siRNA and its application for targeted control of PCSK9 gene expression
By designing siRNA sequences with alternating modifications and conjugating them with GalNAc ligands, the siRNA effectively inhibits PCSK9 expression, addressing the unpredictability of existing siRNA activities and enhancing treatment efficacy for hypercholesterolemia.
Patent Information
- Application Number
- JP2025531011
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2023-11-06
- Filing Date
- 2024-03-18
- Publication Date
- 2026-08-26
- Estimated Expiration
- 2044-03-18
AI Technical Summary
Existing siRNA modifications for PCSK9 gene expression are unpredictable in their activity, making it difficult to select effective sequences for treating PCSK9-related diseases, and current therapies for hypercholesterolemia, such as statins and PCSK9 inhibitors, have limitations in efficacy and specificity.
Designing unique siRNA sequences with alternating modifications and specific template modifications, including combinations of 2'-methoxy and 2'-fluoro monomers, and conjugating them with GalNAc ligands to enhance delivery to the liver, resulting in significant inhibition of PCSK9 expression.
The modified siRNA sequences achieve up to 90% inhibition of PCSK9 expression, leading to substantial reductions in serum LDL-C and total cholesterol levels, demonstrating improved therapeutic efficacy compared to unmodified sequences.
Smart Images

Figure 0007911448000090 
Figure 0007911448000091 
Figure 0007911448000092
Abstract
Description
[Technical Field]
[0001] This application claims priority based on the Chinese patent application No. 202311463375.7, title "siRNA for targeted control of PCSK9 gene expression and its application," filed with the China National Intellectual Property Administration on November 6, 2023, and all contents of the former are incorporated into this application by reference.
[0002] (Technical field) This disclosure relates to the technical field of nucleic acid modification, and more specifically to small interfering ribonucleic acid (siRNA) modified by various chemical methods, and to the use of siRNA in the manufacture of agents for the treatment of PCSK9 gene expression-related diseases. [Background technology]
[0003] Nucleic acid drugs, particularly oligonucleotide drugs, are widely used due to their ease of synthesis and relatively high activity. Oligonucleotide drugs typically include antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), microRNAs (miRNAs), and nucleic acid aptamers.
[0004] Oligonucleotides are short DNA or RNA molecules or oligomers that readily bind to their complementary oligonucleotides, DNA, or RNA in a sequence-specific manner, forming double-stranded or rarely seen higher-order hybrids. This fundamental property gives oligonucleotides widespread applications in genetic testing, research, and medicine. In nature, oligonucleotides are typically small RNA molecules that play a role in regulating gene expression, or intermediates obtained from the degradation of larger nucleic acid molecules.
[0005] RNA interference (RNAi) is a natural defense mechanism against foreign genes. siRNA can knock out target genes by recognizing specific sequences and degrading target mRNA.
[0006] The active molecules of classical RNAi consist of an iconic 19+2 nucleotide polymer structure (a double helix structure consisting of 21 nucleotide RNA molecules and 19 nucleotide molecules corresponding to nucleic acid bases, including 3' end overhangs of two nucleotides). One strand of the siRNA (guide strand or antisense strand) is complementary to the target gene transcript mRNA, and the other strand is labeled as the passenger strand (or sense strand). The siRNAs (antisense strand) induce the Argonaut protein (AGO2) to become complementary to the target transcript and become part of the RNA-induced silencing complex (RISC). Because the siRNA (antisense strand) is perfectly complementary to the target, catalyzed by the AGO2 protein, cleavage of the target transcript occurs at positions 10-11 opposite the guide strand (antisense strand).
[0007] siRNA performs its function by completing Watson-Crick type base pairing with mRNA, whereas small molecule and monoclonal antibody drugs need to recognize the complex spatial structure of specific proteins; therefore, siRNA has an inherent advantage over small molecules and antibody drugs. Thus, many patients cannot be treated with small molecules or monoclonal antibodies because the target molecule has high activity and the molecular structure with affinity and binding specificity to it cannot be recognized. Due to its mechanism of action, siRNA drugs can control the expression of target proteins at the gene level and have greater target specificity than small molecules and antibody drugs. Based on the principle of complementary base pairing, the therapeutic range of siRNA is broader, design is simpler, and research and development time is shorter.
[0008] Oligonucleotides can bind sequence - specifically to complementary RNA strands and can induce ribonuclease H such that the target RNA is cleaved after hybridization. In natural oligonucleotides, nucleotides are linked by phosphodiester bonds. Under physiological conditions, since they are particularly sensitive to nucleases, natural, unmodified, and unstructured oligonucleotide drugs are easily and rapidly degraded by nucleases in vivo, have low activity, and low drug - discovery potential. Chemical modification of the structure of oligonucleotides is effective in enhancing their activity, thereby improving the stability of oligonucleotides against nucleases and their affinity for RNA, better promoting endocytosis and tissue targeting, and effectively controlling the expression of target genes.
[0009] According to the basic structure (base, sugar ring, phosphate backbone, terminus) of oligonucleotides, chemical modification can be carried out by dividing them into four parts. 1) Modification of bases: It can be mainly divided into three types: purine modification, pyrimidine modification, and base substitution. Examples of purine modification include N6 - methyladenosine, N1 - methyladenosine, and 7 - methylguanylic acid. Examples of pyrimidine modification include 3 - methyluridine, 5 - methyluridine, 5 - methylcytidine, N4 - acetylcytidine, pseudouridine, thiouridine, propynuridine, and dihydrouridine. 2) Modification of sugar rings: It can be mainly divided into modification and substitution of sugar rings. Examples of sugar - ring modification include 2’ - modification, 4’ - modification, 5’ - modification, isomerization modification, and combinations thereof. The most common 2’ modification of siRNA is 2’ - OMe (2’ - methoxy) and 2’ - F (2’ - fluoro) modification. siRNA modified with both 2’ - OMe and 2’ - F has a higher Tm value, stronger serum stability, and better activity than natural siRNA. 3) Modification of the phosphate backbone: The main modifications include the modification of thiophosphate esters, the modification with methyl phosphate esters, selenophosphate esters, methylboronyl phosphate esters, dithiophosphate esters, and the modification with cross-linked oxygen atoms obtained by substituting the phosphate diester bond linkage region with sulfur atoms, as well as the substitution of the entire phosphate ester group between nucleosides with a phosphorus atom-free group (for example, substituting the P atom with a C, S or N atom to form a guanidine group, S-methylthiourea, etc.). 4) Terminal modification: There are the covalent conjugation of special groups to the terminals of the 5'-end and / or 3'-end of the sense strand, and the phosphorylation modification of the 5'-end of the antisense strand. All commercially available oligonucleotide drugs are chemically modified. Since the approval for the launch of the first nucleic acid drug, Fomivirsen (Vitravene), in 1998, the chemical modification technology of nucleic acid drugs has been continuously improved. So far, 18 nucleic acid drugs have been commercially available worldwide.
[0010]
Table 1
[0011] In the treatment of hypercholesterolemia, the main strategy employed is to reduce low-density lipoprotein cholesterol (LDL-C), which causes atherosclerosis, and increase high-density lipoprotein cholesterol (HDL-C), which has potential cardioprotective effects. A clinical study involving approximately 170,000 patients revealed that for every 1.0 mmol / L decrease in LDL-C levels, the mean annual incidence of major cardiovascular events can be reduced by approximately 20%. The LDL-C lowering drugs recommended in the 2019 "Basic Clinical Practice Guidelines for Dyslipidemia" mainly include statins, cholesterol absorption inhibitors, Robutecol, and PCSK9 inhibitors, with statins being the first-line treatment. The 2018 "Consensus of Chinese Experts on the Selection and Treatment of Familial Hypercholesterolemia" recommends combination therapy with statins, ezetimibe, and PCSK9 inhibitors.
[0012] PCSK9 is a serine protease encoded by the PCSK9 gene and is mainly produced in the liver. PCSK9 binds to LDL receptors (LDL-R) on the surface of hepatocytes and degrades LDL-R. Since LDL-R binds to LDL-C in the plasma and absorbs it into the liver (which processes the lipids within it and excretes them in bile), the degradation of LDL-R leads to an increase in plasma LDL-C levels. PCSK9 inhibitors reduce the expression level of PCSK9 and increase the LDL-R level on the surface of hepatocytes, thereby reducing plasma LDL-C levels and achieving the goal of lowering lipid levels.
[0013] To effectively treat hypercholesterolemia and dyslipidemia, this field needs to further develop drugs that regulate PCSK9 gene expression. [Overview of the Initiative] [Problems that the invention aims to solve]
[0014] This disclosure describes designing a series of unique siRNA sequences for the PCSK9 mRNA sequence and performing alternating modifications and specific template modifications.
[0015] Generally, siRNAs are modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) monomers. However, even considering only the combination of these two monomer modifications, for siRNAs with a total of 44 bases in the sense and antisense strands, 2 44 There are many possible combinations. Furthermore, when we add the different arrangements of terminal thiol modifications, the number of possible modification schemes becomes enormous.
[0016] When different modification forms are used for the same siRNA sequence, the activity differs significantly, and conversely, when the same modification form is used for different siRNAs, the activity also differs significantly. Furthermore, although several modification principles exist for siRNA modification design, it has been reported that it is not possible to accurately predict the activity from the modification form; in other words, there is no definitive relationship between the modification form and the activity. Therefore, selecting a modification scheme with high activity from countless possible modification combinations is extremely difficult.
[0017] In this disclosure, several alternating modification sequences and special modification sequences that have a significant repressive effect on PCSK9 gene expression are selected by chemically modifying the designed siRNA sequence.
[0018] In one embodiment, this disclosure provides a double-stranded RNAi agent for reducing PCSK9 expression, comprising one selected from the following double-stranded oligonucleotides having a sense strand and antisense strand matched. (1) A double-stranded oligonucleotide having the sequence or a fragment thereof shown in SEQ ID NO. 1, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 13, or a modified sequence of the sequence or a fragment thereof, (2) A double-stranded oligonucleotide having the sense strand having the sequence or fragment thereof shown in SEQ ID NO. 2, or a modified sequence of the sequence or fragment thereof, and the antisense strand having the sequence or fragment thereof shown in SEQ ID NO. 14, or a modified sequence of the sequence or fragment thereof, (3) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 3, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 15, or a modified sequence of the sequence or a fragment thereof, (4) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 4, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 16, or a modified sequence of the sequence or a fragment thereof, (5) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 5, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 17, or a modified sequence of the sequence or a fragment thereof, (6) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 6, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 18, or a modified sequence of the sequence or a fragment thereof, (7) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 7, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 19, or a modified sequence of the sequence or a fragment thereof, (8) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 8, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 20, or a modified sequence of the sequence or a fragment thereof, (9) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 9, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 21, or a modified sequence of the sequence or a fragment thereof, (10) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 10, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 22, or a modified sequence of the sequence or a fragment thereof, (11) A double-stranded oligonucleotide having the sense strand the sequence or fragment thereof shown in SEQ ID NO. 11, or a modified sequence of the sequence or fragment thereof, and the antisense strand the sequence or fragment thereof shown in SEQ ID NO. 23, or a modified sequence of the sequence or fragment thereof, (12) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 12, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 24, or a modified sequence of the sequence or a fragment thereof.
[0019] In another embodiment, the disclosure also provides a conjugate for reducing PCSK9 expression, comprising the double-stranded RNAi agent and a ligand conjugated thereto.
[0020] In another embodiment, the disclosure also provides a pharmaceutical composition comprising the double-stranded RNAi agent or conjugate and a pharmaceutically acceptable carrier.
[0021] In another embodiment, the disclosure also provides the use of the double-stranded RNAi agent, conjugate, or composition in the manufacture of a drug for the treatment of PCSK9-related disease.
[0022] In another embodiment, the disclosure also provides a method for treating or preventing a disease or condition that can be regulated by downregulating PCSK9 gene expression.
[0023] The beneficial effects achieved by this disclosure are at least as follows: (1) The unmodified base sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73, and 83 have a significant inhibitory effect on PCSK9, and the inhibition rate can exceed 60%. (2) By using multiple modification sequences, the inhibition rate can reach up to 90% or more. Furthermore, if the modification sequence is conjugated with a GalNAc compound, it can be efficiently delivered to the animal liver, significantly inhibiting PCSK9 gene expression, resulting in a significant decrease in serum low-density lipoprotein cholesterol (LDL-C) levels and a significant decrease in serum total cholesterol (TC) levels. (3) Each sequence modified with the alternating modification and modification templates of this disclosure exhibits significantly improved inhibitory activity against PCSK9 compared to unmodified sequences that are identical or only slightly different from sequences disclosed in the prior art, and this can be increased by up to 40%. (4) This disclosure shows that siRNAs with similar sequences exhibit significantly different activity, regardless of whether they are unmodified or alternatingly modified sequences. For example, the unmodified base sequence 5 showed a 51.2% improvement in inhibition compared to base sequence 4, and the alternatingly modified sequence P92-si5 showed a 61.8% improvement in inhibition compared to P92-si4, demonstrating a significant improvement. (5) Furthermore, this disclosure has shown that alternating modifications to different sequences have varying effects on activity. For example, in some cases the inhibitory rate was significantly improved, with the sequence obtained by alternating modification of base sequence 5 showing a 12.4% improvement in inhibition compared to the unmodified sequence. In other cases the inhibitory rate was hardly changed compared to the unmodified sequence, with the sequence obtained by alternating modification of base sequences 4, 22, and 52 showing little change in inhibition. [Brief explanation of the drawing]
[0024] To more clearly illustrate the technical concepts of the embodiments of this disclosure, some drawings of the embodiments are briefly shown below. It is clear that the drawings in the following description relate only to some embodiments of this disclosure and do not limit the disclosure. [Figure 1] This gene exhibits significant inhibitory effects on the PCSK9 gene, showing alternating modification sequences with an inhibition rate exceeding 50%. [Figure 2] This gene exhibits alternating modification sequences that inhibit the PCSK9 gene by 30% to 50%. [Figure 3] This shows alternating modification sequences that inhibit the PCSK9 gene by less than 30%. [Figure 4] This shows alternating modification sequences that inhibit the PCSK9 gene by less than 30%. [Figure 5] This unmodified sequence exhibits a significant inhibitory effect on the PCSK9 gene, with an inhibition rate exceeding 50%. [Figure 6] This shows unmodified sequences that inhibit the PCSK9 gene by less than 40%. [Figure 7] This shows the inhibition rates of base sequence 5 modified with different templates against the PCSK9 gene. [Figure 8] This shows the inhibition rates against the PCSK9 gene for sequences with template modifications, anti-off-target modifications, and / or 5'-E-VP modifications to base sequences 5, 51, 81, and 84. [Figure 9]This paper shows the inhibition rates against the PCSK9 protein in animal serum after using different modification forms on the base sequences 5, 51, 81, 82, and 84, and after conjugation with a GalNAc compound. [Figure 10] This study shows the reduction levels of low-density lipoprotein cholesterol (LDL-C) in animal serum after using different modification forms on the base sequences 5, 51, 81, 82, and 84, and after conjugation with a GalNAc compound. [Figure 11] This paper shows the reduction levels of total cholesterol (TC) in animal serum after using different modification forms on the base sequences 5, 51, 81, 82, and 84, and after conjugation with a GalNAc compound. [Modes for carrying out the invention]
[0025] To facilitate understanding of this disclosure, several terms are first defined. When parameter values or ranges of values are listed, it is intended to indicate that the intermediate values and ranges of these cited values are also part of this disclosure.
[0026] As used herein, the articles “a” and “an” refer to one or more (i.e., at least one) grammatical objects of the article. For example, “an element” refers to one element, or one or more elements such as multiple elements.
[0027] The term "including" means "including, but not limited to," and is used interchangeably with it.
[0028] The terms "or" mean and are used interchangeably with "and / or" unless the context clearly indicates otherwise.
[0029] The terms “approximately” or “about” used herein in relation to one or more target values refer to values similar to the reference value. In some embodiments, unless otherwise specified or further evident from the context, the terms “approximately” or “about” refer to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the reference value in either direction (greater than or less than) (not exceeding 100% of the possible values).
[0030] As used herein, "PCSK9" refers to the preproprotein convertase subtilisin kexin9 gene or protein.
[0031] "G," "C," "A," and "U" generally represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. "T" and "dT" are interchangeable herein and refer to deoxyribonucleotides whose nucleic acid base is a thymine such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms "ribonucleotide," "nucleotide," or "deoxyribonucleotide" may also refer to modified nucleotides (as further detailed below) or alternative substitutions. It will be well known to those skilled in the art that guanine, cytosine, adenine, and uracil can be substituted for other parts of oligonucleotides (including nucleotides having such substitutions) without substantially altering their base-pairing properties. For example, a nucleotide containing inosine as its base can, but is not limited to, base-pairing with a nucleotide containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine may be substituted in the nucleotide sequences of this disclosure with, for example, nucleotides containing inosine. Sequences containing such substitutions are described in the examples of this disclosure.
[0032] The terms “RNAi agent,” “iRNA,” “iRNA agent,” and “RNA interference agent” are interchangeable herein and refer to terms including RNA agents as defined herein that mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. RNAi directs sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). RNAi controls (e.g., represses) the expression of PCSK9 in cells such as cells in a subject’s body (e.g., a mammalian subject). RNAi molecules include single-stranded RNAi molecules and double-stranded siRNAs, as well as short hairpin RNAs (shRNAs).
[0033] The term "small interfering ribonucleic acid" or "siRNA" refers to a small interfering ribonucleic acid RNAi molecule. It belongs to a single type of double-stranded RNA molecule and is also called short interfering RNA or silencing RNA in the art. siRNA typically comprises a sense strand (also called a passenger strand) and an antisense strand (also called a guide strand), each strand having a length of 17–30 nucleotides and typically a length of 19–25 nucleosides. The antisense strand is complementary to the target nucleic acid (e.g., having at least 95% complementarity, e.g., complete complementarity) (preferably a mature mRNA sequence), and the sense and antisense strands are complementary to form a double-stranded or double-stranded region. The siRNA strands may form a blunt-ended double-stranded structure, or preferably have 3' overhangs such as 1, 2, or 3 nucleosides at the 3' ends of the sense and antisense strands, and can form RISC substrates in vivo, similar to products produced by Dicer. Effective extended forms of the Dicer substrate are described in the specifications of U.S. Patent No. 8349809 and U.S. Patent No. 8513207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have a 2nt 3' overhanging end. Thus, the double-stranded region may have a length of, for example, 17 to 25 nucleotides (e.g., 21 to 23 nucleotides).
[0034] The term “antisense strand” refers to a strand of RNAi (e.g., dsRNA) containing a region substantially complementary to the target sequence. As used herein, the term “complementary region” refers to a region on the antisense strand that is substantially complementary to the sequence as defined herein (e.g., the target sequence). If the complementary region is not perfectly complementary to the target sequence, the mismatch may be within the molecule or in a terminal region. Typically, the most acceptable mismatches are in terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0035] As used herein, the term “sense strand” refers to a strand of RNAi that contains a region substantially complementary to the antisense strand (as defined herein).
[0036] As used herein, the term “inhibition / suppression” may be used interchangeably with “reduction,” “silencing,” “downregulate,” “suppression,” and other similar terms, and includes any degree of inhibition.
[0037] As used herein, the term "inhibition of PCSK9 expression" means inhibiting the expression of any PCSK9 gene (e.g., mouse PCSK9 gene, rat PCSK9 gene, monkey PCSK9 gene, or human PCSK9 gene), and variants (e.g., naturally occurring variants) or mutants of the PCSK9 gene. Thus, the PCSK9 gene may be a wild-type PCSK9 gene, a mutant PCSK9 gene, or a genetically engineered cell, cell population, or, in the case of an organism, a transgenic PCSK9 gene.
[0038] "Inhibition of PCSK9 gene expression" includes any degree of inhibition of the PCSK9 gene, for example, at least partial inhibition of PCSK9 gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0039] PCSK9 gene expression can be assessed based on the level of any variable related to PCSK9 gene expression, such as PCSK9 mRNA levels, PCSK9 protein levels, or serum lipid levels. Inhibition can be assessed by a reduction in one or more of these variables at an absolute or relative level relative to the control level. The control level may be any type of control level used in the art, such as the baseline level before administration, or levels measured from subjects, cells, or samples treated with a similar untreated or control (e.g., buffer control or inactivator control only).
[0040] As used herein, "patient" or "subject" means a human or a non-human animal, preferably a mammal such as a monkey, and most preferably a human.
[0041] As used herein, “PCSK9-related disease” means any disease associated with the PCSK9 gene or protein. Such diseases may be caused, for example, by overproduction of the PCSK9 protein, mutations in the PCSK9 gene, abnormal cleavage of the PCSK9 protein, or abnormal interactions between PCSK9 and other proteins or other endogenous or exogenous substances. Exemplary PCSK9-related diseases include dyslipidemia such as hyperlipidemia, and other forms of dyslipidemia such as hypercholesterolemia and hypertriglyceridemia, as well as pathological conditions associated with these abnormalities, such as heart and circulatory diseases.
[0042] As used herein, “therapeutic dose” means the amount of RNAi agent sufficient to achieve treatment for a PCSK9-related disorder when administered to a patient for the treatment of the disorder (e.g., to reduce, improve or maintain the symptoms of a pre-existing disorder or at least one disorder). The “therapeutic dose” may vary depending on the RNAi agent, the method of drug administration, the disorder and its severity, as well as the patient’s medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by PCSK9 expression, type of previous treatment or combination therapy (if any), and other personal characteristics of the treated patient.
[0043] As used herein, “prophylactic effective dose” means an amount of RNAi agent sufficient to prevent or improve PCSK9-related disease or one or more symptoms of the disease when administered to a subject who has not yet experienced or shown symptoms of the disease but is likely to develop the disease. Improvement of the disease includes slowing the progression of the disease or reducing the severity of the following diseases. The “prophylactic effective dose” may vary depending on the RNAi agent, the method of drug administration, the disease and its severity, as well as the patient’s medical history, age, weight, family history, genetic makeup, type of previous treatment or combination therapy (if any), and other personal characteristics of the treated patient.
[0044] The term “therapeutic effective dose” or “preventive effective dose” also includes the amount of RNAi agent that produces the desired local or systemic effect with a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the method of this disclosure may be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.
[0045] As used herein, the term “sample” includes similar fluids, cells, or tissues separated from a subject, and aggregates of fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, and saliva. Tissue samples may include samples from tissues, organs, or local areas. For example, a sample may originate from a specific organ, organ portion, or fluids or cells in those organs. In some embodiments, a sample may originate from the liver (e.g., the whole liver or a portion of the liver, or certain types of cells in the liver (e.g., hepatocytes)). In a preferred embodiment, “subject-derived sample” means blood or plasma extracted from a subject. In some other embodiments, “subject-derived sample” means liver tissue (or a subcomponent thereof) derived from a subject.
[0046] In one embodiment, this disclosure provides a double-stranded RNAi agent for reducing PCSK9 expression, comprising one selected from the following double-stranded oligonucleotides having a sense strand and antisense strand matched. (1) A double-stranded oligonucleotide having the sequence or a fragment thereof shown in SEQ ID NO. 1, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 13, or a modified sequence of the sequence or a fragment thereof, (2) A double-stranded oligonucleotide having the sense strand having the sequence or fragment thereof shown in SEQ ID NO. 2, or a modified sequence of the sequence or fragment thereof, and the antisense strand having the sequence or fragment thereof shown in SEQ ID NO. 14, or a modified sequence of the sequence or fragment thereof, (3) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 3, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 15, or a modified sequence of the sequence or a fragment thereof, (4) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 4, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 16, or a modified sequence of the sequence or a fragment thereof, (5) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 5, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 17, or a modified sequence of the sequence or a fragment thereof, (6) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 6, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 18, or a modified sequence of the sequence or a fragment thereof, (7) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 7, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 19, or a modified sequence of the sequence or a fragment thereof, (8) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 8, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 20, or a modified sequence of the sequence or a fragment thereof, (9) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 9, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 21, or a modified sequence of the sequence or a fragment thereof, (10) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 10, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 22, or a modified sequence of the sequence or a fragment thereof, (11) A double-stranded oligonucleotide having the sense strand the sequence or fragment thereof shown in SEQ ID NO. 11, or a modified sequence of the sequence or fragment thereof, and the antisense strand the sequence or fragment thereof shown in SEQ ID NO. 23, or a modified sequence of the sequence or fragment thereof, (12) A double-stranded oligonucleotide having the sense strand having the sequence or a fragment thereof shown in SEQ ID NO. 12, or a modified sequence of the sequence or a fragment thereof, and the antisense strand having the sequence or a fragment thereof shown in SEQ ID NO. 24, or a modified sequence of the sequence or a fragment thereof.
[0047] In some embodiments, all nucleotides in the sense strand and antisense strand are modified nucleotides.
[0048] In some embodiments, the double-stranded RNAi agent is an RNAi agent used to inhibit PCSK9 gene expression.
[0049] In some embodiments, the sense strand differs from one of the sequences SEQ ID NO. 1 to 12 by 1 to 3 nucleotides.
[0050] In some embodiments, the antisense strand differs from one of the sequences SEQ ID NO. 13-24 by 1-3 nucleotides.
[0051] In some embodiments, at least one modified nucleotide is selected from the group consisting of deoxynucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, non-natural base-containing nucleotides, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, thiophosphate-containing nucleotides, methylphosphate-containing nucleotides, 5'-phosphate-containing nucleotides, and 5'-phosphate-containing nucleotides.
[0052] In some embodiments, at least one strand contains the 3' overhang of at least one nucleotide.
[0053] In some embodiments, at least one strand contains the 3' overhanging ends of at least two nucleotides.
[0054] In some embodiments, the double-stranded region has a length of 15 to 30 nucleotide pairs.
[0055] In some embodiments, the double-stranded region has a length of 17 to 25 nucleotide pairs.
[0056] In some embodiments, the double-stranded region has a length of 19 to 23 nucleotide pairs.
[0057] In some embodiments, the double-stranded region has a length of 21 nucleotide pairs.
[0058] In some embodiments, each chain has 15 to 30 nucleotides.
[0059] In some embodiments, each chain has 19 to 25 nucleotides.
[0060] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.
[0061] In some embodiments, the modification of all nucleotides in the sense and antisense strands is a chemical modification of the 2' position of the ribose of the nucleotide.
[0062] In some embodiments, the chemical modification at the 2' position of the ribose of the nucleotide is one or a combination of any of the following: 2'-methoxy group, 2'-methoxyethyl group, 2'-fluoro group, 2'-benzyloxy group, 2'-methylcarbonylamino group, and 2'-pyridylmethoxy group.
[0063] In some embodiments, the chemical modification at the 2' position of the ribose of each nucleotide is selected from a combination of a 2'-methoxy group and a 2'-fluoro group.
[0064] In some embodiments, the chemical modification at the 2' position of the ribose of each nucleotide is selected from alternating combinations of 2'-methoxy and 2'-fluoro groups.
[0065] In some embodiments, the chemical modification of the 2' position of ribose in each nucleotide is 2'-fluoromodification at odd positions on the sense strand, 2'-methoxymodification at even positions on the sense strand, 2'-methoxymodification at odd positions on the antisense strand, and 2'-fluoromodification at even positions on the antisense strand.
[0066] In some embodiments, nucleotide monomers are linked together by 3',5'-phosphate diester bonds.
[0067] In some embodiments, nucleotide monomers are linked together by thiolated 3',5'-phosphate diester bonds.
[0068] In some embodiments, the oligonucleotide is The antisense chain uses one of the following modification forms A, B, and C, and the sense chain uses either the following modification form a or b. TIFF0007911448000003.tif138168 (In the table above, 2'-OMe represents a 2'-methoxy group, 2'-F represents a 2'-fluoro group, and PS represents a thiophosphate skeleton.) When modification A is used on the antisense chain, when modification form a is used on the sense chain, When modification B is used on the antisense chain, when modification form a is used on the sense chain, When modification C is used in the antisense chain, when modification form a is used in the sense chain, When modification B is used for the antisense chain, when modification form b is used for the sense chain, When modification C is used on the antisense chain, the sense chain has the same modification as when modification form b is used.
[0069] In some embodiments, the 2nd to 8th positions from the 5' end of the antisense strand are modified using a group selected from UNA, GNA, and DNA. However, the structures of UNA and GNA are as follows. [ka] (In the formula, the base is selected from adenine, guanine, cytosine, thymine, and uracil.)
[0070] In some embodiments, the phosphorylation of the carbon atom at the 5' position in the glycoside of the nucleotide at the 5' end of the modified antisense chain may include, but are not limited to, 5'-position phosphorylation groups such as 5'-vinylphosphonic acid group (5'-E-VP), 5'-methylphosphonic acid group (5'-MP), 5'-C-methylphosphate group, 5'-thiophosphate group (5'-PS), and 5'-phosphate group (5'-P). [ka] (In the formula, R is hydrogen, hydroxyl group, amine group, C 1-4 Alkyl group, aryl group, C 1~4 Alkoxy group, C 1~4 It is an alkylcarbonylamino group or a halogen, The base is selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil.
[0071] In some embodiments, the 3',5'-phosphate diester bonds that link nucleotide monomers at the ends of the sequence have thiolation modifications to form chiral pure 3',5'-thiophosphate diester bonds, with the 5' ends of the sense and antisense strands containing 1 to 3 thiolation bonds, and the 3' end of the antisense strand containing 1 to 3 thiolation bonds.
[0072] The double-stranded RNA (dsRNA) agent of this disclosure may be conjugated to one or more ligands. The ligand may have a sense strand, an antisense strand, or both strands attached to its 3' end, 5' end, or both ends. For example, the ligand may be conjugated to the sense strand. In a preferred embodiment, the ligand is bound to the 3' end of the sense strand. In a preferred embodiment, the ligand is a GalNAc ligand.
[0073] In another embodiment, this disclosure provides a conjugate (also called a conjugate) for reducing PCSK9 expression, comprising the above-mentioned double-stranded RNAi agent and a ligand conjugated thereto.
[0074] In some embodiments, the ligand is conjugated to the 3' or 5' end of the sense strand of the oligonucleotide.
[0075] In some embodiments, the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.
[0076] In some embodiments, the ligand is represented by the following structural formula. [ka] (In the formula, X is hydrogen, or a hydroxyl protecting group including an acetyl group, a benzoyl group, and an isobutyryl group, or H; Y is an amine protecting group selected from the group consisting of a formyl group, an acetyl group, a propionyl group, an n-butyryl group, and an isobutyryl group, or H; n is an integer from 0 to 20; and q, r, and s are each an integer from 1 to 7.)
[0077] In some embodiments, the ligand is represented by the following structural formula. [ka]
[0078] In some embodiments, the ligand is represented by the following structural formula.
Chemical formula
[0079] In some embodiments, the ligand is represented by the following G4, G5, G6 or G7.
Chemical formula
[0080] In some embodiments, the conjugate (also called a compound) has the following structure. [ka]
[0081] In some embodiments, the double-stranded RNAi agent comprises one selected from double-stranded oligonucleotides having a sense strand and antisense strand matched and conjugated with ligand G4, G5, G6, or G7. (1) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 337 for the sense strand and the sequence shown in SEQ ID NO. 427 for the antisense strand, (2) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 337 for the sense strand and the sequence shown in SEQ ID NO. 428 for the antisense strand, (3) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 342 for the sense strand and the sequence shown in SEQ ID NO. 381 for the antisense strand, (4) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 342 for the sense strand and the sequence shown in SEQ ID NO. 430 for the antisense strand, (5) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 342 for the sense strand and the sequence shown in SEQ ID NO. 431 for the antisense strand, (6) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 347 for the sense strand and the sequence shown in SEQ ID NO. 384 for the antisense strand, (7) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 347 for the sense strand and the sequence shown in SEQ ID NO. 437 for the antisense strand, (8) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 347 for the sense strand and the sequence shown in SEQ ID NO. 438 for the antisense strand, (9) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 348 for the sense strand and the sequence shown in SEQ ID NO. 385 for the antisense strand, (10) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 352 for the sense strand and the sequence shown in SEQ ID NO. 448 for the antisense strand, (11) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 353 for the sense strand and the sequence shown in SEQ ID NO. 390 for the antisense strand, (12) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 353 for the sense strand and the sequence shown in SEQ ID NO. 448 for the antisense strand, (14) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 357 for the sense strand and the sequence shown in SEQ ID NO. 393 for the antisense strand, (15) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 357 for the sense strand and the sequence shown in SEQ ID NO. 446 for the antisense strand, (16) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO.357 for the sense strand and the sequence shown in SEQ ID NO.447 for the antisense strand.
[0082] In some embodiments, the double-stranded RNAi agent comprises one selected from double-stranded oligonucleotides having a sense strand and antisense strand matched and conjugated with ligand G4, G5, G6, or G7. (1) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 352 for the sense strand and the sequence shown in SEQ ID NO. 448 for the antisense strand, (2) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 353 for the sense strand and the sequence shown in SEQ ID NO. 390 for the antisense strand, (3) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 353 for the sense strand and the sequence shown in SEQ ID NO. 448 for the antisense strand.
[0083] In some embodiments, the double-stranded RNAi agent comprises a double-stranded oligonucleotide in which a sense strand indicated by SEQ ID NO. 353 and an antisense strand indicated by SEQ ID NO. 448 are matched and conjugated with ligand G5.
[0084] In another embodiment, this disclosure provides a pharmaceutical composition comprising the above-mentioned double-stranded RNAi agent or its conjugate and a pharmaceutically acceptable carrier.
[0085] This specification provides, in several embodiments, pharmaceutical compositions comprising the RNAi described herein and a pharmaceutically acceptable carrier. The RNAi-containing pharmaceutical compositions can be used to treat diseases or conditions related to PCSK9 gene expression or activity, such as lipid disorders. Such pharmaceutical compositions are formulated based on a delivery model. One example is a systemic administration composition formulated for parenteral delivery, such as intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, such as intracerebral infusion, such as continuous pump infusion.
[0086] The pharmaceutical compositions comprising the RNAi agent of this disclosure may be, for example, solutions with or without a buffer, or compositions comprising a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micelle formulations, emulsions, and gene therapy vectors.
[0087] In the methods of this disclosure, the RNAi agent may be administered as a solution. The free RNAi agent may be administered as a non-buffered solution, such as physiological saline or water. Alternatively, the free siRNA may be administered as a suitable buffer solution. This buffer solution may contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, this buffer solution is phosphate-buffered saline (PBS). The pH and volume molar osmotic concentration of the buffer containing the RNAi agent can be adjusted to be suitable for administration to a subject.
[0088] In some embodiments, the buffer solution further comprises reagents for controlling the osmolality of the solution so that the osmolality is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffer solution to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the osmolality of the solution is a salt. In some embodiments, the reagent for controlling the osmolality of the solution is sodium chloride or potassium chloride.
[0089] The pharmaceutical compositions of this disclosure may be administered in doses sufficient to inhibit PCSK9 gene expression. Typically, appropriate doses of RNAi of this disclosure range from about 0.001 to 200.0 mg per kg of body weight of a subject per day, usually in the range of about 1 to 50 mg / kg per kg of body weight per day. For example, RNAi agents (e.g., dsRNA) may be administered in single doses of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3 0.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7 0.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19 It may be administered at doses of 0.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / kg.
[0090] The pharmaceutical composition may be administered once a day, or the RNAi may be administered in two or three or more subdoses at appropriate intervals per day, or a controlled-release formulation may be administered by continuous infusion or delivery. In this case, the amount of RNAi contained in each subdose must be correspondingly small in order to achieve the total daily dose. The dose units may be formulated to be delivered over several days, for example, by using a conventional sustained-release formulation that sustainably releases RNAi over several days. Sustained-release formulations are well known in the art and are particularly useful for delivering drugs to specific sites, and can therefore be used with the drugs of this disclosure. In this embodiment, the dose unit comprises a plurality of corresponding daily doses.
[0091] In other embodiments, a single dose of the pharmaceutical composition can be sustained for a long period of time such that the interval between subsequent doses is 3, 4, or 5 days or less, or 1, 2, 3, or 4 weeks or less. In some embodiments of the Disclosure, the pharmaceutical composition of the Disclosure is administered once per week in a single dose. In other embodiments of the Disclosure, the pharmaceutical composition of the Disclosure is administered once every two months in a single dose.
[0092] Those skilled in the art will understand that certain factors, including but not limited to the severity of the disease or disorder, previous treatments, the subject's overall health and / or age, and other pre-existing conditions, may influence the dose and timing required to effectively treat a subject. Furthermore, treatment of a subject with a therapeutically effective dose of the composition may include a single treatment or a series of treatments. As described elsewhere in this specification, the effective dose and in vivo half-life of each RNAi contained herein can be estimated based on conventional methods or in vivo experiments using appropriate animal models.
[0093] The pharmaceutical compositions of this disclosure may be administered by many routes, depending on topical or systemic treatment and the area being treated. Administration may be topical (e.g., by skin patch), pulmonary (e.g., by nebulizer inhalation or blowing of powder or aerosol), intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration may include intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, subdermal administration by implant or the like, or intracranial administration such as into the brain parenchyma, intrathecal cavity or ventricle.
[0094] The RNAi used in the compositions and methods of this disclosure can be formulated to deliver liposomes or micelles in membrane molecular assemblies. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer (e.g., one or more bilayers). Liposomes comprise monolayer or multilayer vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi composition. The lipid-soluble material typically separates the aqueous interior from the aqueous exterior (which may contain the RNAi composition in some examples). Liposomes are useful for transporting active ingredients and delivering them to the site of action. Because the liposome membrane is structurally similar to that of biological membranes, when liposomes are applied to tissue, the liposome bilayer fuses with the cell membrane bilayer. As the liposome-cell fusion proceeds, the internal aqueous contents containing RNAi are delivered to the cell, and the RNAi can specifically bind to target RNA and mediate RNAi delivery. In some cases, liposomes may be specifically targeted, for example, to direct RNAi towards a particular cell type.
[0095] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent to form micelles. For example, the lipid component may be an amphiphilic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration or may be nonionic. Examples of detergents include cholates, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. Next, the RNAi agent formulation is added to the micelles containing the lipid component. The cationic groups on the lipids interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example, by dialysis, to obtain the liposomal formulation of the RNAi agent.
[0096] RNAi such as the dsRNAs of this disclosure can be fully packaged in lipid formulations (e.g., LNPs or other nucleic acid-lipid particles).
[0097] As used herein, the term "LNP" refers to stable nucleic acid-lipid particles. LNPs include cationic lipids, non-cationic lipids, and lipids that hinder particle aggregation (e.g., PEG-lipid conjugates). LNPs are extremely useful for synthetic applications because they exhibit a long circulating lifetime after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically distant from the injection site).
[0098] In one embodiment, the ratio of lipid to drug (mass / mass ratio) (e.g., the ratio of lipid to dsRNA) is in the range of approximately 1:1 to 50:1, approximately 1:1 to 25:1, approximately 3:1 to 15:1, approximately 4:1 to 10:1, approximately 5:1 to 9:1, or approximately 6:1 to 9:1.
[0099] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.
[0100] In some preferred embodiments, the cationic lipid is a compound having the structure represented by the following formula (I), or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there is YK-009 having the structure of the following formula (II) (see Patent CN114044741B). [ka] (In the formula, G1 is C 1~6 It is an alkylene group, and G2 is C 2~8 It is an alkylene group, and G3 is C 1~3 It is an alkylene group, and L1 is C 6~15 It is a linear alkyl group, and L2 is C 12~25 It is a branched alkyl group.
[0101] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (II) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there are YK-401 with the following formula (II-I) structure and YK-402 with the following formula (II-II) structure (see Patent CN115784921B). [ka] (In the formula, G1 is C 2~8 It is an alkylene group, and G2 is C 2~8 It is an alkylene group, where L1 is C(O)O- or -OC(O)-, L2 is C(O)O- or -OC(O)-, and R1 is C 6~25 It is a linear or branched alkyl group, and R2 is C 6~25 It is a linear or branched alkyl group, where G3 is HO(CH2)2- or HO(CH2)3-, G4 is HO(CH2)2- or HO(CH2)3-, and L is (CH2)2-, -(CH2)3-, or -(CH2)4-.
[0102] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (III) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there are YK-201 with the following structure of formula (III-I) and YK-202 with the structure of formula (III-II) (see Patent CN115677518B). [ka] (In the formula, G1 is C 1~6 It is an alkylene group, and G2 is C 2~8 It is an alkylene group, and R1 is C 6~20 It is a linear or branched alkyl group, and R2 is C 12~25 It is a branched alkyl group, and G3 is HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2-, or CH3CH2NH(CH2)2-.
[0103] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (IV) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there are YK-305 with the structure of formula (IV-I) and YK-310 with the structure of formula (IV-II) (see Patent CN115745820B). [ka] (In the formula, G1 is C 1~8 It is an alkylene group, and G2 is C 2~8 It is an alkylene group, and R1 is C 6~25 It is a linear or branched alkyl group, and R2 is C 12~25 It is a linear or branched alkyl group, where G3 is HO(CH2)2N(R3)CH2CH(OH)CH2- (where R3 is -CH3, -CH2CH3, or -CH2CH2OH).
[0104] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (V) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there is ALC0315 with the structure of the following formula (VI) (see Patent CN108368028B). [ka] (In the formula, G 1 and G 2 Each of these is an independent, unsubstituted C6~C 10 It is an alkylene group, G 3 This is unsubstituted C1~C 12 It is an alkylene group, and R1 and R2 are independently C6~C6 24 Alkyl alkyl groups or C6-C 24 It is an alkenyl group, R 3 is OR 5 , N, -C(=O)OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 And R 4 is C1~C 12 It is a hydrocarbon group, R 5 (This is H or a C1-C6 hydrocarbon group.)
[0105] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (VI) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. For example, there is SM102 with the following formula (VI-I) structure (see patent CN110520409A). [ka] (In the formula, R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) nA selection is made from the group consisting of N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and a hetero ring, where n is 1, 2, or 3, and each R is independently C 1~3 Alkyl alkyl group, C 2~3 Alkenyl group, (CH2) q A group consisting of OR* and H is selected, each q is independently selected from 1, 2 and 3, and each R* is independently selected from C 1~12 Alkyl alkyl group or C 2~12 Each X is independently selected from the group consisting of alkenyl groups, with each X being chosen from the group consisting of F, Cl, Br, and I.
[0106] In some preferred embodiments, the cationic lipid is a compound represented by the following formula (VII) or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer (see CN102625696B, DLIN-MC3-DMA). [ka]
[0107] In some more preferred embodiments, the cationic lipids include YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.
[0108] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.
[0109] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.
[0110] In some preferred embodiments, the molar ratio of the cationic lipid:neutral lipid:structural lipid:polymer-conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).
[0111] In some preferred embodiments, the molar ratio of the cationic lipid:neutral lipid:structural lipid:polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).
[0112] In some more preferred embodiments, the molar ratio of the cationic lipid:neutral lipid:structural lipid:polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.
[0113] In some preferred embodiments, the neutral lipids include one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol, and derivatives thereof.
[0114] In some more preferred embodiments, the neutral lipids are 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), and 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuxinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16LysoPC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-difytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerin)(DOPG) sodium salt, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoyl-phosph It is one or more selected from phosphate ethanolamine (DSPE), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphatidylethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.
[0115] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.
[0116] In some preferred embodiments, the structural lipid is one or more selected from cholesterol, nonsterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.
[0117] In some more preferred embodiments, the structural lipid is cholesterol.
[0118] In some preferred embodiments, the polymer-bound lipid is one or more selected from PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.
[0119] In some more preferred embodiments, the polymer-conjugated lipid is one or more selected from distearoylphosphatidylethanolamine-polyethylene glycol 2000 (DSPE-PEG), dimyristoylglycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG), and methoxypolyethylene glycol ditetradecylacetamide (ALC-0159).
[0120] The pharmaceutical compositions of this disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be prepared from a variety of components, such as preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. Particularly preferred are formulations that target the liver when treating liver damage (e.g., liver cancer).
[0121] The pharmaceutical formulations of this disclosure (which may conveniently be unit dosage forms) can be prepared according to common methods well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with their drug carrier or excipients. Generally, these formulations are prepared by uniformly and finely combining the active ingredient with a liquid carrier or a finely dispersed solid carrier or both, and the product can be further molded as needed.
[0122] The compositions of this disclosure may be prepared in any possible dosage form. Dosage forms include, but are not limited to, tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of this disclosure may be prepared as suspensions, such as in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain agents that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspensions may also contain stabilizers.
[0123] In certain compositions of this disclosure, a carrier compound is further incorporated into the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid or analogue that is inert (i.e., not biologically active itself) but is considered a nucleic acid in vivo because it reduces the bioavailability of biologically active nucleic acids by degrading them or facilitating their removal from circulation. When nucleic acids are used in combination with a carrier compound (usually in excess of the latter), the amount of nucleic acid recovered in the liver, kidney, or other extracorporeal circulation reservoir can be significantly reduced, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, when used in combination with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4'-isothiocyanato-2,2'-stilbendisulfonic acid, the recovery of partially thiophosphorylated dsRNA in liver tissue can be reduced.
[0124] In contrast to carrier compounds, a "drug carrier" or "excipient" is a pharmaceutically acceptable solvent, suspension, or other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected to provide a desired volume, viscosity, etc., when combined with nucleic acids and other components such as a specific pharmaceutical composition, with reference to the desired means of administration. Typical drug carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, hydroxypropyl methylcellulose), fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylate, or calcium hydrogen phosphate), lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearate, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate), disintegrants (e.g., starch, sodium starch glycolate), and wetting agents (e.g., sodium lauryl sulfate).
[0125] pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not react toxicly with nucleic acids may also be used to prepare the compositions of this disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, or polyvinylpyrrolidone.
[0126] Nucleic acid topical administration formulations may include common solvents such as alcohol, sterile or non-sterile aqueous solutions, non-aqueous solutions, or nucleic acid solutions in liquid or solid oil matrices. These solutions may include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not react toxicly with nucleic acids may be used.
[0127] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, or polyvinylpyrrolidone.
[0128] The dosage forms, carrier compounds, drug carriers, excipients, etc., of the above-mentioned compositions are described in U.S. Patent No. 10125369B2. The contents of this patent are incorporated herein by reference.
[0129] This disclosure also provides methods for treating or preventing diseases and conditions that can be regulated by downregulating PCSK9 gene expression. For example, the RNAi agents described herein can be used to treat dyslipidemia such as hyperlipidemia, and other forms of dyslipidemia such as hypercholesterolemia and hypertriglyceridemia, as well as pathological conditions associated with these abnormalities, such as heart and circulatory diseases. Other diseases and conditions that can be regulated by downregulating PCSK9 gene expression include, but are not limited to, lysosomal storage disorders such as Niemann-Pick disease, Tay-Sachs disease, lysosomal acid lipase deficiency, and Gaucher disease. The RNAi agents described herein can be used to treat cardiovascular diseases such as coronary artery disease (CHD), cerebrovascular disease (CVD), aortic stenosis, peripheral vascular disease, atherosclerosis, arteriosclerosis, myocardial infarction (heart attack), cerebrovascular disease (stroke), transient ischemic attack (TIA), angina pectoris (stable or unstable), atrial fibrillation, arrhythmia, valvular heart disease and / or congestive heart failure or any other condition. These methods involve administering the RNAi agents, conjugates, or compositions of the herein disclosure to a subject in a therapeutically effective or prophylactically effective dose. In some embodiments, the method involves administering PCSK9 siRNA in a therapeutically effective dose to a patient having an LDLR heterozygous gene mutation.
[0130] The RNAi agents of this disclosure may be administered to subjects using any means of administration known in the art. These means of administration include, but are not limited to, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal fluid, and any combination thereof. In preferred embodiments, these agents are administered subcutaneously.
[0131] In other embodiments, siRNA may be administered in combination with another therapeutic agent. The siRNA and the other therapeutic agent may be administered together as the same composition, for example, by parenteral administration, or the other therapeutic agent may be administered as part of a separate composition or by other methods described herein.
[0132] Other examples of therapeutic agents include well-known drugs for treating lipid disorders such as hypercholesterolemia, atherosclerosis, dyslipidemia, or cardiovascular and cerebrovascular diseases. For example, alternative therapeutic agents for treating hyperlipidemia are selected from fibrates, statins, bile acid sequesters, and nicotinic acids. Alternative therapeutic agents for treating cardiovascular and cerebrovascular diseases are selected from angiotensin-converting enzyme inhibitors (e.g., captopril, enalapril, benazepril, or perindopril), angiotensin II receptor antagonists (e.g., losartan, losartan / hydrochlorothiazide, valsartan, valsartan / hydrochlorothiazide, telmisartan, telmisartan / tanhydrochlorothiazide, olmesartan medoxomil), and β-receptor blockers (e.g., propranolol, bisoprolol, metoprolol tartrate, metoprolol succinate).
[0133] In some embodiments, the RNAi agent is administered to the patient, followed by another therapeutic agent (or vice versa). In some other embodiments, the RNAi agent and the other therapeutic agent are administered simultaneously.
[0134] In another embodiment, the present disclosure provides the use of the double-stranded RNAi agent, conjugate, or composition in the manufacture of a drug for treating PCSK9-related disease.
[0135] In another embodiment, the present disclosure provides the use of the double-stranded RNAi agent, conjugate, or composition in the manufacture of agents for treating hypercholesterolemia, atherosclerosis, dyslipidemia, or cardiovascular and cerebrovascular diseases.
[0136] In some embodiments, the PCSK9-related disease is selected from hypercholesterolemia, atherosclerosis, dyslipidemia, cardiovascular and cerebrovascular diseases.
[0137] The following examples are used to illustrate the present disclosure, but are not intended to limit the scope of the disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0138] The abbreviations for nucleotides used in this specification are as follows: A = Adenosine-3'-phosphate ester Am=2'-O-methoxyadenosine-3'-phosphate Ams = 2'-O-methoxyadenosine-3'-thiophosphate Af = 2'-Fluoradenosine-3'-phosphate ester Afs = 2'-Fluoradenosine-3'-thiophosphate G = Guanosine-3'-phosphate ester Gm = 2'-O-methoxyguanosine-3'-phosphate ester Gms = 2'-O-methoxyguanosine-3'-thiophosphate ester Gf = 2'-Fluoroguanosine-3'-phosphate ester Gfs = 2'-Fluoroguanosine-3'-thiophosphate C = Cytidine-3'-phosphate ester Cm=2'-O-methoxycytidine-3'-phosphate ester Cms = 2'-O-methoxycytidine-3'-thiophosphate ester Cf = 2'-Fluorocytidine-3'-phosphate ester Cfs = 2'-fluorocytidine-3'-thiophosphate ester U = Uridine-3'-phosphate ester Um = 2'-O-methoxyuridine-3'-phosphate ester Ums = 2'-O-methoxyuridine-3'-thiophosphate ester Uf = 2'-Fluorouridine-3'-phosphate ester Ufs = 2'-Fluorouridine-3'-thiophosphate ester AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'-thiophosphate UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'-thiophosphate ester Agna = Adenosine Glycol Nucleic Acid Cgna = Cytidine-glycol nucleic acid Ggna = Guanosine Glycol Nucleic Acid Tgna = Thymidine-glycol nucleic acid Ugna = Uridine-glycol nucleic acid [Examples]
[0139] Example 1 Synthesis of alternatingly modified low molecular weight interfering oligonucleotides Eighty-four siRNA base sequences were designed based on the PCSK9 mRNA sequence. To improve the inhibitory efficiency and stability of the sequences, the base sequences were alternatingly modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) and thiolated at the ends. The sense strand had 2'-F modifications at all odd positions and 2'-OMe modifications at all even positions, while the antisense strand had 2'-OMe modifications at all odd positions and 2'-F modifications at all even positions. Furthermore, the sense strand had two thiolation modifications at its 5' end, and the antisense strand had two thiolation modifications at its 5' and 3' ends, respectively. The alternatingly modified siRNA sequences are shown in Table 2.
[0140] 1. Synthesis of alternating modification sequence P92-si5 The base sequence of the small interfering RNA with sequence number P92-si5 in Table 2 is: Sense chain: 5'-AAGAUCCUGCAUGUCUUCCAU-3' (SEQ ID NO.1) The antisense strand was 5'-AUGGAAGACAUGCAGGAUCUUGG-3' (SEQ ID NO.13). 2'-F modifications were used at odd-numbered positions on the sense strand and even-numbered positions on the antisense strand, while 2'-OMe modifications were used at other positions. Furthermore, there were two thiolation modifications at the 5' end of the sense strand, and two thiolation modifications at both the 5' and 3' ends of the antisense strand.
[0141] Equipment and reagents: Automated DNA / RNA synthesizer (Model 192P, Beijing Tsingke Biotech Co., Ltd.) Solid-phase support: General-purpose support for cross-linked polystyrene beads (Model number: Primer support 5G Unylinker 350, Cytiva Co., Ltd.)
[0142] Preparation method: Nucleotide monomer solutions were prepared using acetonitrile at a monomer concentration of 0.15 M, including DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3), DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-AF phosphoramidite monomer (Formula 5), DMT-CF phosphoramidite monomer (Formula 6), DMT-GF phosphoramidite monomer (Formula 7), and DMT-UF phosphoramidite monomer (Formula 8). [ka]
[0143] It was prepared using the following steps. (1) Deprotection The DMT protecting group was removed using a 3% dichloroacetic acid-toluene solution as a deprotection reagent, and then washed with acetonitrile. (2) Coupling For each nucleotide monomer, coupling was performed using 0.25 M 5-(ethylthio)-1H-tetrazole as an activator in acetonitrile solutions, and then the solutions were washed with acetonitrile. (3) Oxidation / Sulfidation Oxidation: Oxidation was carried out using a 0.05 M iodine-pyridine / water (90 / 10) solution as the oxidizing agent, followed by washing with acetonitrile. Sulfidation: Sulfidation was performed using a 3% xanthan hydride pyridine solution as the sulfidating agent, followed by washing with acetonitrile. (4) Protection of the hydroxyl group The hydroxyl groups were protected using a 10% tetrahydrofuran acetate solution (Cap A) or tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (Cap B) as a protective agent for the hydroxyl groups, and then washed with acetonitrile. The above process was repeated and cycled through the set sequence to obtain the total protection product. (5) The DMT protecting group of the last nucleotide was removed using a 3% dichloroacetic acid-toluene solution as a deprotection agent, and then washed with acetonitrile. (6) Aminolysis and Purification The solid support was transferred to a reactor and concentrated aqueous ammonia (25-28%) was added. The aminolysis was maintained at 60°C for 12 hours, and then cooled to room temperature. The mixture was transferred to a filter press and washed with a mixed solution of purified water and ethanol. The filtrates were combined, passed through a chromatography column, concentrated, and freeze-dried to obtain the product. (7) Annealing The purified sense chain and antisense chain were mixed in a 1:1 ratio, heated to 95°C and held for 3 minutes, then slowly cooled to room temperature to form a double helix. Purity of P92-si5: 97.4%, Molecular weight measured: 14493.52
[0144] 2. Combination of other sequences Other sequences shown in Table 2 were synthesized according to the method described above.
[0145] [Table 2] TIFF0007911448000020.tif247168TIFF0007911448000021.tif247168TIFF0007911448000022.tif247168TIFF0007911448000023.tif157168
[0146] Example 2: Inhibitory effect of alternating modification sequences on the PCSK9 gene The siRNA sequences synthesized in Example 1, which were alternately modified with 2'-OMe and 2'-F, were transfected into HELA cells via lipid nanoparticles (LNPs). The inhibitory effect of each sequence on the PCSK9 gene was measured using qPCR technology.
[0147] 1. Experimental materials Sample: The alternatingly modified low molecular weight interfering RNA sequence P92-si1-84 shown in Table 2 (synthesized in Example 1). Cell type: HeLa cell line HELA cells Drug solvent: Enzyme-free sterile water, Gibco Opti-MEM.
[0148] 2. Experimental Method The inhibitory effect of the sample on the mRNA expression of the PCSK9 gene in HELA cell lines was measured using the qRT-PCR method.
[0149] 2.1 Cell culture HELA cell lines were collected after multiple subcultures. Cells in the logarithmic growth phase were cultured in 10% fetal bovine serum RPMI 1640 medium (supplemented with 10 μL / mL of 100× penicillin and streptomycin) at 37°C in a 5% CO2 incubator, with the medium changed once daily. The subcultured cells were digested with 0.25% trypsin, centrifuged at 1000 r / min for 5 minutes, the supernatant was discarded, and fresh medium was added for further subculture.
[0150] 2.2 Cell transfection Preparation of transfection mixture: Lipofectamine RNAiMAX and Opti-MEM were mixed in a ratio of 1.5:98.5, and then mixed using a vortex mixer. Preparation of transfection reagent: 60 μL of siRNA solution diluted with Opti-MEM was added to 60 μL of transfection mixture in a 1:1 (v / v) ratio. The mixture was then mixed using a vortex mixer and allowed to stand at room temperature for 15 minutes to obtain lipid nanoparticles (LNPs). 12.5 μL of these LNPs were used for encapsulation efficiency measurement. Transfection reagent for the blank control group: 60 μL of the prepared transfection mixture was added to 60 μL of Opti-MEM, mixed with a vortex mixer, and allowed to stand at room temperature for 15 minutes. The prepared transfection reagent was added to a 24-well cell culture plate (100 μL / well) so that the final siRNA concentration was 1 nM / well. 4 500 μL of (cells / ml) was added, mixed using the cross-mixing method, and incubated in a 37°C, 5% CO2 incubator for 40 hours.
[0151] 2.3 Measurement of PCSK9 mRNA 1) RNA extraction a. The culture medium was removed from the 12-well plate. 0.5 mL of 1×PBS was added to each well to wash the cells, and the PBS was removed. 0.5 mL of TRIzol reagent was added to each well. The cells were pipetted to completely lyse and transferred to a 1.5 mL RNA enzyme-free EP tube, where they were allowed to stand at room temperature for 5 minutes. b. 0.1 mL of chloroform was added to each tube, and the mixture was shaken vigorously for 15 seconds. The mixture was then allowed to stand at room temperature for 5 minutes. After centrifugation at 4°C and 12000 × g for 15 minutes, 200 μL of the supernatant was collected in a new EP tube. c. Equivolute amounts of isopropanol were added. The liquid in the tube was inverted and gently mixed, and allowed to stand at -20°C for 10 minutes. After centrifugation at 4°C and 12000×g for 15 minutes, the supernatant was discarded. d. Add 0.5 mL of 75% ethanol and gently wash the RNA precipitate. Centrifuge at 12000 × g at 4°C for 5 minutes, then remove the supernatant. Repeat the washing once. Centrifuge at 12000 × g at 4°C for 1 minute, then remove residual ethanol using a micropipette tip. e. The residual ethanol was dried at room temperature for 2-3 minutes. 40 μL of RNase-free ddH2O was added and dissolved. 2) Measurement of RNA concentration RNA concentration was measured using NanoDrop. 2 μL of RNase-free ddH2O was used as a control, and 2 μL of RNA sample was used for each measurement. Sample concentrations were recorded. 3) Quantitative measurement of PCSK9 mRNA The remaining components, excluding the primer and template, were added in 7.5 × 84 = 630 parts to a 15 mL centrifuge tube and marked as A. Eighty-four 1.5 mL EP tubes were marked. 7 parts per tube were added to 77 μL of A and 420 ng of total RNA, and mixed (marked as B). Upstream and downstream primers for the internal standard gene GAPDH and the target gene PCSK9 were mixed (marked as C). Add 11 μL of B and 1 μL of C to each well of the PCR plate, cover with sealing film, centrifuge at 3000 rpm for 1 minute, and transfer to the instrument. *This process was carried out on ice to maintain low temperatures. The plate was placed in the qPCR instrument and operated according to the following program. Reverse transfer: 55°C, 15 minutes. Thermal denaturation: 95°C, 30 seconds. Cycle reaction: 95°C, 10 seconds. 60°C, 35 seconds. 40 cycles. Melting curve: 95°C, 15 seconds. 60°C, 60 seconds. 95°C, 15 seconds. The operating time was set to approximately 2 hours. The experimental results were analyzed, and 2-ΔΔCt was calculated.
[0152] 2.4 Data Processing The mRNA expression rate (%) of PCSK9 was calculated as follows: Expression rate = (PCSK9 mRNA expression level / PCSK9 mRNA expression level in the blank control group) × 100% Inhibition rate of PCSK9 gene expression = 1 - expression rate (%)
[0153] 3. Experimental Results The inhibition rates in this example are the average values from four experiments. The inhibition rates of each sequence against PCSK9 mRNA expression in HELA cells are shown in Tables 4-6. Experimental results showed that alternating 2'-OMe and 2'-F modification sequences, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83 (specific sequences are shown in Table 3), had a significant inhibitory effect on PCSK9 mRNA expression in HELA cells, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates for P92-si5, P92-si81, P92-si82, P92-si3, P92-si8, and P92-si31 were over 70%. Other sequences showed relatively low inhibitory effects on PCSK9 mRNA expression, with inhibition rates all below 50%.
[0154] [Table 3]
[0155] Tables 4-6 show the inhibition rates of each sequence for PCSK9 mRNA expression in HELA cells. (1) Of the 84 sequences designed, 12 sequences, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83, showed significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8, and P92-si31 exceeded 70%.
[0156] [Table 4]
[0157] Table 4 shows that a total of 12 alternating modification sequences, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83 (specific sequences are shown in Table 3), had a significant inhibitory effect on PCSK9 mRNA expression, with inhibition rates of 50% or higher for all of them. Among these, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8, and P92-si31 exceeded 70% (Figure 1). These 12 sequences can be used as candidate sequences.
[0158] (2) The 26 sequences showed inhibition rates of 30% to 50% against the PCSK9 gene. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively.
[0159] [Table 5]
[0160] The 26 sequences shown in Table 5 exhibited low inhibitory effects on the PCSK9 gene, with inhibition rates all below 50%, ranging from 30% to 50%. For example, the inhibition rates for P92-si6 and P92-si7 were 38.3% and 35.7%, respectively (Figure 2).
[0161] (3) The 46 sequences showed inhibition rates of 30% or less against the PCSK9 gene. For example, the inhibition rates of P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively.
[0162] [Table 6] TIFF0007911448000028.tif19168
[0163] The 46 sequences shown in Table 6 exhibited very low inhibitory effects on PCSK9 mRNA expression, with inhibition rates of less than 30% for all of them. For example, the inhibition rates for P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively (Figures 3 and 4).
[0164] (4) siRNAs with similar sequences exhibited very different activities. For example, P92-si5 showed a significantly higher inhibition rate of 61.8% compared to P92-si4.
[0165] Table 7 shows a comparison of the inhibitory effects of siRNAs with sequences similar to PCSK9 mRNA.
[0166] [Table 7]
[0167] Table 7 shows that siRNAs with similar sequences have very different inhibitory effects on PCSK9 mRNA expression. Base sequence 4 differed from base sequence 5 by only one terminal base. In the sense strand, base sequence 4 had one more carbon at its 5' end, and base sequence 5 had one more u at its 3' end, with the remaining bases being exactly the same. In the antisense strand, base sequence 4 had one more u at its 3' end, and base sequence 5 had one more american at its 5' end, with the remaining bases being exactly the same. However, the alternating modification sequence P92-si5 showed a significantly higher inhibition rate, increasing by 61.8% compared to P92-si4.
[0168] The base sequence 50 differed from base sequence 51 only in the last six bases. In the sense strand, the 5' end of base sequence 50 was GAUUAA, and the 3' end of sequence 51 was CUGGAU, with the remaining bases being exactly the same. In the antisense strand, the 3' end of base sequence 50 was AAUCAG, and the 5' end of base sequence 51 was AUCCAG, with the remaining bases being exactly the same. However, the alternatingly modified sequence P92-si51 showed a significantly higher inhibition rate, 46.8% higher than P92-si50.
[0169] Base sequence 2 differed from base sequence 3 only in the last six bases. In the sense strand, base sequence 2 had AUACCU at its 5' end and UGUCUU at its 3' end, with the remaining bases being exactly the same. In the antisense strand, base sequence 2 had GUAUCC at its 3' end, and base sequence 3 had AAGACA at its 5' end, with the remaining bases being exactly the same. However, the alternating modification sequence P92-si3 showed a significantly higher inhibition rate, increasing by 45.9% compared to P92-si2.
[0170] Base sequence 9 differed from base sequence 10 only in the last two bases. In the sense strand, base sequence 9 had a GG base at its 5' end, base sequence 10 had an AG base at its 3' end, and the remaining bases were identical. In the antisense strand, base sequence 9 had a UA base at its 3' end, base sequence 10 had a CU base at its 5' end, and the remaining bases were identical. However, the alternating modification sequence P92-si9 showed a significantly improved inhibition rate, increasing by 53.1% compared to P92-si10.
[0171] Base sequence 21 differed from base sequence 22 only in the last two bases. In the sense strand, the 5' end of base sequence 21 was CA, and the 3' end of base sequence 22 was GA, with the remaining bases being exactly the same. In the antisense strand, the 3' end of base sequence 21 was CA, and the 5' end of base sequence 22 was UC, with the remaining bases being exactly the same. However, the alternating modification sequence P92-si21 showed a significantly higher inhibition rate, increasing by 65.6% compared to P92-si22.
[0172] Base sequence 30 differed from base sequence 31 by only one terminal base. In the sense strand, base sequence 30 had an A at its 5' end, base sequence 31 had a G at its 3' end, and the remaining bases were exactly the same. In the antisense strand, base sequence 30 had a G at its 3' end, base sequence 31 had a C at its 5' end, and the remaining bases were exactly the same. However, the alternating modification sequence P92-si31 showed a significantly higher inhibition rate, by 39.4% compared to P92-si30.
[0173] Base sequence 73 differed from base sequence 74 by only one terminal base. In the sense strand, base sequence 73 had a G at its 5' end, and base sequence 74 had a G at its 3' end, with the remaining bases being exactly the same. In the antisense strand, base sequence 73 had an A at its 3' end, and base sequence 74 had a C at its 5' end, with the remaining bases being exactly the same. However, the alternating modification sequence P92-si73 showed a significantly improved inhibition rate, increasing by 62.2% compared to P92-si74.
[0174] Therefore, selecting sequences with significant inhibitory activity from the vast number of oligonucleotide sequences designed for the PCSK9 mRNA sequence is not easy and requires considerable ingenuity.
[0175] summary: (1) Of the 84 sequences designed, 12 sequences, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83, showed significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8, and P92-si31 exceeded 70%. (2) The 26 sequences showed inhibition rates of 30% to 50% against the PCSK9 gene. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively. (3) The 46 sequences showed inhibition rates of 30% or less against the PCSK9 gene. For example, the inhibition rates of P92-si1 and P92-si20 were 9.2% and 6.0%, respectively. (4) Even siRNAs with similar sequences showed very different activities. For example, P92-si5 showed a 61.8% improvement in inhibition rate compared to P92-si4, which was a significant improvement. Therefore, selecting sequences with significant inhibitory activity from the very large number of oligonucleotide sequences designed for the PCSK9 mRNA sequence is not easy and requires a lot of ingenuity.
[0176] Example 3: Inhibitory effect of unmodified sequences on the PCSK9 gene In this example, several unmodified sequences corresponding to the modified sequences in Example 2 were synthesized and transfected into HELA cells via lipid nanoparticles (LNPs). The inhibitory effect of each unmodified sequence on the PCSK9 gene was measured using qPCR, and unmodified siRNA sequences exhibiting good inhibitory effects were selected.
[0177] 1. Experimental materials Samples: Unmodified small interfering RNA sequences shown in Table 8. All sequences were synthesized according to the method of Example 1.
[0178] [Table 8] TIFF0007911448000031.tif222168
[0179] Cell type: HeLa cell line HELA cells Drug solvent: Sterile water without enzymes, Gibco Opti-MEM.
[0180] 2. Experimental method Example 2 was referred to. 3. Experimental results The inhibition rates of each unmodified sequence on the expression of PCSK9 mRNA are shown in Tables 9 and 10. The unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83 had a significant inhibitory effect on the expression of PCSK9 mRNA in HELA cells, and the inhibition rates were all 50% or more. Among them, the inhibition rates of si5, si81, si82, si3 and si8 exceeded 60%.
[0181] (1) Twelve unmodified sequences including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83 had a significant inhibitory effect on the PCSK9 gene, and the inhibition rates were all over 50%. Among them, the inhibition rates of si5, si81, si82, si3 and si8 exceeded 60%.
[0182] [Table 9]
[0183] The unmodified sequences shown in Table 9, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83, exhibited significant inhibitory effects on PCSK9 mRNA expression, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates for si5, si81, si82, si3, and si8 exceeded 60% (Figure 5). These 12 sequences can be used as candidate sequences.
[0184] (2) The inhibition rates of other unmodified sequences against the PCSK9 gene were all less than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2%, respectively.
[0185] [Table 10]
[0186] Each sequence in Table 10 showed very low inhibitory effects on PCSK9 mRNA expression, with inhibition rates of less than 40% for all of them. For example, the inhibition rates for si52 and si74 were only 0.5% and 2.2%, respectively (Figure 6).
[0187] (3) siRNAs with similar sequences exhibited very different activities. For example, base sequence 5 showed a 51.2% improvement in inhibition rate compared to base sequence 4, which was a significant improvement. Table 11 shows a comparison of the inhibitory effects of siRNAs with sequences similar to PCSK9 mRNA.
[0188] [Table 11]
[0189] Table 11 shows that siRNAs with similar sequences have very different inhibitory effects on PCSK9 mRNA expression.
[0190] The basic sequence 4 differed from the basic sequence 5 only in one base at the end. In the sense strand, there was one more C at the 5' end of the basic sequence 4, one more U at the 3' end of the basic sequence 5, and the remaining bases were exactly the same. In the antisense strand, there was one more U at the 3' end of the basic sequence 4, one more A at the 5' end of the basic sequence 5, and the remaining bases were exactly the same. However, the inhibition rate of the basic sequence 5 was improved by 51.2% compared with that of the basic sequence 4, showing a significant improvement.
[0191] The basic sequence 50 differed from the basic sequence 51 only in six bases at the end. In the sense strand, the 5' end of the basic sequence 50 was GAUUAA, the 3' end of the basic sequence 51 was CUGGAU, and the remaining bases were exactly the same. In the antisense strand, the 3' end of the basic sequence 50 was AAUCAG, the 5' end of the basic sequence 51 was AUCCAG, and the remaining bases were exactly the same. However, the inhibition rate of the basic sequence 51 was improved by 42.6% compared with that of the basic sequence 50, showing a significant improvement.
[0192] The basic sequence 2 differed from the basic sequence 3 only in six bases at the end. In the sense strand, the 5' end of the basic sequence 2 was AUACCU, the 3' end of the basic sequence 3 was UGUCUU, and the remaining bases were exactly the same. In the antisense strand, the 3' end of the basic sequence 2 was GUAUCC, the 5' end of the basic sequence 3 was AAGACA, and the remaining bases were exactly the same. However, the inhibition rate of the basic sequence 3 was improved by 42.7% compared with that of the basic sequence 2, showing a significant improvement.
[0193] The basic sequence 9 differed from the basic sequence 10 only in two bases at the end. In the sense strand, the 5' end of the basic sequence 9 was GG, the 3' end of the basic sequence 1 was AG, and the remaining bases were exactly the same. In the antisense strand, the 3' end of the basic sequence 9 was UA, the 5' end of the basic sequence 10 was CU, and the remaining bases were exactly the same. However, the inhibition rate of the basic sequence 9 was improved by 41.2% compared with that of the basic sequence 10, showing a significant improvement.
[0194] Base sequence 21 differed from base sequence 22 only in the last two bases. In the sense strand, base sequence 21 had CA at its 5' end, base sequence 22 had GA at its 3' end, and the remaining bases were exactly the same. In the antisense strand, base sequence 21 had CA at its 3' end, base sequence 22 had UC at its 5' end, and the remaining bases were exactly the same. However, base sequence 21 showed a significantly improved inhibition rate, with a 53.2% increase compared to base sequence 22.
[0195] Base sequence 30 differed from base sequence 31 by only one terminal base. In the sense strand, base sequence 30 had an A at its 5' end, while base sequence 31 had a G at its 3' end, with the remaining bases being identical. In the antisense strand, base sequence 30 had a G at its 3' end, while base sequence 31 had a C at its 5' end, with the remaining bases being identical. However, base sequence 31 showed a significantly improved inhibition rate, increasing by 32.5% compared to base sequence 30.
[0196] Base sequence 73 differed from base sequence 74 by only one terminal base. In the sense strand, base sequence 73 had a G at its 5' end, and base sequence 74 had a G at its 3' end, with the remaining bases being exactly the same. In the antisense strand, base sequence 73 had an A at its 3' end, and base sequence 74 had a C at its 5' end, with the remaining bases being exactly the same. However, base sequence 73 showed a significantly improved inhibition rate, with a 50.2% increase compared to base sequence 74. Therefore, selecting sequences with significant inhibitory activity from the vast number of oligonucleotide sequences designed for the PCSK9 mRNA sequence is not easy and requires considerable ingenuity.
[0197] (4) The effects on activity varied when alternating modifications were performed on different sequences. For example, in some cases, the inhibitory rate was significantly improved, with the sequence obtained by alternating modification of base sequence 5 showing a 12.4% improvement in inhibition compared to the unmodified sequence. In other cases, the inhibitory rate was almost unchanged, with the sequences obtained by alternating modification of base sequences 4, 22, and 52 showing almost no change in inhibition compared to the unmodified sequence.
[0198] [Table 12]
[0199] Table 12 shows that alternating modifications to different sequences had varying effects on the inhibitory effect of PCSK9 on mRNA. For example, sequences obtained by alternating modification of base sequence 5 showed a 12.4% improvement in inhibition compared to the unmodified sequence, and sequences obtained by alternating modification of base sequence 82 showed a 12.2% improvement in inhibition compared to the unmodified sequence, indicating significant improvements in inhibition. On the other hand, sequences obtained by alternating modification of base sequences 4, 22, and 52 showed almost no change in inhibition compared to the unmodified sequence, indicating almost no change in inhibition. Therefore, not all unmodified sequences can have their activity improved by alternating modifications; in other words, alternating modifications have varying effects on the activity of different sequences.
[0200] summary: (1) Twelve unmodified sequences, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83, had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates for si5, si81, si82, si3, and si8 exceeded 60%. (2) The inhibition rates of other unmodified sequences against the PCSK9 gene were less than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2%, respectively. (3) siRNAs with similar sequences exhibited very different activities. For example, base sequence 5 showed a 51.2% improvement in inhibition compared to base sequence 4, demonstrating a significant improvement in inhibition rate. (4) After alternating modifications to different sequences, the effects on activity varied. For example, in some cases, the inhibitory rate was significantly improved, with the sequence obtained by alternating modification of base sequence 5 showing a 12.4% improvement in inhibition compared to the unmodified sequence. In other cases, the inhibitory rate was almost unchanged, with the sequences obtained by alternating modification of base sequences 4, 22, and 52 showing almost no change in inhibition compared to the unmodified sequence.
[0201] Example 4: Inhibitory effect of template-modified sequences on the PCSK9 gene In this embodiment, the sequences selected in Example 3, namely the unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83 (a total of 12 sequences), were modified using modification templates. Among these, DV25, DV26, DV27, DV28, DV29, DV30, and DV31 are new modification templates designed in this disclosure, while DV21 and DV22 are the disclosed Advanced ESC modification templates. 1. Experimental materials Samples: Table 13 shows the sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83 in Example 3 modified with different templates (DV25, DV26, DV27, DV28, DV29, DV30, DV31, DV21, and DV22), as well as their corresponding alternating modification sequences P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83 (synthesized in Example 1). The modification principle of the modification template in this disclosure is as follows:
[0202] TIFF0007911448000036.tif153168
[0203] The siRNA modification template using modification form A on the antisense strand and modification form a on the sense strand was named DV25. The siRNA modification template using modification form B on the antisense strand and modification form a on the sense strand was named DV26. The siRNA modification template using modification form C on the antisense strand and modification form a on the sense strand was named DV27. The siRNA modification template using modification form B on the antisense strand and modification form b on the sense strand was named DV28. The siRNA modification template using modification form C on the antisense strand and modification form b on the sense strand was named DV29.
[0204] TIFF0007911448000037.tif99168
[0205] TIFF0007911448000038.tif94168
[0206] TIFF0007911448000039.tif80168
[0207] TIFF0007911448000040.tif81168
[0208] Details of each modified template sequence are shown in Table 13. The synthesis method for each sequence was the same as in Example 1.
[0209] [Table 13] TIFF0007911448000042.tif247168TIFF0007911448000043.tif248168TIFF0007911448000044.tif248168TIFF0007911448000045.tif131168
[0210] Cell type: HEP3B cell line cells Drug solvent: Enzyme-free sterile water, Gibco DMEM (purchased from Thermo Fisher Scientific. Catalog number: 10569010)
[0211] 2. Experimental Method The inhibitory effect of the sample on the mRNA expression of the PCSK9 gene in the HEP3B cell line was measured using qRT-PCR. Hep3B cells were provided by Wuxi Apptec Co., Ltd. (ATCC-tings-1618164).
[0212] 2.1 Cell culture HEP3B cell lines were collected after multiple subcultures. Cells in the logarithmic growth phase were cultured in 10% fetal bovine serum RPMI 1640 medium (supplemented with 10 μL / mL each of penicillin and streptomycin) at 37°C in a 5% CO2 incubator, with the medium changed once daily. The subcultured cells were digested with 0.25% trypsin, centrifuged at 1000 r / min for 5 minutes, the supernatant was discarded, and fresh medium was added for further subculture.
[0213] 2.2 Cell transfection Preparation of transfection mixture: Lipofectamine RNAiMAX and Opti-MEM were mixed in a ratio of 1.5:98.5, and then mixed using a vortex mixer. Preparation of transfection reagent: 60 μL of siRNA solution diluted with Opti-MEM was added to 60 μL of transfection mixture in a 1:1 (v / v) ratio, mixed with a vortex mixer, and allowed to stand at room temperature for 15 minutes to obtain lipid nanoparticles (LNPs). 12.5 μL was used for encapsulation efficiency measurement. Transfection reagent for the blank control group: 60 μL of the prepared transfection mixture was added to 60 μL of Opti-MEM, mixed with a vortex mixer, and allowed to stand at room temperature for 15 minutes. The prepared transfection reagent was added to a 24-well cell culture plate (100 μL / well) so that the final siRNA concentration was 0.05 nM / well. 4500 μL of (cells / ml) was added, mixed using the cross-mixing method, and then incubated in a 37°C, 5% CO2 incubator for 40 hours.
[0214] 2.3 Measurement of PCSK9 mRNA The procedure was the same as in "2.3 Measurement of PCSK9 mRNA" in Example 2. 2.4 Data Processing The mRNA expression rate (%) of PCSK9 was calculated as follows: Expression rate = (PCSK9 mRNA expression level / PCSK9 mRNA expression level in the blank control group) × 100% Inhibition rate of PCSK9 gene expression = 1 - expression rate (%)
[0215] 2.5 EC50 Experiment In this experiment, the siRNA concentrations for each sequence in the EC50 experiment were set to a total of eight concentration points (0.2 nM, 0.05 nM, 0.0125 nM, 3.13 pM, 0.78 pM, 0.2 pM, 0.05 pM, and 0.01 pM) through 4-fold dilutions, starting from 0.2 nM. The inhibition rate of each sequence at each concentration was measured and plotted, and the EC50 concentration of each sequence was calculated.
[0216] 3. Experimental Results After repeating the experiment three times, the inhibition rates of each modification sequence against the PCSK9 gene in Hep3B cells are shown in Tables 14-25. Experimental results of activity measurements showed that 12 candidate sequences (unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83) exhibited significant inhibitory effects on the PCSK9 gene after modification using the modification templates DV25-29 designed in this disclosure, with inhibition rates of 70% or higher for all of them. Among these, the inhibition rates of P92-si81-DV26, P92-si82-DV27, and P92-si82-DV29 reached 89.3%, 89.3%, and 89.1%, respectively.
[0217] Sequences modified with modification templates DV25-29 of this disclosure showed significantly improved inhibition of PCSK9 gene expression compared to alternating modification sequences. For example, the sequence P92-si51-DV27, obtained by modifying base sequence 51 with template DV27, showed a 29.1% improvement in inhibition compared to the alternating modification sequence, and the sequence P92-si81-DV26, obtained by modifying base sequence 81 with template DV26, showed a 26.9% improvement in inhibition compared to the alternating modification sequence.
[0218] Furthermore, the activity differed significantly after modifying the same siRNA sequence with different modification templates. For example, when the base sequence 51 was modified with the template DV27 of this disclosure, the inhibition rate improved by 22.8% compared to when the sequence was modified with the modification template DV31 of this disclosure, and by 21.3% compared to when the sequence was modified with the known Advanced ESC template DV21.
[0219] According to EC50 experiments, sequences modified with the modification templates designed in this disclosure had EC50 values ranging from 0.0001 nM to 0.005 nM. For example, the EC50 values of P92-si81-DV27, P92-si84-DV26, and P92-si82-DV27 were 0.0003 nM, 0.0004 nM, and 0.0006 nM, respectively. These nucleotide sequences were found to effectively suppress PCSK9 gene expression even at low concentrations.
[0220] (i) Inhibitory effect of template-modified base sequences on the PCSK9 gene (1) Basic sequence 5
[0221] [Table 14]
[0222] I. Templates DV25-29 of this disclosure When the base sequence 5 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 80%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si5-DV26 and P92-si5-DV27, obtained by modification with templates DV26 and DV27, improved by 19.5% and 16.6%, respectively (Figure 7).
[0223] II. Other Qualifying Templates of the Disclosure After modifying base sequence 5 with templates DV30 and DV31, the inhibition rates of P92-si5-DV30 and P92-si5-DV31 against the PCSK9 gene were 65.3% and 62.4%, respectively, which were 0.1% and 3.0% lower, respectively, than the corresponding alternating modification sequences. P92-si5-DV26 and P92-si5-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significantly improved inhibition rates, with 19.6% and 16.7% higher inhibition rates than P92-si5-DV30, and 22.5% and 19.6% higher inhibition rates than P92-si5-DV31.
[0224] III. Prior art disclosed Advanced ESC templates DV21 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10, 11, 16 and 17 of the sense chain) and DV22 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10 and 11 of the sense chain) P92-si5-DV21 and P92-si5-DV22, obtained by modifying base sequence 5 with templates DV21 and DV22, respectively, showed inhibition rates against the PCSK9 gene of 68.2% and 69.1%, which were 2.8% and 3.7% higher, respectively, than the corresponding alternating modification sequences. P92-si5-DV26 and P92-si5-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significantly improved inhibition rates, with 16.7% and 13.8% higher inhibition rates than P92-si5-DV21, and 15.8% and 12.9% higher inhibition rates than P92-si5-DV22.
[0225] summary: 1) When the base sequence 5 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was significantly improved compared to when the sequences were alternatingly modified. For example, when the base sequence 5 was modified with DV26, the inhibition rate improved by 19.5% compared to when the sequences were alternatingly modified. 2) After modifying the same siRNA sequence with different modification templates, the activity differed significantly. For example, when the base sequence 5 was modified with modification templates DV26 and DV27 of this disclosure, the inhibition rate increased by up to 22.5% compared to when the sequence was modified with modification templates DV30 and DV31 of this disclosure, showing a significant improvement in inhibition rate. Furthermore, when the sequence was modified with known Advanced ESC templates DV21 and DV22, the inhibition rate increased by up to 16.7%, showing a significant improvement. 3) siRNA sequences modified with different templates showed very large activity differences, up to a 20% difference. It was found that it is unclear which template modification results in high activity for the siRNA sequence.
[0226] (2) Basic sequence 51 [Table 15]
[0227] I. Templates DV25-29 of this disclosure After modifying the base sequence 51 with modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 75%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si51-DV26 and P92-si51-DV27, obtained by modification with templates DV26 and DV27, improved by 27.7% and 29.1%, respectively.
[0228] II. Other Qualifying Templates of the Disclosure P92-si51-DV30 and P92-si51-DV31, obtained by modifying the base sequence 51 with templates DV30 and DV31, respectively, showed inhibition rates of 63.5% and 62.8% against the PCSK9 gene, which were only 7.0% and 6.3% higher, respectively, than the corresponding alternating modification sequences. P92-si51-DV26 and P92-si51-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significantly improved inhibition rates, with inhibition rates increasing by 20.7% and 22.1% compared to P92-si51-DV30, and by 21.4% and 22.8% compared to P92-si51-DV31.
[0229] III. Prior art disclosed Advanced ESC templates DV21 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10, 11, 16 and 17 of the sense chain) and DV22 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10 and 11 of the sense chain) P92-si51-DV21 and P92-si51-DV22, obtained by modifying the base sequence 51 with known Advanced ESC templates DV21 and DV22, showed inhibition rates of 64.3% and 65.1% against the PCSK9 gene, respectively, which were 7.8% and 8.6% higher than those of the alternating modification sequence. P92-si51-DV26 and P92-si51-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significantly improved inhibition rates, with 19.9% and 21.3% higher inhibition rates than P92-si51-DV21, and 19.1% and 20.5% higher inhibition rates than P92-si5-DV22.
[0230] summary: 1) When the base sequence 51 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was significantly improved compared to when the sequences were alternatingly modified. For example, when the base sequence 51 was modified with DV27, the inhibition rate improved by 29.1% compared to when the sequences were alternatingly modified. 2) After modifying the same siRNA sequence with different modification templates, the activity differed significantly. For example, when the base sequence 51 was modified with modification templates DV26 and DV27 of this disclosure, the inhibition rate increased by up to 22.8% compared to when the sequence was modified with modification templates DV30 and DV31 of this disclosure, showing a significant improvement. Furthermore, the inhibition rate increased by up to 21.3% compared to when the sequence was modified with known Advanced ESC templates DV21 and DV22, also showing a significant improvement. 3) siRNA sequences modified with different templates showed very large activity differences, up to a 20% difference. It was found that it is unclear which template modification results in high activity for the siRNA sequence. (3) Basic sequence 81
[0231] [Table 16]
[0232] I. Templates DV25-29 of this disclosure When the base sequence 81 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 80%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si81-DV26 and P92-Si81-DV27, obtained by modifying the sequence with templates DV26 and DV27, improved by 26.9% and 24.7%, respectively.
[0233] II. Other Qualifying Templates of the Disclosure The P92-Si81-DV30 and P92-Si81-DV31 sequences, obtained by modifying the base sequence 81 with templates DV30 and DV31, respectively, showed inhibition rates of 71.6% and 73.5% against the PCSK9 gene, which were 9.2% and 11.1% higher, respectively, than the sequences obtained by the corresponding alternating modifications.
[0234] P92-Si81-DV26 and P92-Si81-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significant improvements, with inhibition rates 17.7% and 15.5% higher than P92-Si81-DV30, and 15.8% and 13.6% higher than P92-Si81-DV31.
[0235] III. Prior art disclosed Advanced ESC templates DV21 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10, 11, 16 and 17 of the sense chain) and DV22 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10 and 11 of the sense chain) The P92-Si81-DV21 and P92-Si81-DV22 sequences, obtained by modifying the base sequence 81 with templates DV21 and DV22, showed inhibition rates against the PCSK9 gene of 78.3% and 75.1%, respectively, which were 15.9% and 12.7% higher, respectively, than the sequences obtained by the corresponding alternating modifications. P92-Si81-DV26 and P92-Si81-DV27, obtained by modifying the sequences with the modification templates DV26 and DV27 of this disclosure, showed significant improvements, with inhibition rates 11.0% and 8.8% higher than P92-Si81-DV21, and 14.2% and 12.0% higher than P92-Si81-DV22.
[0236] summary: 1) When the base sequence 81 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was significantly improved compared to when the sequences were alternatingly modified. For example, when the base sequence 81 was modified with DV26, the inhibition rate improved by 26.9% compared to when the sequences were alternatingly modified. 2) After modifying the same siRNA sequence with different modification templates, the activity differed significantly. For example, when the base sequence 81 was modified with modification templates DV26 and DV27 of this disclosure, the inhibition rate increased by up to 17.7% compared to when the sequence was modified with modification templates DV30 and DV31 of this disclosure, showing a significant improvement. Furthermore, the inhibition rate increased by up to 14.2% compared to when the sequence was modified with known Advanced ESC templates DV21 and DV22, also showing a significant improvement. 3) siRNA sequences modified with different templates showed very different activities, with differences of up to 20%. It was found that it is unclear which template modification results in high activity for the siRNA sequence.
[0237] (4) Basic sequence 82
[0238] [Table 17]
[0239] I. Templates DV25-29 of this disclosure When the base sequence 82 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 80%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si82-DV27 and P92-si82-DV29, obtained by modification with templates DV27 and DV29, improved by 19.6% and 19.4%, respectively.
[0240] II. Other Qualifying Templates of the Disclosure P92-si82-DV30 and P92-si82-DV31, obtained by modifying the base sequence 82 with templates DV30 and DV31, respectively, showed inhibition rates of 70.2% and 69.7% against the PCSK9 gene, corresponding to the alternating modification sequences. P92-si82-DV27 and P92-si82-DV29, obtained by modifying the modified template DV27 and DV29 sequences of this disclosure, showed significantly improved inhibition rates, with 19.1% and 18.9% higher inhibition rates than P92-si82-DV30, and 19.6% and 19.4% higher inhibition rates than P92-si82-DV31.
[0241] III. Prior art disclosed Advanced ESC templates DV21 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10, 11, 16 and 17 of the sense chain) and DV22 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10 and 11 of the sense chain) P92-si82-DV21 and P92-si82-DV22, obtained by modifying the base sequence 82 with templates DV21 and DV22, respectively, showed inhibition rates against the PCSK9 gene of 76.5% and 75.4%, which were 6.8% and 5.7% higher, respectively, than the alternating modification sequences. P2-si82-DV27 and P92-si82-DV29, obtained by modifying the modified template DV27 and DV29 sequences of this disclosure, showed significantly improved inhibition rates, with 12.8% and 12.6% higher inhibition rates than P92-si82-DV21, and 13.9% and 13.7% higher inhibition rates than P92-si82-DV22.
[0242] summary: 1) When the base sequence 82 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was significantly improved compared to when the sequences were alternatingly modified. For example, when the base sequence 82 was modified with DV27, the inhibition rate improved by 19.6% compared to when the sequences were alternatingly modified. 2) After modifying the same siRNA sequence with different modification templates, the activity differed significantly. For example, when the base sequence 82 was modified with modification templates DV27 and DV29 of this disclosure, the inhibition rate increased by up to 19.6% compared to when the sequence was modified with modification templates DV30 and DV31 of this disclosure, showing a significant improvement. Furthermore, the inhibition rate increased by up to 13.9% compared to when the sequence was modified with known Advanced ESC templates DV21 and DV22, also showing a significant improvement. 3) siRNA sequences modified with different templates showed very large activity differences, up to a 20% difference. It was found that it is unclear which template modification results in high activity for the siRNA sequence.
[0243] (5) Basic sequence 84
[0244] [Table 18]
[0245] I. Templates DV25-29 of this disclosure When the base sequence was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 85%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si84-DV28 and P92-Si84-DV29, obtained by modification with templates DV28 and DV29, improved by 26.8% and 25.9%, respectively.
[0246] II. Other Qualifying Templates of the Disclosure P92-Si84-DV30 and P92-Si84-DV31, obtained by modifying the base sequence 84 with templates DV30 and DV31, respectively, showed inhibition rates of 70.3% and 72.4% against the PCSK9 gene, which were 8.7% and 10.8% higher, respectively, than the corresponding alternating modification sequences. P2-Si84-DV28 and P92-Si84-DV29, obtained by modifying the modified template DV28 and DV29 sequences of this disclosure, showed significantly improved inhibition rates, with 18.1% and 17.2% higher inhibition rates than P92-Si84-DV30, and 16.0% and 15.1% higher inhibition rates than P92-Si84-DV31.
[0247] III. Prior art disclosed Advanced ESC templates DV21 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10, 11, 16 and 17 of the sense chain) and DV22 (fluorination sites: positions 2, 6, 14 and 16 of the antisense chain, and positions 7, 9, 10 and 11 of the sense chain) P92-Si84-DV21 and P92-Si84-DV22, obtained by modifying the base sequence 84 with templates DV21 and DV22, showed inhibition rates against the PCSK9 gene of 77.7% and 75.1%, respectively, which were 16.1% and 13.5% higher than the alternating modification sequences. P2-si84-DV28 and P92-si84-DV29, obtained by modifying the modified template DV28 and DV29 sequences of this disclosure, showed significant improvements, with inhibition rates 10.7% and 9.8% higher than P92-si84-DV21, and 13.3% and 12.4% higher than P92-si84-DV22.
[0248] summary: 1) When the base sequence 84 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was significantly improved compared to when the sequences were alternatingly modified. For example, when the base sequence 84 was modified with DV28, the inhibition rate improved by 26.8% compared to when the sequences were alternatingly modified. 2) After modifying the same siRNA sequence with different modification templates, the activity differed significantly. For example, when the base sequence 84 was modified with modification templates DV28 and DV29 of this disclosure, the inhibition rate increased by up to 18.1% compared to when the sequence was modified with modification templates DV30 and DV31 of this disclosure, showing a significant improvement. Furthermore, the inhibition rate increased by up to 13.3% compared to when the sequence was modified with known Advanced ESC templates DV21 and DV22, also showing a significant improvement. 3) siRNA sequences modified with different templates showed very large activity differences, up to a 20% difference. It was found that it is unclear which template modification results in high activity for the siRNA sequence.
[0249] (6) Basic sequence 3
[0250] [Table 19]
[0251] 1) When the base sequence 3 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 75%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si3-DV28 and P92-Si3-DV29, obtained by modification with templates DV28 and DV29, improved by 24.0% and 24.7%, respectively. 2) When the base sequence 3 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0252] (7) Basic sequence 8
[0253] [Table 20]
[0254] 1) When the base sequence 8 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 75%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si8-DV27 and P92-Si8-DV28, obtained by modification with templates DV27 and DV28, were improved by 19.7% and 20.2%, respectively. 2) When the base sequence 8 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0255] (8) Basic sequence 9
[0256] [Table 21]
[0257] 1) When the base sequence 9 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 70%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si9-DV27 and P92-Si9-DV28, obtained by modification with templates DV27 and DV28, were improved by 27.2% and 25.4%, respectively. 2) When the base sequence 9 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0258] (9) Basic sequence 21
[0259] [Table 22]
[0260] 1) When the base sequence 21 was modified with modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 70%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si21-DV25 and P92-si21-DV26, obtained by modification with templates DV25 and DV26, were improved by 24.4% and 26.5%, respectively. 2) When the base sequence 21 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0261] (10) Basic sequence 31
[0262] [Table 23]
[0263] 1) When the base sequence 31 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 70%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si31-DV25 and P92-si31-DV26, obtained by modification with templates DV25 and DV26, were improved by 22.9% and 22.6%, respectively. 2) When the base sequence 31 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0264] (11) Basic sequence 73
[0265] [Table 24]
[0266] 1) When the base sequence 73 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 70%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-si73-DV28 and P92-si73-DV29, obtained by modification with templates DV28 and DV29, were improved by 30.6% and 32.7%, respectively. 2) When the base sequence 73 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0267] (12) Basic sequence 83
[0268] [Table 25]
[0269] 1) When the base sequence 83 was modified with the modification templates DV25-29 designed in this disclosure, the inhibition rate against the PCSK9 gene exceeded 75%, which was significantly higher than when alternating 2'-methoxy and 2'-fluoro modifications were performed. For example, the inhibition rates of P92-Si83-DV27 and P92-Si83-DV29, obtained by modification with templates DV27 and DV29, were improved by 30.9% and 29.7%, respectively. 2) When the base sequence 83 was modified with the modification templates DV25-29 of this disclosure, the inhibitory effect on the PCSK9 gene was found to be significantly improved compared to when the sequences were modified alternately.
[0270] summary: (1) The selected base sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73, and 83, after being modified with the modification templates DV25-29 designed in this disclosure, exhibited significant inhibitory effects on PCSK9 gene expression, with inhibition rates of 70% or higher for all of them. Among these, the inhibition rates of P92-Si81-DV26, P92-Si82-DV27, and P92-Si81-DV29 reached 89.3%, 89.3%, and 89.1%, respectively. (2) The 12 sequences modified with modification templates DV25-29 of this disclosure showed significantly improved inhibition of PCSK9 gene expression compared to the alternating modification sequences. For example, P92-Si51-DV27, obtained by modifying base sequence 51 with template DV27, showed a 29.1% improvement in inhibition compared to the alternating modification sequences, and P92-Si81-DV26, obtained by modifying base sequence 81 with template DV26, showed a 26.9% improvement in inhibition compared to the alternating modification sequences. (3) When the same sequence was modified with modification templates DV25-29 of this disclosure, the inhibition rate of PCSK9 gene expression was significantly improved compared to when it was modified with modification templates disclosed in the prior art. For example, when the base sequence 51 was modified with modification template DV27 of this disclosure, the inhibition rate was improved by 21.3% compared to when the sequence was modified with the known Advanced ESC template DV21. (4) When the same sequence was modified with modification templates DV25-29 of the Disclosure, the inhibition rate of PCSK9 gene expression was significantly improved compared to when it was modified with the other modification templates DV30 and DV31 of the Disclosure. For example, when the base sequence 51 was modified with modification template DV27 of the Disclosure, the inhibition rate was improved by 22.8% compared to when it was modified with modification template DV31 of the Disclosure. (5) Sequences modified with different templates showed very different activity levels. For example, when base sequence 5 was modified with DV26, the inhibition rate was 22.5% higher than when modified with DV31. When base sequence 51 was modified with DV27, the inhibition rate was 20.5% higher than when modified with DV22. It was found that it is unclear which modification template will enable the siRNA sequence to achieve high activity.
[0271] (ii) EC50 experiment A total of 12 template-modified sequences, including P92-si5-DV26, P92-si51-DV25, P92-si81-DV27, P92-si82-DV27, P92-si84-DV26, P92-si3-DV28, P92-si8-DV29, P92-si9-DV28, P92-si21-DV25, P92-si31-DV27, P92-si73-DV28, and P92-si83-DV26, were selected, and EC50 experiments were performed to measure the EC50 concentration of each sequence. The experimental results are shown in Table 26.
[0272] [Table 26]
[0273] Table 26 shows that the EC50 values of these 12 sequences ranged from 0.0001 nM to 0.005 nM. Among them, the EC50 values of P92-si81-DV27, P92-si84-DV26, and P92-si82-DV27 were 0.0003 nM, 0.0004 nM, and 0.0006 nM, respectively. These results indicate that these sequences can effectively inhibit PCSK9 gene expression even at low concentrations.
[0274] Example 5: Comparison of inhibitory effects of sequences disclosed in the prior art on the PCSK9 gene In this example, the inhibition efficiency against the PCSK9 gene was compared between unmodified sequences disclosed in the prior art that are identical or similar to the base sequences 3, 5, 8, 9, 31, 81, 82, 83, and 84 of this disclosure, and sequences modified with the alternating modified sequences and modification templates DV25-29 of this disclosure.
[0275] 1. Experimental materials sample: (1) Sequence disclosed in the prior art
[0276] [Table 27]
[0277] Note: All sequences disclosed in the above patent applications were unmodified RNA sequences.
[0278] (2) In Example 2, siRNA sequences that were alternately modified with 2'-OMe and 2'-F and whose terminals were thiolated were used, such as P92-si5, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si31 and P92-si83. (3) siRNA sequences modified with modification templates DV25-29 (details of the sequences are shown in Table 28) were used.
[0279] [Table 28] TIFF0007911448000061.tif243168TIFF0007911448000062.tif243168 TIFF0007911448000063.tif122168
[0280] Cell type: Hep3B cells (ATCC-tings-1618164) provided by Wuxi Apptec Co., Ltd.
[0281] Hep3B cells were cultured in EMEM medium (ATCC-30-2003) containing 10% fetal bovine serum (FBS, ExCell Bio-FSP500), 1% penicillin-streptomycin (HyClone-SV30010), 1% non-essential amino acid solution (Gibco-11140-050), and 1% GlutaMAX supplement (Gibco-35050-061). Drug solvent: Enzyme-free sterile water, Gibco DMEM.
[0282] 2. Experimental Method The inhibitory effect of the sample on mRNA expression of the PCSK9 gene in the HEP3B cell line was measured using qRT-PCR.
[0283] 2.1 Cell culture HEP3B cell lines were collected after multiple subcultures. Cells in the logarithmic growth phase were cultured in 10% fetal bovine serum RPMI 1640 medium (supplemented with 10 μL / mL each of penicillin and streptomycin) at 37°C in a 5% CO2 incubator, with the medium changed once daily. Cells were subcultured by digestion with 0.25% trypsin. The cells were centrifuged at 1000 r / min for 5 minutes, the supernatant was discarded, and fresh medium was added for subculturing.
[0284] 2.2 Cell transfection Two μL of siRNA (1 μg / μL) was added to 18 μL of sterile water without enzymes in a ratio of 1:0.06 (wt / wt) and mixed. Then, 22 μL of the prepared LNP was added and mixed, and the mixture was allowed to stand at room temperature for 15 minutes. 12.5 μL was used for encapsulation efficiency measurement. The final transfection volume / well = (1 μg theoretical sample volume / siRNA purity) / drug loading concentration, and the final siRNA concentration was 0.05 nM. Negative control group: 22 μL of prepared LNP was added to 20 μL of sterile water without enzymes, mixed, and left at room temperature for 15 minutes. After mixing using the cross-pollination method, the mixtures were incubated at 37°C in a 5% CO2 incubator for 40 hours.
[0285] 2.3 Measurement of PCSK9 mRNA 1) RNA extraction The procedure was the same as "1) RNA extraction" in "2.3 Measurement of PCSK9 mRNA" in Example 2. 2) Measurement of RNA concentration The procedure was the same as in "2) Measurement of RNA concentration" of "2.3 Measurement of PCSK9 mRNA" in Example 2. 3) Quantitative measurement of PCSK9 mRNA 7.5 × 84 = 630 parts of the components other than the primer and template were added to a 15 mL centrifuge tube and marked as A. 1.5 mL EP tubes were marked. 7 parts / tube were used to add 77 μL of A and 420 ng of total RNA, and the mixture was mixed (marked as B). Upstream and downstream primers for the internal standard gene GAPDH and the target gene PCSK9 were mixed (marked as C). Add 11 μL of B and 1 μL of C to each well of the PCR plate, cover with sealing film, centrifuge at 3000 rpm for 1 minute, and transfer to the instrument. *This process was carried out on ice to maintain low temperatures. The plate was placed in the qPCR instrument and operated according to the following program. Reverse transfer: 55°C, 15 minutes. Thermal denaturation: 95°C, 30 seconds. Cycle reaction: 95°C, 10 seconds. 60°C, 35 seconds. 40 cycles. Melting curve: 95°C, 15 seconds. 60°C, 60 seconds. 95°C, 15 seconds. The operating time was set to approximately 2 hours. The experimental results were analyzed, and 2-ΔΔCt was calculated.
[0286] 2.4 Data Processing The mRNA expression rate (%) of PCSK9 was calculated as follows: Expression rate = (PCSK9 mRNA expression level in the experimental group / PCSK9 mRNA expression level in the blank control group) × 100% Inhibition rate of PCSK9 gene expression = 1 - expression rate (%)
[0287] 3. Experimental Results The specific experimental results are shown in Tables 29 and 30. Experimental results showed that the alternatingly modified sequences and sequences modified with specific modification templates of this disclosure exhibited significantly improved inhibitory effects against PCSK9 compared to identical or similar unmodified sequences disclosed in the prior art. For example, the inhibitory rate of the identical unmodified sequence si84 was 38.6%, but after alternating modification, the inhibitory rate was 61.6%, an improvement of 23.0% compared to the unmodified sequence si84. After modification with the modification template DV26 of this disclosure, the inhibitory rate reached 86.8%, an improvement of 48.2% compared to the unmodified sequence.
[0288] The sequence 31P disclosed in the prior art had only two bases UG at the 3' end of the antisense strand deleted compared to the sequence si31 of this disclosure, with the remaining bases being exactly the same. However, the unmodified sequence si31 of this disclosure showed a 10.4% improvement in inhibition compared to 31P, the inhibition of the alternating modified sequence was 59.5%, a 21.2% improvement over 31P, and the inhibition after modification with the modification template DV26 of this disclosure reached 80.2%, a 41.9% improvement over 31P.
[0289] (1) The alternating modification sequences and sequences modified with specific modification templates of this disclosure exhibit significantly improved inhibition of the PCSK9 gene compared to the same unmodified sequences disclosed in the prior art, and can be increased by up to 40%. The alternating modification sequences and sequences modified with specific modification templates of this disclosure showed significantly improved inhibition rates against the PCSK9 gene compared to the same unmodified sequences disclosed in the prior art. For example, the unmodified sequence si84 had an inhibition rate of 38.6%, but after alternating modification, the inhibition rate was 61.6%, an improvement of 23.0% compared to the unmodified sequence si84. After modification with the modification template DV26 of this disclosure, the inhibition rate reached 86.8%, an improvement of 48.2% compared to the unmodified sequence.
[0290] [Table 29]
[0291] The unmodified sequences si81, si84, si3, si8, si9, and si83 disclosed in the prior art shown in Table 29 were identical to the sequences in this disclosure. However, alternating modification and modification with the modification template in this disclosure significantly improved the inhibitory effect on PCSK9. For example, the unmodified sequence si84 had an inhibition rate of 38.6%, while P92-si84 obtained by alternating modification had an inhibition rate of 61.6%, an improvement of 23.0% compared to the unmodified sequence si84. P92-si84-DV25, P92-si84-DV26, P92-si84-DV27, P92-si84-DV28, and P92-si84-DV29 obtained by modification with the modification templates DV25-29 of this disclosure achieved inhibition rates of 84.9%, 86.8%, 84.5%, 86.2%, and 86.4%, respectively, all of which were improvements of more than 40% compared to the unmodified sequence si84.
[0292] (2) The unmodified sequences, alternatingly modified sequences, and sequences modified with specific modification templates of this disclosure significantly improve the inhibition rate against the PCSK9 gene compared to unmodified sequences with only minor differences disclosed in the prior art, and can be increased by up to 40%. The unmodified sequences, alternatingly modified sequences, and sequences modified with specific modification templates of this disclosure showed significantly improved inhibition rates against the PCSK9 gene compared to sequences with only minor differences disclosed in the prior art. For example, the unmodified sequence 31P had an inhibition rate of 38.3%, while the similar unmodified sequence si31 of this disclosure had an inhibition rate of 48.7%, an improvement of 10.4% compared to 31P. The alternatingly modified sequence had an inhibition rate of 59.5%, an improvement of 21.2% compared to 31P, and the sequence obtained by modification with the modification template DV26 of this disclosure reached an inhibition rate of 80.2%, an improvement of 41.9% compared to 31P.
[0293] [Table 30]
[0294] I. Sequence Comparison The sequences 5P, 31P, and 82P disclosed in the prior art in Table 30 are very similar to the sequences si5, si31, and si82 of this disclosure, with only slight differences. A specific comparison is shown in the table below.
[0295] [Table 31]
[0296] From Table 31, it was found that sequence 5P disclosed in the prior art had only two bases GG at the 3' end of the antisense strand deleted compared to sequence si31 of this disclosure. Sequence 31P had only two bases UG at the 3' end of the antisense strand deleted compared to sequence si31 of this disclosure. Sequence 82P had only two bases AA at the 3' end of the antisense strand deleted compared to sequence si82 of this disclosure, but the remaining bases were exactly the same.
[0297] II. Activity comparison 1) The unmodified sequences of this disclosure exhibit significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the unmodified sequence si31 of this disclosure showed a 10.4% improvement in inhibition compared to 31P, which has a similar structure. The inhibition rate of the unmodified sequence si5 of this disclosure against the PCSK9 gene was 50.1%, which is a significant improvement of 8.3% compared to the similar sequence 5P disclosed in the prior art (inhibition rate 41.8%). The inhibition rate of the unmodified sequence si82 of this disclosure against the PCSK9 gene was 53.8%, which is a significant improvement of 7.1% compared to the similar sequence 82P disclosed in the prior art (inhibition rate 46.7%). The inhibition rate of the unmodified sequence si31 of this disclosure against the PCSK9 gene was 48.7%, which is a significant improvement of 10.4% compared to the similar sequence 31P disclosed in the prior art (inhibition rate 38.3%).
[0298] 2) The alternating modification sequences of this disclosure exhibit significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the alternating modification sequence P92-si5 of this disclosure showed a 22.0% improvement in inhibition compared to sequence 5P. P92-si5, obtained by alternating modification of the base sequence 5 of this disclosure, showed an inhibition rate of 63.8% against the PCSK9 gene, which is a significant improvement of 22.0% compared to the unmodified sequence 5P disclosed in the prior art.
[0299] P92-si82, obtained by alternating modification of the base sequence 82 of this disclosure, showed an inhibition rate of 68.3% against the PCSK9 gene, which is a significant improvement of 21.6% compared to the unmodified sequence 82P disclosed in the prior art. P92-si31, obtained by alternating modification of the base sequence 31 of this disclosure, showed an inhibition rate of 59.5% against the PCSK9 gene, which is a significant improvement of 21.2% compared to the unmodified sequence 31P disclosed in the prior art.
[0300] 3) Sequences modified with the modification templates of this disclosure exhibited significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the alternating modification sequence P92-si82-DV29 of this disclosure showed a 42.8% improvement in inhibition compared to sequence 82P. The base sequences 5 modified with modification templates 25-29 of this disclosure all showed inhibitory rates of 30% or more higher than the unmodified sequences 5P disclosed in the prior art. For example, the inhibitory rate of P92-si5-DV27 improved by 40.8%, which was a significant improvement. The base sequences 82 modified with modification templates 25-29 of this disclosure all showed inhibitory rates of 30% or more higher than the unmodified sequences 82P disclosed in the prior art. For example, the inhibitory rate of P92-si82-DV29 improved by 42.8%, which was a significant improvement. The base sequences 31 modified with modification templates 25-29 of this disclosure all showed inhibitory rates of 30% or more higher than the unmodified sequences 31P disclosed in the prior art. For example, the inhibitory rate of P92-si31-DV26 improved by 41.9%, which was a significant improvement.
[0301] This revealed that the unmodified sequences, alternatingly modified sequences, and template-modified sequences of this disclosure can exhibit significantly improved inhibitory activity against PCSK9 compared to similar unmodified sequences disclosed in the prior art, with the inhibition rate increasing by up to 40%.
[0302] summary: (1) The alternating modification sequences and sequences modified with specific modification templates of this disclosure showed significantly improved inhibitory effects on the PCSK9 gene compared to the same sequences disclosed in the prior art. For example, the inhibition rate of the unmodified sequence si84 was 38.6%, but after alternating modification, the inhibition rate was 61.6%, an improvement of 23.0% compared to the unmodified sequence si84, and after modification with the modification template DV26 of this disclosure, the inhibition rate reached 86.8%, an improvement of 48.2% compared to the unmodified sequence. (2) The unmodified sequences, alternating modified sequences, and sequences modified with specific modification templates of this disclosure exhibit significantly improved inhibitory effects on the PCSK9 gene compared to similar sequences disclosed in the prior art. For example, the unmodified sequence si31 of this disclosure showed a 10.4% improvement in inhibition compared to a similar sequence 31P disclosed in the prior art. The alternating modified sequence P92-si5 of the sequence si5 of this disclosure showed a 22.0% improvement in inhibition compared to an unmodified sequence 5P disclosed in the prior art that is similar to sequence si5. The sequence P92-si82-DV29, obtained by modifying sequence si82 of this disclosure with the modification template DV29, showed a 42.8% improvement in inhibition compared to an unmodified sequence 82P disclosed in the prior art that is similar to sequence si82.
[0303] Example 6: Sequence inhibitory effect on PCSK9 and off-target genes using a specific anti-off-target design. In the practical application of siRNA, the expression of non-target mRNA that is only partially complementary to the guide strand (antisense strand) is often suppressed. Research by Alnylam has shown that the hepatotoxicity of N-acetylgalactosamine (GalNAc)-conjugated siRNA is mainly due to off-target effects that result in gene suppression of the wrong target via a recognition mechanism similar to that of microRNA (miRNA).
[0304] To address this issue, Alnylam Corporation significantly reduced off-target effects and mitigated hepatotoxicity in its latest fifth-generation template design by disrupting the seed region of the siRNA antisense strand using glycol nucleic acid (GNA) modifications at seven sites. Such modifications can suppress off-target effects by affecting the binding of siRNA to undesigned targets via seed region recognition.
[0305] Natural 5'-end phosphorylation or simple direct 5'-end phosphorylation can be dephosphorylated within cells. Directly 5'-end phosphorylated oligonucleotide chains can be circulated in the blood for 2 hours, then 90% dephosphorylated, and completely eliminated after 24 hours. The 5'-end phosphorylation design (5'-E-VP) uses E-vinylphosphonic acid ester instead of cross-linking oxygen, resulting in the best phosphorylation effect and higher stability.
[0306] Based on the above, in order to reduce the off-target effects of the sequence and to investigate the effect of 5'-terminal phosphorylation on off-target effects, the base sequences 5, 51, 81, and 84 modified with DV25-29 in this example were used, and a 5'-E-VP modification and a GNA anti-off-target design at position 7 were added to the 5' end of the antisense chain.
[0307] Furthermore, to investigate off-target effects, we compared the sequences P92-si3, P92-si8, P92-si21, P92-si31, P92-si73, and P92-si83, which are alternatingly modified with 2'-methoxy and 2'-fluoro, with the sequences P92-si3+, P92-si8+, P92-si21+, P92-si31+, P92-si73+, and P92-si83+, which include a GNA anti-off-target design at position 7 of the antisense chain.
[0308] Experimental results showed that at a concentration of 10 nM, the off-target modified sequences all exhibited significant inhibitory effects against the target gene PCSK9, while the inhibitory effects on the off-target gene were significantly reduced. This indicates that anti-off-target design does not affect the inhibitory effects of the alternating modification sequences and template modification sequences disclosed herein on the PCSK9 gene, but can significantly inhibit off-target effects.
[0309] 1. Experimental materials 1) Sample: Alternating modification sequences: Sequences P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83 due to alternating modifications. Sequences with alternating modification and anti-off-target design: P92-si3+, P92-si8+, P92-si9+, P92-si21+, P92-si31+, P92-si73+, and P92-si83+ (Table 32).
[0310] Table 33 shows sequences obtained by template modification of base sequences 5, 84, 81, and 51, sequences obtained by template modification and 5'-E-VP modification, sequences obtained by template modification and anti-off-target design, and sequences obtained by template modification, 5'-E-VP modification, and anti-off-target design.
[0311] 2) Sequence synthesis: I. Alternating Modification Sequences and Template Modification Sequences The synthesis method was as described in Example 1. II. siRNA sequences containing 5'-E-VP siRNA sequences were synthesized referring to Example 1. When synthesizing the 5' end base (last base) of the antisense chain, monomers having a phosphonic acid group at the 5' end, such as vinyl-(E)-phosphonic acid ester-A-OMe phosphoramidite monomer (Formula 9) and vinyl-(E)-phosphonic acid ester-U-OMe phosphoramidite monomer (Formula 10), were used. Their structural formulas are as follows. [ka]
[0312] III. siRNA sequences including anti-off-target designs The siRNA sequence was synthesized referring to Example 1. The sequence was synthesized using a GNA monomer when synthesizing the seventh base from the 5' end of the antisense strand. The structural formula of the GNA monomer was as follows. [ka]
[0313] [Table 32]
[0314] All of the above sequences employ an alternating modification configuration of 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F). (1) The sense chains were 2'-F at odd positions and 2'-OMe at even positions. (2) The antisense chains were all 2'-OMe at odd positions and all 2'-F at even positions. (3) Two thiolation modifications were present at the 5' end of the sense strand and at the 5' and 3' ends of the antisense strand, respectively. (4) GNA modification was used on the 7th base of the antisense strand (5'-3' direction).
[0315] [Table 33] TIFF0007911448000071.tif242168TIFF0007911448000072.tif55168
[0316] Cell type: Hep3B cells (ATCC-tings-1618164) provided by Wuxi Apptec Co., Ltd.
[0317] Hep3B cells were cultured in EMEM medium (ATCC-30-2003) containing 10% fetal bovine serum (FBS, ExCell Bio-FSP500), 1% penicillin-streptomycin (HyClone-SV30010), 1% non-essential amino acid solution (Gibco-11140-050), and 1% GlutaMAX supplement (Gibco-35050-061). Drug solvent: Enzyme-free sterile water, Gibco DMEM.
[0318] 2. Experimental Method 1) Dilution of the compound For off-target experiments, the sample was diluted to a concentration of 10 nM and detected using triplet wells. Digestion and counting of Hep3B cells: Hep3B cells, with a density of 80%, were washed with Dulbecco's phosphate-buffered saline (DPBS) and digested with 0.05% trypsin for 3–10 minutes. After cell collection, the cells were counted using a Countstar Rigel S2 and the cell density was determined to be 2 × 10⁻⁶. 5 The volume was adjusted to / mL.
[0319] 2) Preparation of transfection reagents RNAiMAX transfection reagents were prepared. An appropriate amount of RNAiMAX:Opti-MEM was prepared in a 15 mL centrifuge tube in a ratio of 3:97, mixed for 15 seconds using a vortex mixer, and incubated at room temperature for 15 minutes. 40 μL of RNAiMAX Opti-MEM was added to each well at the corresponding position, and 40 μL of the corresponding concentration of the diluted compound was added to the corresponding wells of the dilution plate. The mixture was then mixed and incubated for 15 minutes.
[0320] 3) Cell Plating Hep3B cells (2 × 10 4 Cells (per well) were plated into a 96-well cell culture plate, and siRNA compounds were mixed with RNAiMAX Opti-MEM transfection reagent and added to the cells in each well. A control group, which did not contain siRNA compounds including RNAiMAX Opti-MEM, was also provided.
[0321] Anti-off-target experiment: The compound and RNAiMAX Opti-MEM mixture was removed from the dilution plate and added to a 96-well cell culture plate (20 μL / well). Cells were then added to the 96-well plate at a rate of 100 μL / well to achieve a final volume / well of 120 μL. After plating, the cells were cultured for 24 hours in an incubator at 5% CO2 and 37°C.
[0322] 4) RNA extraction and reverse transcription 24 hours after transfection, the culture medium was removed and cells were collected for RNA extraction. Total RNA was extracted using RNeasy® 96Kit (QIAGEN-74182) according to the kit instructions. Then, cDNA was synthesized using FastKing RT Kit (With gDNase) (TIANGEN-KR116-02) according to the instructions.
[0323] 5) RT-qPCR The target cDNA was measured by qPCR, and GAPDH cDNA was measured in parallel using it as an internal standard. 8 μL of the prepared qPCR reaction solution and 2 μL of sample cDNA were added to 384 wells. The TaqMan qPCR reaction step involved heating at 95°C for 10 minutes, followed by a cycle mode of 95°C for 15 seconds and 60°C for 1 minute, for a total of 40 cycles. The SYBR qPCR reaction step involved heating at 50°C for 2 minutes, followed by 95°C for 10 minutes, followed by a cycle mode of 95°C for 15 seconds and 60°C for 1 minute, for a total of 40 cycles. The final melting curve was obtained by heating at 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds.
[0324] 6) Data Analysis The RNA expression levels of the target gene in each sample were calculated using the ΔΔCt relative quantification method, based on the Ct value of each sample. The relative expression level of the target gene was expressed as 2-ΔΔCT. The calculation was performed as follows: ΔCT = Average Ct value of target gene - Average Ct value of internal standard gene ΔΔCT = ΔCT(treatment group) - ΔCT(RNAiMAX control group) Relative expression level of target gene mRNA = 2 - ΔΔCT Inhibition rate = (1 - relative expression level of sample / mean expression level of RNAiMAX control group) × 100%
[0325] 3. Experimental Results (1) Different modification sequences all had a significant inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the alternating modification sequence P92-si3 reached 75.6%, and the inhibition rate of the sequence D84-DV27P, which uses template modification and 5'-E-VP modification, was a high 94.4%. The inhibition rates of all samples against the PCSK9 gene are shown in Tables 34-36. All alternating modification sequences exhibited significant inhibitory effects on PCSK9 at a concentration of 10 nM. For example, the inhibition rate of the alternating modification sequence P92-si3 reached 75.6%.
[0326] I. The alternating modification sequences exhibited a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60% for all of them, and P92-si3 reaching 75.6%.
[0327] [Table 34]
[0328] From the table above, at a concentration of 10 nM, the alternating modification sequences P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si51, P92-si73, and P92-si83 all showed significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 60%, and among them, P92-si3 reached a maximum inhibition rate of 75.6%.
[0329] II. Template-modified sequences using anti-off-target design and / or 5'-E-VP modification exhibited significant inhibitory effects on the PCSK9 gene. For example, the inhibition rate of the sequence D84-DV27P, which used template modification and 5'-E-VP modification, was high at 94.4%.
[0330] [Table 35]
[0331] 1) The base sequences 5, 51, 81, and 84 modified with the modification templates of this disclosure exhibited a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 90%. Furthermore, the inhibitory effect was even more enhanced than that of the alternating modification sequences. For example, P92-si51, obtained by alternating modification of base sequence 51, had an inhibition rate of 70.1% (see Table 34), while D51-DV26, obtained by modification with template DV26, reached an inhibition rate of 90.7%, a significant improvement of 20.6% compared to the alternating modification sequences (Figure 8).
[0332] 2) After using template modification, anti-off-target design was performed, resulting in significant inhibitory activity against PCSK9 gene expression. For example, D84-DV26+, obtained by modifying the base sequence 84 with template DV26 and then performing anti-off-target design, showed a high inhibition rate of 90.1%.
[0333] 3) Performing 5'-E-VP modification after template modification can improve the inhibitory effect on the PCSK9 gene. For example, D84-DV27, obtained by modifying the base sequence 84 with template DV27, had an inhibition rate of 91.5%, and D84-DV27P, obtained by further 5'-E-VP modification, had an inhibition rate of 94.4%, an improvement of 2.9%.
[0334] 4) After template modification, anti-off-target design and 5'-E-VP modification can achieve inhibitory activity against the PCSK9 gene of over 90%. For example, D84-DV27+P, obtained by modifying the base sequence 84 with template DV27 and then performing anti-off-target and 5'-E-VP modifications, achieved an inhibition rate of 90.4%.
[0335] From the above, it can be concluded that modifying the sequence with the modification templates DV25-29 of this disclosure can further enhance the inhibitory effect compared to alternating sequence modifications. Furthermore, it was found that modifying the sequence using the modification templates DV25-29 of this disclosure, followed by anti-off-target design and / or 5'-E-VP modification, shows a significant inhibitory effect on PCSK9 gene expression, with inhibition rates reaching over 90%.
[0336] (2) In addition to one or more of the various modification forms of this disclosure, further anti-off-target design has a significant anti-off-target effect on off-target genes and reduces the inhibitory effect on off-target genes. The following was found from the experimental results. 1) When anti-off-target design is applied to the alternating modification sequence or template modification sequence of this disclosure, the inhibitory effect on off-target genes can be reduced, i.e., it has a significant anti-off-target effect.
[0337] 2) When both anti-off-target design and 5'-E-VP modification are applied to sequences using template modification, the inhibition rate against off-target genes is significantly reduced in both cases, indicating a significant anti-off-target effect.
[0338] I. When an anti-off-target design is applied to the alternating modification sequences of this disclosure, a significant anti-off-target effect is achieved, and the inhibition rate against off-target genes can be reduced by 20%.
[0339] [Table 36]
[0340] Table 36 shows that after applying anti-off-target design to the alternating modification sequences of this disclosure, the inhibition rate against off-target genes decreased, demonstrating an anti-off-target effect. For example, the alternating modification sequence P92-Si3+ with anti-off-target design showed a significant reduction compared to the sequence P92-Si3 without anti-off-target design, with a 20.0% decrease in inhibition rate against the off-target gene AARSD1 and a 20.5% decrease in inhibition rate against the off-target gene ACAP2.
[0341] II. When an anti-off-target design is applied to a sequence modified with the modification template of this disclosure, it exhibits a significant anti-off-target effect, and the inhibition rate against off-target genes can be reduced by up to 73.6%.
[0342] [Table 37]
[0343] 1) Use only off-target modifiers (indicated by "+" in the array index) When anti-off-target design was applied to sequences using template modifications, the inhibitory effect on off-target genes was significantly reduced. For example, the inhibition rate of D84-DV26+ against the MXD1 gene decreased by 39.9%, the inhibition rate of D81-DV25+ against the PCYOX1 gene decreased by 54.1%, the inhibition rate of D51-DV26+ against the NEPRO gene decreased by 25.9%, and the inhibition rate of D5-DV25+ against the DTWD1 gene decreased by 10.9%.
[0344] It has been shown that modifying the base sequences 5, 51, 81, and 84 with the modification templates designed in this disclosure, followed by further anti-off-target design, results in a significant anti-off-target effect.
[0345] 2) Combination of anti-off-target design and 5'-E-VP modification (indicated by "+P" in SEQ ID NO.) Sequences using both template modification and 5'-E-VP modification showed a significant reduction in the inhibition rate against off-target genes, demonstrating a remarkable anti-off-target effect. For example, the inhibition rate of D84-DV26+P against the off-target gene MXD1 decreased by 73.6%, the inhibition rate of D81-DV27+P against the off-target gene PCYOX1 decreased by 31.1%, and the inhibition rate of D51-DV26+P against the off-target gene KIF1B decreased by 41.6%, showing a significant reduction.
[0346] It has been shown that modifying the base sequences 5, 51, 81, and 84 with the modification templates designed in this disclosure, followed by anti-off-target design and 5'-E-VP modification, results in a significant anti-off-target effect.
[0347] summary: 1. Different modification sequences all exhibited significant inhibitory effects on the PCSK9 gene. For example, the inhibition rate of the alternating modification P92-si3 reached 75.6%, while the inhibition rate of the sequence D84-DV27P, which uses template modification and 5'-E-VP modification, was a high 94.4%. (1) The alternating modification sequences had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60% for all of them, and among them, P92-si3 reached 75.6%. (2) When anti-off-target design and / or 5'-E-VP modification was applied to the template-modified sequence, it had a significant inhibitory effect on the PCSK9 gene. For example, the sequence D84-DV27P, which used template modification and 5'-E-VP modification, showed a high inhibition rate of 94.4%.
[0348] 2. In addition to one or more of the various modification forms of this disclosure, further anti-off-target design was performed, resulting in a significant anti-off-target effect against off-target genes and a reduction in the inhibitory effect against off-target genes. (1) By using an anti-off-target design for the alternating modification sequence of this disclosure, a significant anti-off-target effect can be achieved, and the inhibition rate against off-target genes can be reduced by 20%. (2) When an anti-off-target design is applied to a sequence modified with the modification template of this disclosure, it exhibits a significant anti-off-target effect, and the inhibition rate against off-target genes can be reduced to a maximum of 73.6%.
[0349] Example 7: Effects of sequences modified with the modification template of this disclosure on PCSK9, low-density lipoprotein cholesterol (LDL-C), and total cholesterol (TC) in mouse serum. In this example, several sequences, including the base sequences 5, 51, 81, 82, and 84, were selected as examples. These sequences were modified, for example, by template modification only, by a combination of template modification and anti-off-target design, by a combination of template modification and 5'-E-VP modification, or by a combination of template modification, 5'-E-VP modification, and anti-off-target design. Using transgenic mice expressing the human PCSK9 gene, the inhibitory effects of each of the above sequences on serum PCSK9, low-density lipoprotein cholesterol (LDL-C), and total cholesterol (TC) were measured by ELISA at different time points.
[0350] 1. Experimental materials Investigational drug: Each sequence in Table 38 included sequences using template modification only, sequences using template modification and anti-off-target design, sequences using template modification and 5'-E-VP modification, or sequences using template modification, 5'-E-VP modification, and anti-off-target design. The 3' end of the sense strand of these sequences was bound to a GalNAc ligand, either G4, G5, G6, or G7. [ka]
[0351] The method for conjugating oligonucleotides with ligands G4, G5, G6, or G7 was the same as the method for preparing conjugates 4, 5, 6, and 7 in Example 3 of Patent CN116854754A. Specifically, YK-GAL-304, YK-GAL-305, YK-GAL-306, and YK-GAL-307 were conjugated to oligonucleotides. The method for synthesizing YK-GAL-304, YK-GAL-305, YK-GAL-306, and YK-GAL-307 was the same as in Example 1 of this application.
[0352] The oligonucleotide and ligand formed a conjugate as shown below. [ka]
[0353] The specific sequences of each sequence are shown in Table 38. G4, G5, G6, and G7 in the sequence numbers indicate that the sequence was bound to GalNAc ligand G4, G5, G6, or G7.
[0354] [Table 38] TIFF0007911448000080.tif243168TIFF0007911448000081.tif106168
[0355] Preparation of the investigational drug Drug solvent: PBS buffer Preparation conditions: sterile environment Labeling method: Labels were affixed to the prepared dosage formulations, and the theme number, name, concentration, quantity, preparation date, preparer, and storage conditions were indicated on the outer container. Storage conditions: Samples were prepared immediately before use, and the remaining samples were stored at -80°C.
[0356] Laboratory animal information: Species / Lineage: hPCSK9 Transgenic Mouse Grade: SPF Gender: Male Quantity: 214 animals Age: 4 - 7 weeks old Weight: 18 - 20 g Source: Jiangsu Jicui Yakang Biotechnology Co., Ltd. (GemPharmatech co., Ltd.) Manufacturing License Number: SCXK (Jiangsu) 2018 - 0008
[0357] Institutional Animal Care and Use Committee (IACUC): The experimental animals were received and raised by Youji (Tianjin) Pharmaceutical Technology Co., Ltd. (License Number for Use: SYXK (Tianjin Binjiang) 2019 - 0002). This project was reviewed by the Experimental Animal Ethics Committee of Youji (Tianjin) Pharmaceutical Technology Co., Ltd., and the experimental process was strictly implemented in accordance with the requirements of IACUC to ensure animal welfare.
[0358] Rearing and Management: Rearing Conditions: The experimental animals were received and raised by Youji (Tianjin) Pharmaceutical Technology Co., Ltd. (License Number for Use: SYXK (Tianjin Binjiang) 2019 - 0002). They were raised in breeding cages with dimensions of length × width × height = 29.0 cm × 18.5 cm × 13.0 cm. The temperature range was 20°C - 26°C, the humidity range was 40% - 70%, the ventilation rate was 15 times / hour or more, and the artificial lighting was set to 12 hours of light and 12 hours of darkness.
[0359] The rearing environmental conditions conformed to the national standard GB14925 - 2010 of the People's Republic of China and were managed by a packaged air - conditioning unit. The animals were allowed to eat and drink freely. The drinking water bottles and the drinking water inside were changed at least twice a week. After use, the drinking water bottles were sterilized by a pulsating vacuum sterilizer and reused.
[0360] The breeding cages and bedding of the animals were changed at least once a week. All breeding cages and bedding of the animals were sterilized by a pulsating vacuum sterilizer and used in a barrier environment. The breeding cages of the animals were washed, disinfected, and wiped at least once a week. The observation room for animal rearing was washed and disinfected daily, including flat shelves, floors, tables, etc.
[0361] As the disinfectant solutions used in the barrier environment, there are 6.67% benzalkonium bromide solution, 0.5% 84 disinfectant solution, 75% disinfectant solution, and 0.08% BESTAQUAM-S. The four types of disinfectants were used in sequence and should not be mixed.
[0362] Feed for experimental animals: SPF rat and mouse maintenance feed (manufactured by Spf (Beijing) Biotechnology Co., Ltd., with the animal feed production license number SCXK (Beijing) 2019 - 0010 issued by the Beijing Municipal Science and Technology Commission). Feed inspection: Each batch of feed has a quality certificate, and our company conducted a microbial inspection once every quarter. The feed supplier submitted the latest third - party feed inspection report every six months. The feed nutrient component inspection referred to the National Standard of the People's Republic of China GB14924.3 - 2010, and the contaminant index inspection referred to the National Standard of the People's Republic of China GB14924.2 - the year 2001.
[0363] [[ID=II]]Drinking water for experimental animals: Sterilized water prepared by a filtration system and directly filled into drinking water bottles. Drinking water inspection: Our company conducted a microbial experiment once every quarter and sent water to a third - party inspection agency for a water quality inspection once a year. The drinking water inspection referred to the National Standard of the People's Republic of China GB5749 - 2006.
[0364] Dressings for animals: Corn cobs (manufactured by Spf (Beijing) Biotechnology Co., Ltd., with the animal dressing production license number SCXK (Beijing) 2019 - 0004 issued by the Beijing Municipal Science and Technology Commission). Dressing inspection: Our company conducted a microbial experiment once every quarter. The dressing supplier submitted at least one third - party dressing inspection report every six months. The dressing inspection referred to the National Standard of the People's Republic of China GB14924.2 - 2001.
[0365] 2. Experimental methods Dosage setting and grouping Definition of the experimental day: The day when the solvent or the test drug was administered to the animals was defined as day 0. Grouping and Administration: After adaptive rearing of experimental animals, they were randomly divided into a negative control group and a test drug group according to their serum PSCK9 protein content, with 5 animals per group. A single subcutaneous dose of 6 mg / kg, 1 mL / kg, and 6 mg / mL was administered. The day of administration was designated as day 0.
[0366] Animal identification was performed using ear tags. Cages were identified using hanging cage cards. Laboratory signs were hung on the laboratory doors. Details of the grouping are shown in the table below.
[0367] [Table 39]
[0368] indicator measurement (1) General observations Patients were observed once a day from one week before administration until the end of the experiment. Observations included: observing the animals' death or near-death state, mental state, behavior and activity, fecal characteristics, and the supply of feed and drinking water near their cages. Experimental animals: All animals in the negative control group and the test drug group.
[0369] (2) Expression of PCSK9 protein in serum Measurement times: 3 days before administration on day 3 (day 3), 1 week after administration on day 7 (1w), 2 weeks after administration on day 14 (2w), 3 weeks after administration on day 21 (3w), 4 weeks after administration on day 28 (4w), and 5 weeks after administration on day 35 (5w). Method for measuring PCSK9 protein levels: An ELISA kit was used. Serum samples were kept from being repeatedly frozen and thawed. Experimental animals: All animals in the negative control group and the test drug group.
[0370] (3) Lipid measurement Measurement times: Approximately 200 μL of blood was collected from the medial canthus of the eye at the following times: 3 days before administration on day 3 (day 3), 1 week after administration on day 7 (1w), 2 weeks after administration on day 14 (2w), 3 weeks after administration on day 21 (3w), 4 weeks after administration on day 28 (4w), and 5 weeks after administration on day 35 (5w). Whole blood samples were temporarily stored in an icebox before centrifugation. After centrifugation at 2-8°C with a centrifugal force of approximately 3000g for 10 minutes, the samples were divided into two tubes (one containing approximately 60 μL, with the remaining serum stored in the other tube) and stored at -70 to -86°C for use in lipid measurements.
[0371] (4) Data processing and statistical analysis Experimental data were expressed as mean ± standard deviation (Mean ± SD) and analyzed using GraphPad Prism 8.3 analysis software. The LSD test was used for homogeneity of variance, and the Dunnett T3 test was used for unequal variance. A p-value of <0.05 was considered statistically significant.
[0372] 3. Experimental Results The specific experimental results are shown in Tables 40-42. Tables 40-42 show that these sequences can sustainably and significantly inhibit the PCSK9 protein in serum, leading to a significant reduction in serum low-density lipoprotein cholesterol (LDL-C) and serum total cholesterol (TC) levels. For example, in the D81-DV25G7 group, the inhibition rate of serum PCSK9 protein reached 83.1%, 82.2%, and 70.3% on days 7, 14, and 28, respectively. In the D82-DV27G5 group, serum LDL-C levels decreased by 32.6%, 35.8%, and 21.7% on days 7, 14, and 28, respectively. In the D82-DV29G7 group, serum TC levels decreased by 32.2%, 26.8%, and 19.6% on days 7, 14, and 28, respectively.
[0373] (1) The sequences of this disclosure, such as base sequences 5, 51, 81, 82, and 84, using different modifications, had a significant inhibitory effect on the expression of PCSK9 protein in serum. For example, in the D81-DV25G7 group, the inhibition rates reached 83.1%, 82.2%, and 70.3% on days 7, 14, and 28, respectively.
[0374] [Table 40]
[0375] Table 40 shows that the conjugates formed by conjugating each sequence with a GalNAc compound had a significant inhibitory effect on the expression of PCSK9 protein in serum. For example, the inhibition rates of D81-DV25G7 reached 83.1%, 82.2%, and 70.3% for sequences 7, 14, and 28, respectively (Figure 9).
[0376] The base sequences designed in this disclosure (e.g., base sequences 5, 51, 81, 82, and 84) have been shown to be efficiently delivered to animal livers and significantly inhibit PCSK9 gene expression when conjugated with a GalNAc compound using the template modifications of this disclosure, or simultaneously using 5'-E-VP modifications and / or anti-off-target designs.
[0377] (2) The sequences of this disclosure, such as the base sequences 5, 51, 81, 82, and 84 with different modifications, can significantly reduce serum low-density lipoprotein cholesterol (LDL-C) levels. For example, in the D82-DV27PG5 group, LDL-C levels decreased by 32.6%, 35.8%, and 21.7% on days 7, 14, and 28, respectively.
[0378] [Table 41]
[0379] Table 41 shows that serum LDL-C levels decreased significantly in all experimental groups. For example, in the D82-DV27PG5 group, LDL-C levels decreased by 32.6%, 35.8%, and 21.7% on days 7, 14, and 28, respectively (Figure 10). The base sequences designed in this disclosure (e.g., 5, 51, 81, 82, and 84), when conjugated with a GalNAc compound using the template modifications of this disclosure, or simultaneously using 5'-E-VP modifications and / or anti-off-target designs, have been shown to be efficiently delivered to animal livers and significantly reduce serum low-density lipoprotein cholesterol (LDL-C) levels.
[0380] (3) The sequences of this disclosure, such as the base sequences 5, 51, 81, 82, and 84 with different modifications, can significantly reduce serum total cholesterol (TC) levels. For example, D82-DV29PG7 reduced TC levels by 32.2%, 26.8%, and 19.6% on days 7, 14, and 28, respectively.
[0381] [Table 42]
[0382] Table 42 shows that serum total cholesterol (TC) decreased significantly in all experimental groups. For example, in the D82-DV29PG7 group, TC levels decreased by 32.2%, 26.8%, and 19.6% on days 7, 14, and 28, respectively (Figure 11). The base sequences designed in this disclosure (e.g., base sequences 5, 51, 81, 82, and 84) have been shown to be efficiently delivered to animal livers and significantly reduce serum total cholesterol (TC) levels when conjugated with a GalNAc compound using the template modifications of this disclosure, or simultaneously using 5'-E-VP modifications and / or anti-off-target designs.
[0383] summary: The base sequences designed in this disclosure (e.g., base sequences 5, 51, 81, 82, and 84), when conjugated with a GalNAc compound using the template modifications of this disclosure, or simultaneously using 5'-E-VP modifications and / or anti-off-target designs, can be efficiently delivered to animal livers, sustainably and significantly inhibiting serum PCSK9 protein expression and reducing serum low-density lipoprotein cholesterol (LDL-C) and serum total cholesterol (TC) levels.
[0384] For example, in the D81-DV25G7 group, the inhibition rate of serum PCSK9 protein expression reached 83.1%, 82.2%, and 70.3% on days 7, 14, and 28, respectively. In the D82-DV27PG5 group, serum low-density lipoprotein cholesterol (LDL-C) levels decreased by 32.6%, 35.8%, and 21.7% on days 7, 14, and 28, respectively. In the D82-DV29PG7 group, serum total cholesterol (TC) levels decreased by 32.2%, 26.8%, and 19.6% on days 7, 14, and 28, respectively.
[0385] Conclusion: In this disclosure, a series of siRNAs were designed based on the mRNA sequence of PCSK9, and these sequences were modified using a set of specific modification templates through alternating modifications. Furthermore, anti-off-target design and 5'-E-VP modification were performed on some of these sequences. The results are as follows. (1) Unmodified sequences containing base sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73, and 83 all exhibited significant inhibitory effects against PCSK9, with inhibition rates exceeding 60% at their peak.
[0386] (2) The inhibition rate of the sequence using multiple modifications reached over 90%. Furthermore, when the modified sequence was conjugated with a GalNAc compound, it could be efficiently delivered to the liver of animals, significantly inhibiting PCSK9 gene expression, significantly reducing serum low-density lipoprotein cholesterol (LDL-C) levels, and significantly reducing serum total cholesterol (TC) levels.
[0387] Details are as follows:
[0388] 1. The alternating modification sequences described herein exhibited a significant inhibitory effect on the PCSK9 gene. (1) Of the 84 designed sequences, 12 sequences, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73, and P92-si83, showed significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50% for all of them. Among these, P92-si5, P92-si81, P92-si82, P92-si3, P92-si8, and P92-si31 showed inhibition rates exceeding 70%. (2) The 26 sequences showed inhibition rates of 30% to 50% against the PCSK9 gene. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively. (3) The 46 sequences showed inhibition rates of 30% or less against the PCSK9 gene. For example, the inhibition rates of P92-si1 and P92-si20 were 9.2% and 6.0%, respectively. (4) siRNAs with similar sequences exhibited very different activities. For example, P92-si5 showed a significantly higher inhibition rate than P92-si4, with a 61.8% improvement.
[0389] 2. The unmodified sequence disclosed herein had a significant inhibitory effect on the PCSK9 gene. (1) Twelve unmodified sequences, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73, and si83, had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 50% for all of them. Among these, the inhibition rates of si5, si81, si82, si3, and si8 exceeded 60%. (2) Other unmodified sequences inhibited the PCSK9 gene by less than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2%, respectively. (3) siRNAs with similar sequences exhibited very different activities. For example, base sequence 5 showed a significantly higher inhibition rate of 51.2% compared to base sequence 4. (4) After alternating modifications to different sequences, the effects on activity varied. For example, in some cases, the inhibitory rate was significantly improved, with the sequence obtained by alternating modification of base sequence 5 showing a 12.4% improvement in inhibition compared to the unmodified sequence. In other cases, the inhibitory rate was almost unchanged, with the sequences obtained by alternating modification of base sequences 4, 22, and 52 showing almost no change in inhibition compared to the unmodified sequence.
[0390] 3. Sequences modified with the modification templates of this disclosure exhibited a significant inhibitory effect on the PCSK9 gene. (1) The base sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73, and 83 modified with the modification templates DV25-29 designed in this disclosure had a significant inhibitory effect on PCSK9 gene expression, with inhibition rates of 70% or more. Among these, the inhibition rates of P92-si-DV26, P92-si82-DV27, and P92-si82-DV29 reached 89.3%, 89.3%, and 89.1%, respectively. (2) The 12 sequences modified with modification templates DV25-29 of this disclosure showed significantly improved inhibition of PCSK9 gene expression compared to the alternating modification sequences. For example, P92-si51-DV27, obtained by modifying base sequence 51 with template DV27, showed a 29.1% improvement in inhibition compared to the alternating modification sequences. P92-si81-DV26, obtained by modifying base sequence 81 with template DV26, showed a 26.9% improvement in inhibition compared to the alternating modification sequences. (3) When the same sequence was modified with modification templates DV25-29 of this disclosure, the inhibition rate of PCSK9 gene expression was significantly improved compared to when it was modified with modification templates disclosed in the prior art. For example, when the base sequence 51 was modified with modification template DV27 of this disclosure, the inhibition rate was improved by 21.3% compared to when the sequence was modified with the known Advanced ESC template DV21. (4) When the same sequence was modified with modification templates DV25-29 of the Disclosure, the inhibition rate of PCSK9 gene expression was significantly improved compared to when it was modified with the other modification templates DV30 and DV31 of the Disclosure. For example, when the base sequence 51 was modified with modification template DV27 of the Disclosure, the inhibition rate was improved by 22.8% compared to when it was modified with modification template DV31 of the Disclosure. (5) The EC50 values of the above 12 sequences ranged from 0.0001 nM to 0.005 nM, with P92-si81-DV27, P92-si84-DV26, and P92-si82-DV27 having EC50 values of 0.0003 nM, 0.0004 nM, and 0.0006 nM, respectively. These sequences have been shown to effectively inhibit PCSK9 gene expression even at low concentrations.
[0391] 4. Each sequence modified with the alternating modification and modification templates of this disclosure exhibited significantly improved inhibitory activity against PCSK9 compared to unmodified sequences that were either completely identical or only slightly different from the sequences disclosed in the prior art. (1) The alternating modification sequences and sequences modified with specific modification templates of this disclosure showed significantly improved inhibition of the PCSK9 gene compared to completely identical unmodified sequences disclosed in the prior art, with the inhibition rate increasing by up to 40%. (2) The unmodified sequences, alternatingly modified sequences, and sequences modified with specific modification templates of this disclosure significantly improve the inhibition rate against the PCSK9 gene compared to unmodified sequences with only minor differences disclosed in the prior art, and can be increased by up to 40%.
[0392] I. The unmodified sequences of this disclosure exhibit significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the unmodified sequence si31 of this disclosure showed a 10.4% improvement in inhibition compared to 31P, which has a similar structure. II. The alternating modification sequences of this disclosure exhibit significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the alternating modification sequence P92-si5 of this disclosure showed a 22.0% improvement in inhibition compared to sequence 5P. III. Sequences modified with the modification templates of this disclosure exhibit significantly improved activity compared to similar unmodified sequences disclosed in the prior art. For example, the alternating modification sequence P92-si82-DV29 of this disclosure showed a 42.8% improvement in inhibition compared to sequence 82P.
[0393] 5. When specific anti-off-target designs were applied to the alternating modification sequences and template modification sequences of this disclosure, a significant inhibitory effect was observed against the PCSK9 gene, and the inhibitory effect against off-target genes was significantly reduced. (1) Different modification sequences all had a significant inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the alternating modification P92-si3 reached 75.6%, while the inhibition rate of the sequence D84-DV27P, which uses template modification and 5'-E-VP modification, was high at 94.4%.
[0394] I. The alternatingly modified sequences exhibited a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60%, and among these, P92-si3 reached 75.6%. II. Applying anti-off-target design and / or 5'-E-VP modification to template-modified sequences resulted in significant inhibitory effects on the PCSK9 gene. For example, the sequence D84-DV27P, which underwent both template modification and 5'-E-VP modification, showed a high inhibition rate of 94.4%.
[0395] (2) In addition to one or more of the various modification forms of this disclosure, further anti-off-target design has a significant anti-off-target effect on off-target genes and reduces the inhibitory effect on off-target genes.
[0396] I. When an anti-off-target design is applied to the alternating modification sequences of this disclosure, a significant anti-off-target effect is achieved, and the inhibition rate against off-target genes can be reduced by 20%. II. When an anti-off-target design is applied to a sequence modified with the modification template of this disclosure, it exhibits a significant anti-off-target effect, and the inhibition rate against off-target genes can be reduced by up to 73.6%.
[0397] 6. Sequences modified with the modification templates of this disclosure significantly inhibited PCSK9 expression in mouse serum and significantly reduced levels of low-density lipoprotein cholesterol (LDL-C) and total cholesterol (TC). (1) Different modifications to the base sequences 5, 51, 81, 82, and 84 of the present disclosure resulted in significant inhibitory effects on the expression of PCSK9 protein in serum. For example, in the D81-DV25G7 group, the inhibition rates reached 83.1%, 82.2%, and 70.3% on days 7, 14, and 28, respectively. (2) Different modifications to the basic sequences 5, 51, 81, 82, and 84 of the present disclosure significantly reduced serum low-density lipoprotein cholesterol (LDL-C) levels. For example, in the D82-DV27PG5 group, LDL-C levels decreased by 32.6%, 35.8%, and 21.7% on days 7, 14, and 28, respectively. (3) Different modifications to the base sequences 5, 51, 81, 82, and 84 of the present disclosure significantly reduced serum total cholesterol (TC) levels. For example, in the D82-DV29PG7 group, TC levels decreased by 32.2%, 26.8%, and 19.6% on days 7, 14, and 28, respectively.
Claims
1. A double-stranded RNAi agent comprising a double-stranded oligonucleotide in which the sense strand and antisense strand are matched, The double-stranded RNAi agent is a double-stranded oligonucleotide in which the sense strand consists of the sequence shown in SEQ ID NO. 4 (GAAGAUAUUAUUCUGGGGUUU) or a modified sequence thereof, and the antisense strand consists of the sequence shown in SEQ ID NO. 16 (AAACCCAGAAUAAAUAUCUUCAA) or a modified sequence thereof.
2. The double-stranded RNAi agent according to claim 1, wherein the chemical modification of the 2' position of ribose of each nucleotide is 2'-fluoro modification at odd positions on the sense strand, 2'-methoxy modification at even positions on the sense strand, 2'-methoxy modification at odd positions on the antisense strand, and 2'-fluoro modification at even positions on the antisense strand.
3. The double-stranded RNAi agent according to claim 2, wherein nucleotide monomers are linked together by thiolated 3',5'-phosphate diester bonds.
4. The aforementioned double-stranded RNAi agent is formed by matching the sense strand shown in SEQ ID NO. 172 (sequence: Gfs-Ams-Af-Gm-Af-Um-Af-Um-Uf-Um-Af-Um-Uf-Cm-Uf-Gm-Gf-Gm-Uf-Um-Uf) with the antisense strand shown in SEQ ID NO. 184 (sequence: Ams-Afs-Am-Cf-Cm-Cf-Am-Gf-Am-Af-Um-Af-Am-Af-Um-Af-Um-Cf-Um-Uf-Cms-Afs-Am), The double-stranded RNAi agent according to claim 3, wherein Af, Gf, Cf and Uf are 2'-fluoro modified A, G, C and U nucleotides, respectively, Am, Gm, Cm and Um are 2'-methoxy modified A, G, C and U nucleotides, respectively, and s indicates that the nucleotide monomers are linked by thiolated 3',5'-phosphate diester bonds.
5. The double-stranded RNAi agent according to claim 1 comprises one selected from the following double-stranded oligonucleotides in which the sense strand and antisense strand are matched, (1) A double-stranded oligonucleotide having a sense strand consisting of the sequence shown in SEQ ID NO. 352 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and an antisense strand consisting of the sequence shown in SEQ ID NO. 388 (Ams-Afs-Am-Cm-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (2) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 352 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 389 (Ams-Afs-Af-Cf-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (3) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 352 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 390 (Ams-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (4) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 389 (Ams-Afs-Af-Cf-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (5) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 390 (Ams-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (6) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 354 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gm-Gm-Um-Um-Um), and the antisense strand consisting of the sequence shown in SEQ ID NO. 391 (Ams-Afs-Am-Cm-Cm-Cf-Am-Gm-Am-Am-Um-Am-Am-Af-Um-Am-Um-Cm-Um-Um-Cms-Ams-Am), (7) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 355 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Am-Um-Um-Cm-Um-Gm-Gm-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 388 (Ams-Afs-Am-Cm-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (8) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 356 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gf-Gf-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 388 (Ams-Afs-Am-Cm-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (9) A double-stranded oligonucleotide having the sense strand consisting of the sequence shown in SEQ ID NO. 354 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gm-Gm-Um-Um-Um) and the antisense strand consisting of the sequence shown in SEQ ID NO. 388 (Ams-Afs-Am-Cm-Cm-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), However, Af, Gf, Cf and Uf are 2'-fluoro modified A, G, C and U nucleotides, respectively, Am, Gm, Cm and Um are 2'-methoxy modified A, G, C and U nucleotides, respectively, and s indicates that the nucleotide monomers are linked by thiolated 3',5'-phosphate diester bonds, in a double-stranded RNAi agent.
6. The double-stranded RNAi agent according to claim 2 or 5, wherein, in the phosphorylation of the carbon atom at the 5' position in the glycoside of the 5'-terminal nucleotide of the modified antisense strand, the phosphorylation group of the carbon atom at the 5' position is a 5'-vinylphosphonic acid ester group (5'-E-VP), and the 5'-terminal nucleotide is represented by the structural formula [Chemical Formula 1]. 【Chemistry 1】 (In the formula, R is C) 1-4 It is an alkoxy group, and the base is selected from adenine.
7. In the modified sequence, all nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are deoxynucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, unlocked nucleotides, conformally restricted nucleotides, restricted ethyl nucleotides, etc. A double-stranded RNAi agent according to claim 1, selected from the group consisting of nucleotide, debasalized nucleotide, 2'-amino group modified nucleotide, 2'-O-allyl group modified nucleotide, 2'-C-alkyl group modified nucleotide, 2'-hydroxy group modified nucleotide, 2'-methoxyethyl group modified nucleotide, 2'-O-alkyl group modified nucleotide, morpholino nucleotide, phosphoramidate, unnatural base-containing nucleotide, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl group modified nucleotide, thiophosphate ester group-containing nucleotide, methylphosphate ester group-containing nucleotide, 5'-phosphate ester-containing nucleotide, and 5'-phosphate ester analog-containing nucleotide.
8. A conjugate for reducing PCSK9 expression, comprising the double-stranded RNAi agent described in claim 1 and a ligand conjugated thereto.
9. The conjugate according to claim 8, wherein the ligand is conjugated to the 3' or 5' end of the sense strand of the oligonucleotide.
10. The conjugate according to claim 8 or 9, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.
11. The ligand is represented by the following structural formula, or 【Chemistry 2】 The conjugate according to claim 10, wherein the ligand is represented by G4, G5, G6, or G7 below. 【Transformation 3】
12. The conjugate according to claim 8 or 9, having the structure shown below. 【Chemistry 4】
13. The double-stranded RNAi agent is a conjugate according to claim 8 or 9, comprising one selected from double-stranded oligonucleotides having a sense strand and an antisense strand matched and conjugated with ligand G4, G5, G6, or G7, (1) A double-stranded oligonucleotide having the sense strand having the sequence shown in SEQ ID NO. 352 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand having the sequence shown in SEQ ID NO. 448 (AmsEVP-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (2) A double-stranded oligonucleotide having the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the sequence shown in SEQ ID NO. 390 (Ams-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), (3) A double-stranded oligonucleotide having the sense strand having the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um) and the antisense strand having the sequence shown in SEQ ID NO. 448 (AmsEVP-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), However, Af, Gf, Cf and Uf are 2'-fluoromodified A, G, C and U nucleotides, respectively, Am, Gm, Cm and Um are 2'-methoxymodified A, G, C and U nucleotides, respectively, and s indicates that the nucleotide monomers are linked by a thiolated 3',5'-phosphate diester bond, and the 5' carbon atom in the glycoside of the nucleotide at the 5' end of the antisense chain shown in SEQ ID NO. 448 is phosphorylated, and the phosphorylation of the 5' carbon atom is a 5'-vinylphosphonic acid ester group EVP conjugate.
14. The conjugate according to claim 13, wherein the double-stranded RNAi agent comprises one selected from the following double-stranded oligonucleotides in which the sense strand and antisense strand are matched. (1) The sense strand consists of the sequence shown in SEQ ID NO. 352 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Uf-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um), and the antisense strand is SEQ ID (1) A double-stranded oligonucleotide having the sequence shown in NO. 448 (AmsEVP-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), and the sense strand of the double-stranded oligonucleotide being conjugated with ligand G5 or G7, (2) The sense strand having the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um), and the antisense strand being SEQ ID NO. (3) A double-stranded oligonucleotide having the sequence shown in 390 (Ams-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), and the sense strand of the double-stranded oligonucleotide being conjugated with ligand G4 or G7, (3) The sense strand having the sequence shown in SEQ ID NO. 353 (Gms-Ams-Am-Gm-Am-Um-Af-Um-Uf-Um-Af-Um-Um-Cm-Um-Gm-Gf-Gm-Um-Um-Um), and the antisense strand being SEQ ID NO. A double-stranded oligonucleotide having the sequence shown in 448 (AmsEVP-Afs-Am-Cf-Cf-Cf-Am-Gm-Am-Am-Um-Am-Am-Af-Um-Af-Um-Cm-Um-Um-Cms-Ams-Am), wherein the sense strand of the double-stranded oligonucleotide is conjugated with ligand G5, G6, or G7.
15. The conjugate according to claim 14, wherein the double-stranded RNAi agent comprises a double-stranded oligonucleotide in which the sense strand indicated by SEQ ID NO. 353 and the antisense strand indicated by SEQ ID NO. 448 are matched, and the sense strand of the double-stranded oligonucleotide is conjugated with ligand G5.
16. A pharmaceutical composition comprising a double-stranded RNAi agent according to claim 1 or a conjugate according to claim 8, and a pharmaceutically acceptable carrier.
17. A pharmaceutical composition according to claim 16 for the treatment of PCSK9-related diseases, A pharmaceutical composition in which PCSK9-related disease is selected from hypercholesterolemia, atherosclerosis, dyslipidemia, cardiovascular disease, or cerebrovascular disease.
Citation Information
Patent Citations
Modified siRNA molecule and application thereof
CN109957565A
Double-stranded oligonucleotide, composition containing double-stranded oligonucleotide, conjugate containing double-stranded oligonucleotide, and preparation method and application of double-stranded oligonucleotide
CN115677810A
GalNAc compound containing ribose ring or derivative structure thereof and oligonucleotide conjugate thereof
CN116854754A
PCSK9 iRNA Composition and Method of Using the Same
JP2016506240A
Inhibitory nucleic acids for PCSK9
WO2023017004A1