4.7 × 10⁻⁶. 17 It was determined that the diversity of the final generated Fab library is 6 × 10 9 This was the case. Please refer to Figure 15D.

[0264] Example 10: Adenosine A2A receptor library with various CDRs

[0265] An adenosine A2A receptor library is prepared using the CDR randomization scheme similarly described in Example 9.

[0266] In short, an adenosine A2A receptor library is designed based on GPCR antibody sequences. More than 60 different GPCR antibodies are analyzed, and sequences from these GPCRs are modified using a CDR randomization scheme. The adenosine A2A receptor variant IgG designed using the CDR randomization scheme is purified and assayed to determine cell-based affinity measurements and for functional analysis.

[0267] Example 11. A2A variant immunoglobulin

[0268] The generated A2AR variant immunoglobulins were analyzed using various functional assays.

[0269] First, the A2AR immunoglobulin scFv phage library was screened by panning on cells and fixed A2a proteins. The number of effluxed phages in each round of selection is shown in Tables 7 and 8.

[0270] [Table 6]

[0271] [Table 7]

[0272] Example 12. Screening of antibody binding

[0273] A2AR immunoglobulins selected from the groups listed in Tables 15 to 18 were assayed for binding to targets as listed in the tables.

[0274] HEK293-A2a cells

[0275] Flow cytometry data showing the binding of immunoglobulins from a variant library to HEK293-A2a cells was generated using 100 nM IgG and compared to the binding detected in parental cells. Binding using variants from the immunolibrary is shown in Figures 16A–16N. The control is shown in Figure 16O, which shows cell binding to human adenosine A2aR monoclonal (MAB9497). Selected variants were evaluated for binding at titrated concentrations starting from 100 nM. The resulting curves are shown in Figures 17A–17H. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). Binding using variants from a mouse immunolibrary is shown in Figures 18A–18N. The control is shown in Figure 18O, which shows cell binding to human adenosine A2aR monoclonal (MAB9497). Selected variants were evaluated for binding at titrated concentrations starting from 100 nM. The resulting curves are shown in Figures 19A to 19G. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity).

[0276] protein binding

[0277] Purified A2a immunoglobulins from Tables 15-18 were assayed for binding by titration from 100 nM. The results for the selected variants are shown in Figures 20A-20G.

[0278] Example 13. Agonist response in the LANCE® cAMP assay

[0279] The agonist dose-response assay was performed using the LANCE® cAMP assay in a 384-well format with 2500 cells / well, according to the manufacturer's instructions. Cell stimulation with NECA and CGS 21680 was performed at room temperature for 30 minutes. Readings were performed with an EnVision plate reader in laser mode. The data are shown in Figure 21. The Z' factor was calculated for NECA with at least 16 backgrounds and 16 maximum signal points (Z'=0.80). The EC calculated for NECA50 (M) = 2.7 × 10 -7 , and the EC calculated for CGS 21680 50 (M) = 4.3 × 10 -7 .

[0280] Example 14. Antagonist response in the LANCE® cAMP assay

[0281] The antagonist dose-response assay was performed using the LANCE® cAMP assay in a 384-well format with 2500 cells / well and 1 μM NECA (reference agonist), according to the manufacturer's instructions. Cell stimulation with ZM241385 was performed at room temperature for 30 minutes. Readings were performed using an EnVision plate reader in laser mode. The data are shown in Figure 22. The IC50 was calculated for ZM241385. 50 (M) = 1.25 × 10 -5 .

[0282] Example 15. A2A cAMP antagonist titration

[0283] Cells were plated at 3000 cells / well, pre-incubated with immobilized 100 nM IgG at room temperature for 1 hour, and then stimulated at room temperature for 30 minutes using NECA titration according to the manufacturer's instructions. The buffer was PBS + 0.1% BSA + 0.5 mM IBMX. The results are shown in Figure 23. The absolute IC50 is shown in Table 9, which indicates that A2A-1 is a negative allosteric modulator.

[0284] [Table 8]

[0285] Example 16. LANCE® Allosteric cAMP Assay

[0286] A2A-1 and A2A-9 were assayed for allosteric regulation. Cells were pre-incubated with titrated IgG at room temperature for 1 hour, and then stimulated with fixed NECA concentrations. The results are shown in Figure 24. The IC50 values ​​are shown in Table 10, which indicate that A2A-1 is a negative allosteric modulator.

[0287] [Table 9]

[0288] Example 17. cAMP Allosteric A2A PerkinElmer

[0289] A2A-9 was assayed as described in Example 15. The obtained response curve is shown in Figure 25. The calculated IC50 for A2A-9 is shown in Table 11.

[0290] [Table 10]

[0291] Example 18. Titration of A2A cAMP antagonist

[0292] A2A-9 was assayed as described in Example 16. The obtained response curve is shown in Figure 26. The calculated IC50 values ​​are shown in Table 12. The results indicate that A2A-9 is an antagonist.

[0293] [Table 11]

[0294] Example 19. A2A Antagonist cAMP Assay

[0295] The selected variants were assayed for binding to the target. Immunoglobulins were titrated in triplicate and incubated on cells for 1 hour, followed by incubation with 0.5 μM NECA for 30 minutes. Binding curves, showing relative fluorescence unit (RFU) ratios at 665 nm / 615 nm versus nM IgG on a logarithmic scale, are shown in Figures 27A–27C. In the final binding studies, functional antibodies were found in the generated libraries, as listed in Tables 13 and 14.

[0296] [Table 12]

[0297] [Table 13]

[0298] Example 20. Functional cAMP assay of A2AR cells

[0299] Allosteric and antagonist cAMP assays were performed using A2A cell lines.

[0300] In short, cells were pre-incubated with 100 nM anti-A2AR antibody and then titrated 3× with NECA stimulation starting from 100 μM. Data from the functional allosteric cAMP assay are shown in Figures 28A–28C. ZM241385 functioned as an antagonist. "No Ab" functioned only as an agonist.

[0301] For the functional antagonist cAMP assay, cells were pre-incubated using a 3× titration of anti-A2AR antibody starting at 100 nM, followed by NECA stimulation with 0.5 μM. The data are shown in Figures 29A to 29C. Additionally, cells were pre-incubated using a 3× titration of anti-A2AR antibody starting at 100 nM, followed by NECA stimulation with 10 μM. The data are shown in Figures 30A to 30C.

[0302] Based on the data, A2AR variants A2A-17, A2A-19, A2A-24, A2A-26, and A2A-27 showed improved function in cAMP assays for NECA titration, IgG titration (NECA 0.5uM), and IgG titration (NECA 10uM).

[0303] Example 21. T cell activation assay

[0304] The variant A2A-77, developed according to the previous example, was found to be a high-affinity conjugate to hA2a (Figure 31A). A2A-77 was determined to be a functional antagonist in vitro (Figure 31B) and exhibited high specificity in vitro (Figure 31C). A2A-77 was found to bind to cynomolgus monkey PBMCs containing A2AR-expressing cells, including T cells, NK cells, dendritic cells, and macrophages (Figure 31D). Further studies were conducted to determine its effects in T cell activation assays.

[0305] In short, 2 x 10 per well 5 PBMCs were incubated with the antagonist ZM-241385 or A2aR immunoglobulin titrated from 100 nM at 37°C for 30 minutes, followed by treatment with the A2AR agonist NECA at 1 μM at 37°C for 30 minutes. The cells were then activated with magnetic beads coated with anti-CD3ε / CD28 antibody. Three days after incubation, the supernatant was collected for detection of IFN-γ release and evaluation of T cell activation. ZM-241385 is potent and can be used as a selective small molecule A2A antagonist control.

[0306] The data are shown in Figures 32A to 32H. As seen in Figures 32A to 32B, T cell activation was observed in variants A2A-81, A2A-51, A2A-53, A2A-77, A2A-31, and A2A-78. A2A-77 was further observed to have an IC50 of 5.92 nM (Figure 32C). The data in Figures 32D to 32G demonstrate that when more NECA is used to suppress T cell activation, A2A-77 and A2A-81 do not restore T cell activation as well as at low NECA levels. A2A-51 still functions well even at high NECA levels.

[0307] This example demonstrates that A2A-77 is a functional antagonist of A2AR that blocks immunosuppression.

[0308] Example 22. Exemplary arrangement

[0309] [Table 14-1]

[0310] [Table 14-2]

[0311] [Table 14-3]

[0312] [Table 15-1]

[0313] [Table 15-2]

[0314] [Table 15-3]

[0315] Table 16-1

[0316] Table 16-2

[0317] Table 16-3

[0318] Table 16-4

[0319] Table 16-5

[0320] Table 17-1

[0321] Table 17-2

[0322] Table 17-3

[0323] Table 17-4

[0324] Table 17-5

[0325] Example 23. In vivo cell analysis of A2A-77 and A2A-81

[0326] Cell binding assay

[0327] The binding of A2A-77 and A2A-81 was evaluated at titrated concentrations starting from 100 nM. The resulting curves are shown in Figure 33A, and the results are shown in Table 19. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). Both A2A-77 and A2A-81 were high-affinity binding agents to the hA2a receptor.

[0328] [Table 18]

[0329] A2A antagonist cAMP assay

[0330] Immunoglobulin was titrated in triplicate and incubated on cells for 1 hour, followed by incubation with 0.5 μM NECA for 30 minutes. Binding curves showing relative fluorescence units (RFU) at 665 nm / 615 nm versus nM IgG on a logarithmic scale are shown in Figure 33B. Absolute IC50 values ​​are shown in Table 20, indicating that A2A-77 and A2A-81 were functional agonists in vitro.

[0331] [Table 19]

[0332] Cross-reactivity

[0333] A2A-77 and A2A-81 were assayed for cross-reactivity with HA1, hA2b, hA3, and mA2 receptors. The results are shown in Figure 33C. Both A2A-77 and A2A-81 showed in vitro specificity.

[0334] Primary T cell activation assay

[0335] As described above, a primary T cell activation assay was performed. The data are shown in Figure 33D and Table 21. T cell activation was observed in variants A2A-77 and A2A-81. A2A-81 showed improved activity compared to A2A-77.

[0336] [Table 20]

[0337] Example 24. In vivo study in a colon cancer model

[0338] Mice with human colon cancer (Colo205) were divided into four groups. Group 1 was the isotype control, Group 2 mice were treated with anti-PD1, Group 3 mice were treated with variant A2A-77, and Group 4 mice were treated with variant A2A-81. Tumor volume was measured over 30 days. The results are shown in Figures 34A to 34D. Tumor size with variant A2A-81 regressed better than with variant A2A-77 or anti-PD-1 antibody.

[0339] Further tests were conducted using mice treated with 10 mg / kg of variants A2A-51 (group 5), A2A-28 (group 6), Ab7 / PD1TAO15 ​​(group 7), and AZD4635 (group 8). The mice were also treated with 20 mg / kg according to the schedule shown in Figure 34E. The data are shown in Figures 34F to 34K.

[0340] The data show that A2A-77 and A2A-51 demonstrated the ability to reduce tumor volume, and PD1TAO15 ​​showed similar results to the comparator anti-PD1 antibody. No differences were observed in combination therapy compared to single-dose or anti-PD1 antibody therapy. See Figure 35K.

[0341] Tumor-infiltrating lymphocytes (TILs) were measured in both the lymphoid and myeloid compartments in each treatment group. The results are shown in Figures 35A to 35M. TIL CD8+ cells increased more in the group treated with the A2A-77 variant than in the group treated with the A2A-81 variant. TIL-M1 tumor-associated macrophages increased more in the A2A-81 variant than in the A2A-77 variant.

[0342] Cellular profiles of lysed whole blood (LWB) from peripheral blood were measured in intermediate and final samples. The results are shown in Figures 36A-36C, 37A-37G, and 38A-38G. Cytokine levels in peripheral blood after T cell activation are shown in Figure 39. The results for cytokine levels in terminal serum are shown in Figures 40A-40G.

[0343] Cellular profiles of lysed whole blood (LWB) from peripheral blood were measured in intermediate and final samples. The results are shown in Figures 41A–41C, 42A–42G, and 43A–43G. The cytokine levels in the final serum sample are shown in Figures 44A–44G.

[0344] Example 25. Functional cAMP assay using A2bR cells

[0345] Cross-reactivity

[0346] A2b cross-binding agents, whose specificity in HEK293T cells was evaluated, were assayed for cross-reactivity. The results are shown in Figure 45 and Table 22.

[0347] [Table 21]

[0348] Figure 46 shows a functional cAMP assay performed against a selected A2b antibody. CHO-K1 cells were incubated with the A2b antibody. The cells were then stimulated using NECA. A2b activation was monitored based on 3'-5'-cyclic adenosine monophosphate (cAMP) production in the cell line.

[0349] A functional allosteric cAMP assay was performed. Cells were pre-incubated with 100 nM of anti-A2A-17, A2A-19, A2A-26, A2A-27, A2A-35, A2A-36, A2A-83, and A2A-84, and then stimulated with NECA at 300 nM by 3× titration. The results are shown in Figure 47A.

[0350] A functional antagonist cAMP assay was performed. First, cells were pre-incubated with A2A-17, A2A-19, A2A-26, A2A-27, A2A-35, A2A-36, and A2A-83 by 3× titration starting at 100 nM. Next, NECA stimulation was performed at a concentration of 10 nM. The results are shown in Figures 47B-47C.

[0351] Antagonist cAMP assays were performed at high IgC and low ligand levels. Cells were pre-incubated with A2A-17, A2A-19, A2A-26, A2A-27, A2A-35, A2A-36, A2A-83, and A2A-72 by 3× titration starting at 1000 nM. Next, NECA stimulation was performed at a concentration of 5 nM. The results are shown in Figure 47D. A2A-27 exhibited characteristics of both an A2a antagonist that cross-links with A2b and an A2b antagonist. The characteristics of A2b are shown in Table 23.

[0352] [Table 22]

[0353] Example 26. A2AR antibody for reformatting IgG1 and IgG4

[0354] The antibodies were reformatted to either IgG1 or IgG4. The reformatted antibodies were then assayed in a primary T-cell activation assay, and cytokine release was measured. The data are shown in Figures 48A to 48E. As seen in the data, after reformatting the reads to IgG4, IgG4 exhibited better T-cell activation activity than IgG1.

[0355] Example 27. In vivo study in a colon cancer model.

[0356] Mice carrying human colon cancer (HuCD34NCG-Colo205) were divided into two sets: Set 1 was divided into eight groups, and Set 2 was divided into six groups. In Set 1, Group 1 was the isotype control, Group 2 mice were treated with anti-PD1, Group 3 mice with variant Ab3, Group 4 mice with variant Ab4, Group 5 mice with variant Ab5, Group 6 mice with variant Ab6, Group 7 mice with variant Ab7, and Group 8 mice with AZD4635. Each group in Set 1, except for Group 8, received a dose of 10 mg / kg on a Q3D×6 schedule, and 50 mg / kg twice daily. In Set 2, Group 1 was the isotype control, Group 2 mice were treated with anti-PD1, Group 3 mice with Ab4, Group 4 mice with Ab4 + anti-PD1, Group 5 mice with AB7, and Group 6 mice with AB4 + Ab7. Each group in Set 2 received the total dose of 20 mg / kg on a Q3D × 6 schedule. Tumor volume was measured over 30 days.

[0357] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Many variations, alterations, and substitu...

Claims

1. A pharmaceutical composition for treating colon cancer comprising an antibody or antigen-binding fragment that binds to the adenosine 2A receptor, wherein the antibody or antigen-binding fragment comprises a heavy chain containing a heavy chain variable region (VH) and a light chain containing a light chain variable region (VL), a. The VH includes CDRH1 containing the amino acid sequence of SEQ ID NO: 56, CDRH2 containing the amino acid sequence of SEQ ID NO: 145, and CDRH3 containing the amino acid sequence of SEQ ID NO: 234, and the VL includes CDRL1 containing the amino acid sequence of SEQ ID NO: 323, CDRL2 containing the amino acid sequence of SEQ ID NO: 412, and CDRL3 containing the amino acid sequence of SEQ ID NO: 501, b. The VH includes CDRH1 containing the amino acid sequence of SEQ ID NO: 82, CDRH2 containing the amino acid sequence of SEQ ID NO: 171, and CDRH3 containing the amino acid sequence of SEQ ID NO: 260, and the VL includes CDRL1 containing the amino acid sequence of SEQ ID NO: 349, CDRL2 containing the amino acid sequence of SEQ ID NO: 438, and CDRL3 containing the amino acid sequence of SEQ ID NO: 527, or c. The VH comprises CDRH1 containing the amino acid sequence of SEQ ID NO: 86, CDRH2 containing the amino acid sequence of SEQ ID NO: 175, and CDRH3 containing the amino acid sequence of SEQ ID NO: 264, and the VL comprises CDRL1 containing the amino acid sequence of SEQ ID NO: 353, CDRL2 containing the amino acid sequence of SEQ ID NO: 442, and CDRL3 containing the amino acid sequence of SEQ ID NO:

531. Pharmaceutical composition.

2. a. The VH contains an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 590, and the VL contains an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 679, b. The VH contains an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 616, and the VL contains an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 705, or c. The VH comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 620, and the VL comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:

709. The pharmaceutical composition according to claim 1.

3. a. The VH contains the amino acid sequence of SEQ ID NO: 590, and the VL contains the amino acid sequence of SEQ ID NO: 679, b. The VH contains the amino acid sequence of SEQ ID NO: 616, and the VL contains the amino acid sequence of SEQ ID NO: 705, or c. The VH contains the amino acid sequence of SEQ ID NO: 620, and the VL contains the amino acid sequence of SEQ ID NO:

709. The pharmaceutical composition according to claim 1.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the antibody or its antigen-binding fragment is a monoclonal antibody, a bispecific antibody, a polyspecific antibody, a grafted antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a single-chain Fv(scFv), a Fab fragment, an F(ab')2 fragment, an Fv fragment, a diabody, a disulfide-bonded Fv(sdFv), an intrabody, or an antigen-binding fragment thereof.

5. The antibody or its antigen-binding fragment has a K content of less than 75 nM. D A pharmaceutical composition according to any one of claims 1 to 3, wherein the adenosine 2A receptor is bound to the adenosine 2A receptor.

6. The pharmaceutical composition according to any one of claims 1 to 3, wherein the antibody or its antigen-binding fragment has an IC50 of less than 20 nM in a T cell activation assay.