Method for producing cerebral cortical cell preparation derived from human pluripotent stem cells
Patent Information
- Application Number
- JP2023530419
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-16
- Filing Date
- 2022-06-16
- Publication Date
- 2025-06-19
- Estimated Expiration
- 2042-06-16
AI Technical Summary
Current methods for producing cerebral organoids from human pluripotent stem cells in the absence of supporting cells face low efficiency, particularly when using the SFEBq method without feeder cells.
Culturing pluripotent stem cells in a medium lacking bFGF and TGFβ signals, followed by differentiation in a suspension culture with TGFβ and Wnt signal inhibitors, and subsequent culture in a medium without these inhibitors to produce high-quality cerebral cortical cell clusters suitable for transplantation.
This method enables efficient production of cerebral organoids and cerebral cortical cell clusters with high purity, suitable for clinical use, improving the efficiency and quality of cell preparations for treating cerebrovascular disorders.
Abstract
Description
Method for producing cerebral cortical cell preparations derived from human pluripotent stem cells
[0001] The present invention relates to cerebral organoids or cerebral cortical cell masses derived from pluripotent stem cells, and methods for producing them.
[0002] Cell transplantation therapy, which involves transplanting nerve cells induced to differentiate from human pluripotent stem cells, particularly human induced pluripotent stem cells (iPS cells), is expected to improve symptoms such as motor paralysis caused by cerebrovascular disorders.
[0003] A method for inducing differentiation of cerebral organoids from human embryonic stem cells (ES cells) maintained in the presence of support cells (sometimes called feeder cells) such as mouse embryonic fibroblasts (MEFs) (Serum-free Floating Culture of Embryoid Body-like Aggregates with Quick Reaggregation: SFEBq method) has been established, making it possible to obtain deep layer neurons in layers V and IV of the cerebral cortex, including motor neurons.
[0004] On the other hand, it is desirable to produce transplant cells for clinical use in the absence of xenogeneic cells (feeder-free). However, when human pluripotent stem cells maintained in the absence of feeder cells are induced to differentiate by the SFEBq method, the efficiency of generating cerebral organoids is low (Non-Patent Document 3).
[0005] WO2015 / 076388WO2016 / 167372WO2016 / 063985
[0006] Kitahara, et al., Stem Cell Reports 2020 Vol. 15, 467-481Kuwahara, et. al., Scientific Reports 2019, 9:18936Eiraku, M et al., Cell Stem Cell, 3, 519-532 (2008)
[0007] The present invention aims to provide cerebral organoids derived from human pluripotent stem cells, cell masses containing cerebral cortical cells, and methods for producing them, which are useful in regenerative medicine. More specifically, the present invention aims to provide a method for producing cerebral organoids from pluripotent stem cells in the absence of feeder cells, and the products obtained by this method.
[0008] In order to solve the above problems, the present inventors discovered that cerebral organoids can be efficiently produced by culturing pluripotent stem cells in a culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling in the absence of supporting cells, and then inducing differentiation into neurons. They also discovered that cerebral cortical cell masses of a quality suitable for transplantation can be efficiently produced by culturing cerebral organoids in a culture medium containing a Notch signaling inhibitor.
[0009] That is, the present invention provides the following. [1] A method for producing cerebral organoids from pluripotent stem cells in the absence of feeder cells, comprising: (1) culturing pluripotent stem cells in a culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling; and (2) inducing the differentiation of the cells obtained in step (1) into neurons. [2] The method of [1], wherein step (2) comprises: (2a) suspension culturing the cells obtained in step (1) in a culture medium containing a TGFβ signaling inhibitor and a Wnt signaling inhibitor to obtain cell clusters; and (2b) suspension culturing the cell clusters obtained in step (2a) in a culture medium that is substantially free of a TGFβ signaling inhibitor and a Wnt signaling inhibitor to obtain cerebral organoids. [3] The method of [2], wherein the suspension culture in step (2a) is static culture. [4] The method according to [2] or [3], wherein the suspension culture in step (2b) is a shaking culture. [5] The method according to any one of [1] to [4], wherein the culture period in step (1) is less than 3 days. [6] The method according to any one of [1] to [5], wherein the culture period in step (1) is 12 hours or more and 2 days or less. [7] The method according to any one of [1] to [6], wherein the culture medium in step (1) contains a TGFβ signaling inhibitor selected from the group consisting of SB431542, A-83-01, and XAV-939. [8] The method according to any one of [2] to [7], wherein the culture medium in steps (1), (2a), and (2b) is a serum-free culture medium. [9] The method according to any one of [1] to [8], wherein the pluripotent stem cells are human induced pluripotent stem cells or human embryonic stem cells.
[10] (3) The method according to any one of [1] to [9], further comprising a step of selecting cerebral organoids from the plurality of cell clusters obtained in step (2) using one or more indicators selected from the group consisting of the shape, internal structure, size, surface color or pattern, and gene expression of the cell clusters.
[11] A cell culture produced by the method according to any one of [1] to [9], comprising a plurality of spherical cell clusters, wherein the proportion of cerebral organoids among the plurality of spherical cell clusters is 40% or more.
[12] The cell culture according to
[11] , wherein the proportion of cerebral cortex-like structures in the cerebral organoids is 40% or more.
[13] The cerebral organoids further comprise the following (1) to (5): (1) a spherical cell mass, (2) having a cerebral cortex-like structure inside the cell mass, (3) not having pigmentation on the surface, (4) not having any cystic, protruding, or balloon-like shape in any part of the cell mass, and (5) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22 , CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53 The cell culture of
[12] , which is a cell mass having one or more characteristics selected from the group consisting of I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
[14] A cerebral cortical cell mass, characterized in that: (a) the number of cells positive for a proliferation marker is 10% or less of the total number of cells, (b) the number of cells positive for one or more markers selected from the group consisting of neuronal markers, cortical layer V / VI markers, and forebrain markers is 70% or more of the total number of cells, and (c) it is substantially free of neuroepithelium or cerebral cortex-like structures.
[15] The cerebral cortical cell mass according to
[14] , wherein the proliferation marker in (a) is Ki67, the neuronal marker in (b) is βIII-Tubulin, the cortical layer V / VI marker is Ctip2, and the forebrain marker is FOXG1.
[16] (d) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2 , KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PC The cerebral cortical cell mass according to
[14] or
[15] , which further expresses at least one marker selected from the group consisting of DH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
[17] The cerebral cortical cell mass according to
[16] , which expresses SLC17A7.
[18] The cerebral cortical cell mass according to any of
[15] to
[17] , which does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2.
[19] A method for producing a cerebral cortical cell mass from pluripotent stem cells in the absence of supporting cells, comprising: (i) obtaining cerebral organoids from the pluripotent stem cells; and (ii) culturing the cerebral organoids obtained in step (i) in a culture medium containing a Notch signal inhibitor to obtain a cerebral cortical cell mass.
[20] The method according to
[19] , wherein in step (i), cerebral organoids are obtained from pluripotent stem cells by the method of any of [1] to
[10] .
[21] A highly purified cerebral cortical cell mass, characterized in that: (A) the number of cells positive for a proliferation marker is 5% or less of the total number of cells; (B) the number of cells positive for one or more markers selected from neuronal markers, cortical layer V / VI markers, and forebrain markers is 70% or more of the total number of cells; and (C) the mass is substantially free of neuroepithelium or cerebral cortex-like structures.
[22] The high-purity cerebral cortical cell mass according to
[21] , wherein the proliferation marker of (A) is Ki67, the neuronal marker of (B) is βIII-Tubulin, the cortical layer V / VI marker is Ctip2, and the forebrain marker is FOXG1.
[23] (D) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2 , KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, P The high-purity cerebral cortical cell mass according to
[21] or
[22] , which expresses at least one gene selected from the group consisting of CDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
[24] The high-purity cerebral cortical cell mass according to
[23] , which expresses one or more genes selected from the group consisting of SLC17A7, NEUROD6, and EMX1.
[25] The highly purified cerebral cortical cell mass according to any one of
[21] to
[24] , which does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2.
[26] A method for producing a highly purified cerebral cortical cell mass from pluripotent stem cells in the absence of feeder cells, comprising: (i) obtaining cerebral organoids from the pluripotent stem cells; (ii) culturing the cerebral organoids obtained in step (i) in a culture medium; (iii) dispersing the cell culture obtained in step (ii) into single cells or cell clumps of 2 to 5 cells; and (iv) culturing the cell culture obtained in step (ii) or the cell population obtained in step (iii) in a culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator to obtain a cell mass, wherein the culture medium in step (ii) and / or the culture medium in step (iv) contains a Notch signal inhibitor.
[27] The method according to
[26] , wherein in step (i), cerebral organoids are obtained from pluripotent stem cells by a method according to any one of [1] to
[10] .
[28] The method according to any one of
[19] ,
[20] ,
[26] and
[27] , wherein the cerebral organoids administered in step (ii) are cerebral organoids 28 to 44 days after the start of induction of differentiation into neurons.
[29] The method according to any one of
[19] ,
[20] and
[26] to
[28] , wherein the culture period in step (ii) is 2 to 6 days.
[30] The method according to any one of
[19] ,
[20] and
[26] to
[29] , wherein the culture period in step (iv) is 2 to 14 days.
[31] The method according to any one of
[19] ,
[20] and
[26] to
[30] , wherein the Notch signal inhibitor is a gamma-secretase inhibitor.
[32] The method according to
[31] , wherein the gamma secretase inhibitor is N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) or Compound E.
[33] A cell population comprising the high-purity cerebral cortical cell mass according to any one of
[21] to
[25] , wherein the high-purity cerebral cortical cell mass is uniform in size, shape or constituent cell composition.
[34] A pharmaceutical composition comprising as an active ingredient the cerebral cortical cell mass according to any one of
[14] to
[18] , the high-purity cerebral cortical cell mass according to any one of
[21] to
[25] , or the cell population according to
[33] , or a cell population obtained by dispersing them into their constituent cells.
[35] A tissue for transplantation, comprising the cerebral cortical cell mass according to any one of
[14] to
[18] , the high-purity cerebral cortical cell mass according to any one of
[21] to
[25] , or the cell population according to
[33] , or a cell population obtained by dispersing them into their constituent cells.
[36] A therapeutic agent for cerebrovascular disorders, comprising as an active ingredient the cerebral cortical cell mass according to any one of
[14] to
[18] , the high-purity cerebral cortical cell mass according to any one of
[21] to
[25] , or the cell population according to
[33] , or a cell population obtained by dispersing them into their constituent cells.
[37] A method for treating cerebrovascular disorders, comprising administering or transplanting the cerebral cortex cell mass described in any of
[14] to
[18] , the high-purity cerebral cortex cell mass described in any of
[21] to
[25] , or the cell population described in
[33] , or a cell population obtained by dispersing them into their constituent cells, to the cerebral cortex or basal ganglia of a subject in need thereof.
[38] A method for evaluating the quality of cerebral organoids or cerebral cortical cell masses, comprising: (aa) measuring the expression level of at least one gene selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2, or a protein or fragment thereof encoded by said gene, in the cerebral organoids or cerebral cortical cell mass; and (bb) evaluating the amount of non-target cells contained in the cerebral organoids or cerebral cortical cell mass as being below the standard, if the expression level of the gene is below the standard, based on the measurement results of step (aa).
[39] (AA) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, C in cerebral organoids or cerebral cortical cell clusters A method for evaluating the quality of a cerebral organoid or a cerebral cortical cell cluster, comprising the steps of: measuring the expression level of at least one gene selected from the group consisting of ORO2B, TP53I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3; and (BB) evaluating, based on the measurement results of step (AA), if the expression level of the gene is equal to or greater than a reference value, that the amount of target cells contained in the cerebral organoid or the cerebral cortical cell cluster is equal to or greater than a reference value.
[0010] The present invention enables the efficient production of cerebral organoids from human pluripotent stem cells, which can be used as materials for cerebral cortical cell preparations. The cerebral organoid-derived cerebral cortical cell masses of the present invention are useful as therapeutic agents or transplant materials for treating cerebrovascular disorders and the like.
[0011] 1 shows an image of the morphology of cell aggregates after induction of differentiation into neurons in preliminary test 1. 1 shows the results of expression analysis of FGF2 and TGFβ pathway-related genes by microarray in preliminary test 2. 1 shows an example of a differentiation induction scheme in Example 1. 1 shows a bright-field image (A) and a confocal fluorescence microscope image (B) of cell aggregates after differentiation induction in 1-1 of Example 1. 1 shows an example of a differentiation induction scheme in Example 1. 1 shows a confocal fluorescence microscope image of a cerebral cortical cell mass after differentiation induction in 1-1 of Example 1. 1 shows a confocal fluorescence microscope image of a cerebral organoid on Day 35 after differentiation induction in 1-2 of Example 1. 1 shows representative bright-field images of cultures on Day 18, Day 27, and Day 34 after differentiation induction in Example 2. 1 shows the formation efficiency (%) of cerebral organoids under each condition after differentiation induction in Example 2. 1 shows the results of expression analysis of various marker genes after step (1) (Day 0) in Example 3. 4-1 of Example 4 shows a differentiation induction scheme (A), and bright-field images (B) of cerebral organoids (DAPT-, Day 36), cerebral cortical cell clusters (DAPT+, Day 36), and high-purity cerebral cortical cell clusters (Day 40). Representative confocal fluorescence microscope images of immunostaining in 4-1 of Example 4 are shown. Differentiation induction scheme in 4-2 of Example 4 is shown. Analysis results of marker gene expression by flow cytometry in 4-2 of Example 4 are shown. Analysis results of marker gene expression by flow cytometry in 4-2 of Example 4 are shown. DAPT method scheme in 4-3 of Example 4 is shown (A), and results of RT-qPCR analysis of changes in gene expression in the obtained cell clusters are shown (B). Differentiation induction scheme in Example 5 is shown (A), and results of immunostaining of cerebral organoids on Day 28 (4 weeks), Day 42 (6 weeks), and Day 75 (10 weeks) are shown (B). 1 shows the results of analyzing the relative expression levels of various markers in cerebral organoids on Day 28 (4 wk), Day 35 (5 wk), Day 42 (6 wk), and Day 75 (10 wk) in Example 5. 1 shows a representative confocal fluorescence microscope image of an immunostained graft in Example 6. 1 shows the results of analyzing the volume of an immunostained graft in Example 6. 1 shows a scheme of the method of a preferred embodiment. 1 shows a representative confocal fluorescence microscope image of immunostaining in Example 7.8-1 of Example 8 shows the results of flow cytometry analysis. 8-1 of Example 8 shows the schemes of two methods. 8-1 of Example 8 shows the results of RT-qPCR analysis of the time-course gene expression levels of each marker in cell clusters obtained by the single-cell DAPT method and the organoid method in Example 8 shows the results of RT-qPCR analysis of the time-course gene expression levels of each marker in cell clusters obtained by the single-cell DAPT method and the organoid method in Example 8 shows the results of flow cytometry analysis of the gene expression levels on day 10 of cell clusters obtained by the single-cell DAPT method and the organoid method in Example 8 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of gene expression in cell clusters obtained by the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of gene expression in cell clusters obtained by the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morphology in Example 9 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of gene expression in cell clusters obtained by the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morphology in Example 9 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morphology in Example 9 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morphology in Example 9 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of gene expression in cell clusters obtained by the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morphology in Example 9 shows the scheme of the single-cell DAPT method in Example 8 shows the results of flow cytometry analysis of organoid morph 9-1 of Example 9 shows a bar graph of the proportion of organoids of each morphology. 9-2 of Example 9 shows bright field images of nine organoids obtained after three rounds of differentiation induction. 9-2 of Example 9 shows the results of single-cell RNA-seq analysis data for nine organoids displayed in UMAP format. 9-2 of Example 9 shows the results of single-cell RNA-seq analysis data for nine organoids displayed in UMAP format. 9-2 of Example 9 shows the results of identifying cell types in each cluster based on the gene expression of each cluster. 9-2 of Example 9 shows the expression profiles of genes characteristic of each cluster and known marker genes in the single-cell gene expression data in Example 9. 9-2 of Example 9 shows the expression profiles of genes characteristic of each cluster and known marker genes in the single-cell gene expression data in Example 9. 9-2 of Example 9 shows the expression profiles of genes characteristic of each cluster and known marker genes in the single-cell gene expression data in Example 9. 9-2 of Example 9 shows the proportion of each cell type in the nine organoids (A) and the proportion of neural crest cells at each differentiation stage (B). 9-3 of Example 9 shows the results of immunostaining of representative marker proteins for organoids in each group. 9-4 of Example 9 shows bright-field images of three organoids in each group.The results of analyzing the expression of marker genes by RT-qPCR for each organoid in 9-4 of Example 9 are shown. The results of analyzing the expression of marker genes by RT-qPCR for each organoid in 9-4 of Example 9 are shown. Bright-field images (A) of Rosettes organoids in Lot 1, Lot 2, and Lot 3 in 9-5 of Example 9, and a UMAP plot (B) of single-cell gene expression analysis are shown. The expression of marker genes was analyzed for organoids in 9-5 of Example 9, and the results displayed by UMAP are shown.
[0012] 1. Definitions [Stem Cells] As used herein, the term "stem cells" refers to undifferentiated cells that have differentiation potential and proliferation potential (particularly self-renewal potential) while maintaining differentiation potential. Stem cells include subpopulations such as pluripotent stem cells, multipotent stem cells, and unipotent stem cells, depending on their differentiation potential.
[0013] Pluripotent stem cells are stem cells that can be cultured in vitro and have the ability (pluripotency) to differentiate into all cell lineages belonging to the three germ layers (ectoderm, mesoderm, and endoderm) and / or extraembryonic tissues. Multipotent stem cells are stem cells that have the ability to differentiate into multiple types of tissues and cells, although not all types. Unipotent stem cells are stem cells that have the ability to differentiate into specific tissues and cells.
[0014] Pluripotent stem cells can be derived from fertilized eggs, cloned embryos, germline stem cells, tissue stem cells, somatic cells, etc. Examples of pluripotent stem cells include embryonic stem cells (ES cells), embryonic germ cells (EG cells), and induced pluripotent stem cells (iPS cells). Muse cells (multi-lineage differentiating stress enduring cells) obtained from mesenchymal stem cells (MSCs) and mGS cells prepared from germ cells (e.g., testes) are also included in pluripotent stem cells.
[0015] Human embryonic stem cells were established in 1998 and are now being used in regenerative medicine. Embryonic stem cells can be produced by culturing the inner cell mass of blastocysts, i.e., within 14 days after fertilization, on feeder cells or in a medium containing FGF2. Methods for producing embryonic stem cells are described, for example, in WO 96 / 22362, WO 02 / 101057, US 5,843,780, US 6,200,806, US 6,280,718, etc. Embryonic stem cells are available from designated institutions and can also be purchased commercially. For example, human embryonic stem cells KhES-1, KhES-2, and KhES-3 are available from the Institute for Frontier Medical Sciences, Kyoto University.
[0016] As used herein, "induced pluripotent stem cells" refer to cells in which pluripotency has been induced by reprogramming somatic cells using known methods.
[0017] In 2006, Yamanaka et al. established induced pluripotent stem cells from mouse cells (Cell, 2006, 126(4), pp. 663-676). In 2007, induced pluripotent stem cells were also established from human fibroblasts, and they possess the same pluripotency and self-renewal capabilities as embryonic stem cells (Cell, 2007, 131(5), pp. 861-872; Science, 2007, 318(5858), pp. 1917-1920; Nat. Biotechnol., 2008, 26(1), pp. 101-106).
[0018] Specifically, induced pluripotent stem cells include cells in which pluripotency is induced by reprogramming somatic cells differentiated into fibroblasts, peripheral blood mononuclear cells, etc. by forcibly expressing any combination of multiple genes selected from a group of reprogramming genes including OCT3 / 4, SOX2, KLF4, MYC (c-MYC, N-MYC, L-MYC), GLIS1, NANOG, SALL4, LIN28, ESRRB, etc. Preferred combinations of reprogramming factors include (1) OCT3 / 4, SOX2, KLF4, and MYC (c-MYC or L-MYC), and (2) OCT3 / 4, SOX2, KLF4, LIN28, and L-MYC (Stem Cells, 2013; 31: 458-466).
[0019] In addition to producing induced pluripotent stem cells by inducing reprogramming through gene expression, induced pluripotent stem cells can also be induced by adding compounds to somatic cells (Science, 2013, 341, pp. 651-654; Nature, 2022, 605, pp. 325-331).
[0020] It is also possible to obtain established induced pluripotent stem cells. For example, human induced pluripotent cell lines such as 201B7 cells, 201B7-Ff cells, 253G1 cells, 253G4 cells, 1201C1 cells, 1205D1 cells, 1210B2 cells, and 1231A3 cells established at Kyoto University are available from Kyoto University and iPS Academia Japan, Inc. Clinical iPS cell lines, such as Ff-I01, Ff-I14, QHJI01, and QHJI14 established at Kyoto University, are available from Kyoto University. iPS cells can also be produced by reprogramming somatic cells, such as hematopoietic progenitor cells and fibroblasts derived from peripheral blood or umbilical cord blood, using reprogramming factors. S2WCB1 and S2WCB3 used herein were established from adult peripheral blood mononuclear cells using CytoTune™-2.0 (ID Pharma).
[0021] In this specification, pluripotent stem cells are preferably embryonic stem cells or induced pluripotent stem cells, and more preferably induced pluripotent stem cells.
[0022] In this specification, pluripotent stem cells refer to mammalian pluripotent stem cells, preferably rodent (e.g., mouse, rat) or primate (e.g., human, monkey) pluripotent stem cells, more preferably human pluripotent stem cells, and even more preferably human induced pluripotent stem cells (iPS cells) or human embryonic stem cells (ES cells).
[0023] Pluripotent stem cells such as human iPS cells can be subjected to maintenance culture and expansion culture by methods well known to those skilled in the art.
[0024] [Marker] As used herein, the term "marker" refers to a substance present in a cell, the presence or amount of which makes it possible to identify or distinguish the type or properties of the cell. Specific examples of markers include mRNA, proteins and sugar chains encoded by the mRNA, and fragments of these.
[0025] [Nerve Cells] As used herein, a nerve cell refers to a nerve unit composed of a cell body, dendrites, and axon, and is also called a neuron. Nerve cells have the function of transmitting stimuli from other nerve cells or stimulus receptor cells to other nerve cells, muscles, or glandular cells. They are classified into dopaminergic nerves, serotonergic nerves, GABAergic nerves, glutamatergic nerves, etc., depending on the neurotransmitters they produce; however, the type of neurotransmitter is not particularly limited herein. Nerve cells can be identified by significantly expressed markers, and examples of such markers include βIII-tubulin and MAP2.
[0026] [Neural Stem Cells] As used herein, "neural stem cells" refer to stem cells that are destined to differentiate into neural cells but retain the ability to proliferate and differentiate into multiple neural cell types. These cells have the ability to differentiate into neural progenitor cells and cerebral cortical cells. They can be identified by markers of primitive neuroectoderm and neural stem cells, such as intermediate filament proteins (nestin, vimentin, etc.) and transcription factors SOX1, SOX2, and PAX6. Neural stem cells as used herein include radial glia.
[0027] Immature cells that arise from neural stem cells and can differentiate into multiple nerve cells are also called neural progenitor cells.
[0028] [Cerebral organoids] As used herein, the term "cell culture" refers to a product obtained by culturing cells, regardless of the specific composition. A cell culture may be an aggregate of multiple cell clusters, and may further include a single cell and an aggregate of 2 to 5 cells as described below. A cell culture may or may not contain a culture medium or suspension medium, and unless otherwise specified, the cell culture herein refers to one that does not contain a culture medium or suspension medium.
[0029] In this specification, " cerebral organoid " refers to one or more, preferably a plurality of, spherical cell aggregates (cell masses) that comprise the cerebral cortex-like structure with a neuronal cell layer on the outside of neuroepithelium.Here, the cerebral cortex-like structure is a rosette-like structure with a neuronal cell layer on the outside of neuroepithelium.Therefore, the cerebral cortex-like structure may comprise a neuroepithelial-like structure, and the cerebral organoid of the present application may comprise a neuroepithelial-like structure.
[0030] Here, "neuroepithelium" refers to a layered structure whose main constituent cells are neural stem cells and / or neural progenitor cells, and can also be referred to as a localized region of neural stem cells and / or neural progenitor cells.
[0031] Here, the "neuronal layer" is a layered structure containing neurons. The neurons are not particularly limited as long as they are neurons that can be generated during the differentiation stage of cerebral organoids, but examples include cells that are positive for at least one of neuron markers, forebrain markers, and cerebral cortical neuron markers. The neuron layer preferably contains two or more, or all, of neuron marker-positive cells, forebrain marker-positive cells, and cerebral cortical neurons or their precursor cell marker-positive cells. The neuron layer can also be said to be a localized region of neurons (cerebral cortical neurons) that originate from the neuroepithelium.
[0032] One embodiment of the cerebral organoid herein includes a cerebral organoid obtained by inducing differentiation of pluripotent stem cells.
[0033] Here, "spherical" refers to a structure that is not rod-shaped or flat (plate-shaped), and preferably refers to a "three-dimensional structure that is close to a sphere." For example, a structure that is circular or elliptical when projected onto a two-dimensional surface can be mentioned. However, it does not have to show a smooth curve, and even if there are partial irregularities, it can be considered "spherical" as long as the cell mass as a whole is recognizable as having a shape that is close to a sphere. As used herein, "spherical" does not necessarily require a high sphericity, but an example is a structure with a sphericity of 0.7 or more, 0.8 or more, preferably 0.9 or more.
[0034] As used herein, examples of marker genes for neural stem cells or neural progenitor cells include SOX1, SOX2, and PAX6.
[0035] Examples of nerve cell marker genes include βIII-Tubulin and MAP2.
[0036] Examples of forebrain marker genes include FOXG1 (also called BF1), SIX3, and EMX1.
[0037] Examples of cerebral cortical neuron marker genes include markers for layers I to VI, which will be described later.
[0038] Furthermore, as marker genes for various cells, the genes listed in Table 6 below can be mentioned, as will be described later.
[0039] [Cerebral Cortex Cells] As used herein, the term "cerebral cortex cells" is also referred to as cerebral cortical neurons or cerebral cortical nerve cells, and refers to nerve cells that constitute the cerebral cortex.
[0040] In cerebral organoids, the neuronal cell layer may be a single layer, or may be divided into multiple cell layers. For example, from the side close to the neuroepithelium toward the outside of the organoid, the cerebral cortex layer VI (Tbr1, Tbr2), layer V (Ctip2, Er81, Fezf2), layer IV (Rorb), layer III / II (Foxp1, Mef2c, Satb2) layer I (Reelin) may contain layers in which characteristic neurons are localized. Marker genes frequently used to identify each layer are shown in parentheses.
[0041] In the present specification, cerebral cortical cells are preferably cells that are positive for the forebrain marker FOXG1. In the present invention, examples of FOXG1 include polynucleotides represented by NCBI accession number NM_005249 and proteins encoded thereby.
[0042] As used herein, cerebral cortical cells may include neurons in the motor cortex or upper motor neurons, i.e., neurons in the anterior part of the cerebral cortex, and more specifically, may include neurons in layer V and / or layer VI of the motor cortex.
[0043] As used herein, layer V or layer VI (collectively referred to as layer V / VI) neurons are a cell population characterized by being positive for Ctip2. In the present invention, examples of Ctip2 include polynucleotides designated by NCBI accession numbers NM_001282237, NM_001282238, NM_022898, and NM_138576, and proteins encoded thereby. Furthermore, cerebral cortical cells may include neurons in layer I, layer II / III, and layer IV.
[0044] The cerebral cortical cells herein may be produced as a cell population containing other cell types, and the cell population containing cerebral cortical cells may contain, for example, 15% or more, 20% or more, 30% or more, 40% or more, or 50% or more of cerebral cortical cells in the produced cell population.
[0045] As used herein, the term "cerebral cortical cells" is a concept that includes "cerebral cortical progenitor cells," and the target cells of the "cerebral organoids" of the present invention include cerebral cortical progenitor cells. On the other hand, the target cells of the "cerebral cortical cell clusters (including high-purity cerebral cortical cell clusters)" of the present invention, which are at a more advanced differentiation stage, may contain almost no cerebral cortical progenitor cells, or may contain only a minimal number of cerebral cortical progenitor cells.
[0046] [Cell aggregates and cell populations] As used herein, the term "cell aggregate" (also referred to as cell aggregate) is not particularly limited as long as it is a three-dimensional structure formed by adhesion of multiple cells to each other, and refers to, for example, a cluster formed by the aggregation of cells dispersed in a medium such as a culture medium, or a cluster of cells formed through cell division. Cell aggregates also include those that form specific tissues. Embryoid bodies, spheres, and spheroids are included in the cell aggregate. The cell aggregate may have any shape, and examples thereof include spherical cell aggregates and layered cell aggregates.
[0047] As used herein, a "cell population" refers to a population containing a plurality of cells, and may be a cell cluster (spherical cell cluster, layered cell cluster), or a cell clump of 2 to 5 cells. The "cell population" may also be a population of cell clusters, a population of dispersed single cells, or a population of cell clumps of 2 to 5 cells, or any combination thereof.
[0048] As used herein, a cell mass being highly pure means that the cell mass contains a high content of target cells. The specific content will vary depending on the type of cell, but for example, a cell mass can be said to be highly pure when the content of target cells is 70% or more, preferably 80% or more, or 90% or more of the total number of cells in the cell mass.
[0049] Furthermore, in this specification, a cell mass having high purity means that the content of non-target cells relative to the total number of cells in the cell mass is 30% or less, preferably 20% or less, or 10% or less. More preferably, the content of proliferative cells in the cell mass is 10% or less, 5% or less, preferably 3% or less, or more preferably 2% or less relative to the total number of cells in the cell mass.
[0050] As used herein, the term "reaggregated cell cluster" refers to a cell cluster (e.g., a reaggregated cerebral cortical cell cluster) formed by dispersing a cell cluster into single cells or clusters of 2 to 5 cells, and then reassembling the dispersed single cells and cell clusters. The reaggregated cerebral cortical cell cluster contains at least a high-purity cerebral cortical cell cluster.
[0051] [Culture Solution] In this specification, the "culture solution (also referred to as medium)" may be any culture solution (medium) commonly used for culturing animal cells, and is not particularly limited as long as it can maintain the life of the animal cells, but preferably provides an environment in which the target cells can grow. The culture solution (medium) may be prepared by the user or a commercially available medium may be purchased and used.
[0052] Examples of basal media include media that can be used for culturing animal cells, such as BME medium, BGJb medium, CMRL 1066 medium, Glasgow MEM (GMEM) medium, Improved MEM Zinc Option medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, F-12 medium, DMEM / F-12 medium, IMDM / F12 medium, Ham's medium, RPMI 1640 medium, Fischer's medium, and mixtures thereof. These basal media contain carbohydrates such as glucose, carbon sources such as amino acids, vitamins, inorganic salts, etc.
[0053] Any component normally used in the culture of animal cells may be added to the basal medium as appropriate, as long as it does not adversely affect the desired differentiation induction.
[0054] The medium used in the present invention is preferably a serum-free culture medium, from the viewpoint of using it to produce a cell mass suitable for transplantation.
[0055] In the present invention, the term "serum-free culture medium" refers to a medium that is substantially free of unconditioned or unpurified serum. As used herein, even a medium containing purified blood-derived components or animal tissue-derived components (e.g., growth factors) is considered to be a serum-free culture medium as long as it does not contain unconditioned or unpurified serum. The serum-free culture medium may contain fatty acids or lipids, amino acids (e.g., non-essential amino acids), vitamins, growth factors, cytokines, antioxidants, 2-mercaptoethanol, pyruvic acid, buffers, inorganic salts, and the like, as appropriate.
[0056] The medium used in the present invention is preferably a xeno-free medium. Here, "xeno-free" refers to conditions in which components derived from organisms different from the organism of the cells to be cultured (heterogeneous components, also known as xenogenic factors) are excluded. A portion of the serum-free culture medium may be a xeno-free medium.
[0057] [Serum substitute] The medium used in the present invention may contain a serum substitute. Examples of serum substitutes include those that appropriately contain albumin, transferrin, fatty acids, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, or equivalents thereof. Such serum substitutes can be prepared, for example, by the method described in WO98 / 30679. Commercially available serum substitutes may also be used. Examples of such commercially available serum substitutes include Knockout Serum Replacement (manufactured by Thermo Fisher Scientific; hereinafter, sometimes referred to as KSR), StemSure (registered trademark) Serum Replacement (SSR) Chemically-defined Lipid Concentrated (manufactured by Thermo Fisher Scientific), B27 Supplement (manufactured by Thermo Fisher Scientific), N2 Supplement (manufactured by Thermo Fisher Scientific), and ITS Supplement (manufactured by Thermo Fisher Scientific), and preferably N2 Supplement or B27 Supplement.
[0058] [Supporting Cells] As used herein, supporting cells, also referred to as feeder cells, refer to cells other than stem cells that are allowed to coexist with stem cells such as pluripotent stem cells when the stem cells are cultured. Examples of supporting cells include mouse fibroblasts (MEFs, etc.), human fibroblasts, SNL cells, and STO cells. Supporting cells may be growth-inhibited supporting cells. Examples of growth-inhibiting treatment include treatment with a growth inhibitor (e.g., mitomycin C), gamma ray irradiation, UV irradiation, etc.
[0059] As used herein, "in the absence of feeder cells (also referred to as feeder-free)" refers to culturing in the absence of feeder cells. Examples of the absence of feeder cells include conditions in which no feeder cells are added, or conditions in which feeder cells are substantially absent (for example, the ratio of the number of feeder cells to the total number of cells is 3% or less, preferably 1% or less).
[0060] [Suspension culture] In the present invention, "suspension culture" means allowing cells to survive in a suspended state in a medium, or culturing cells by forming aggregates (also called spheres) in a non-adherent state to a culture vessel. In this specification, cells are cultured in suspension in the form of single cells or clumps of multiple cells (cell clumps or cell populations).
[0061] Culture vessels used for suspension culture are not particularly limited, but examples include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, Petri dishes, tubes, trays, culture bags, bioreactors, and roller bottles.
[0062] To enable culture under non-adhesive conditions, the culture vessel is preferably non-cell-adhesive. Non-cell-adhesive culture vessels can be used where the surface of the culture vessel has not been artificially treated (e.g., coated with an extracellular matrix or the like) for the purpose of improving cell adhesion, or where the surface has been artificially treated to suppress adhesion (e.g., coated with polyhydroxyethyl methacrylate (poly-HEMA), a nonionic surface-active polyol (Pluronic F-127, etc.), or a phospholipid-like structure (e.g., a water-soluble polymer (Lipidure (registered trademark)) having 2-methacryloyloxyethyl phosphorylcholine as a constituent unit). Examples of culture vessels used in suspension culture, particularly the SFEBq method, include PrimeSurface (registered trademark) (a 96-well plate with low protein adsorption treatment, manufactured by Sumitomo Bakelite).
[0063] In this specification, the suspension culture may be a static culture, a shaking culture, a rotation culture, or an agitation culture.
[0064] As used herein, static culture refers to a culture method in which cell clusters are cultured without intentional movement. That is, for example, local changes in medium temperature can cause convection in the medium, which can cause the cell clusters to move, but since the cell clusters are not intentionally moved, the term static culture is used in the present invention to include such cases.
[0065] For shaking culture, rotation culture, or stirring culture, any equipment known to those skilled in the art can be used as appropriate.
[0066] <bFGF> In this specification, bFGF means basic fibroblast growth factor, a protein also known as FGF2.
[0067] <TGFβ signal inhibitor> In this specification, a TGFβ signal inhibitor refers to a substance that inhibits signal transmission that continues from the binding of TGFβ to its receptor to SMAD, and examples thereof include substances that inhibit binding to the ALK family receptor, or substances that inhibit the phosphorylation of SMAD by the ALK family.
[0068] In this specification, the TGFβ signal inhibitor is not particularly limited as long as it is capable of suppressing signal transduction mediated by TGFβ, and may be any of a nucleic acid, a protein, or a low molecular weight organic compound.
[0069] Examples of TGFβ signal inhibitors include substances that act directly on TGFβ (e.g., proteins, antibodies, aptamers, etc.), substances that suppress the expression of genes encoding TGFβ (e.g., antisense oligonucleotides, siRNA, etc.), substances that inhibit the binding of TGFβ receptors to TGFβ, and substances that inhibit physiological activity resulting from signal transduction by TGFβ receptors (e.g., TGFβ receptor inhibitors, etc.). Further examples of TGFβ signal inhibitors include substances that inhibit binding to the ALK family receptors, or substances that inhibit the phosphorylation of SMADs by the ALK family. Specific examples of the ALK family include ALK4, ALK5, and ALK7.
[0070] Examples of TGFβ signal inhibitors include Lefty-1 (NCBI Accession No. mouse: NM_010094, human: NM_020997), Lefty-2 (NCBI Accession No. mouse: NM_177099, human: NM_003240 and NM_001172425), SB431542 (4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]-benzamide), and SB202190 (all of which are described by RK Lindemann et al.). al., Mol. Cancer, 2003, 2:20), SB505124 (GlaxoSmithKline), NPC30345, SD093, SD908, SD208 (Scios), LY2109761, LY364947, LY580276 (Lilly Research Laboratories), A-83-01 (WO 2009146408), Galunisertib (LY2157299), LY3200882, SB525334, GW788388, RepSox, and derivatives thereof. The TGFβ signal inhibitor used in the present invention is preferably SB431542 or A-83-01.
[0071] <Wnt signaling inhibitor> As used herein, a Wnt signaling inhibitor refers to a substance that suppresses the production of Wnt (e.g., Wnt3), or a substance that inhibits signal transduction that continues from the binding of Wnt to a receptor to the accumulation of β-catenin, and examples thereof include a substance that inhibits binding to the Frizzled family of receptors, or a substance that promotes the degradation of β-catenin.
[0072] Examples of such Wnt signaling inhibitors include substances that inhibit PORCN, which is involved in Wnt protein processing (examples include proteins represented by NCBI accession numbers NP_001269096, NP_073736, NP_982299, NP_982300, and NP_982301 in humans), DKK1 protein (e.g., NCBI accession number NM_012242 in humans), sclerostin (e.g., NCBI accession number NM_025237 in humans), Cerberus protein, Wnt receptor inhibitors, soluble Wnt receptors, anti-Wnt antibodies, casein kinase inhibitors, and dominant-negative Wnt proteins, but are not limited to these, and one or more substances may be used in combination.
[0073] Specific Wnt signaling inhibitors include IWR-1-endo ((4-[(3aR,4S,7R,7aS)-1,3,3a,4,7,7a-hexahydro-1,3-dioxo-4,7-methano-2H-isoindol-2-yl]-N-8-quinolinyl-benzamide), Merck Millipore), IWP-2 (Sigma-Aldrich), IWP-3 (Sigma-Aldrich), IWP-4 (Sigma-Aldrich), IWP-L6 (EMD Millipore), C59 (or Wnt-C59) (Cellagen technology), ICG-001 (Cellagen Examples of such a soluble endothelial cell line include Sigma-Aldrich (Sigma-Aldrich), LGK-974 (or NVP-LGK-974) (Cellagen Technology), FH535 (Sigma-Aldrich), WIKI4 (Sigma-Aldrich), KYO2111 (Minami I, et al., Cell Rep. 2:1448-1460, 2012), PNU-74654 (Sigma-Aldrich), XAV939 (Stemgent), and derivatives thereof. Of these, IWR-1-endo, C59, LGK-974, and the like are preferred.
[0074] Notch signal inhibitors are not limited as long as they are substances capable of suppressing signal transduction by Notch. Examples of Notch signal inhibitors include γ-secretase inhibitors and Notch transcription complex inhibitors, such as MAML-1 inhibitors.
[0075] The gamma-secretase inhibitor is not limited as long as it is a substance that can inhibit the enzymatic activity of gamma-secretase. Specific examples include DAPT (N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester), DBZ (dibenzazepine), MDL28170 (Calpain Inhibitor III), Compound E (N-[(1S)-2-[[(3S)-2,3-Dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), Compound B (N-[(1S)-2-[[(3S)-2,3-Dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), Compound C (N-[(1S)-2-[[(3S)-2,3-Dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), Compound D (N-[(1S)-2-[[(3S)-2,3-Dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl]amino]-1-methyl-2-oxoethyl]-3,5-difluorobenzeneacetamide), Compound E ... Examples of inhibitors include 34 ((2S,3R)-3-(3,4-Difluorophenyl)-2-(4-fluorophenyl)-4-hydroxy-N-((3S)-2-oxo-5-phenyl-2,3-1H-benzo[e][1,4]diazepin-3-yl)butyramide), γ-secretase inhibitor XI, and γ-secretase inhibitor III. Examples of inhibitors of the Notch transcription complex include CB-103 (6-[4-(1,1-dimethylethyl)phenoxy]-3-pyridinamine) and IMR-1 (2-Methoxy-4-(4-oxo-2-thioxo-thiazolidin-5-ylidenemethyl)-phenoxy]-acetic acid ethyl ester).
[0076] <ROCK Inhibitor> The ROCK inhibitor is an inhibitor of Rho-associated coiled-coil kinase (ROCK), and is not particularly limited as long as it is a substance that suppresses the function of ROCK.Examples of ROCK inhibitors include Y-27632 ((+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl)cyclohexanecarboxamide dihydrochloride), H-1152 ((S)-4-Methyl-5-((2-methyl-1,4-diazepan-1-yl)sulfonyl)isoquinoline dihydrochloride), Fasudil (HA-1077; 1-(5-Isoquinolinesulfonyl)homopiperazine Hydrochloride), Wf-536 (4-[(1R)-1-aminoethyl]-N-(pyridin-4-yl)benzamide), Thiazovivin (N-Benzyl-2-(pyrimidin-4-ylamino)thiazole-4-carboxamide), Ripasudil (4-Fluoro-5-[[(2S)-hexahydro-2-methyl-1H-1,4-diazepin-1-yl]sulfonyl]isoquinoline), GSK42928 (4-[4-(Trifluoromethyl)phenyl]-N-(6-Fluoro-1H-indazol-5-yl)-2-methyl-6-oxo-1,4,5,6-tetrahydro-3-pyridinecarboxamide) 6, RKI-1447 (N-[(3-Hydroxyphenyl)methyl]-N'-[4-(4-pyridinyl)-2-thiazolyl]urea), Azaindole1 (6-chloro-N4-[3,5-difluoro-4-[(3-methyl-1H-pyrrolo[2,3-b]pyridin-4-yl)oxy]phenyl]pyrimidine-2,4-diamine), HA-1100 (1-[(1,2-Dihydro-1-oxo-5-isoquinolinyl)sulfonyl]hexahydro-1H-1,4-diazepine), Y-39983 (4-[(1R)-1-Aminoethyl]-N-1H-pyrrolo[2,3-b]pyridin-4-ylbenzamide), etc. Preferred as the ROCK inhibitor is Y-27632.
[0077] <Neurotrophic Factors> As used herein, neurotrophic factor is a general term for secreted proteins that have the activity of promoting nerve cell survival, neurite and axon extension, synapse formation, etc. Examples of neurotrophic factors include nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3), neurotrophin 4 / 5 (NT-4 / 5), neurotrophin 6 (NT-6), glia cell line-derived neurotrophic factor (GDNF), and ciliary neurotrophic factor (CNTF). In the present invention, preferred neurotrophic factors are factors selected from the group consisting of GDNF and BDNF. Neurotrophic factors are commercially available from, for example, Wako and R&D Systems and can be easily used, but they may also be obtained by forced expression in cells using methods known to those skilled in the art.
[0078] <cAMP activator> In the present specification, examples of the cAMP activator include cAMP, dibutylyl-cAMP, and forskolin.
[0079] 2. Method for Producing Cerebral Organoids One embodiment of the method for producing cerebral organoids of the present invention is a method for producing cerebral organoids from pluripotent stem cells in the absence of supporting cells, comprising the following steps (1) and (2). "In the absence of supporting cells" is as described above, and both steps (1) and (2) are carried out "in the absence of supporting cells." (1) A step of culturing pluripotent stem cells in a culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling. (2) A step of inducing differentiation of the cells obtained in step (1) into neurons. <Step (1)> In this specification, culturing "in the presence of substance X" means culturing in a "medium containing substance X," and the substance X may be an inherent component of the medium or may be added exogenously. In other words, endogenous substance X, which can be expressed, secreted, or produced by cells or tissues during the culture, is distinguished from exogenous substance X, and a medium that does not contain exogenous substance X does not fall within the category of "medium containing substance X," even if it contains endogenous substance X.
[0080] For example, a "medium containing a TGFβ signaling inhibitor" is a medium to which a TGFβ signaling inhibitor has been added or a medium that contains a TGFβ signaling inhibitor as an inherent component.
[0081] Furthermore, a culture medium that is "substantially free of bFGF" does not deny the presence of bFGF expressed by the cells themselves, but means a culture medium that does not inherently contain bFGF or to which exogenous bFGF has not been added.
[0082] Alternatively, depending on the cells used and the medium exchange procedure, the presence of residual bFGF below the detection limit may be excluded, and such cases are also included in the scope of the present application. In addition, the present application also includes culturing using a medium containing a low amount of bFGF to the extent that it does not affect the efficiency of neural differentiation in the present invention.
[0083] Furthermore, a culture medium that "does not substantially induce TGFβ signaling" does not deny the presence of TGFβ expressed by the cells themselves, but means that the culture medium does not inherently contain TGFβ or that TGFβ has not been exogenously added. Alternatively, a culture medium containing exogenously added TGFβ or a culture medium not containing exogenously added TGFβ to which an effective amount of a TGFβ signaling inhibitor has been added also falls within the category of a "culture medium that does not substantially induce TGFβ signaling."
[0084] When a TGFβ signaling inhibitor is used to substantially not induce TGFβ signaling, the above-mentioned TGFβ signaling inhibitor can be appropriately selected. The concentration of the TGFβ signaling inhibitor can be appropriately adjusted depending on the intensity of TGFβ signaling activity in the culture medium. That is, the concentration of the TGFβ signaling inhibitor in the culture medium is not particularly limited as long as it is a concentration that inhibits the activity of ALK4, ALK5, or ALK7 signaling.
[0085] The TGFβ signal inhibitor added to the culture medium in step (1) may be any of the above-mentioned TGFβ signal inhibitors, and is preferably selected from the group consisting of SB431542 and A-83-01. When a commercially available medium for culturing pluripotent stem cells such as ES cells or iPS cells while maintaining their pluripotency and not containing bFGF is used as the culture medium in step (1), the concentration of the TGFβ signal inhibitor may be, for example, 100 nM to 1 mM, 100 nM to 500 μM, 100 nM to 100 μM, 100 nM to 50 μM, or 100 nM to 4 μM when SB431542 is used as the TGFβ signal inhibitor. The concentrations include, but are not limited to, concentrations equivalent to 0 μM, 100 nM to 30 μM, 100 nM to 25 μM, 100 nM to 20 μM, 100 nM to 15 μM, 100 nM to 10 μM, 500 nM to 30 μM, 500 nM to 10 μM, 100 nM to 7 μM, 1 μM to 20 μM, 1 μM to 10 μM, 500 nM to 7 μM, 1 μM to 7 μM, 100 nM to 3 μM, 100 nM to 2 μM, 100 nM to 1 μM, and 100 nM to 750 nM. Preferably, the concentrations include concentrations equivalent to 1 μM to 10 μM. In the case of other TGFβ signaling inhibitors, the concentrations exhibiting ALK inhibitory activity or TGFβ inhibitory activity equivalent to the aforementioned concentrations of SB431542 can be appropriately set. Here, the concentration equivalent to the concentration when SB431542 is used means a concentration that has the same inhibitory effect on the TGFβ signaling pathway (e.g., the effect of inhibiting the activity of ALK4, ALK5, or ALK7 signaling) as the concentration of SB431542. Those skilled in the art can easily determine such a concentration.
[0086] The culture medium used in step (1) can be, for example, a commercially available medium for culturing pluripotent stem cells that does not contain bFGF, to which a TGFβ signal inhibitor has been added.
[0087] Furthermore, as a culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling, for example, a commercially available culture medium (e.g., Essential 6) obtained by removing bFGF and TGFβ from a medium capable of maintaining and growing pluripotent stem cells (e.g., Essential 8) can also be used.
[0088] The culture medium used in step (1) may contain other substances to the extent that they do not affect the culture, i.e., to the extent that they do not substantially affect the formation of cerebral organoids obtained by steps (1) and (2), but preferably does not contain any externally added substances that enhance or inhibit signal transduction that affects the differentiation induction of pluripotent stem cells, such as BMP signals or sonic hedgehog signals. Furthermore, the culture medium used in step (1) may contain a Wnt signaling inhibitor, but preferably does not contain any externally added substances that enhance Wnt signaling.
[0089] The pluripotent stem cells subjected to step (1) are preferably human induced pluripotent stem cells (iPS cells) or human embryonic stem cells (ES cells), and more preferably human induced pluripotent stem cells.
[0090] In step (1), pluripotent stem cells are cultured in the absence of feeder cells. The absence of feeder cells is also called feeder-free and refers to a state in which no feeder cells are present in the medium. Specific examples of culture conditions in the absence of feeder cells include culture conditions in which no feeder cells such as fibroblasts, SNL cells, or STO cells are added.
[0091] The culture medium used in step (1) is preferably a serum-free culture medium that is substantially free of serum, and may be a serum-free culture medium supplemented with a serum substitute as needed. Examples of serum substitutes include those mentioned above, but preferably KSR, preferably 1 to 30% KSR, etc., can be used.
[0092] The culture medium used in step (1) is not particularly limited as long as it is a culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling, preferably a serum-free culture medium, but it is desirable that the medium contains components necessary for culturing pluripotent stem cells while maintaining their pluripotency, other than bFGF and substances that induce TGFβ signaling.
[0093] Many media for culturing pluripotent stem cells while maintaining their pluripotency, i.e., media for pluripotent stem cells, are commercially available, including Essential 8 (manufactured by Thermo Fisher Scientific), S-medium (manufactured by DS Pharma Biomedical), StemPro (manufactured by Thermo Fisher Scientific), hESF9 (Proc Natl Acad Sci U S A. 2008 Sep 9; 105(36): 13409-14), mTeSR1 (manufactured by STEMCELL Technologies), mTeSR2 (manufactured by STEMCELL Technologies), TeSR-E8 (manufactured by STEMCELL Technologies), Cellartis DEF-CS 500 Xeno-Free Examples include Culture Medium (manufactured by Takara Bio Inc.) and StemFit (manufactured by Ajinomoto Healthy Supply Co., Ltd.).
[0094] The pluripotent stem cells subjected to step (1) may be cryopreserved pluripotent stem cells immediately after thawing, but preferably, they can be pre-cultured and passaged in a medium suitable for expansion while maintaining the pluripotency of the pluripotent stem cells. There is no particular limitation on the number of passages the pluripotent stem cells subjected to step (1) have undergone, but 2 to 8 passages are desirable.
[0095] The culture period in step (1) is less than 5 days, less than 4 days, preferably less than 3 days, more preferably 12 to 48 hours, 18 to 48 hours, even more preferably 24 to 48 hours, 24 to 36 hours, or 18 to 36 hours, and most preferably about 1 day. Note that this culture period does not include the period of subculture of pluripotent stem cells as a preparatory step.
[0096] The culture in step (1) may be carried out under either suspension culture or adherent culture conditions, but is preferably carried out under adherent culture conditions.
[0097] The culture vessel used for adhesion culture is not particularly limited as long as it is capable of "adhesion culture," but a cell-adhesive culture vessel is preferred. Examples of cell-adhesive culture vessels include culture vessels whose surfaces have been artificially treated to improve adhesion to cells, and specific examples include culture vessels whose interiors are coated with the aforementioned coating agent. Examples of coating agents include laminin [including laminin α5β1γ1 (hereinafter referred to as laminin 511), laminin α1β1γ1 (hereinafter referred to as laminin 111), laminin α1β1γ2 (laminin 112), laminin α2β1γ1 (laminin 211), laminin α2β1γ2 (laminin 212), laminin α2β2γ1 (laminin 221), laminin α2β2γ2 (laminin 222), laminin α5β1γ2 (laminin 512), and laminin fragments (laminin 511E8, etc.)], entactin, collagen, gelatin, extracellular matrices such as Vitronectin, Synthemax (Corning), and Matrigel, as well as polymers such as polylysine and polyornithine. Surface-treated culture vessels, for example, with a positive charge treatment, can also be used. Preferably, laminin is used, more preferably laminin 511E8. Laminin 511E8 can be purchased commercially (e.g., iMatrix-511, Nippi).
[0098] Culture temperature and CO in step (1) 2 Culture conditions such as concentration can be appropriately set. The culture temperature is, for example, about 30°C to about 40°C, preferably about 37°C. 2 The concentration is, for example, about 1% to about 10%, preferably about 5%.
[0099] Step (1) is a maintenance culture step in which pluripotent stem cells are cultured in the absence of supporting cells while maintaining their pluripotency, and is a neural differentiation preparation step that is performed before step (2) (differentiation induction step). This neural differentiation preparation step is a preparation step performed before the induction of neural differentiation or before the introduction of neural differentiation, and the pluripotent stem cells cultured in step (1) have suppressed expression of TGFβ-related genes, thereby induced differentiation of the pluripotent stem cells into neurons, resulting in high efficiency of cerebral organoid formation.
[0100] <Step (2)> The cells obtained in step (1) can be induced to differentiate into neurons by methods well known to those skilled in the art, thereby obtaining cerebral organoids.
[0101] The differentiation induction method can be appropriately selected from differentiation induction methods that can differentiate pluripotent stem cells into cell populations that constitute cerebral organoids. Such methods are well known, and can be used, for example, methods described in WO2015 / 076388, WO2016 / 167372, Sakaguchi et al., Stem Cell Reports 2019 Vol. 13 458-473, Kitahara, et al., Stem Cell Reports 2020 Vol. 15, 467-481 (Non-Patent Document 1) and Kadoshima et al., 2013, PNAS, Vol. 110, No. 50, 20284-20289, etc.
[0102] That is, the differentiation induction method performed in step (2) includes the following steps (2a) and (2b): (2a) A step of subjecting the cells obtained in step (1) to suspension culture, preferably static culture, in a culture medium containing a TGFβ signal inhibitor and a Wnt signaling inhibitor to obtain cell clusters. (2b) A step of subjecting the cell clusters obtained in step (2a) to suspension culture in a culture medium substantially free of a TGFβ signal inhibitor or a Wnt signaling inhibitor, preferably a culture medium free of both a TGFβ signal inhibitor and a Wnt signaling inhibitor, to obtain cerebral organoids.
[0103] <Step (2a)> The cells obtained in step (1) are dispersed in a culture medium, preferably a serum-free culture medium substantially free of serum (unconditioned or unpurified serum), and cultured under non-adhesive conditions (i.e., suspension culture) to aggregate a plurality of cells and form cell clusters. The culture medium used for aggregation may be a serum-free culture medium containing a serum substitute.
[0104] The culture vessel used for this cell mass formation is not particularly limited, but examples include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, Petri dishes, tubes, trays, culture bags, bioreactors, and roller bottles. Another example is a method of forming cell masses by embedding cells in gels such as alginate hydrogel. To enable culture under non-adhesive conditions, the culture vessel is preferably non-adhesive to cells. Examples of non-adhesive culture vessels include those whose surfaces have been artificially treated to make them non-adhesive to cells, and those that have not been artificially treated (e.g., coated with an extracellular matrix) to improve cell adhesion.
[0105] To form cell aggregates, first, the cells obtained in step (1) are recovered from the subculture and dispersed into single cells or a state close to single cells. This dispersion is carried out using an appropriate cell dissociation solution. Examples of cell dissociation solutions include chelating agents such as EDTA; proteolytic enzymes such as trypsin, collagenase IV, and metalloproteases, which can be used alone or in appropriate combinations. Among these, those with minimal cytotoxicity are preferred, and commercially available cell dissociation solutions include, for example, Dispase (Eidia), TrypLE (Gibco), and Accutase (MILLIPORE). The dispersed cells are suspended in the above-mentioned medium (serum-free culture medium, i.e., the basal medium used in step (2a) described below) supplemented with Y-27632.
[0106] Here, in order to suppress cell death of pluripotent stem cells (particularly human pluripotent stem cells) induced by dispersion, it is preferable to add an inhibitor of Rho-associated coiled-coil kinase (ROCK inhibitor) from the start of culture (WO2008 / 035110, Watanabe, K. et al., Nature Biotechnology, 2007, Vol. 25, No. 6, pp. 681-686).
[0107] Examples of ROCK inhibitors include those mentioned above, and preferred examples include Y-27632 and the like.
[0108] The ROCK inhibitor is added, for example, within 20 days, within 15 days, preferably within 10 days, and more preferably within 6 days from the start of culture. The concentration of the ROCK inhibitor may be constant or gradually decreased. In one embodiment, culture is performed in the presence of the ROCK inhibitor for 10 to 20 days, preferably 15 to 20 days, and even more preferably about 17 to 19 days, and the concentration of the ROCK inhibitor may be gradually decreased during this period. In one embodiment, culture is performed in the presence of the ROCK inhibitor for 10 to 25 days, preferably 12 to 25 days, 10 to 20 days, and even more preferably about 15 to 20 days, or about 17 to 19 days, and the concentration of the ROCK inhibitor may be gradually decreased during this period.
[0109] The concentration of the ROCK inhibitor used in suspension culture is a concentration that can suppress cell death of pluripotent stem cells induced by dispersion, for example, a concentration equivalent to about 0.1 to 200 μM, preferably about 2 to 100 μM, and more preferably about 30 to 100 μM when Y-27632 is used as the ROCK inhibitor.
[0110] As described above, the concentration of the ROCK inhibitor may be varied during the period of addition; for example, the concentration may be reduced by half in the latter half of the period, or the concentration may be gradually reduced from the start of step (2a).
[0111] The suspension of dispersed cells obtained in step (1) is seeded in the above-mentioned culture vessel and cultured under non-adhesive conditions, whereby a plurality of cells are aggregated to form cell masses.
[0112] In one embodiment, it is preferable to rapidly aggregate the dispersed cells to form a single cell cluster in a single culture compartment (SFEBq method). Examples of methods for rapidly aggregating dispersed cells include the following: 1) a method in which dispersed cells are confined in a culture compartment with a relatively small volume (e.g., 1 ml or less, 500 μl or less, 200 μl or less, 100 μl or less) to form a single cell cluster in the compartment, or 2) a method in which dispersed cells are placed in a centrifuge tube, centrifuged, and the cells are precipitated in one location to form a single cell cluster in the tube.
[0113] In the above step 1), preferably, the culture compartment is left to stand after confining the dispersed cells. Examples of the culture compartment include, but are not limited to, wells in a multi-well plate (384 wells, 192 wells, 96 wells, 48 wells, 24 wells, etc.), a micropore, a chamber slide, etc., a tube, and a droplet of medium in the hanging drop method. The dispersed cells confined in the compartment settle in one place due to gravity, or the cells adhere to each other, forming one cell mass per culture compartment. The bottom shape of the multi-well plate, micropore, chamber slide, tube, etc. is preferably U-bottom or V-bottom, so that the dispersed cells can easily settle in one place.
[0114] The number of cells to be seeded in one culture compartment is not particularly limited, as long as one cell cluster is formed per culture compartment and the cell cluster can be induced to differentiate into forebrain cells by the method of the present invention. However, the number of cells obtained in step (1) per culture compartment is usually about 1 × 10 3 ~Approx. 5×10 4 pieces, preferably about 1×10 3 ~Approx. 2×10 4 , more preferably about 2×10 3 ~Approx. 1.2×10 4 The cells are then rapidly aggregated to a density of typically about 1 × 10 per culture compartment.3 ~Approx. 5×10 4 pieces, preferably about 1×10 3 ~Approx. 2×10 4 , more preferably about 2×10 3 ~Approx. 1.2×10 4 One cell mass is formed.
[0115] Alternatively, the cells obtained in step (1) are typically cultured at about 1 x 10 3 ~Approx. 5×10 5 pieces, preferably about 1×10 3 ~Approx. 2×10 5 , more preferably about 2×10 3 ~Approx. 1×10 5 The cells are then rapidly aggregated to a density of typically 5 × 10 cells per culture compartment. 2 ~Approx. 5×10 5 pieces, preferably about 5×10 2 ~Approx. 2×10 5 , more preferably about 1×10 3 ~Approx. 1×10 5 One cell mass is formed.
[0116] The time until cell mass formation can be appropriately determined within a range in which one cell mass is formed per compartment and the cell mass can be induced to differentiate into cerebral organoids, but preferably, cell masses are formed within 24 hours, more preferably within 12 hours. Alternatively, the time until cell mass formation is preferably, cell masses are formed within 48 hours, more preferably within 24 hours.
[0117] The culture temperature during the formation of aggregates and CO 2 Other culture conditions such as the concentration can be appropriately set. The culture temperature is not particularly limited, but is, for example, about 30 to 40°C, preferably about 37°C. 2 The concentration is, for example, about 1 to 10%, preferably about 5%.
[0118] Furthermore, by preparing multiple culture compartments under the same culture conditions and allowing one cell cluster to form in each culture compartment, a qualitatively uniform population of cell clusters can be obtained. The qualitative uniformity of cell clusters can be evaluated based on the size and cell number of the cell clusters, macroscopic morphology, microscopic morphology and its uniformity determined by tissue staining analysis, expression and uniformity of differentiated and undifferentiated markers, control of differentiation marker expression and its synchrony, and reproducibility of differentiation efficiency between cell clusters. Here, a "uniform" population of cell clusters means that 80% or more of the cell clusters in the entire population of cell clusters have a value within a range of the mean value of the parameter in the population of cell clusters ±20%, preferably within a range of the mean value ±10%, and more preferably within a range of the mean value ±5%.
[0119] The culture medium used in step (2a) contains a TGFβ signaling inhibitor and a Wnt signaling inhibitor. The TGFβ signaling inhibitors mentioned above can be used, and preferred examples include SB431542, A-83-01, and XAV-939. The Wnt signaling inhibitors mentioned above can be used, and preferred examples include IWR-1-end, C59, LGK-974, and DKK-1 (protein).
[0120] A preferred combination of a Wnt signaling inhibitor and a TGFβ signaling inhibitor is IWR-1-endo and SB431542.
[0121] The concentration of the Wnt signaling inhibitor in the medium can be appropriately set within a range in which the cell clusters can be induced to differentiate into forebrain cells. When IWR-1-endo is used as the Wnt signaling inhibitor, the concentration may be such that it exhibits Wnt signaling inhibitory activity equivalent to 0.1 to 50 μM, preferably 0.3 to 10 μM, and more preferably 0.3 to 5 μM.
[0122] The concentration of the TGFβ signal inhibitor in the culture medium can be appropriately set within a range in which the cell clusters can be induced to differentiate into forebrain cells. When SB431542 is used as the TGFβ signal inhibitor, an example of the concentration is one that exhibits TGFβ signal inhibitory activity equivalent to 0.1 to 100 μM, preferably 1 to 50 μM, and more preferably 1 to 10 μM.
[0123] The culture medium used in step (2a), i.e., the medium used during the formation of cell clusters and for the suspension culture of the cell clusters, is not particularly limited as long as it is a medium that can be used for culturing animal cells, and can be prepared from a basal medium as defined above as a medium used for culturing animal cells.
[0124] Examples of the basal medium used in step (2a) include Glasgow MEM medium, DMEM medium, F-12 medium (also called F12 medium), DMEM / F12 medium, etc. Preferably, Glasgow MEM medium is used.
[0125] The medium used for forming cell aggregates may contain a serum substitute. The serum substitute may be any of those mentioned above, including, for example, KSR (knockout serum replacement) (manufactured by Invitrogen), Chemically-defined Lipid Concentrated (manufactured by Gibco), and Glutamax (manufactured by Gibco).
[0126] Specifically, a medium containing about 10 to 30% serum replacement (for example, KSR) can be used.
[0127] Alternatively, the medium used for forming cell aggregates may contain a serum substitute. The serum substitutes that can be used include those listed above, such as KSR (Gibco), Chemically-defined Lipid Concentrated (Gibco), and Glutamax (Gibco). Specifically, a medium containing an appropriate amount of serum substitute (e.g., 1 to 30% KSR) according to the instructions for use of each product can be used.
[0128] The medium used for suspension culture of cell clusters may contain other additives to the extent that they do not adversely affect the induction of differentiation into forebrain cells. Examples of additives include, but are not limited to, insulin, iron sources (e.g., transferrin, etc.), minerals (e.g., sodium selenate, etc.), sugars (e.g., glucose, etc.), organic acids (e.g., pyruvic acid, lactic acid, etc.), serum proteins (e.g., albumin, etc.), amino acids (e.g., L-glutamine, etc.), reducing agents (e.g., 2-mercaptoethanol, etc.), vitamins (e.g., ascorbic acid, d-biotin, etc.), antibiotics (e.g., streptomycin, penicillin, gentamicin, etc.), buffers (e.g., HEPES, etc.), etc.
[0129] In one aspect, the medium used for suspension culture of cell aggregates preferably does not contain pattern formation factors such as Fgf, Wnt, Nodal, Notch, and Shh; or growth factors such as insulin and lipid-rich albumin, from the viewpoint of not adversely affecting the induction of differentiation into forebrain cells.
[0130] Culture temperature and CO in suspension culture of aggregates 2 Concentration, O 2 Other culture conditions such as concentration can be set appropriately. The culture temperature is, for example, about 30 to 40°C, preferably about 37°C. 2 The concentration is, for example, about 1 to 10%, preferably about 5%. 2 The concentration is, for example, about 20%.
[0131] The suspension culture in step (2a) may be static culture, shaking culture, rotation culture, or stirring culture, but static culture is preferred. Alternatively, static culture may be performed only for a part of the period of step (2a).
[0132] Step (2a) is carried out for a period of time sufficient to determine the direction of differentiation into the forebrain region and induce a forebrain marker-positive cell cluster (e.g., a Foxg1-positive cell cluster). That is, step (2a) allows for the production of a cell cluster containing forebrain marker-positive cells.
[0133] In one embodiment, step (2a) is carried out until at least one forebrain marker-positive cell is generated. Preferably, step (2a) is carried out until, for example, 50% or more, preferably 70% or more of the cell clusters in the culture become forebrain marker-positive.
[0134] In one embodiment, step (2a) is carried out until a cell cluster is produced in which 30% or more, preferably 50% or more, and more preferably 70% or more of the cells contained in the cell cluster are forebrain marker positive.
[0135] The culture period in step (2a) cannot be generally specified because it may vary depending on the types of Wnt signaling inhibitor and TGFβ signaling inhibitor and the culture conditions; however, for example, when human pluripotent stem cells are used, the culture period is 7 to 30 days, preferably 15 to 20 days (e.g., 18 days).
[0136] <Step (2b)> In step (2b), the cell mass obtained in step (2a) is further subjected to suspension culture in a culture medium substantially free of a TGFβ signal inhibitor and a Wnt signaling inhibitor to obtain cerebral organoids.
[0137] In one embodiment, the suspension culture in step (2b) may be carried out under high oxygen partial pressure conditions. High oxygen partial pressure conditions refer to conditions where the oxygen partial pressure exceeds the oxygen partial pressure in air (20%). In one embodiment, the oxygen partial pressure in step (2b) is, for example, 30 to 60%, preferably 35 to 60%, and more preferably 38 to 60%.
[0138] The medium used in step (2b), like the medium used in step (2a), is not particularly limited as long as it is a medium used for culturing animal cells, and the medium defined above can be prepared as a basal medium.
[0139] Examples of the basal medium include Glasgow MEM medium, DMEM medium, F-12 medium, and DMEM / F12 medium, etc. Preferably, DMEM / F12 medium is used.
[0140] The medium used in step (2b) is preferably a serum-free medium, and may contain a serum substitute, if necessary. The serum substitute may be any of those described above, such as N2 supplement, B27 supplement, Neurocult SM1 Neuronal supplement, and KSR.
[0141] The concentration of the serum substitute may be adjusted as appropriate. Specifically, for example, a culture medium containing about 0.1 to 3%, preferably about 1%, of an N2 supplement, about 0.1 to 10%, preferably 2%, of a B27 supplement, or about 1 to 30% of a serum substitute may be used.
[0142] In step (2b), the Wnt signaling inhibitor and the TGFβ signaling inhibitor used in step (2a) are not required. In one embodiment, the medium used in step (2b) does not contain a Wnt signaling inhibitor or a TGFβ signaling inhibitor.
[0143] In one embodiment, the culture medium in step (2b) is preferably a serum-free culture medium that is substantially free of serum, and more preferably a serum-free culture medium that contains a serum substitute.
[0144] The medium used in step (2b) preferably contains an N2 supplement as a serum replacement to promote differentiation into cerebral cortical cells. N2 supplement is a known serum replacement composition containing insulin, transferrin, progesterone, putrescine, and sodium selenite, and is commercially available from Gibco / Thermo Fisher Scientific, Inc. The amount of N2 supplement added can be appropriately determined so as to promote differentiation into forebrain tissue or its precursor tissue, or into neurons, and / or into cells constituting the cerebral cortex or their precursor cells.
[0145] Furthermore, the medium used in step (2b) preferably contains a chemically defined lipid concentrate for long-term maintenance culture of ventricular zone cells. The chemically defined lipid concentrate is a lipid mixture containing purified cholesterol, DL-α-tocopherol, arachidonic acid, linolenic acid, linoleic acid, myristic acid, oleic acid, palmitic acid, palmitoleic acid, and stearic acid. Commercially available chemically defined lipid concentrates can be used, and are available from, for example, Gibco / Thermo Fisher Scientific.
[0146] The medium used for suspension culture of cell clusters may contain other additives to the extent that they do not adversely affect the induction of differentiation into cerebral cortical cells. Examples of additives include, but are not limited to, insulin, iron sources (e.g., transferrin, etc.), minerals (e.g., sodium selenate, etc.), sugars (e.g., glucose, etc.), organic acids (e.g., pyruvic acid, lactic acid, etc.), serum proteins (e.g., albumin, etc.), amino acids (e.g., L-glutamine, etc.), reducing agents (e.g., 2-mercaptoethanol, etc.), vitamins (e.g., ascorbic acid, d-biotin, etc.), antibiotics (e.g., streptomycin, penicillin, gentamicin, etc.), and buffers (e.g., HEPES, etc.).
[0147] In one embodiment, the medium in step (2b) may contain serum. Serum can contribute to long-term maintenance culture of the ventricular zone. Examples of serum include, but are not limited to, FBS. It is preferable that the serum is inactivated. The serum concentration in the medium can be appropriately adjusted within a range that contributes to long-term maintenance culture of the ventricular zone, but is usually 1 to 20% (v / v).
[0148] In one embodiment, the medium in step (2b) may contain heparin. Heparin can contribute to long-term maintenance culture of the ventricular zone. The heparin concentration in the medium can be appropriately adjusted within a range that contributes to long-term maintenance culture of the ventricular zone, but is usually 0.5 to 50 μg / ml, preferably 1 to 10 μg / ml (e.g., 5 μg / ml).
[0149] In one embodiment, the medium in step (2b) may contain extracellular matrix components. The extracellular matrix may contribute to long-term maintenance culture of the ventricular zone. "Extracellular matrix components" refer to various components typically found in the extracellular matrix. In the method of the present invention, it is preferable to use basement membrane components. Examples of major components of basement membrane include type IV collagen, laminin, heparan sulfate proteoglycan, and entactin. Commercially available extracellular matrix components can be used as the extracellular matrix components to be added to the medium, such as Matrigel (BD Bioscience) and human laminin (Sigma-Aldrich). Matrigel is a basement membrane preparation derived from Engelbreth-Holm-Swarn (EHS) mouse sarcoma. The main components of Matrigel are type IV collagen, laminin, heparan sulfate proteoglycan, and entactin, but it also contains TGF-β, fibroblast growth factor (FGF), tissue plasminogen activator, and growth factors naturally produced by EHS tumors. Matrigel growth factor reduced products contain lower concentrations of growth factors than regular Matrigel, with typical concentrations of EGF <0.5 ng / ml, NGF <0.2 ng / ml, PDGF <5 pg / ml, IGF-1 5 ng / ml, and TGF-β 1.7 ng / ml. The use of growth factor reduced products is preferred in the methods of the present invention.
[0150] The concentration of the extracellular matrix components in the medium can be adjusted as appropriate within a range that contributes to the long-term maintenance culture of the ventricular zone. When Martigel is used, it is preferable to add it at a volume of 1 / 500 to 1 / 20 of the volume of the culture medium, more preferably 1 / 100 of the volume.
[0151] In one embodiment, the medium used in step (2b) contains serum and heparin in addition to N2 supplement and chemically defined lipid concentrate. In this embodiment, the medium may further contain an extracellular matrix. The medium of this embodiment is suitable for observing the differentiation induction of the telencephalon or a partial tissue thereof, or a precursor tissue thereof over a long period of time.
[0152] In this case, a medium containing an N2 supplement, a chemically defined lipid concentrate, serum, and heparin (and optionally an extracellular matrix) may be used throughout the entire range of step (2b), but the medium of this embodiment may be used only for a part of the period. In one embodiment, in step (2b), a medium containing an N2 supplement and a chemically defined lipid concentrate and not containing serum, heparin, or extracellular matrix may be used initially, and then switched to a medium containing an N2 supplement, a chemically defined lipid concentrate, serum, and heparin (optionally, an extracellular matrix) midway through the culture (e.g., after the stage at which a neuroepithelial-like structure having ventricle-like cavities (pseudostratified columnar epithelium), for example, pseudostratified columnar epithelium having multiple hemispherical or spherical cavities, is formed in the Foxg1-positive aggregate).
[0153] Cultivation temperature and CO in step (2b) 2 Other culture conditions such as concentration can be set appropriately. The culture temperature is, for example, about 30 to 40°C, preferably about 37°C. 2 The concentration is, for example, about 1 to 10%, preferably about 5%.
[0154] Step (2b) is carried out for a period of time sufficient to generate cells positive for a forebrain marker (e.g., Foxg1) and form a cerebral cortex-like structure, which can be confirmed by microscopic observation.
[0155] The culture period in step (2b) cannot be generally specified because it may vary depending on the types of the Wnt signaling inhibitor and the TGFβ signaling inhibitor in step (2a). However, for example, when human pluripotent stem cells are used, the culture period is at least 10 days, or 10 to 40 days, preferably 10 to 31 days, and more preferably 15 to 24 days.
[0156] In this specification, by carrying out the step (2b) culture step for a long period of time (e.g., 20 days or more, preferably 50 days or more, more preferably 70 days or more), it is possible to induce the self-organization of stable cerebral cortex-like structures within the cell aggregates, and if step (2b) is continued, the differentiation stage of the cerebral tissue contained in the cell aggregates will progress over time. Therefore, it is preferable to continue carrying out step (2b) until the desired differentiation stage, i.e., the formation of cerebral organoids containing multiple cerebral cortex-like structures, is reached.
[0157] In step (2b), the culture vessel used for suspension culture of cell aggregates is not particularly limited, and examples thereof include flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, Petri dishes, tubes, trays, culture bags, bioreactors, and roller bottles. To enable culture under non-adhesive conditions, the culture vessel is preferably non-cell-adhesive. Examples of non-cell-adhesive culture vessels that can be used include those whose surfaces have been artificially treated to be non-cell-adhesive, and those that have not been artificially treated (e.g., coated with an extracellular matrix) to improve cell adhesion.
[0158] In one embodiment, an oxygen-permeable culture vessel may be used for the suspension culture of cell clusters in step (2b). By using an oxygen-permeable culture vessel, the supply of oxygen to the cell clusters is improved. In step (2b), an oxygen-permeable culture vessel may be used to avoid the risk that the cell aggregates will grow too large and sufficient oxygen will not be supplied to the cells in the cell clusters.
[0159] In the suspension culture of step (2b), the cell aggregates may be subjected to static culture, or the aggregates may be intentionally moved by rotational culture or shaking culture, as long as the cell aggregates can be maintained in a non-adherent state to the culture vessel. Static culture may be performed throughout the entire period of step (2b), or only for a part of the period.
[0160] In one embodiment, the suspension culture in step (2b) is a static culture, preferably under the above-mentioned high oxygen partial pressure conditions.
[0161] In one embodiment, the suspension culture in step (2b) is a shaking culture, which does not require culture under high oxygen partial pressure conditions.
[0162] Step (2b) results in the formation of a forebrain marker-positive cerebral cortex-like structure in the cell cluster. In one embodiment, 70% or more of the cells contained in the cell cluster containing the cerebral cortex-like structure are forebrain marker-positive (e.g., Foxg1-positive).
[0163] In one embodiment, the cerebral cortex-like structure formed in the cell aggregate by step (2b) is a rosette-like structure with a neuronal cell layer outside the neuroepithelium. In one embodiment, the cerebral cortex-like structure has a cell layer positive for neural stem cell markers, specifically PAX6 and / or SOX2, on the luminal side, and contains mitotic cells positive for phosphorylated histone H3 in the innermost lumen. In one embodiment, the outer side of the neuroepithelial-like cell layer contains cells that express βIII-Tubulin (βTubIII, TUBB3, or TUJ1), a marker for postmitotic neurons, and Ctip2 or Tbr1, an early cortical plate marker of the cerebral cortex. These cells contain Reelin-positive Cajal-Retzius cells, which are neurons in the first layer of the cerebral cortex, and may have a layer rich in laminin near the surface. That is, in a preferred embodiment, the aggregate obtained by the production method of the present invention contains cerebral cortical precursor tissue.
[0164] <Step (3)> The method for producing cerebral organoids of the present invention may further comprise step (3), which is a step of selecting cerebral organoids. Step (3) is a step of selecting desired cerebral organoids from the plurality of cell clusters obtained in step (2), using one or more indicators selected from the group consisting of cell cluster shape, internal structure, size, surface color or pattern, and gene expression. Of these indicators, it is preferable to adopt two or more, three or more, or four or more. In addition, as an indicator, it is preferable that the shape of the cell cluster, internal structure, surface color or pattern, and / or gene expression are the shape of the cell cluster, more preferably the shape of the cell cluster, internal structure, and / or gene expression, and particularly preferably the shape of the cell cluster. For example, if the shape of the cell cluster is spherical (spherical), it can be selected as the desired cerebral organoid.
[0165] Each index for selecting cerebral organoids preferably conforms to the general definition of cerebral organoids, and for example, a cell cluster that satisfies at least one, at least two, at least three, or at least four of the following (1) to (5) may be determined to be a cerebral organoid: (1) It is a spherical cell cluster, (2) It has a cerebral cortex-like structure inside the cell cluster, (3) It does not have pigmentation on the surface of the cell cluster, (4) It does not have a cystic shape, protruding shape, or balloon-like shape in any part of the cell cluster, and (5) The cell mass is selected from the group consisting of NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, and PCD The cells express at least one, at least two, at least three, or at least five genes selected from the group consisting of H9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
[0166] Regarding (5) above, it is preferable that the cerebral organoid expresses one or more genes, preferably all genes, selected from the group consisting of SLC17A7, NEUROD6, and EMX1.
[0167] Furthermore, it is preferable that the cell line does not substantially express at least one, at least two, at least three or more, or at least five or more of the genes expressed in non-target cells listed in Table 6 below. Furthermore, it is preferable that the cell line does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR and HOXA2, and it is more preferable that the cell line does not express two or more, three or more, four or more, or all of these markers.
[0168] As used herein, the phrase "not substantially expressed" means that the protein, which is the expression product of the gene, is expressed in an amount that is not sufficient to exert a physiological function.
[0169] As used herein, the state of "not substantially expressed" specifically refers to a state in which the expression level of any control gene constitutively expressed in cells (for example, constitutively expressed genes include GAPDH, ACTB, B2M, 18S ribosomal RNA, etc.) is 1 / 10 or less of the expression level of the control gene.
[0170] The spherical shape in (1) above and the cerebral cortex-like structure in (2) above are as described above. Here, a representative example of a cell cluster that is spherical but does not have a cerebral cortex-like structure is a cell cluster called a "potato-like" or "jelly-like" cell cluster in Figure 31.
[0171] The pigmentation in (3) above means that a cell cluster has a black or brown area in part. A representative example of a cell cluster having pigmentation is the cell cluster called "Pigment" in Figure 28.
[0172] In (4) above, the absence of a cyst-like, protruding, or balloon-like shape in any part of the cell mass means that there are no highly transparent sac-like structures, fibrous epithelial structures, or protruding structures within the cell mass.
[0173] Here, a representative example of a cyst-like shape is the shape called "Transparent" in FIG. 31. Here, a representative example of a protrusion shape is the shape called "Cotton-like" in FIG. 31. Here, a representative example of a balloon-like shape is the shape called "Balloon" in FIG. 31. The above features (1) to (4) allow the cell mass to be visually identified and removed, possibly after enlarging it. Alternatively, the shape may be identified by a device using software capable of image analysis based on a magnified microscope image. In this case, the accuracy of shape identification may be improved using methods such as deep learning.
[0174] The cerebral organoid may be a spherical cell mass having a diameter (equivalent circle diameter) of about 100 μm to 10,000 μm, preferably about 500 μm to 5,000 μm. The cerebral cortex-like structure contained within the cell mass may have a diameter (equivalent circle diameter) of about 10 μm to 1,000 μm, preferably about 50 μm to 500 μm.
[0175] The expression of a gene (marker) can be determined by its expression level. The expression level of a gene can be evaluated by the amount of the expression product of the gene (mRNA, protein, or fragment thereof), preferably the expression level of mRNA. Specifically, the expression level can be determined by quantitative RT-PCR, RT-PCR, next-generation sequencing analysis, microarray analysis, Western blotting, ELISA, immunostaining, flow cytometry, etc.
[0176] The determination may be made for each cell cluster, or in the case of the same lot, a certain number of cell clusters (e.g., one or more, three or more, five or more) may be sampled and determined. The shape, internal structure, size, and surface color or pattern of the cell clusters can be determined by visual inspection under an inverted microscope, and it is preferable to determine each cell cluster. Gene expression is preferably determined by sampling rather than by each cell cluster. Specifically, for example, cell clusters selected based on shape and / or internal structure may be determined by quantitative RT-PCR, RT-PCR, next-generation sequencing analysis, microarray analysis, Western blotting, ELISA, immunostaining, flow cytometry, or the like.
[0177] In step (3), the cell masses determined to be cerebral organoids by the above-mentioned determination method are collected and selected as cerebral organoids. The cerebral organoids selected in step (3) are enriched for cerebral organoids compared to those not selected. That is, by undergoing step (3), the proportion of cerebral organoids in the cell mass population can be further improved.
[0178] 3. Cerebral organoid The cell culture of the present invention is a cell culture produced by the method for producing cerebral organoids comprising the above-mentioned steps (1) and (2), and comprises a plurality of spherical cell aggregates, and the proportion of cerebral organoids in the plurality of spherical cell aggregates is 40% or more, preferably 50% or more, more preferably 60% or more. Here, this proportion can be calculated by sampling the cell culture and calculating the number of cerebral organoids in the total number of spherical cell aggregates in the sample.
[0179] Cerebral organoids refer to spherical cell masses containing one or more, preferably multiple, cerebral cortex-like structures with a neuronal cell layer outside the neuroepithelium. The method for determining cerebral organoids is similar to the method described in step (3) above.
[0180] The proportion of cerebral cortex-like structures in individual cerebral organoids may be 20% or more, preferably 40% or more, and more preferably 50% or more. Here, the proportion of cerebral cortex-like structures in cerebral organoids refers to the proportion of cerebral cortex-like structures in the area or volume of the entire cerebral organoid, and from the perspective of ease of evaluation, it is preferably the proportion of area. Furthermore, this proportion may be the average value of multiple (e.g., 2 to 20, preferably 5 or 10) cerebral organoids. This proportion may be evaluated, for example, by the proportion of cerebral cortex-like structures in the cross-sectional area of a section containing the center of the cerebral organoid. Here, the center refers to the central part of the cross-section having the maximum diameter of the cerebral organoid. The above evaluation may be performed, for example, by immunostaining a cerebral organoid section, determining cells positive for neural stem cell markers and / or neural progenitor cell markers, and neuron markers as cerebral cortex-like structures, and calculating the proportion of the area of the cerebral cortex-like structures in the area of the section. Alternatively, it may be calculated as the ratio of the volume of the cerebral cortex-like structure to the volume of the cerebral organoid.
[0181] Here, the neural stem cell and / or neural progenitor cell marker includes Pax6, and the nerve cell marker includes the forebrain marker Foxg1, the cerebral cortex marker Ctip2, and the like.
[0182] Furthermore, in a preferred embodiment of the cerebral organoid, 20% or more, preferably 40% or more, and preferably 70% or more of the total number of cells are Foxg1-positive cells.
[0183] In one aspect, the cerebral cortex-like structure has a cell layer positive for neural stem cell markers PAX6 and / or SOX2 on the luminal side, and contains phosphorylated histone H3-positive mitotic cells in the luminal-most portion.
[0184] In one aspect, the outer side of the neuroepithelial-like cell layer of the cerebral cortex-like structure contains cells that express βIII-Tubulin (βTubIII, TUBB3, or TUJ1), a marker for postmitotic neurons, and Ctip2 and / or Tbr1, markers for the early cortical plate of the cerebral cortex. These cells contain Reelin-positive Cajal-Retzius cells, which are neurons in the first layer of the cerebral cortex, and may have a layer rich in Laminin near the surface.
[0185] In one embodiment, the cerebral organoid may be a cerebral organoid produced using a method for producing a cerebral organoid comprising the steps (1) and (2) above. The cerebral organoid of one embodiment may be a cerebral organoid selected by the step (3) above, or may be a cell mass having the following characteristics (1) to (5): (1) being a spherical cell mass, (2) having a cerebral cortex-like structure inside the cell mass, (3) not having pigmentation on the surface, (4) not having a cystic shape, protruding shape, or balloon-like shape in a part of the cell mass, and (5) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCD The cell expresses at least one, at least two, at least three, or at least five genes selected from the group consisting of H9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
[0186] Regarding the above (5), it is preferable that the cerebral organoid expresses one or more, two or more, or all of the markers selected from the group consisting of SLC17A7, NEUROD6, and EMX1. Furthermore, it is preferable that one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2 are not substantially expressed, and it is more preferable that two or more, three or more, four or more, or all of these markers are not expressed.
[0187] In one embodiment, the cerebral organoid is as described above, and the number of cells per cell cluster is about 5 x 10 3 ~5 x 10 6 pieces, preferably about 1×10 4 ~3 x 10 6 It may be one.
[0188] 4. Method for Producing Cerebral Cortical Cell Cluster 1 One embodiment of the present invention is a method for producing a cerebral cortical cell cluster from pluripotent stem cells in the absence of feeder cells, comprising the following steps (i) and (ii): (i) obtaining cerebral organoids from pluripotent stem cells, and (ii) culturing the cerebral organoids obtained in step (i) in a culture medium containing a Notch signal inhibitor, preferably a γ-secretase inhibitor, to obtain a cerebral cortical cell cluster.
[0189] In the above step (i), the method for obtaining cerebral organoids from pluripotent stem cells is not limited, and can be prepared by methods well known to those skilled in the art. Such well-known methods include, for example, step (2) in the method for producing cerebral organoids in the above section 2.
[0190] One aspect of the present invention is a "method for producing cerebral cortical cell mass 1," which comprises, in step (i), obtaining cerebral organoids from pluripotent stem cells by the method for producing cerebral organoids described in 2 above. That is, method for producing cerebral cortical cell mass 1 is a method for producing a cerebral cortical cell mass from pluripotent stem cells in the absence of supporting cells, comprising treating cerebral organoids obtained by the method for producing cerebral organoids described in 2 above with the following steps (i) and (ii): (i) obtaining cerebral organoids by the method for producing cerebral organoids described in 2 above (i.e., including the method described in any one of claims 1 to 10); (ii) culturing the cerebral organoids obtained in step (i) in a culture medium containing a Notch signal inhibitor, preferably a γ-secretase inhibitor, to obtain a cerebral cortical cell mass.
[0191] <Step (i)> Step (i) is as described in step (1), step (2a), and step (2b) in 2 above. Step (i) may further include step (3) in 2 above.
[0192] In one embodiment, step (2b) is carried out for about 7 to 31 days, preferably about 7 to 21 days.
[0193] <Step (ii)> After performing the above-mentioned step (2b), optionally performing the selection in step (3), step (ii) can be performed by exchanging the medium with a medium containing a Notch inhibitor, preferably a γ-secretase inhibitor. Alternatively, step (ii) may be performed after performing the above-mentioned step (2b), and then the selection in step (3) may be performed.
[0194] In step (ii), the Notch signal inhibitor can be appropriately selected and used from those described in the definitions. Preferable examples of the Notch signal inhibitor used in step (ii) include γ-secretase inhibitors. Preferable examples of the γ-secretase inhibitor can be appropriately selected and used from those described in the definitions. Preferable examples of the γ-secretase inhibitor include N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) and Compound E.
[0195] The culture medium used in step (ii) can be the same as that used in step (i), i.e., step (2b) of production method 2, except that it contains a Notch signal inhibitor. Alternatively, a culture medium different from that used in step (2b) may be appropriately selected from the culture conditions described in step (2b) of production method 2 above.
[0196] The culture conditions in step (ii) may be appropriately the same as those in step (2b).
[0197] The concentration of the Notch signal inhibitor, preferably the γ-secretase inhibitor, in the culture medium can be appropriately set within a range capable of suppressing proliferative cells, such as neural stem cells, that may be contained in the cell mass. Specifically, when DAPT is used as the γ-secretase inhibitor, the concentration can be set to a range that exhibits γ-secretase activity or Notch signal inhibitory activity based on the γ-secretase activity equivalent to 0.1 to 1000 μM, 1 to 100 μM, preferably 1 to 30 μM, and more preferably 5 to 20 μM.
[0198] Step (ii) is carried out about 28 to 49 days, preferably about 28 to 44 days, from the start of suspension culture in step (i) (start of induction of differentiation into neurons).
[0199] The culture period in step (ii) is 1 to 7 days, preferably 2 to 6 days, more preferably 2 to 4 days.
[0200] 5. Method for Producing Cerebral Cortical Cell Cluster 2 One embodiment of the present invention includes a method for producing a cerebral cortical cell cluster from pluripotent stem cells in the absence of support cells, the method comprising: (i) obtaining cerebral organoids from pluripotent stem cells; (ii) culturing the cerebral organoids obtained in step (i) in a culture medium; (iii) dispersing the cell culture obtained in step (ii) into single cells or clusters of 2 to 5 cells (cell clumps); and (iv) culturing the cell culture obtained in step (ii) or the cell population obtained in step (iii) in a culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator, wherein the dispersal step of step (iii) into single cells or clusters of 2 to 5 cells (cell clumps) is an optional step, and the culture medium in step (ii) and / or the culture medium in step (iv) contains a Notch signaling inhibitor.
[0201] In the above step (i), the method of obtaining cerebral organoid from pluripotent stem cells is not limited, and can be prepared by the method known to those skilled in the art.Preferably, in step (i), obtain cerebral organoid from pluripotent stem cells by the method of producing cerebral organoid described in above 2, particularly by the method comprising step (1), step (2a) and step (2b).
[0202] The culture medium in step (ii) and / or the culture medium in step (iv) may contain a Notch signal inhibitor during part or all of the period of the step. When the treatment period with a Notch signal inhibitor is a partial period, a culture medium not containing a Notch signal inhibitor is used when replacing the culture medium in step (ii) or step (iv). The partial period is not particularly limited as long as the effect of the treatment with the Notch signal inhibitor is obtained, and may be a few hours to several days, specifically 1 to 7 days, preferably 2 to 6 days, and more preferably 2 to 4 days, during the culture period of step (ii) or step (iv). Furthermore, extremely short treatment periods (e.g., 4 hours, 12 hours, 24 hours, 2 days) may be repeated. Furthermore, the present application also encompasses combinations in which periods containing a Notch signal inhibitor and periods not containing a Notch signal inhibitor are alternated, or in which different concentrations of a Notch signal inhibitor are used. The Notch signal inhibitor used here and its concentration can be determined by reference to the description of step (ii) in method 1 for producing cerebral cortical aggregates.
[0203] One embodiment of the present invention is a "method for producing cerebral cortical cell mass 2-1," in which step (i) is performed according to the method for producing cerebral organoids described in 2 above, and includes step (iii). That is, method for producing cerebral cortical cell mass 2-1 is a method for producing a high-purity cerebral cortical cell mass, which includes treatment with the following steps (iii) and (iv-1) in addition to steps (i) and (ii) in method for producing cerebral cortical cell mass 1 described in 4 above. This is a high-purity cerebral cortical cell mass that has been dispersed and reaggregated. Here, in step (ii), the cerebral organoids obtained in step (i) are cultured in a culture medium containing a Notch signal inhibitor, preferably a γ-secretase inhibitor. Step (ii) may be performed in the same manner as step (ii) in method for producing cerebral cortical cell mass 1 described in 4 above. (iii) A step of dispersing the cerebral organoid obtained in step (ii) into single cells or clusters of 2 to 5 cells (cell clumps); (iv-1) A step of culturing the cell population obtained in step (iii) in a serum-free culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator (e.g., dibutyryl cAMP (dbcAMP)) to obtain cell clusters (e.g., consisting of 20 or more cells).
[0204] <Step (iii)> The cerebral organoids obtained in step (ii) can be dispersed into single cells or aggregates of 2 to 5 cells (cell clumps) by methods well known to those skilled in the art, such as physically by pipetting or by enzymatic treatment. Here, the cell population obtained by dispersion may be a population of single cells and / or aggregates of 2 to 5 cells (cell clumps). That is, in step (iii), the cerebral organoids obtained in step (ii) may be dispersed into single cells or aggregates of 2 to 5 cells (cell clumps) by methods well known to those skilled in the art.
[0205] <Step (iv-1)> The cell population obtained in step (iii) can be reaggregated by suspension culture to obtain a highly purified cell mass containing cerebral cortical cells (high-purity cerebral cortical cell mass).
[0206] The culture medium used in step (iv-1) is a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof, and a cAMP activator.
[0207] The neurotrophic factors may be appropriately selected from the above definitions, 1 to 4, 1 to 3, preferably 1 or 2 factors. Preferred examples of neurotrophic factors include BDNF and / or GDNF. The concentration of BDNF is 1 to 100 ng / mL, preferably 10 to 30 ng / mL. The concentration of GDNF is 1 to 100 ng / mL, preferably 5 to 20 ng / mL.
[0208] The concentration of ascorbic acid or a derivative thereof (for example, ascorbic acid-2-phosphate) is, in the case of ascorbic acid, a concentration equivalent to 10 to 500 μM, preferably 50 to 300 μM, and similar concentrations can be used for derivatives.
[0209] The concentration of the cAMP activator may be, for example, a concentration capable of activating cAMP equivalent to 10 to 1000 μM, preferably 100 to 600 μM, more preferably 300 to 500 μM when dbcAMP is used.
[0210] The culture period in step (iv-1) is 1 to 21 days, preferably 2 to 15 days, 2 to 10 days, 2 to 8 days, 2 to 6 days, and more preferably about 4 days, or 1 to 40 days, preferably 2 to 28 days, and more preferably 2 to 14 days.
[0211] The suspension culture in step (iv-1) can be carried out with reference to the method described in step (2b) of Section 2. For example, a medium can be prepared by adding one or more neurotrophic factors, ascorbic acid or a derivative thereof, and a cAMP activator to the same medium as in step (2b) of Section 2.
[0212] The culture medium used in step (iv-1) may optionally contain a ROCK inhibitor. The ROCK inhibitor may be any of those defined above, and preferred examples include Y-27632.
[0213] The concentration of the ROCK inhibitor used here is, for example, a concentration equivalent to about 0.1 to 200 μM, preferably about 2 to 100 μM, and more preferably about 30 to 100 μM when Y-27632 is used as the ROCK inhibitor. The cerebral cortical cell mass obtained via step (iii) is a highly purified cerebral cortical cell aggregate mass due to the dispersion-reagglomeration step.
[0214] 6. Method for producing cerebral cortical cell mass 2-2 One embodiment of the present invention is a method for producing cerebral cortical cell mass 2-1 described above in 5, which does not include step (iii). That is, a method for producing a cerebral cortical cell mass includes, in addition to steps (i) and (ii), the method for producing a cerebral cortical cell mass 1 described above in 4, and further comprising the following step (iv-2). Here, in step (ii), the cerebral organoids obtained in step (i) are cultured in a culture medium containing a Notch signal inhibitor, preferably a γ-secretase inhibitor. (iv-2) A step of obtaining a cerebral cortical cell mass by suspension culture of the cell culture containing the cerebral organoids obtained in step (ii) in a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof (e.g., ascorbic acid-2-phosphate), and a cAMP activator (e.g., dibutylyl cAMP (dbcAMP)).
[0215] <Step (iv-2)> By subjecting the cell culture containing the cerebral organoids obtained in step (ii) to suspension culture, a cell mass containing cerebral cortical cells (cerebral cortical cell mass) can be obtained.
[0216] The culture medium used in step (iv-2) may be the culture medium described in step (iv-1) of 5 above, and the conditions and culture period for suspension culture may also be those described in step (iv-1) of 5 above.
[0217] 7. Methods 3-1 to 3-7 for producing cerebral cortical cell mass One embodiment of the present invention is "method 3-1 for producing cerebral cortical cell mass," in which the culture medium in step (ii) contains a Notch signal inhibitor. That is, method 3-1 for producing cerebral cortical cell mass includes a method for producing a cerebral cortical cell mass, which includes the following step (I): (I) a step of culturing pluripotent stem cell-derived cerebral organoids in a culture medium containing a Notch inhibitor, preferably a γ-secretase inhibitor. Here, step (I) may be carried out in the same manner as step (ii) in method 1 for producing a cerebral cortical cell mass.
[0218] One embodiment of the present invention is a "method for producing cerebral cortical cell mass 3-2," which includes, in addition to the above-mentioned step (I), the following steps: (II) dispersing the cell culture containing the cerebral organoids obtained in step (I) into single cells or aggregates of 2 to 5 cells (cell clumps); and (III) culturing the cell population obtained in step (II) in a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof, and a cAMP activator to obtain a cerebral cortical cell mass. Here, step (I) may be performed in the same manner as step (ii) in method for producing cerebral cortical cell mass 1, and steps (II) and (III) may be performed in the same manner as steps (iii) and (iv-1) in method for producing cerebral cortical cell mass 2. Furthermore, the cerebral cortical cell mass obtained through step (III) has undergone a dispersion-reaggregation process and is a high-purity cerebral cortical cell aggregate.
[0219] One embodiment of the present invention does not include the above step (II). That is, in addition to step (I), a "method for producing cerebral cortical cell mass 3-3" is exemplified, which includes treatment with the following steps. (III-2) A step of obtaining a cerebral cortical cell mass by suspension culture of a cell culture containing the cerebral organoids obtained in step (I) in a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof (e.g., ascorbic acid-2-phosphate), and a cAMP activator (e.g., dibutylyl cAMP (dbcAMP)). Here, step (I) may be performed in the same manner as step (ii) in the method for producing a cerebral cortical cell mass 1, and step (III-2) may be performed in the same manner as step (iv-1) in the method for producing a cerebral cortical cell mass 2.
[0220] One aspect of the present invention includes a "method 3-4 for producing cerebral cortical cell masses," which comprises the following steps (I-2), (II), and (III-3). (I-2) A step of culturing pluripotent stem cell-derived cerebral organoids in a culture medium, (II) A step of dispersing the cell culture containing the cerebral organoids obtained in step (I-2) into single cells or aggregates of 2 to 5 cells (cell clumps), and (III-3) A step of culturing the cell population obtained in step (II) in a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof, and a cAMP activator to obtain a cerebral cortical cell mass, wherein the culture medium in step (I-2) does not contain a Notch signal inhibitor, and the culture medium in step (III-3) contains a Notch signal inhibitor. Here, step (I-2) may be performed in the same manner as step (2b) in the method for producing cerebral organoids described in 2 above. Step (I-2) may be a culture corresponding to a portion of the process for producing pluripotent stem cell-derived cerebral organoids, and the culture period is not particularly limited. Step (II) may be performed in the same manner as step (iii) in the method for producing cerebral cortical cell mass 2-1 described in 5 above. The culture medium in step (III-3) may contain a Notch signal inhibitor during part or all of the period of the step. If the treatment period with a Notch signal inhibitor is a partial period, a culture medium not containing a Notch signal inhibitor is used when replacing the culture medium in step (III-3). The partial period is not particularly limited as long as the effect of treatment with a Notch signal inhibitor is obtained, and may be several hours to several days, specifically 1 to 7 days, preferably 2 to 6 days, and more preferably 2 to 4 days, within the culture period of step (III-3). Furthermore, extremely short treatment periods (e.g., 4 hours, 12 hours, 24 hours, 2 days) may be repeated. The present application also encompasses combinations in which a period containing a Notch signaling inhibitor and a period not containing a Notch signaling inhibitor are alternately performed, or in which different concentrations of a Notch signaling inhibitor are used. The culture medium in the following steps (III-4) and (III-5) may contain a Notch signaling inhibitor for part or all of the period of the steps, similar to the culture medium in step (III-3).
[0221] <Step (III-3)> The cell population obtained in step (II) can be reaggregated by suspension culture to obtain a cell mass containing highly purified cerebral cortical cells (high-purity cerebral cortical cell mass).
[0222] The culture medium used in step (III-3) may be the culture medium described in step (iv-1) of the method for producing a cerebral cortical cell cluster 2 described in 5 above, and the conditions and culture period for suspension culture may also be those described in step (iv-1) of 5 above.
[0223] In step (III-3), the culture medium contains a Notch signal inhibitor, preferably a γ-secretase inhibitor, during part or all of the suspension culture period.
[0224] The Notch signal inhibitor used herein can be appropriately selected from those described in the definitions and used, but preferred examples of the Notch signal inhibitor include γ-secretase inhibitors. The γ-secretase inhibitor can be appropriately selected from those described in the definitions and used, but preferred examples of the γ-secretase inhibitor include N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) and Compound E.
[0225] The concentration of the Notch signal inhibitor, preferably the γ-secretase inhibitor, in the culture medium can be appropriately set within a range capable of suppressing proliferative cells that may be contained in the cell mass to be produced. Specifically, when DAPT is used as the γ-secretase inhibitor, the concentration can be set to a range that exhibits γ-secretase activity or Notch signal inhibitory activity based on the γ-secretase activity equivalent to 0.1 to 1000 μM, 1 to 100 μM, preferably 1 to 30 μM, and more preferably 5 to 20 μM.
[0226] In step (III-3), the timing of initiating culture in the presence of a Notch signal inhibitor, preferably a γ-secretase inhibitor, is not particularly limited, but may be, for example, 28 to 42 days after the initiation of differentiation. The culture period is preferably about 1 to about 20 days, more preferably 2 to 8 days. The cerebral cortical cell mass obtained through step (III-3) has undergone a dispersion-reaggregation step and is a highly purified cerebral cortical cell aggregate mass.
[0227] One embodiment of the present invention includes the above steps (I), (II), and (III-4), and the culture medium for step (I) and the culture medium for step (III-4) both contain a Notch signal inhibitor (method for producing cerebral cortical cell mass 3-5). Here, step (I) may be carried out in the same manner as step (ii) in method for producing cerebral cortical cell mass 1 described in 4 above, step (II) may be carried out in the same manner as step (iii) in method for producing cerebral cortical cell mass 2 described in 5 above, and step (III-4) may be carried out in the same manner as step (III-3) in method for producing cerebral cortical cell mass 3-4. Furthermore, the cerebral cortical cell mass obtained via step (III-4) has undergone a dispersion-reaggregation step, and is a highly purified cerebral cortical cell aggregate mass.
[0228] One embodiment of the present invention includes the above steps (I) and (III-5), and the culture medium in the step (III) contains a Notch signal inhibitor (method 3-6 for producing a cerebral cortical cell mass). Here, step (I) may be carried out in the same manner as step (ii) in method 1 for producing a cerebral cortical cell mass described in 4 above, and step (III-5) may be carried out in the same manner as step (III-3) in method 3-4 for producing a cerebral cortical cell mass.
[0229] Here, culturing in a culture medium containing a Notch signal inhibitor in step (I) and / or step (III-5) means that the culture medium used during a part of the culture period or the entire culture period in step (I) and / or step (III-5) contains a Notch signal inhibitor.
[0230] Here, when the treatment period with a Notch signal inhibitor is a partial period, a culture medium containing no Notch signal inhibitor is used when replacing the culture medium in step (I) or step (III-5). This partial period is not particularly limited as long as the effect of the treatment with the Notch signal inhibitor is obtained, and may be a few hours to several days, specifically 1 to 7 days, preferably 2 to 6 days, and more preferably 2 to 4 days, of the culture period in step (I) or step (III-5). Furthermore, short treatment periods (e.g., 4 hours, 12 hours, 24 hours, 2 days) may be repeated. Furthermore, alternating periods containing a Notch signal inhibitor and periods not containing a Notch signal inhibitor, or combinations using different concentrations of a Notch signal inhibitor, are also within the scope of the present application.
[0231] One embodiment of the present invention is an embodiment (3-7) of the method for producing a cerebral cortical cell mass, in which the step (I) of the method for producing a cerebral cortical cell mass 3-6 is changed to the step (I-2). Except for changing the step (I) to the step (I-2), the method is carried out in accordance with the method for producing a cerebral cortical cell mass 3-6. The culture medium in step (III-5) further contains a Notch signal inhibitor in addition to a culture medium containing one or more neurotrophic factors, ascorbic acid or a derivative thereof, and a cAMP activator.
[0232] In the methods 3-1 to 3-7 for producing cerebral cortical cell masses, the method for producing cerebral organoids used in step (I) or (I-2) is not particularly limited, and they can be prepared by methods well known to those skilled in the art. For example, they can be produced according to the method for producing cerebral organoids described in 2 above. Alternatively, step (1) of the method for producing cerebral organoids described in 2 above can be omitted, and step (2) can be performed using pluripotent stem cells instead of the "cells obtained in step (1)" in step (2).
[0233] Furthermore, in the methods 3-1 to 3-7 for producing cerebral cortical cell clusters, instead of the treatment in steps (III) to (III-5), the method described in step (2b) of 2 above may be used, or the cells may be cultured in a medium that allows neurons to survive. In this case, it is possible to select whether or not to add a Notch signal inhibitor.
[0234] Although the present specification shows an embodiment of a representative method for producing cerebral cortical cell masses, it is expected that the efficiency of cerebral cortical cell mass formation will vary depending on the properties of the cerebral organoids used (genotype, tissue shape, proportion of cell types contained, maturity, etc.) and the equipment, instruments, and location where the process is performed. Therefore, the concentration, start time, and duration of treatment with a drug (e.g., a Notch signal inhibitor), as well as the culture period in a drug-free medium before and after treatment, can be adjusted as appropriate as long as the desired cerebral cortical cell mass is obtained.
[0235] One aspect of the present invention is a method for producing a cerebral cortical cell preparation from pluripotent stem cells in the absence of feeder cells, which comprises the steps of recovering cerebral cortical cell masses obtained by method 1 for producing a cerebral cortical cell mass described in 4 above, method 2 for producing a cerebral cortical cell mass described in 5 above, method 2-2 for producing a cerebral cortical cell mass described in 6 above, and method 3-1 to 3-7 for producing a cerebral cortical cell mass described in 7 above, and preparing a cerebral cortical cell preparation comprising the cell masses and a medium.
[0236] Although not particularly limited, media for preparing cerebral cortical cell preparations include, in the case of non-frozen preparations, solutions such as physiological saline, phosphate buffer solution (PBS(-)), Hank's balanced salt solution (HBSS), Earl's balanced salt solution, and Artceleb.
[0237] Furthermore, examples of media for preparing cerebral cortical cell preparations include, but are not limited to, solutions containing cryoprotectants such as DMSO, glycerol, polyethylene glycol, propylene glycol, glycerin, polyvinylpyrrolidone, sorbitol, dextran, and trehalose, as well as commercially available cryopreservation solutions such as Cell Banker, Stem Cell Banker, and Bambanker, when freezing.
[0238] 8. Cerebral Cortical Cell Cluster One embodiment of the present invention is a cerebral cortical cell cluster having the following properties: The cerebral cortical cell cluster can be produced by the method 1 for producing a cerebral cortical cell cluster described in 4 above.
[0239] That is, one embodiment of the present invention is a cerebral cortical cell mass having the following characteristics (a) to (c): (a) the number of proliferation marker-positive cells is 10% or less of the total number of cells, (b) the number of cells positive for one or more markers selected from the group consisting of neuronal markers, cortical layer V / VI markers, and forebrain markers is 60% or more, preferably 70% or more, and more preferably 80% or more of the total number of cells, and (c) the mass is substantially free of neuroepithelium or cerebral cortex-like structures.
[0240] The proliferation marker includes Ki67. The neuronal marker includes βIII-Tubulin (βTubIII). The cortical layer V / VI marker includes Ctip2. The forebrain marker includes Foxg1.
[0241] One embodiment of the present invention is a cerebral cortical cell mass having the following characteristics: (a') the number of Ki67-positive cells is 5% or less of the total number of cells; (b') the number of cells positive for βIII-Tubulin (βTubIII), Ctip2, and Foxg1 is 60% or more, preferably 70% or more, and more preferably 80% or more of the total number of cells; and (c) the mass is substantially free of neuroepithelium or cerebral cortex-like structures.
[0242] Neuroepithelial and cerebral cortex-like structures in cerebral organoids can be visually confirmed under an inverted microscope.
[0243] In one embodiment, being substantially free of neuroepithelium or cerebral cortex-like structures means that the above-mentioned neuroepithelium or cerebral cortex-like structures cannot be identified visually in observation with an inverted microscope or the like.
[0244] In one embodiment, the cerebral cortical cell mass further contains (d) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53 The cerebral cortical cell cluster further expresses at least one gene selected from the group consisting of I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3. The cerebral cortical cell cluster preferably expresses one or more genes selected from the group consisting of SLC17A7, NEUROD6, and EMX1, and more preferably does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2.
[0245] In one embodiment, the cerebral cortical cell mass further comprises: (e) neural stem cell marker-positive cells accounting for 10% or less of the total cell number; and examples of the neural stem cell marker include Pax6, Sox1, and Sox2.
[0246] In one embodiment, the cerebral cortical cell cluster further (f) is negative for a pluripotency marker.
[0247] Pluripotency marker-negative means that pluripotent stem cells are not substantially detected, specifically, that pluripotency marker-positive cells account for 1% or less of the total number of cells. Examples of the pluripotency marker include Oct4.
[0248] In one embodiment, the cerebral cortical cell mass may further optionally contain (g) cells positive for the cortical layer II to IV marker (SATB2).
[0249] One embodiment of the present invention is a cell population containing the above-mentioned cerebral cortical cell masses in an amount of 10% or more, preferably 20% or more, more preferably 40% or more, and even more preferably 50% or more of the total cell masses.
[0250] In one embodiment of the present invention, the cerebral cortical cell cluster may be a spherical cell cluster having a diameter (circle equivalent diameter) of about 100 μm to 1000 μm, preferably about 300 μm to 600 μm. The number of cells per cell cluster is about 1×10 3 ~5 x 10 4 pieces, preferably about 5×10 3 ~2 x 10 4 Alternatively, in one embodiment of the present invention, the cerebral cortical cell cluster may be a spherical cell cluster having a diameter (circle-equivalent diameter) of about 100 μm to 5000 μm, preferably about 300 μm to 2000 μm. The number of cells per cell cluster is about 5×10 3 ~5 x 10 6 pieces, preferably about 1×10 4 ~3 x 10 6 It may be one.
[0251] In one embodiment of the present invention, the average diameter (circle equivalent diameter) of a cell population of cerebral cortical cell clusters is approximately 300 μm to 2000 μm.
[0252] In one aspect of the present invention, the cerebral cortical cell mass and cell population thereof are characterized in that, when transplanted into the brain in vivo, they survive at the transplant site and suppress the proliferation of graft-derived cells. For example, when transplanted into a mouse brain, the volume of the graft of a cerebral cortical cell mass 5 weeks after differentiation induction was suppressed to 2% to 50% three months after transplantation compared to a cerebral organoid transplant from the same period.
[0253] The cerebral cortical cell mass and cell population thereof are useful for cell transplantation therapy for patients suffering from cerebrovascular disorders or head trauma, as will be described later.
[0254] 9. High-Purity Cerebral Cortical Cell Mass One aspect of the present invention is a high-purity cerebral cortical cell mass having the following properties. A high-purity cerebral cortical cell mass having the following properties, in which proliferation marker-positive cells are suppressed and the content of target neurons is increased, can be produced by method 2-1 for producing a cerebral cortical cell mass described in 5 above, method 2-2 for producing a cerebral cortical cell mass described in 6 above, or methods 3-1 to 3-6 for producing a cerebral cortical cell mass described in 7 above.
[0255] That is, one embodiment of the present invention is a highly purified cerebral cortical cell mass having the following characteristics: (A) the number of proliferation marker-positive cells is 5% or less, preferably 3% or less, and more preferably 1% or less of the total number of cells, (B) the number of cells positive for one or more markers selected from neuronal markers, cortical layer V / VI markers, and forebrain markers is 60% or more, preferably 70% or more, and more preferably 80% or more of the total number of cells, and (C) the mass is substantially free of neuroepithelium or cerebral cortex-like structures.
[0256] The proliferation marker includes Ki67. The neuronal marker includes βIII-Tubulin (βTubIII). The cortical layer V / VI marker includes Ctip2. The forebrain marker includes Foxg1.
[0257] One embodiment is a highly purified cerebral cortical cell mass having the following characteristics: (A) the number of Ki67-positive cells is 5% or less of the total number of cells; (B) the number of cells positive for βIII-Tubulin (βTubIII), Ctip2, and Foxg1 is 60% or more, preferably 70% or more, and more preferably 80% or more of the total number of cells; and (C) the mass is substantially free of neuroepithelium or cerebral cortex-like structures.
[0258] In one embodiment, being substantially free of neuroepithelium or cerebral cortex-like structures means that the above-mentioned neuroepithelium or cerebral cortex-like structures cannot be identified visually in observation with an inverted microscope or the like.
[0259] In the present invention, methods for obtaining a highly purified cerebral cortical cell cluster, i.e., steps that are effective for increasing the content of cerebral cortical cells in a cerebral cortical cell cluster and decreasing the content of non-target cells such as proliferative cells, include the steps described in step (iv) or step (III) above (the presence of a Notch signal inhibitor is optional but not essential), and more preferably, include steps that additionally include the step of dispersing and re-aggregating the cerebral cortical cell cluster described in step (iii) or step (II) above.
[0260] In one embodiment, the high-purity cerebral cortical cell mass further contains: (D) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCDH9, The cerebral cortical cell mass further expresses at least one, at least two, at least three, or at least five genes selected from the group consisting of NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3. The cerebral cortical cell mass preferably expresses one or more genes selected from the group consisting of SLC17A7, NEUROD6, and EMX1, or all of the genes, and more preferably does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2.
[0261] In one embodiment, the high-purity cerebral cortical cell mass further comprises: (E) neural stem cell marker-positive cells accounting for 10% or less, preferably 5% or less, and more preferably 3% or less of the total number of cells; and examples of the neural stem cell marker include Pax6, Sox1, and Sox2.
[0262] In one embodiment, the highly purified cerebral cortical cell mass is further (F) pluripotency marker-negative.
[0263] Pluripotency marker-negative means that pluripotent stem cells are not substantially detected, specifically, that pluripotency marker-positive cells account for 1% or less of the total cell number.
[0264] Examples of the pluripotency marker include Oct4.
[0265] In one embodiment, the cerebral cortical cell mass may further contain (G) cells positive for the cortical layer II to IV marker (SATB2) in some cases.
[0266] One embodiment of the present invention is a cell population containing the above-mentioned cerebral cortical cell masses in an amount of 10% or more, preferably 20% or more, more preferably 40% or more, and even more preferably 50% or more of the total cell masses.
[0267] In one embodiment of the present invention, the high-purity cerebral cortical cell clusters may be spherical cell clusters with a diameter (equivalent circle diameter) of about 100 μm to 10,000 μm, preferably about 200 μm to 3,000 μm. The number of cells per cell cluster is about 1×10 3 ~5 x 10 6 pieces, preferably about 5×10 3 ~3 x 10 6 It may be one.
[0268] In one embodiment of the present invention, the average diameter (circle equivalent diameter) of a cell population of highly purified cerebral cortical cell clusters is approximately 300 μm to 500 μm.
[0269] In one aspect of the present invention, the high-purity cerebral cortical cell mass and the cell population obtained therefrom are characterized in that, when transplanted into the brain in vivo, they survive at the transplant site and suppress the proliferation of graft-derived cells. For example, when transplanted into the brain of a mouse, the volume of the graft 5 weeks after transplantation can be 2% to 50% of that immediately after transplantation.
[0270] The above-mentioned highly purified cerebral cortical cell mass and the cell population obtained therefrom are useful for cell transplantation therapy for patients suffering from cerebrovascular disorders, as will be described later.
[0271] One embodiment of the present invention includes a cell population of high-purity cerebral cortical cell clusters that, in addition to the above properties, are uniform in size, constituent cell composition, or shape. This cell population can be produced by methods 2-1, 2-2, and 3-1 to 3-6 for producing cerebral cortical cell clusters described above in 5 to 7. That is, according to this production method, cerebral organoids are dispersed and reaggregated to produce a cell population of high-purity cerebral cortical cell clusters that are uniform in size, constituent cell composition, or shape.
[0272] Here, homogeneity can be identified, for example, by using as an indicator that the variation in values such as the marker expression levels, size, and number of cells contained in one cell cluster of the high-purity cerebral cortical cell cluster is ±20% or less, preferably ±10% or less, and even more preferably ±5% or less.
[0273] The above-mentioned highly purified cerebral cortical cell mass and cell population thereof are useful for cell transplantation therapy for patients suffering from cerebrovascular disorders or head trauma, as will be described later.
[0274] 10. Pharmaceutical Compositions One aspect of the present invention includes pharmaceutical compositions containing the cerebral organoids obtained by the method for producing cerebral organoids described in 2 above, or the cerebral organoids described in 3 above, cell populations containing cerebral cortical cells obtained from these cerebral organoids, cerebral cortical cell masses obtained by the method for producing cerebral cortical cell masses described in 4 to 7 above, cerebral cortical cell masses described in 8 or 9 above, or cell populations containing cerebral cortical cells obtained from these cell masses as an active ingredient. That is, the cerebral organoids obtained by the method for producing cerebral organoids described in 2 above, or the cerebral organoids described in 3 above, cell populations containing cerebral cortical cells obtained from these cerebral organoids, cerebral cortical cell masses obtained by the method for producing cerebral cortical cell masses described in 4 to 7 above, cerebral cortical cell masses described in 8 or 9 above, or cell populations containing cerebral cortical cells obtained from these cell masses can be used as an active ingredient for cell transplantation therapy as a cell mass for transplantation (also called a graft) or a cell / tissue for transplantation.
[0275] The effective amount of the active ingredient varies depending on the purpose of administration, the administration method, and the condition of the subject (sex, age, weight, medical condition, etc.). For example, the effective amount of the active ingredient is 1 x 10 4 pieces ~ 1×10 10 pieces, 1×10 5 pieces ~ 1×10 9 pieces, 1×10 6 pieces ~ 1×10 7 pieces, 3×10 6 ~3 x 10 7 Pieces, or 1 x 10 6 pieces ~ 1×10 9 It can be made into one.
[0276] The pharmaceutical composition, or cell mass for transplantation, cell for transplantation, or tissue for transplantation (hereinafter referred to as pharmaceutical composition, etc.) herein may contain a pharmaceutically acceptable carrier in addition to an effective amount of the active ingredient. As a pharmaceutically acceptable carrier, a physiological aqueous solvent (such as physiological saline, buffer solution, or serum-free culture medium) can be used. If necessary, the pharmaceutical composition, etc. may contain preservatives, stabilizers, reducing agents, isotonicity agents, etc. that are commonly used in medicines containing cell mass for transplantation or cells for transplantation in transplantation medicine.
[0277] The transplantable cell mass, transplantable cells, or transplantable tissue can be prepared as a cell suspension by suspending it in an appropriate physiological aqueous solvent. If necessary, the transplantable cell population can be cryopreserved by adding a cryopreservative, and then thawed and washed with a buffer solution before use, or stored at low temperatures and washed with a buffer solution before use, for use in transplantation therapy.
[0278] Specifically, after carrying out the method for producing cerebral organoids described in 2 above or the method for producing cerebral cortical cell clusters described in 4 to 7 above, all of the cerebral organoids or cell clusters are recovered, and if necessary, the recovered cell clusters can be washed with the culture medium used, other culture medium, phosphate buffer, etc., and then suspended in a medium used in the pharmaceutical composition.
[0279] The pharmaceutical composition etc. of the present invention may be a suspension in which cell clusters are dispersed or suspended, or may be a suspension or sheet in which cells are dispersed from the cell clusters.
[0280] Furthermore, the pharmaceutical composition obtained by the production method of the present invention can be cultured on a plate after carrying out the method for producing cerebral organoids described in 2 above or the method for producing cerebral cortical cell masses described in 4 to 7 above, and then molded into a sheet-like shape to form a two-dimensional cell tissue structure, or can be cultured on a scaffold to form a three-dimensional shape to form a three-dimensional cell tissue structure.
[0281] As described below, pharmaceutical compositions containing cell masses or cell populations containing the cerebral cortical cells of the present invention, when administered to the cerebral cortex of cerebrovascular disorder model animals (e.g., mice), exhibit remarkable effects, such as repair of the damaged nervous system at the damaged site and recovery of motor function (e.g., improvement of symptoms such as motor paralysis). Therefore, pharmaceutical compositions of the present invention are useful as therapeutic agents for cerebrovascular disorders or head trauma. Furthermore, pharmaceutical compositions of the present invention are useful as agents for improving motor function in patients with cerebrovascular disorders.
[0282] Furthermore, the cell masses or cell populations containing cerebral cortical cells contained in the pharmaceutical compositions and the like described herein are produced from established pluripotent stem cells, and are identified and quality-controlled using markers and the like. Therefore, transplant cell populations of stable quality can be produced in large quantities and used for transplantation. Furthermore, because transplant cell populations can be stored, they can be prepared in accordance with the time of transplantation for the patient.
[0283] 11. Treatment Methods One aspect of the present invention includes a method for treating diseases requiring replenishment or functional improvement of cerebral cortical cells, specifically cerebrovascular disorders, comprising transplanting (administering) to a subject in need thereof an effective amount of a cerebral organoid obtained by the method for producing cerebral organoids described in 2 above, or a cerebral organoid described in 3 above, a cell population containing cerebral cortical cells obtained from these cerebral organoids, a cerebral cortical cell mass obtained by the method for producing a cerebral cortical cell mass described in 4 to 7 above, a cerebral cortical cell mass described in 8 or 9 above, a cell population containing cerebral cortical cells obtained from these cell masses, or a pharmaceutical composition described in 10 above. Here, the administration (transplantation) site may be the cerebral cortex or the basal ganglia. The subject may be a mammal, preferably a rodent (e.g., mouse, rat) or a primate (e.g., human, monkey), and more preferably a human. The cerebrovascular disorder may also be head trauma. Furthermore, the concept of this treatment method includes a method for improving motor function (for example, improving symptoms such as motor paralysis) in patients with cerebrovascular disorders, a method for replenishing cerebral cortical cells in patients with cerebrovascular disorders, and the like.
[0284] In transplantation medicine, rejection reactions due to differences in histocompatibility antigens are often a problem, but this problem can be overcome by using autologous pluripotent stem cells (e.g., induced pluripotent stem cells) established from the somatic cells of the transplant recipient. That is, in a preferred embodiment of the present invention, pluripotent stem cells (e.g., induced pluripotent stem cells) established from the somatic cells of the recipient are used as pluripotent stem cells, thereby producing an immunologically autologous cell mass (cell population) for the recipient, and a transplant cell population containing the cell mass (cell population) or cells obtained from the cell mass (cell population) is transplanted into the recipient.
[0285] Alternatively, an allogeneic (allogeneic) cell mass (cell population) may be produced from pluripotent stem cells (e.g., induced pluripotent stem cells) established from somatic cells of another person whose immune system is compatible with that of the recipient (e.g., whose HLA type or MHC type is compatible), and a transplant cell population containing the cell mass (cell population) or cells obtained from the cell mass (cell population) may be transplanted into the recipient.
[0286] Furthermore, by producing the cell mass (cell population) of the present invention using iPS cells in which the expression of histocompatibility antigens (e.g., antigen proteins constituting HLA Class I and HLA Class II) or factors necessary for the expression of said antigens is suppressed, rejection reactions can be avoided even in allogeneic cell transplants.
[0287] The aforementioned pharmaceutical composition can be used as a therapeutic agent to be administered or implanted into a patient or recipient in the treatment method of the present invention.
[0288] One embodiment of the present invention is the use of a cell mass or cell population containing the cerebral cortical cells of the present invention for use in the treatment of cerebrovascular disorders.
[0289] 12. Toxicity / Pharmacological Efficacy Evaluation Method One aspect of the present invention includes a method for evaluating the toxicity or efficacy of a test substance, which comprises contacting a test substance with a cerebral organoid obtained by the method for producing cerebral organoids described in 2 above, or the cerebral organoid described in 3 above, or a cell population containing cerebral cortical cells obtained from these cerebral organoids, a cerebral cortical cell mass obtained by the method for producing a cerebral cortical cell mass described in 4 to 7 above, a cerebral cortical cell mass described in 8 or 9 above, or a cell population obtained by dispersing these cell masses, and detecting or quantifying the effect of the test substance on the cell mass or the cell population.
[0290] Cerebral organoids obtained by the method for producing cerebral organoids described in 2 above, or the cerebral organoids described in 3 above, or cell populations containing cerebral cortical cells obtained from these cerebral organoids, cerebral cortical cell masses obtained by the method for producing cerebral cortical cell masses described in 4 to 7 above, cerebral cortical cell masses described in 8 or 9 above, or cell populations obtained by dispersing these cell masses can be used as disease model cells for screening and evaluating the efficacy of therapeutic agents for diseases accompanied by cerebrovascular disorders or preventive agents for such diseases.
[0291] Furthermore, cerebral organoids obtained by the method for producing cerebral organoids described in 2 above, or the cerebral organoids described in 3 above, or cell populations containing cerebral cortical cells obtained from these cerebral organoids, cerebral cortical cell masses obtained by the method for producing cerebral cortical cell masses described in 4 to 7 above, cerebral cortical cell masses described in 8 or 9 above, or cell populations obtained by dispersing these cell masses can be used as healthy model cells in safety tests, stress tests, toxicity tests, side effect tests, infection or contamination tests of chemical substances, etc. Furthermore, since the cell masses or cell populations of the present invention contain cells of cortical layer V / VI tissue, they can also be used in functional tests of neural tissues containing these cells (e.g., cerebral cortex), specifically, functional evaluation of glutamatergic neurons, etc., and evaluation of the proliferation and differentiation potential of cerebral cortical cells.
[0292] The evaluation methods include stimulation / toxicity tests such as apoptosis evaluation, as well as tests to evaluate the effects of chemical substances on the differentiation, axonal outgrowth, and firing ability of cerebral cortical cells (RT-PCR of various gene markers, expression protein analysis using cytokine ELISA, etc., phagocytosis tests, patch clamp method, electrophysiological analysis using multi-electrode arrays (MEA), etc.). For example, the method can be used to search for compounds that promote or inhibit neuronal differentiation, axonal outgrowth, and firing ability, and to search for compounds, proteins, etc. that rescue disease-specific phenotypes in cells differentiated from iPS cells derived from patients with cerebrovascular disorders.
[0293] Furthermore, as cell materials for these tests, for example, a plate on which the cells of the cell aggregate of the present invention are dispersed and seeded and adhered, a cell suspension, a sheet thereof, or a molded product thereof can be provided.
[0294] Cerebral organoids obtained by the method for producing cerebral organoids described in 2 above of the present invention, or the cerebral organoids described in 3 above, or cell populations containing cerebral cortical cells obtained from these cerebral organoids, cerebral cortical cell masses obtained by the method for producing cerebral cortical cell masses described in 4 to 7 above, cerebral cortical cell masses described in 8 or 9 above, or cell populations obtained by dispersing these cell masses can be used as extrapolation tests for human and animal tests.
[0295] 13. Method for Assessing the Quality of Cerebral Organoids or Cerebral Cortical Cell Clusters (Including High-Purity Cerebral Cortical Cell Clusters) One embodiment of the present invention includes a method for assessing the quality of cerebral organoids or cerebral cortical cell clusters, comprising the following steps (aa) and (bb). Here, the cerebral cortical cell clusters include the high-purity cerebral cortical cell clusters of the present invention. (aa) Measuring the expression level of at least one or all genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2 in the cerebral organoids or cerebral cortical cell clusters; (bb) Evaluating that the amount of non-target cells contained in the cerebral organoids or cerebral cortical cell clusters is below the standard level based on the measurement results of step (aa).
[0296] Another aspect of the present invention is a method for evaluating the quality of cerebral organoids or cerebral cortical cell clusters, comprising the following steps (AA) and (BB): (AA) assessing the levels of NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, and TP53I1 in cerebral organoids or cerebral cortical cell clusters; 1. ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3. (BB) Based on the measurement results of step (AA), if the expression levels of the genes are equal to or greater than a reference value, evaluate that the amount of target cells contained in the cerebral organoid or the cerebral cortical cell mass is equal to or greater than a reference value.
[0297] The expression level of genes (i.e., the expression level of mRNA or protein) and the method for measuring it are as described above. The reference value of the expression level of each gene that serves as a marker for non-target cells, such as the genes described in (aa) above, can be, for example, a value measured in a cerebral organoid or cerebral cortical aggregate that serves as a specimen, and can be evaluated as being equal to or less than the reference value. In addition, the reference value of each gene that serves as a marker for target cells, such as the genes described in (AA) above, can be, for example, a value measured in a cerebral organoid or cerebral cortical aggregate that serves as a specimen, and can be evaluated as being equal to or greater than the reference value.
[0298] In one aspect of the present invention, a portion of the cell population of a cerebral cortical cell mass obtained by the method for producing a cerebral cortical cell mass described in 4 to 7 above is sampled and evaluated using the above-mentioned method for evaluating the quality of a cerebral organoid or cerebral cortical cell mass, and based on the evaluation results, a population of cerebral cortical cell masses in which the number of non-target cells is below a standard and / or the number of target cells is above a standard value can be selected (identified) as a population that can be used for transplantation.
[0299] One aspect of the present invention is a method for producing a cerebral cortical cell mass as described in 4 to 7 above, which further includes a method for evaluating the quality of the cerebral organoid or cerebral cortical cell mass.
[0300] That is, examples include methods for producing cerebral cortical cell masses, which include the following steps: (1) a step of producing a cerebral cortical cell mass by the production method described in 4 to 7; (2) a step of evaluating, using the above-mentioned quality evaluation method, whether the amount of target cells is above a standard and / or whether the amount of non-target cells is below a standard; and (3) a step of selecting or identifying cerebral cortical cell masses that can be used for transplantation based on the evaluation results of (2).
[0301] (Maintenance culture of human induced pluripotent stem cells (hiPSCs)) hiPSCs were cultured in a medium containing iMatrix-511 (Nippi Corporation), an E8 fragment of laminin 511, at a concentration of 0.5 μg / cm 2 The cells were added to a 6-well plate so that the total number of cells was 100, and the cells were maintained and cultured on the coated plate in StemFit (registered trademark) AK02N medium or AK03N medium (hereinafter sometimes referred to as "StemFit"; manufactured by Ajinomoto Healthy Supply Co., Inc.). For passage, the hiPSCs were treated with 0.5x Tryple Select at 37°C for 8 minutes to separate them into single cells, and then cultured at 1 to 1.5x10 4 Cells were seeded into 6-well plates at a cell density of 1000 kJ / well and passaged every 7 days.
[0302] (Immunostaining Analysis) Organoids were fixed with 4% paraformaldehyde for 30 minutes, dehydrated with 30% (w / v) sucrose in PBS, and embedded in O.C.T. Compound (Sakura Finetek). Frozen sections were prepared at a thickness of 16 μm using a cryostat (CM1850, Leica Biosystems). Permeabilization was performed with 0.3% or 2% (v / v) Triton-X100, and antigen retrieval was performed as needed. After blocking with BlockACE (KAC), double- or triple-labeling staining was performed. Primary and secondary antibodies used for immunostaining were used at the recommended dilution concentrations.
[0303] The primary and secondary antibodies used for immunostaining are shown below. L1CAM: 554273 (BD) Ctip2: ab18465 (Abcam) Pax6: EPR15858 (Abcam),561482 (BD) Foxg1: M227 (Takara) Ki67: NCL (Leica) Emx1: M196 (Takara) Gad65: 559931 (BD) Col1a1: AF6220 (R&D) TTR: A0002 (DAKO) TYR: MA5-14177 (Thermo Fisher) Alexa Fluor (registered trademark) 488 donkey anti-mouse IgG (H+L): A21202 (Thermo Fisher) Alexa Fluor (registered trademark) 647 donkey anti-mouse IgG (H+L): 1900251 (Thermo Fisher) Alexa Fluor (registered trademark) 594 donkey anti-rat IgG (H+L): 1979379 (Thermo Fisher) Alexa Fluor® 488 donkey anti-rabbit IgG (H+L): A21206 (Thermo Fisher) Alexa Fluor® 647 donkey anti-rabbit IgG (H+L): A32795 (Thermo Fisher) Alexa Fluor® 594 donkey anti-sheep IgG (H+L): A11016 (Thermo Fisher)
[0304] (Microscopy and Image Analysis) Images (bright field images) of organoids in culture were taken with a digital inverted microscope (Leica Biosystems, DMS1000). Confocal fluorescence microscopy images were taken with an LSM800 confocal microscope (Zeiss) and analyzed with ZENBlue image processing software.
[0305] (Flow cytometry) Cerebral organoids, cerebral cortical cell clusters, and high-purity cerebral cortical cell clusters were dispersed into single cells using a nerve cell dispersion solution (Fujifilm Wako Pure Chemical Industries), fixed using Fixation Buffer (BD Biosciences) at 4 ° C for 30 minutes, then treated with Perm / Wash buffer (BD Biosciences) at room temperature for 15 minutes, double or triple stained, and analyzed using Aria III. Analysis software used was FACSDiva software (BD). The primary and secondary antibodies used are shown below. PerCP-Cy5.5 Mouse IgG1 k isotype control: 550795 (BD Biosciences) Alexa 647 Mouse Anti-human Oct3 / 4 antigen: 560329 (BD Biosciences) Tra-2-49 / 6E-FITC antibody : FCMAB133F (Merck) Alexa647 mouse anti β-tubulin Class III: 560394 (BD) PerCP-Cy5.5 Mouse anti-Human Sox1: 561549 (BD) Alexa647 mouse anti-Human Pax6: 561165(BD) Alexa488 mouse anti-Ki67: 562249 (BD) Alexa488 rat anti-Ctip2 antibody: ab123449 (Abcam)
[0306] (Gene Expression Analysis by Quantitative Reverse Transcription PCR (RT-qPCR)) Total RNA was obtained using RNeasy MicroKit (QIAGEN), and reverse transcription was performed using the SuperScript III First-Strand Synthesis System (QIAGEN) according to the manufacturer's protocol. Quantitative PCR was performed using TaqMan™ Gene Expression Master Mix (Thermo Fisher) or SYBR Green Master Mix (Thermo Fisher) according to the manufacturer's instructions. Gene expression levels were normalized to GAPDH using the ΔΔCt method.
[0307] The primer sets and Taqman probes used are shown below. Oligo DNA primers POU5F1: Forward: AGACCATCTGCCGCTTTGAG (SEQ ID NO: 1) Reverse: GCAAGGGCCGCAGCTT (SEQ ID NO: 2) NANOG: Forward: GGCTCTGTTTTGCTATATCCCCTAA (SEQ ID NO: 3) Reverse: CATTACGATGCAGCAAATACGAGA (SEQ ID NO: 4) BMP4: Forward: ATGATTCCTGGTAACCGAATGC (SEQ ID NO: 5) Reverse: CCCCGTCTCAGGTATCAAACT (SEQ ID NO: 6) NODAL: Forward: TGAGCCAACAAGAGGATCTG (SEQ ID NO: 7) Reverse: TGGAAAATCTCAATGGCAAG (SEQ ID NO: 8) TGFB1: Forward: TACCTGAACCCGTGTTGCTCTC (SEQ ID NO: 9) Reverse: GTTGCTGAGGTATCGCCAGGAA (SEQ ID NO: 10) SOX1: Forward: GCGGAGCTCGTCGCATT (SEQ ID NO: 11) Reverse: GCGGTAACAACTACAAAAAACTTGTAA (SEQ ID NO: 12) PAX6: Forward: CTGGCTAGCGAAAAGCAACAG (SEQ ID NO: 13) Reverse: CCCGTTCAACATCCTTAGTTTATCA (SEQ ID NO: 14) T (TBXT): Forward: ATGGAGGAACCCGGAGACA (SEQ ID NO: 15) Reverse: TGAGGATTTGCAGGTGGACA (SEQ ID NO: 16) SOX17: Forward: CGCTTTCATGGTGTGGGCTAAGGACG (SEQ ID NO: 17) Reverse: TAGTTGGGGTGGTCCTGCATGTGCTG (SEQ ID NO: 18) hCGalpha: Forward: ACCGCCCTGAACACATCCTGC (SEQ ID NO: 19) Reverse: GCGTGCATTCTGGGCAATCCTGC (SEQ ID NO: 20) SOX2: Forward: GCCGAGTGGAAACTTTTGTCG (SEQ ID NO: 21) Reverse:GGCAGCGTGTACTTATCCTTCT (SEQ ID NO: 22) Taqman probe SLC17A7: Hs01574213 EMX1: Hs00417957 GAD2: Hs00609536 DLX2: Hs00269993 TTR: Hs00174914 COL1A1: Hs00164004 TYR: Hs00165976 HOXA2: Hs00534579
[0308] <Preliminary Test 1> Induction of differentiation into neurons of pluripotent stem cells maintained and cultured in the presence or absence of feeder cells Human embryonic stem cells (hESCs) or human iPS cell lines (hiPSCs) were induced to differentiate into neurons in the presence (on feeder) or absence (feeder-free) of feeder cells, and the resulting spherical cell aggregates were analyzed to compare the efficiency of differentiation induction into cerebral organoids.
[0309] Human ES cells KhES-1 and KhES-2 were obtained from the Institute for Frontier Medical Sciences, Kyoto University, and human iPS cell lines 201B7 cells, 1231A3 cells, and Ff-I01s04 cells were obtained from Kyoto University.
[0310] In the case of the on-feeder system, mouse embryonic fibroblasts (MEF, Oriental Yeast) were used as feeder cells. Various stem cell lines, such as KhES-1, were cultured at 1.2 × 10 cells per 90 mm dish. 6 The cells were seeded at a density of 1000 μg / ml and cultured in the presence of MEFs in DMEM / F12 medium containing 1% (v / v) NEAA, 1% (v / v) L-Glutamine, 1% (v / v) 2-Mercaptoethanol, and 20% (v / v) KSR, supplemented with 5 ng / ml bFGF at 37°C and 5% CO 2 For feeder-free culture, various stem cell lines were cultured in StemFit (Ajinomoto Healthy Supply Co., Ltd.) on a 6-well plate coated with iMatrix-511 (Nippi Co., Ltd.) as a matrix at 37°C and 5% CO. 2 The cells were maintained in a culture medium at RT for 7 days.
[0311] After maintenance culture, the cells were induced to differentiate into cerebral organoids using a modified version of the method described in Non-Patent Document 1. At the start of differentiation, various pluripotent stem cells were treated with 0.5x TrypLE Select and dispersed into single cells. The medium was then replaced with a differentiation medium (described below) supplemented with 50 μM Y-27632 (Fujifilm Wako Pure Chemical Industries, Ltd.), and the cells were seeded at 9,000 cells / well into a non-cell-adsorbent V-bottom 96-well plate (Sumitomo Bakelite). The differentiation medium was DMEM / F-12 GlutaMAX medium (Gibco) supplemented with 20% (v / v) KSR, 5 μM SB431542 (TGFβ inhibitor; TOCRIS), and 3 μM IWR1e (Wnt inhibitor; Calbiochem). From day 3 to day 15 of differentiation, half of the medium was replaced every three days using differentiation medium. On day 18, the aggregated cells were transferred to a 90 mm suspension culture dish (Sumitomo Bakelite) and further cultured in DMEM / F-12 GlutaMAX (Gibco) supplemented with 1% (v / v) N2-supplement (Gibco), 1% (v / v) Chemically defined lipid concentrate (CDLC; Gibco), 0.25 μg / ml Amphotericin B (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin until day 35 after the start of differentiation induction. The entire medium was replaced every three days until day 35.
[0312] Among the spherical cell aggregates obtained 33 to 35 days after differentiation induction (Day 33-35), if the number percentage of cerebral organoids was approximately 5% or more, it was judged as "cerebral organoid formation (good organoid)", and if it was less than 5%, it was judged as "cerebral organoid non-formation (bad organoid)". An example of a good organoid is shown in Figure 1 (A) (201B7 strain), and an example of a bad organoid is shown in Figure 1 (B) (Ff-I01s04 strain). The arrow in (A) indicates the rosette structure. The results for each cell line are summarized in Table 1 below.
[0313] The numbers in the table represent the number of experiments in which differentiation induction was performed (the denominator) and the number of times cerebral organoids were formed (the numerator). For example, "1 / 3" indicates that differentiation induction was performed three times and cerebral organoids were formed only once. For all ES or iPS cell lines, it was confirmed that the efficiency of cerebral organoid formation was lower in the feeder-free case than in the on-feeder case.
[0314] <Preliminary Test 2> Analysis of Gene Expression As in Preliminary Test 1, KhES-1, 201B7, Ff-I01s04, and 1231A3 cell lines were cultured and induced to differentiate under three conditions: on feeder, feeder-free, and feeder-conditioned medium. For the feeder-conditioned medium condition, MEFs were cultured for 24 hours in DMEM / F12 medium containing 1% (v / v) NEAA, 1% (v / v) L-Glutamine, 1% (v / v) 2-Mercaptoethanol, and 20% (v / v) KSR, and the culture supernatant was collected, filtered, and used for feeder-free cell culture. The expression of FGF2 and TGFβ pathway-related genes (FGF2, LEFTY, NODAL, TGFβ1, Activin) in the resulting cells before and after differentiation induction after culture was analyzed by microarray.
[0315] Microarray analysis was performed on four iPS cell lines (KhES1, 201B7, 1231A3, Ff-I01s04) cultured under three conditions: on feeder, feeder-free, and MEF conditioned medium. RNA was extracted using TaKaRa's NucleoSpin RNA Plus XS according to the established protocol, and gene expression analysis was performed using a Clariom S (Applied Biosystems) microarray. Analysis of gene expression levels was performed using Transcriptome Viewer (Kurabo).
[0316] The analysis results are shown in Figure 2. Figure 2 (A) shows the results after culture before differentiation induction, and shows the results of comparative analysis of gene expression using microarrays for four cell lines cultured on a feeder (horizontal axis) or a feeder-free (vertical axis) culture (n indicates the type of cell line). Compared to the feeder-free culture group, the on-feeder culture group had more than two-fold higher expression of FGF2 and TGFβ pathway-related genes (FGF2, LEFTY, NODAL, TGFβ1, Activin).
[0317] Figure 2 (B) shows the results of comparative analysis of gene expression between the two groups in which iPS cells were induced to differentiate under three conditions, namely, on-feeder, feeder-free, and feeder-conditioned medium, using four types of cell lines according to Preliminary Test 1, and dividing the conditions into those in which cerebral organoids were formed (good organoid; horizontal axis) and those in which they were not (bad organoid; vertical axis) (n indicates the number of conditions in which cerebral organoid formation efficiency was high). In the group that formed cerebral organoids, expression of FGF2 and TGFβ pathway-related genes (FGF2, LEFTY, NODAL, TGFβ1, Activin) was higher than in the group that did not form cerebral organoids. It was found that the expression of endogenous bFGF- and TGFβ-related genes was high in undifferentiated stem cells maintained in culture on a feeder and in which cerebral organoid formation efficiency was high. In other words, it was revealed that the expression levels of bFGF- and TGFβ-related genes in pluripotent stem cells were high in ES / iPS cells and culture conditions that facilitate the formation of cerebral organoids.
[0318] The compositions of known maintenance media for human pluripotent stem cells are shown in Table 2 below. It can be seen that high concentrations of bFGF and TGFβ are usually added to feeder-free maintenance media. It was suggested that ES / iPS cells cultured in these media had lower expression of bFGF- and TGFβ-related genes compared to cultured on a feeder. Therefore, it is possible that differences in the expression levels of bFGF- and TGFβ-related genes are responsible for the differences in cerebral organoid formation efficiency.
[0319] Therefore, the present inventors searched for compounds that could affect the formation efficiency by culturing ES / iPS cells in the presence of various compounds, then inducing their differentiation into neurons, and analyzing the efficiency of cerebral organoid formation. Surprisingly, they found that the efficiency of cerebral organoid formation was significantly improved when iPS cells were cultured in a "medium that does not contain bFGF and does not contain TGFβ or that contains a TGFβ signaling inhibitor" (step (1)) and then induced to differentiate into neurons (step (2)).
[0320] Example 1: Effect of step (1) on organoid formation efficiency 1-1. Maintenance medium for step (1) Steps (1) and (2) were performed according to the scheme shown in Figure 3 or Figure 5. Maintenance culture of human iPS cells (S2WCB1 strain, S2WCB3 strain) was performed in StemFit medium on a 6-well plate coated with iMatrix-511 (feeder-free).
[0321] The medium was replaced with either (1) StemFit C-free medium (i.e., bFGF-free medium) supplemented with 5 μM SB431542 (FIG. 3), or (2) Essential 6 medium (i.e., bFGF-free, TGFβ-free medium) (FIG. 5), and adherent culture was performed for 1 day.
[0322] In step (2a), differentiation into neurons was induced in serum-free medium using the method described by Sakaguchi et al. (Stem Cell Reports, 13:458-473, 2019. doi: 10.1016 / j.stemcr.2019.05.029.) Specifically, the human iPS cells cultured in step (1) were dispersed into single cells by enzymatic treatment. The dispersed human iPS cells were seeded (9,000 cells / well / 100 μL) into a non-cell-adhesive 96-well culture plate (PrimeSurface 96V-bottom plate, manufactured by Sumitomo Bakelite Co., Ltd.) and cultured in Glasgow MEM (GMEM; Thermo Fisher) medium (hereinafter also referred to as 20GMK) supplemented with 0.1 mM non-essential amino acids, 1 mM pyruvate, 0.1 mM 2-mercaptoethanol, 20% (v / v) KnockOut™ serum replacement, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C in 5% CO in a medium supplemented with SB431542 (TGFβ signaling inhibitor; Tocris) and 3 μM IWR1e (Wnt signaling inhibitor; Calbiochem). 2 The cells were cultured in suspension for 18 days at 100°C for 18 days. The medium was changed every 3 days. Y-27632 was added to a concentration of 50 μM on Day 0, and was not added during subsequent medium changes. Cell masses were obtained after the culture.
[0323] Step (2b) On Day 18, the obtained cell masses were transferred to a 90 mm dish and cultured in DMEM / F12 / GlutaMAX medium supplemented with 1x N2 supplement (Thermo Fisher), Chemically Defined Lipid Concentrate (Invitrogen), 0.25 mg / mL fungizone (Gibco), 1% penicillin / streptomycin, and 0.1% amphotericin B at 37°C under 20% O 2 , 5% CO 2 Then, shaking culture was performed using an Orbital Shaker from Day 35 to Day 42. The medium was changed every 3 to 4 days.
[0324] The cell cultures on Day 35 were observed using an inverted microscope, and representative images are shown in Figure 4(A). The cell cultures were also subjected to fluorescent immunostaining for each marker (L1CAM, CTIP2, and PAX6). The primary antibodies and their corresponding fluorescently labeled secondary antibodies were used for the fluorescent immunostaining. Nuclei were also stained with DAPI. Representative fluorescent staining images (confocal fluorescent microscope images) are shown in Figure 4(B).
[0325] The formation efficiency (%) of cerebral organoids was calculated using the following formula.
[0326] In step (1), when cells were maintained in bFGF-free StemFit medium supplemented with SB431542 (hereinafter sometimes referred to as SB) (StemFit - bFGF + SB), cell clusters with multiple distinct rosette structures (far right in (B)) were observed. A Pax6-positive neural progenitor cell layer (radial glial cells) was localized inside the cerebral cortex-like structure, and a neuronal cell layer expressing Ctip2 and L1CAM was observed outside. Furthermore, when maintenance culture (step (1)) was performed in bFGF-free medium ("StemFit -bFGF" or "StemFit -bFGF + SB"), the formation efficiency of cerebral organoids ("StemFit -bFGF" in the case of <10%, "StemFit -bFGF + SB" in the case of approximately 40% to 50%) was significantly increased compared to maintenance culture in bFGF-containing medium (StemFit, <1%). In step (1), maintenance culture was performed using Essential 6 (E6) medium supplemented with SB431542 as the medium, and differentiation was induced in the same manner as above. Immunostaining was performed in the same manner as above, and confocal fluorescence microscope images of representative cell clusters are shown in Figure 6. As can be seen from Figure 6, when E6 medium supplemented with SB431542 was used, cerebral organoids were obtained in the same manner as StemFit medium supplemented with SB431542. In addition, the efficiency of cerebral organoid formation (%) = (22 / 39) × 100% = 56.9%.
[0327] 1-2. Additives in the maintenance medium in step (1) In step (1) of the scheme in Figure 3, cells were cultured in a medium containing the following additives from Day 1 to Day 0, induced to differentiate into neurons on Day 0, and evaluated for cerebral organoid formation efficiency on Day 35. The results of immunostaining are shown in Figure 7, and the cerebral organoid formation efficiency is shown in Table 3. Note that "none" in Figure 7 means no additives were used.
[0328] In experimental groups using bFGF-containing medium, the efficiency of cerebral organoid formation was low, regardless of the type of additive. Even in the group with SB431542, the efficiency was low, at less than 5% (Exp. C). In contrast, in the groups using bFGF-free medium, only the group with SB431542 added produced cerebral organoids with numerous rosette structures at a high efficiency (Exp. D). In the group with IWR1e added, abnormal cell cultures were observed, in which neuroepithelium and neurons were generated but no cerebral cortex-like structure was formed (Exp. F). A Pax6-positive neural progenitor cell layer (radial glial cells) was localized inside the cerebral cortex-like structure observed in Exp. D, and a neuronal cell layer expressing Ctip2 and L1CAM was observed outside.
[0329] The results of Example 1 show that when human pluripotent stem cells are cultured in a "medium containing no bFGF and no TGFβ or containing a TGFβ signaling inhibitor" and then induced to differentiate into neurons, the efficiency of cerebral organoid formation is significantly improved. Therefore, it has become clear that when pluripotent stem cells are cultured in a "culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling" and then induced to differentiate into neurons, the efficiency of cerebral organoid formation is significantly improved.
[0330] Example 2: Culture Period in Step (1) In Example 1 (1), in an experimental system using a "bFGF-free SB431542-supplemented medium" in which 5 μM SB431542 was added to StemFit Solution C-free medium, iPS cells were cultured in the "bFGF-free SB431542-supplemented medium" for the period shown in the table below. Figure 8 shows representative bright-field images of cultures on Day 18, Day 27, and Day 34. Figure 9 shows the results of analyzing the efficiency of cerebral organoid formation on Day 35.
[0331] As shown in Figures 8 and 9, when treated with "bFGF-free SB431542-supplemented medium" for 1 or 2 days, the efficiency of cerebral organoid formation was about 30% to 40%, but when treated for 3 days or more, almost no cerebral organoid formation was observed. Under the condition of treatment with "bFGF-free SB431542-supplemented medium" for 6 days, the proliferation of iPS cells was significantly reduced, and it was not possible to obtain a sufficient number of cells for differentiation induction. Therefore, it was revealed that the culture period in step (1) is preferably less than 3 days, more preferably 12 hours to 2 days, and most preferably about 1 day.
[0332] Example 3: Effect of step (1) on gene expression In an experimental system using a "bFGF-free SB431542-supplemented medium" prepared by adding 5 μM SB431542 to StemFit Solution C-free medium in Example 1 (1), gene expression analysis of human iPS cells (S2WCB1) was carried out on Day 0. Control iPS cells were cultured in StemFit medium (bFGF-containing medium), a regular maintenance medium.
[0333] The expression of various marker genes in organoids obtained after three rounds of differentiation induction was analyzed by RT-qPCR. The results of the gene analysis are shown in Figure 10. Each dot represents a sample from each round. Organoids (Control) induced to differentiate from iPS cells cultured in StemFit medium (bFGF-containing medium), a standard maintenance medium, are shown as black circles, while organoids induced to differentiate after culture in StemFit (-bFGF, +TGFβ inhibitor) are shown as white circles. The vertical axis represents the relative expression level of GAPDH and Control, corrected for one lot using the ΔΔCt method. "TGFβi" in the figure refers to TGFβ inhibitor.
[0334] 10 shows that iPS cells (open circles) that underwent step (1) (1 day) showed lower expression levels of undifferentiated markers (POU5F1, NANOG) and higher expression levels of neuroectodermal markers (SOX1, PAX6), mesodermal marker (TBXT), and endodermal marker (SOX17) compared to control cells (filled circles). In the figure, "T" stands for TBXT (also known as BRACHYURY).
[0335] This suggests that step (1) may change iPS cells to a state where they are more likely to differentiate into the three germ layers. That is, it suggests that culturing pluripotent stem cells for an appropriate period in a "culture medium that is substantially free of bFGF and does not substantially induce TGFβ signaling" leads to a state where they are more likely to differentiate into the three germ layers.
[0336] Example 4 Effect of steps (ii)-(iv) of step (2) 1: Increase in neurons in layers V / VI and decrease in proliferating cells 4-1. Occurrence of dispersion and reaggregation - From Day 7 to Day 35, culture was performed in the same manner as in Example 1. For step (1), (1) StemFit medium without solution C (medium without bFGF) supplemented with 5 μM SB431542 was used.
[0337] As shown in the scheme of FIG. 11(A), in step (ii), cerebral organoids were selected on day 33 after the start of differentiation induction, and the medium was replaced with the medium in step (2b) supplemented with 10 μM DAPT. The culture medium was then incubated at 37° C., 5% CO 2The cells were cultured in suspension under 5% CO₂ for 3 days, yielding cerebral cortical cell clusters.
[0338] In step (iii), the cerebral cortical cell mass obtained in step (ii) above was incubated at 37°C for 20 minutes in a 0.5x TrypLE Select, 0.25 mM EDTA solution, and further incubated at 37°C for 10 minutes in a solution prepared by adding 25 U / mL DNase I to the medium of step (2b). Thereafter, the cells were dispersed into single cells by pipetting, and the dispersed cells were suspended in a medium prepared by adding 10 ng / mL GDNF, 20 ng / mL BDNF, 200 µM ascorbic acid, 400 µM dibutylyl-cAMP, and 50 µM Y-27632 to the medium of step (2b).
[0339] In step (iv), the cell suspension obtained in step (iii) is dispensed into a non-cell-adhesive 96-well plate at 30,000 cells / well, and incubated at 37°C, 5% CO 2 The cells were cultured in suspension for 4 days under a constant temperature. This resulted in the production of highly purified cerebral cortical cell clusters. Bright-field images of the cerebral cortical cell clusters (Day 36) and the highly purified cerebral cortical cell clusters (Day 40) are shown in Figure 11 (B).
[0340] The cerebral cortical cell clusters (Day 36) and the highly purified cerebral cortical cell clusters (Day 40) were further immunostained for Ctip2, a marker for cortical layer V / VI progenitor cells (Deep Layer), Foxg1, a telencephalon marker, Pax6 / Ki67, a neural stem cell (Radial Glia) marker, and Ki67, a proliferative cell marker.
[0341] Representative confocal fluorescence microscope images of immunostaining are shown in Figure 12. The upper row of Figure 12(A) shows an immunostaining image of a cerebral cortical cell mass on Day 36 without DAPT, and the lower row shows an immunostaining image of a cerebral cortical cell mass on Day 36 with DAPT (both obtained via steps (i)-(ii)), and Figure 12(B) shows an immunostaining image of a highly purified cerebral cortical cell mass on Day 40 (obtained via steps (i)-(iv)).
[0342] In the group cultured up to Day 36 without DAPT treatment (upper row of (A)), a cerebral cortex-like layer structure was confirmed, with a Pax6 / Ki67-positive neural stem cell (radial glia) layer, which is characteristic of cerebral organoids, and a Ctip2 / Foxg1 double-positive cortical V / VI layer neuronal layer outside it. In contrast, in the group treated with DAPT (lower row of (A)), Pax6-positive cells were observed, but Ki67 expression was hardly observed, and a cerebral cortex-like layer structure was not observed. On the other hand, Ctip2 / Foxg1-positive cells were observed throughout the cell mass. Therefore, in the cerebral cortical cell mass, the cerebral cortex-like layer structure disappeared, and it became clear that Ctip2 / Foxg1 double-positive cortical V / VI layer neuronal cells were widely distributed inside.
[0343] Furthermore, in a highly purified cerebral cortical cell cluster (Figure 12(B)), obtained by dispersing a cerebral cortical cell cluster into single cells and then reaggregating them, Ctip2 / Foxg1 double-positive neurons in cortical layer V / VI were observed throughout the cluster, and Pax6-positive cells were even fewer.
[0344] 4-2. No Dispersion or Reaggregation Next, the proportion of constituent cells in the cell culture immediately after DAPT treatment (immediately after step (ii)) was analyzed using flow cytometry. The differentiation induction scheme is shown in Figure 13. Day 40 cerebral organoids were treated with DAPT for 3 days, and then the expression of marker genes was analyzed by flow cytometry.
[0345] The results of flow cytometry analysis of the expression of Ctip2, a marker for cortical layer V / VI progenitor cells (Deep Layer), βIII-Tubulin (βTubIII), a neuronal marker, Pax6 / Sox1 / Ki67, a neural stem cell (Radial Glia) marker, and Ki67, a proliferative cell marker, are shown in Figure 14.
[0346] Each dot in Figure 14 represents a cell. The left and center panels show the results for all live cells, while the right panel shows only Ki67-positive cells. The percentage of Ctip2 / βIII-Tubulin double-positive cells (left panel) was 36.4% in the DAPT-untreated group (top row) but increased to 86.1% in the DAPT-treated group (bottom row). In contrast, the percentage of Pax6 / Ki67 double-positive neural stem cells (radial glia) (middle panel) was 46.7% in the DAPT-untreated group (top row) but decreased to 1.5% in the DAPT-treated group (bottom row). Furthermore, the percentage of proliferating cells, Pax6-positive / Sox1-positive / Ki67-positive cells (right panel), was 0.68% in the DAPT-untreated group (top row) but decreased to 0.01% in the DAPT-treated group (bottom row).
[0347] Therefore, it was revealed that when cerebral organoids were cultured in the presence of DAPT, a Notch signal inhibitor, the cerebral cortex-like structure disappeared and the number of proliferative cells was significantly reduced, while the number of neurons (especially neurons in cortical layers V / VI) increased.
[0348] Furthermore, iPS cells on Day 0 (undifferentiated iPS cells), organoids not treated with DAPT (Ctrl, without step (ii)), organoids treated with DAPT for 3 days (Days 40-43) (DAPT3d, with step (ii)), and organoids treated with DAPT for 3 days and then cultured as cell clumps in a medium from which DAPT had been removed for 4 days without dispersing the cells (DAPT3d+Release4d, with steps (ii) and (iv), without step (iii)). These organoids were analyzed by flow cytometry, and the results are shown in Figure 15.
[0349] In Figure 15, the first to fourth columns from the left show the results of displaying all live cells, and the rightmost panel shows the results of displaying only Ki67-positive cells. Co-expressing cells of Tra2-49 / 6E and Oct4, which are indicators of undifferentiated iPS cells, were not detected in organoids under any conditions (first column from the left). Ctip2 and βIII-Tubulin co-positive cells were 36.4% in "Ctrl" (second row from the top), 86.1% in "DAPT3d" (third row from the top), and 87.4% in "DAPT3d + Release4d" (bottom row) (second column from the left). Furthermore, Ki67, Sox1, and Pax6 triple-positive cells were 0.68% in "Ctrl," but reduced to 0.01% in "DAPT3d," and to 0% in "DAPT3d + Release4d" (first column from the right). The percentage of Pax6-positive, Sox1-positive, and Ki67 triple-positive cells was even lower in "DAPT 3d + Release 4d" than in "DAPT 3d," demonstrating that simply culturing cell aggregates after DAPT treatment can reduce proliferative cells.
[0350] Organoid DAPT Method and Single-Cell DAPT Method (2) To analyze the effect of DAPT treatment duration on differentiation, cerebral organoids at week 7 of differentiation induction were treated with 10 μM DAPT for 3 to 7 days according to the method scheme (organoid DAPT method) shown in Figure 16(A), and changes in gene expression were analyzed by RT-qPCR. The results are shown in Figure 16(B). The vertical axis represents the expression level relative to GAPDH.
[0351] Figure 16(B) shows that the longer the DAPT treatment period, the more advanced the maturation and the fewer the proliferative cells. The expression of Ctip2, a marker for cortical layer V / VI progenitor cells, increased with the DAPT treatment period. Meanwhile, the expression of Pax6, Sox2, and Ki67, markers for neural progenitor cells (radial glial cells), decreased with the DAPT treatment period. These results demonstrate that DAPT treatment promotes neural differentiation and maturation and reduces the proportion of proliferative cells.
[0352] Example 5: Study on the timing of step (ii) Figure 17(A) shows the differentiation induction scheme. Organoids on Day 25, Day 32, Day 39, and Day 72 (differentiation induction periods were approximately 4 weeks, 5 weeks, 6 weeks, and 10 weeks, respectively) were cultured for 3 days in the presence or absence of DAPT, and organoids on Day 28 (4 weeks), Day 42 (6 weeks), and Day 75 (10 weeks) were analyzed by immunostaining for various markers. The results of immunostaining (confocal fluorescence microscope images) are shown in Figure 17(B). Satb2 is a marker for cortical layer II-IV progenitor cells (upper layer). 17(B) shows that in 4- to 6-week-old organoids, in the absence of DAPT, rosette structures consisting of Ctip2- and Bf1-positive cells and Ki67-positive cells were observed, but after DAPT treatment, the rosette structures were no longer observed, Ctip2- and Bf1-positive cells increased, and Ki67-positive cells decreased. In 10-week-old organoids, the rosette structures became unclear after DAPT treatment, but no significant changes were observed in the proportions of Ctip2-positive cells and Satb2-positive cells.
[0353] Furthermore, organoids on Day 25, Day 32, Day 39, and Day 72 (each differentiation induction period is approximately 4 weeks, 5 weeks, 6 weeks, 10 weeks) were cultured for 3 days in the presence or absence of DAPT, and the expression levels of marker genes were analyzed by RT-qPCR for cerebral organoids on Day 28 (4wk), Day 35 (5wk), Day 42 (6wk), and Day 75 (10wk). The analysis results of the relative expression levels of each marker are shown in Figure 18. From Figure 18, it was found that in organoids aged 4 to 6 weeks, there was a tendency for increased expression of Ctip2 after DAPT treatment, and decreased expression of Pax6 and Ki67. In organoids aged 10 weeks, there was no decrease in Ki67 expression, and no effect on Satb2 expression was observed.
[0354] The above results revealed that the timing for starting step (ii) is preferably about 20 to 44 days after the start of differentiation induction (Day 20 to Day 44), more preferably Day 25 to Day 39. It was also revealed that the period for step (ii) is preferably about 2 to 4 days, more preferably about 3 days (e.g., 60 to 84 hours).
[0355] Example 6 Effect 2 of Steps (ii)-(iv) of Step (2): Inhibitory effect on graft growth Cerebral cortical cell clusters obtained by the differentiation induction scheme of Figure 17(A) were stereotactically transplanted into the brains of Scid mice (CLEA Japan) at a density of 1.5 x 10 5 Three months after cell transplantation, the brains were perfusion-fixed with 4% paraformaldehyde and 35-μm-thick frozen sections were prepared. Human cell engraftment was evaluated using the brain sections by immunostaining for Ku80. Representative confocal fluorescence microscopy images of immunostained grafts are shown in Figure 19.
[0356] Furthermore, the analysis results of the stained graft volume are shown in Figure 20. The graft volume was calculated by observing immunostained brain sections at intervals of 350 μm, calculating the graft area from the Ku80 stained image for each section, and multiplying the area and the interval between sections. One-way ANOVA (Tukey Multiple Test) was used to test (****p<0.0001, **p<0.01).
[0357] Figures 19 and 20 show that the cerebral cortical cell clusters obtained by performing step (ii) approximately 5 or 6 weeks after the start of differentiation induction had a higher engraftment rate after transplantation into the brain and also showed a very small increase in volume compared to cerebral cortical cell clusters obtained without performing step (ii).
[0358] Therefore, it was revealed that cerebral cortical cell masses formed by culturing cerebral organoids induced to differentiate from pluripotent stem cells in the presence of DAPT and then culturing them in a culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator have a high engraftment rate after transplantation into the brain and are less likely to expand (cell proliferation).
[0359] Based on Examples 1 to 6, a method according to a preferred embodiment of the present invention is shown in Figure 21. A preferred method for producing cerebral organoids from pluripotent stem cells in the absence of feeder cells comprises the following steps: Step (1): culturing pluripotent stem cells in a culture medium that is substantially free of bFGF and that does not substantially induce TGFβ signaling; Step (2): inducing the differentiation of the cells obtained in Step (1) into cerebral organoids.
[0360] Step (2) comprises the following steps: Step (2a): Suspension-culturing the cells obtained in Step (1) in a culture medium containing a TGFβ signaling inhibitor and a Wnt signaling inhibitor to obtain cell clusters; Step (2b): Suspension-culturing the cell clusters obtained in Step (2a) in a culture medium substantially free of a TGFβ signaling inhibitor or a Wnt signaling inhibitor to obtain cerebral organoids.
[0361] A preferred method for producing a cerebral cortical cell cluster, and further a highly purified cerebral cortical cell cluster, from pluripotent stem cells in the absence of feeder cells comprises the following steps: step (i): obtaining a cerebral organoid by a method comprising step (2) or a method comprising steps (1) and (2), step (ii): culturing the cerebral organoid obtained in step (i) in a culture medium containing a Notch signal inhibitor (DAPT or the like) to obtain a cerebral cortical cell cluster, step (iii): dispersing the cell culture that has undergone step (ii) into single cells or clusters of 2 to 5 cells (cell clumps), and step (iv): culturing the cells obtained in step (iii) in a culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator to obtain a highly purified cerebral cortical cell cluster.
[0362] Furthermore, even if step (iii) is skipped and the cell culture that has been subjected to step (ii) is cultured in the culture medium of step (iv), a highly pure cerebral cortical cell mass can be obtained.
[0363] Example 7: Examination of the effect of DAPT on organoids induced with neural differentiation preparation - From Day 7 to Day 35, the organoids were cultured using the same method as the scheme in Figure 3 of Example 1. In the "neural differentiation preparation" (with step (1)), StemFit C-free medium (= bFGF-free medium) supplemented with 5 μM SB431542 was used in step (1), and in the "no neural differentiation preparation" (without step (1)), StemFit medium was used. Then, cerebral cortical cell clusters were induced using the method described in step (ii) of Example 4, and evaluated by immunostaining. Furthermore, after dispersion into single cells using the method described in steps (iii) and (iv) of Example 4, the cells were re-aggregated, and high-density cerebral cortical cell clusters were induced and analyzed by flow cytometry.
[0364] Representative confocal fluorescence microscopy images of immunostaining are shown in Figure 22. Even without neural differentiation preparation, a cerebral cortex-like structure was formed, albeit with low efficiency, with Pax6-positive neuroepithelium and a Ctip2-positive cortical layer V / VI neuronal cell layer outside it. When this organoid was treated with DAPT, Ctip2-positive cells were observed throughout the cell mass, as in the case of neural differentiation preparation.
[0365] The results of flow cytometry analysis are shown in Figure 23. As shown in Figure 23, even without neural differentiation preparation, the percentage of Ctip2 / βTubIII double-positive cells (left panel) increased from 22.5% to 85.9% by DAPT treatment. Furthermore, the percentage of Pax6 / Ki67 double-positive neural stem cells (radial glia) (middle panel) decreased from 59.5% to 1.9% by DAPT treatment. Furthermore, the percentage of proliferative cells, Pax6-positive / Sox1-positive / Ki67-positive cells (right panel), decreased from 14.5% to 0% by DAPT treatment.
[0366] Therefore, regardless of whether or not neural differentiation preparation was performed, in the cerebral cortical cell mass, not only the cerebral cortex-like structure but also the neuroepithelium disappeared, and Ctip2-βTubIII double-positive cortical layer V / VI neurons were widely distributed inside, and proliferative cells were reduced. That is, based on Example 7, in the absence of supporting cells, it was found that even if the above step (1) of the method for producing cerebral organoids from pluripotent stem cells is omitted, cerebral cortical cell masses and high-density cerebral cortical cell masses can be produced.
[0367] Example 8 Optimization of the Timing and Method of DAPT Treatment 8-1. Organoid DAPT Method and Single Cell DAPT Method (1) - From Day 7 to Day 35, the cells were cultured in the same manner as in Example 1. In step (1), StemFit medium without solution C (i.e., medium without bFGF) supplemented with 5 μM SB431542 was used.
[0368] In Figure 24 (A) "Organoid DAPT method (when DAPT treatment is performed in step (ii))," cerebral organoids were selected 35 days after the start of differentiation induction, and the medium was replaced with the medium used in step (2b) supplemented with 10 μM DAPT, followed by suspension culture at 37°C and 5% CO2 for 3 days. The cerebral cortical cell clusters thus obtained were dispersed into single cells by the method described in steps (iii) and (iv) of Example 4, and then reaggregated to obtain highly purified cerebral cortical cell clusters.
[0369] 24 (B) "single cell DAPT method (when DAPT treatment is performed in step (iv))" in Figure 24, cerebral organoids were selected on the 38th day after the start of differentiation induction, and then dispersed into single cells by the method described in step (iii) of Example 4, the cells, step (2b) medium containing 10 ng / mL GDNF, 20 ng / mL BDNF, 200 μM Ascorbic Acid, 400 μM dibutylyl-cAMP, 30 μM Y-27632 in the medium, DAPT was added at a concentration of 0 μM, 0.1 μM, 1 μM, or 10 μM and suspended. Then, in the presence of DAPT, reaggregation was performed by the method described in step (iv) of Example 4, and cultured for 1 day, 2 days, or 3 days. Thereafter, the medium was switched to the medium from step (2b) supplemented with 10 ng / mL GDNF, 20 ng / mL BDNF, 200 μM ascorbic acid, and 400 μM dibutylyl-cAMP, and culture was continued until day 10 from the start of reaggregation. Cells on days 3, 4, and 10 from the start of reaggregation were analyzed by RT-qPCR, and cells on day 10 were analyzed by flow cytometry, and the results are shown in Figures 25 to 27.
[0370] In the single-cell DAPT method (a method in which DAPT treatment is performed in step (iv)), the DAPT concentration was set to 10 μM and the DAPT treatment period was set to 1 day, 2 days, or 3 days. The results of analyzing the time-dependent gene expression level of each marker by RT-qPCR are shown in Figure 25. In Figure 25, "day" represents the number of days in step (iv), "Conc." represents the concentration of DAPT, and "Treatment" represents the number of days of DAPT treatment.
[0371] As shown in Figure 25, the expression of Hes1, whose expression is activated downstream of Notch signaling, decreased immediately after DAPT treatment regardless of the duration of DAPT treatment. However, after 1 and 2 days of DAPT treatment, expression increased again with the culture in step (iv). On the other hand, after 3 days of DAPT treatment, Hes1 expression was suppressed for 10 days. Expression of Ki67, a proliferation marker, and Pax6, a neural stem cell marker, were also suppressed. Meanwhile, expression of Map2, a neural maturation marker, and Ctip2, a marker for the neuronal layer in cortical layers V / VI, increased with the culture in step (iv). Therefore, it was found that DAPT treatment for at least 3 days can suppress the proliferation of proliferative neural stem cells and increase the proportion of neurons in cortical layers V / VI.
[0372] In the single cell DAPT method (a method in which DAPT treatment is performed in step (iv)), the DAPT concentration was 0 μM, 0.1 μM, 1 μM, and 10 μM, and the DAPT treatment period was 3 days. The results of analyzing the time course of gene expression levels of each marker by RT-qPCR are shown in Figure 26. For comparison, the case in which treatment was performed in step (ii) at a DAPT concentration of 10 μM and a DAPT treatment period of 3 days is also shown (organoid DAPT method). In Figure 26, "day" represents the number of days in step (iv), and "Conc." represents the concentration of DAPT.
[0373] 26 shows that Hes1, whose expression is activated downstream of Notch signaling, was not sufficiently suppressed by DAPT treatment at concentrations of 0.1 to 1 μM, whereas it was suppressed for 10 days at 10 μM. Expression of the proliferation marker Ki67 and the neural stem cell marker Pax6 was also suppressed for 10 days. Meanwhile, expression of Map2, a marker of neural maturation, and expression of Ctip2, a marker of the cortical layer V / VI neurons, increased with the culture in step (iv). Therefore, when DAPT treatment was performed in step (iv), DAPT treatment at 10 μM for 3 days suppressed the proliferation of proliferative neural stem cells and increased the proportion of neurons in cortical layer V / VI, demonstrating effects comparable to or superior to those achieved by DAPT treatment in step (ii).
[0374] When DAPT treatment is performed in step (iv), the DAPT concentration is 0 μM, 0.1 μM, 1 μM, 10 μM, the DAPT treatment period is 3 days, and the expression level of each marker when cultured for 10 days in step (iv) is analyzed by flow cytometry. The results are shown in Figure 27. For comparison, the case where treatment was performed in step (ii) with a DAPT concentration of 10 μM and a DAPT treatment period of 3 days (organoid DAPT method).
[0375] 27 shows that when DAPT treatment was performed in step (iv), the percentage of Ctip2 / βTubIII (Tuj1) double-positive cells (upper panel) increased from 32.2% to 89.6% with increasing DAPT treatment concentration. Furthermore, the percentage of proliferating Pax6-positive / Sox1-positive / Ki67-positive cells (lower panel) decreased from 35.0% to 0.8% with DAPT treatment. Thus, similar to step (ii), DAPT treatment in step (iv) also increased the percentage of Ctip2 / βTubIII double-positive neurons in cortical layer V / VI, while decreasing the percentage of proliferating cells, with increasing DAPT treatment concentration.
[0376] 8-2. Single Cell DAPT Method (2) According to the method scheme shown in Figure 28, cerebral organoids at 5 weeks of differentiation induction were dispersed into single cells in step (II), and then treated with 10 μM DAPT for 3 days in step (III). Then, under DAPT-free medium conditions, the cells were cultured for 4 days (1 day after DAPT removal) and 14 days (11 days after DAPT removal), and the marker expression of the resulting cell masses was analyzed by flow cytometry. The results of the analysis are shown in Figure 29.
[0377] As the culture period after DAPT treatment was extended, the percentage of Ctip2 / Tuj1 co-positive cells increased (left panel, fourth row). On the other hand, the percentage of Pax6 and Ki67 double-positive cells (middle panel, fourth row), which are markers of proliferative neural progenitor cells, and the percentage of Pax6, Ki67, and Sox1 triple-positive cells (right panel, fourth row) decreased with the culture period after DAPT treatment. Figure 16(B) and Figure 29 reveal that neural differentiation and maturation progressed and the percentage of proliferative cells decreased with the culture period after DAPT treatment.
[0378] Example 9 Analysis of Organoid Morphology and Expression Profile 9-1. Morphological Analysis of Organoids - Culture was performed using the same method as in Example 1 from Day 7 to Day 35. Bright-field images of cerebral organoids obtained from 12 induction differentiation lots (Lot 1 to Lot 12) were taken using an inverted microscope (Leica DMS1000), and representative bright-field images are shown in Figure 30 (scale bar: 5 mm). Figure 30 shows that there were differences in the morphology of the induced organoids depending on the lot.
[0379] Observation of the cerebral organoids obtained by the above 12 differentiation inductions revealed that they could be classified into seven morphological groups: cerebral organoids containing rosette structures throughout the cell mass (rosette structure; Rosette), organoids with low transparency and no clear structure (potato-like tissue; Potato-like), organoids with balloon-like structures (balloon-like tissue; Balloon), organoids with fibrous structures (cotton-like tissue; Cotton-like), organoids with high transparency and cyst-like structures inside (transparent tissue; Transparent), organoids with black or brown pigmentation (pigment; Pigment), and organoids with high transparency and no clear structure (jelly-like tissue; Jelly-like) (Figure 31). Statistical results according to the above morphological classification are shown in Figure 32, Table 5).
[0380] Table 5 shows the percentage of organoids of each morphology. Organoids were classified according to the type of morphology contained within a single organoid. Rows 1 to 7 from the top indicate the morphology contained within each organoid. Rows 1 to 12 from the bottom show the results of classifying organoids induced in 12 differentiation-inducing lots by morphology. The values in Table 5 represent the percentage of organoids of each morphology among all organoids within a lot, and the shade of the color corresponds to the magnitude of the value. Figure 32 shows the percentage of organoids of each morphology in a bar graph.
[0381] The proportion of organoid groups generated varied significantly depending on the differentiation lot. Some lots contained a combination of "rosette structure," "balloon-shaped or cotton-like tissue," and "transparent tissue," while others contained mostly "balloon-shaped or cotton-like tissue," and others contained mostly "potato-like tissue" (Figure 32, Table 5). Thus, the proportion of organoid types generated by the differentiation induction cycle varied depending on the lot. Furthermore, some organoids exhibited characteristics belonging to more than one of the seven morphological classifications described above. Furthermore, these organoids could be visually distinguished by magnification.
[0382] 9-2. Single-cell gene expression analysis of organoids in each morphological group Single-cell gene expression analysis was performed to identify the cell types contained in organoids in each morphological group. Nine organoids obtained after three rounds of differentiation induction (Figure 33) were used for the analysis. The morphology of the tissue contained in each organoid is shown at the top of each photograph. Single-cell gene expression analysis was performed as follows.
[0383] First, to prepare a single-cell suspension from organoids, organoids were dissociated into single cells using a neural cell dispersion medium (Fujifilm Wako Pure Chemical Industries, Ltd.) according to the recommended conditions. Dissociated cells were resuspended at a density of 1,000 cells / μL in HBSS supplemented with 10% (v / v) KSR and 10 μM Y-27632 (Fujifilm Wako Pure Chemical Industries, Ltd.). Approximately 4,670 cells per channel were loaded onto a ChromiumNextGEM Chip G (2000177 10X Genomics) and processed with a Chromium controller to obtain gel beads-in-emulsion (GEM). Libraries were generated using Chromium Next GEM Single Cell 3′ Reagent Kits v3.1 (1000121; 10x Genomics) according to the manufacturer's protocol (CG000204 Rev C). Library sequences were analyzed by Novaseq 6000 (Illumina).
[0384] A Cell Ranger pipeline was used to map the single-cell RNA-seq sequence. The GRCh38 human genome sequence was used as the reference genome sequence. The UMI count values obtained by analysis with a next-generation sequencer were analyzed using the Seurat R package. First, the data for each organoid was standardized using the Log-Normalize method, and then the data for all organoids was integrated. Next, the top 2,000 genes with the greatest intercellular variation were extracted, and principal component analysis (PCA) was performed using the data for these genes to obtain the top 50 principal components (principal component 1 to principal component 50). Furthermore, in order to simultaneously analyze three differentiation-induced lots of organoids, batch effect correction was performed using the Harmony method, and then dimensionality reduction was performed using the UMAP (Uniform Manifold Approximation and Projection) method to convert the data into two-dimensional data. Then, clustering based on the Shared Nearest Neighbor Graph was performed, and all cells were classified into clusters. Furthermore, based on the gene groups characteristically expressed in each cluster, the cell types constituting each cluster were identified.
[0385] The similarities and differences in gene expression of individual cells were evaluated by visualizing the two-dimensional data obtained by the UMAP method. Specifically, the PCA described above represents tens of thousands of cells using 50-dimensional data (principal components) based on their gene expression data. The UMAP method then compresses the data into two-dimensional data while maintaining similarities and differences, and converts it into a planar plot. In the plot obtained by the UMAP method, each point represents an individual cell, and cells with similar gene expression patterns are plotted closer together. When there are many cells with particularly high similarity, a clump-like structure appears, with the points clustered very close together. Cell groups that form such a structure are interpreted as cells that exhibit very similar gene expression, i.e., the same or closely related cell types (Nature Biotechnology volume 37, pages 38-44 (2019)).
[0386] Figures 34 and 35 show the results of single-cell RNA-seq analysis of the cells contained in the nine analyzed organoids, displayed using the UMAP method. Figure 34 indicates that the cells contained in the nine organoids were divided into more than 10 different clusters, and that they contained cell populations exhibiting more than 10 distinct gene expression patterns. Furthermore, the plot patterns differed depending on the organoid (Figure 35), suggesting that the cell types contained in each organoid were different.
[0387] To identify the cell types contained in each cluster, cells were statistically classified into 14 clusters using the Nearest Neighbors method. Genes characteristically expressed in each cluster were extracted based on the percentage of expressing cells and average expression levels, and are shown in Table 6. The top 50 genes in each cell in Table 6 are listed in descending order. Furthermore, cell types were annotated based on literature information, and the cell types in each cluster were identified based on gene expression in each cluster ( Figure 36 ). Each dot represents an individual cell, and the shading of the dot represents the cluster. The respective cell types are thought to be: Cortical Neuron (Radial Glia (RG)): cerebral cortical neural progenitor cell (Radial Glia (RG)), Cortical neuron (CR): Cajal-Retzius cell (CR), Cortical Neuron (Glutamatergic neuron (GN)): cerebral cortical neuron (Glutamatergic neuron (GN)), GABAergic neuron: GABAergic neuron, Choroid plexus (ChP): choroid plexus, CNS fibroblast: central nervous system fibroblast, Neural Crest: neural crest cell, Vascular Endothelial cells: vascular endothelial cell, and Caudal Neuron: caudal neuron.
[0388]
[0389] □ Figures 37 and 38 show the expression profiles of genes characteristic of each cluster and known marker genes in single-cell gene expression data in dot plots. The vertical axis represents the cluster, and the horizontal axis represents the gene. The size of the circle represents the percentage of expressing cells relative to all cells in the cluster. The shade of color represents the average gene expression level of cells in the cluster.
[0390] MAP2 and TUBB3 were analyzed as markers for neurons. KRT19 and KRT8 were analyzed as markers for epithelial cells. MKI67 and TOP2A were analyzed as markers for proliferative cells. PAX6, SOX2, and HES1 were analyzed as markers for radial glia (RG). EMX1 was analyzed as a marker for the dorsal forebrain region. NEUROD6 and SLC17A7 were analyzed as markers for glutamatergic neurons. SSTR3 is a somatostatin receptor known to be expressed in glutamatergic neurons. TBR1 and BCL11B were analyzed as markers for deep layers, which are precursors of layers V and VI of the cerebral cortex. RELN was analyzed as a marker for Cajal-Retzius cells. ASCL1, DLX1, DLX2, DLX5, and DLX6 were analyzed as markers expressed during the differentiation of GABAergic neurons. GAD2 was analyzed as a marker of GABAergic neurons. SST and TAC1 were analyzed as markers expressed in GABAergic neuron subtypes. TTR, RSPO3, CLIC6, HTR2C, and TRPM3 were analyzed as markers expressed during choroid plexus development. COL1A1 was analyzed as a marker of CNS fibroblasts. DCN, LUM, and DLK1 are genes expressed in stromal cells. AQP1 has been reported to be expressed in the choroid plexus and arachnoid granules. OTX2 and EMX2 are region-specific markers known to be expressed in the telencephalic choroid plexus. HOXA5 and HOXB5 were analyzed as caudal neuronal markers. ZIC1, MSX1, LGALS1, TWIST1, PRRX1, GPC3, SOX10, and TFAP2A were analyzed as markers whose expression is observed during the differentiation process of the neural crest. Among these, LGALS1, TWIST1, PRRX1, and GPC3 are genes involved in epithelial-mesenchymal transition (EMT), and SOX10 and TFAP2A are markers expressed in mature neural crest. PECAM1, KDR, FLT1, and ICAM2 were analyzed as vascular endothelial cell markers.
[0391] In selecting the genes to be analyzed, first, genes with a proportion of cells expressing the "Cortical Neuron (GN)" cluster that was more than twice as high as other clusters were selected. Next, 50 genes with a large fold change in the average expression level were selected from the "Cortical Neuron (GN)" cluster compared to other clusters. Finally, in single-cell gene expression analysis of 3 lots of cerebral organoids before DAPT treatment and cerebral cortical cell masses after DAPT treatment, 46 genes whose expression was detected in all lots were analyzed.
[0392] Clusters of cortical neurons expressed the forebrain marker EMX1. Among them, the "radial glia (RG)" expressed LHX2, SOX2, and PAX6, genes essential for the regulation of radial glia. "Glutamate neurons (GN)" expressed TBR1 (Robert F. Hevner, Tbr1 Regulates Differentiation of the Preplate and Layer 6, Neuron, 2001), a transcription factor characteristic of deep layer neurons and pyramidal neurons, and NEUROD6 (Tutukova S et al., The Role of Neurod Genes in Brain Development, Function, and Disease, Frontiers in Molecular Neuroscience, 2021), as well as glutamate transporters SLC17A7 (VGluT1) and BCL11B (Ctip2). Furthermore, "Cajal-Retzius cells (CR)" expressed marker genes for Cajal-Retzius cells, such as RELN and TBR1.
[0393] GABAergic neuron clusters commonly expressed GAD2, a glutamate decarboxylase. Among these, the "GABAergic neuron-1, 2" cluster showed high expression of the proliferation marker MKI67 (Ki67) and ASCL1, which is expressed in the early differentiation stage (VZ). The "GABAergic neuron-3" cluster showed expression of DLX5 and DLX6, which are expressed in the mid-differentiation stage (SVZ) and later.
[0394] The choroid plexus clusters highly expressed TTR (transthyretin), a marker of choroid plexus epithelium. Choroid plexuses are classified into telencephalic and hindbrain types, but co-expression of EMX2 and BMP7 suggested that these were telencephalic choroid plexuses associated with the cerebral cortex.
[0395] The CNS fibroblast clusters showed high expression of COL1A1, a marker of fibroblasts associated with the central nervous system. At the same time, expression of AQP1 and other markers was also observed, suggesting that some of these cells may represent fibroblasts associated with the choroid plexus.
[0396] In the neural crest cluster, expression of various genes that are expressed during the differentiation process of neural crest cells (NCC) was observed (Simoes-Costa M et al., Establishing neural crest identity: a gene regulatory recipe, Development, 2015). In the "Neural crest-1" cluster, expression of the ZIC gene group and Msx1, which are expressed at the neural plate border, the origin of NCC, was observed. In the "Neural crest-2" cluster, expression was observed of ID genes downstream of Smad signaling and epithelial-mesenchymal transition (EMT)-related genes (LGALS1, TWIST1, PRRX1, GPC3 (Fazilaty H et al., A gene regulatory network to control EMT programs in development and disease, 2019)) which are expressed in the early stages of differentiation into NCC. In the "Neural crest-3" cluster, expression was observed of genes such as SOX10TFAP2A which are expressed during the migration stage of NCC.
[0397] Endothelial cell clusters expressed numerous vascular endothelial cell markers, including KDR (VEGFR-2), PECAM1, FLT1, and ICAM2 (Gonchalov et al., Markers and Biomarkers of Endothelium: When Something Is Rotten in the State, Oxidative Medicine and Cellular Longevity, 2017).
[0398] In the caudal neuron cluster, expression of many HOX genes, including TUBB3, a neuronal marker, as well as HOXA5 and HOXB5, which control caudal regionalization, was observed.
[0399] The proportion of each cell type in the nine organoids is shown in Figure 39 (A), and the proportion of neural crest cells at each differentiation stage among the neural crest is shown in Figure 39 (B). Organoid 9, which contains pigment cells, had a higher proportion of neural crest than the other organoids. It was found that the proportion of "Neural Crest-2," a cell population that expresses genes related to EMT, was particularly high, and that it contained many actively migrating neural crests.
[0400] 9-3. Analysis of marker expression by immunostaining. Organoids from each group were immunostained for representative marker proteins. The results are shown in Figure 40.
[0401] The forebrain marker EMX1 was specifically expressed in the rosette structure (rosette) region. The GABAergic neuron marker GAD65 (GAD2) was expressed in the "potato-like tissue" region. The ECM fibroblast marker COL1A1 was expressed in the balloon-like tissue, cotton-like tissue, and pigmented regions. The choroid plexus-specific marker was expressed in the transparent tissue. The melanocyte marker TYR was expressed in the pigmented organoid "pigment." These results confirmed that the markers identified by single-cell gene expression analysis were indeed expressed in regions with their respective characteristic structures.
[0402] 9-4. Analysis of Marker Gene Expression by RT-qPCR - Culture was performed using the same method as in Example 1 from Day 7 to Day 35. Three organoids were obtained from each group, and bright-field images were taken using an inverted microscope (Leica DMS1000) (Figure 41). Marker gene expression was analyzed for each organoid using RT-qPCR. The analysis results are shown in Figures 42 and 43.
[0403] VGluT1 and EMX1, identified as markers of cerebral cortical neurons, were expressed in Rosette organoids. DLX2 and GAD2, identified as markers of GABAergic neurons, were highly expressed in potato-like organoids. TYR, a marker of melanocytes, was highly expressed in Pigment organoids. COL1A1, a marker of CNS fibroblasts, was expressed in balloon-like and cotton-like tissues. HOXA2, a marker of caural neurons, was expressed in jelly-like tissues.
[0404] 9-5. Analysis of cerebral organoids and cerebral cortical cell clusters by single-cell gene expression analysis Rosette organoids were visually selected from organoids obtained after three rounds of differentiation induction cultured using the same method as in Example 1 from Day 7 to Day 35. Then, using the method described in step (ii) of Example 4, the cerebral organoids were treated with DAPT for three days to induce cerebral cortical cell clusters ("DAPT+"). A control group was created in step (ii) without the addition of DAPT (cerebral organoids: "DAPT-"). Using these cells, single-cell gene expression analysis was performed using the same method as in 9-2.
[0405] The morphology of Rosettes organoids from each differentiation induction round (Lot 1, Lot 2, Lot 3) was observed using an inverted microscope, and a representative bright-field image is shown in Figure 44(A). The UMAP plot of single-cell gene expression analysis is shown in Figure 44(B). (Rosettes Lot 1, Rosettes Lot 2, Rosettes Lot 3)
[0406] Organoids (cerebral organoids) obtained under DAPT- conditions were divided into two clusters, and were found to contain two types of cell populations (Figure 44 (B)). Organoids (cerebral cortical cell masses) obtained under DAPT+ conditions were found to be aggregated into one cluster, and composed of one type of cell population. The distribution of cells from the three production lots overlapped, indicating that there was little difference between production runs, and that similar cell populations were obtained with good reproducibility.
[0407] Furthermore, the expression of the marker genes identified above was further analyzed for the organoids (Figure 45). The cerebral organoids (DAPT-) were divided into two clusters. The right cluster showed high expression of glutamatergic neuron markers SLC17A7 and NEUROD6, as well as Ctip2, a deep layer neuron marker, suggesting that glutamatergic neurons and their progenitor cells were present. The left cluster showed high expression of radial glia markers PAX6 and MKI67, suggesting that these cells represent highly proliferative radial glia. Satb2, a marker for upper neurons, was barely expressed, suggesting that most of these cells represent progenitor cells in layers V and VI of the cerebral cortex. Furthermore, the markers of unintended cells identified in this study, TTR, COL1A1, TYR, and PECAM1, were barely detected. From this, it was found that by selecting organoids that have a rosette structure throughout their morphology, or by excluding organoids with other morphologies, it is possible to obtain cerebral cortical cells and reduce contamination with undesired cells.
[0408] Furthermore, in the cerebral cortical cell clusters (DAPT+), the cells were aggregated into a single cluster and expressed SLC17A7 (VGluT1), NEUROD6, and Ctip2, but the cell population expressing the non-target cell markers Pax6 and MKI67 was significantly reduced. Furthermore, TTR, COL1A1, TYR, and PECAM1 were barely detectable. These results demonstrate that DAPT treatment can yield highly pure cerebral cortical cell clusters containing glutaminergic neurons.
[0409] Each gene listed in Table 6 can also be used as a marker for cerebral cortical neural progenitor cells (which are broadly included in cerebral cortical neurons, but correspond to radial glia (RG)), cerebral cortical neurons (including glutamatergic neurons (GN) and Cajal-Retzius cells (CR)), GABAergic neurons, choroid plexus (ChP), central nervous system fibroblasts, neural crest cells, vascular endothelial cells, or caudal neurons.
[0410] Furthermore, markers for cerebral cortical neural progenitor cells and cerebral cortical neurons (including glutamatergic neurons and Cajal-Retzius cells) can be used as markers for cerebral organoids, since these cells are contained in cerebral organoids.
[0411] In particular, genes expressed in cerebral cortical neurons, specifically genes expressed in glutamatergic neurons or Cajal-Retzius cells, can be used as markers for the cerebral cortical cell cluster of the present invention and the highly purified cerebral cortical cell cluster of the present invention.
[0412] Of the 50 genes (Table 6) belonging to the cluster of cerebral cortical neurons (excluding radial glia), three genes (EOMES, SPINK5, and EBF2) were expressed at low levels in organoids after DAPT treatment, indicating that the remaining 47 genes are suitable as markers for the cerebral cortical cell cluster of the present invention or the highly purified cerebral cortical cell cluster of the present invention. Furthermore, of this list of genes, NEUROD6, NEUROD2, SSTR2, TBR1, NRXN1, BHLHE22, NEUROD1, NEUROG2, SLC17A7, and EMX1 are known to be expressed in the dorsal forebrain region, where the cerebral cortex develops, the planned region of layers II to VI of the cerebral cortex (cortical plate), and glutamatergic neurons, while the other 37 genes have been newly identified as markers for cerebral cortical neurons.
[0413] That is, the cerebral cortical cell cluster and the highly purified cerebral cortical cell cluster defined in the present application contain cerebral cortical neurons, which are the target cells, due to the fact that NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I The evaluation can be carried out by examining the expression or expression levels of at least one, at least two, at least three, or at least five genes selected from the group consisting of 11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3. More preferably, the evaluation can be carried out by examining the expression or expression levels of SLC17A7, NEUROD6, and EMX1.
[0414] Furthermore, it was found that the gene group (hereinafter referred to as "non-target cell gene group") expressed in cerebral cortical neural progenitor cells (radial glia (RG)), GABAergic neurons, choroid plexus (ChP), central nervous system fibroblasts (CNS fibroblasts), neural crest cells, vascular endothelial cells, or caudal neurons listed in Table 6 can be used as a marker for non-target cells in the cerebral cortical cell cluster or high-purity cerebral cortical cell cluster of the present invention, to determine whether the non-target cells are below the standard level.
[0415] That is, whether the cerebral cortical cell mass or high-purity cerebral cortical cell mass specified in the present application does not contain non-target cells or the non-target cells are below a standard can be evaluated using as an indicator whether the expression levels of at least one, at least two, or at least three genes selected from the non-target cell gene group in Table 6 are substantially not expressed or are below a standard.
[0416] Specifically, we have identified LHX2, SOX2, and PAX6 as markers of radial glia, GAD2, DLX1, DLX2, DLX5, and DLX6 as markers of GABAergic neurons, TTR and TRPM3 as markers of choroid plexus, COL1A1 as a marker of central nervous system fibroblasts, ZIC gene group identified as markers of neural crest cells, Msx1, ID gene group downstream of Smad signaling, epithelial-mesenchymal transition (EMT)-related genes (TWIST1, PRRX1, GPC3, Sox10, and TFAP2), and many vascular endothelial markers, including KDR (VEGFR-2), PECAM1, and CDH5 (VE-Cadherin), which are identified as markers of vascular endothelial cells. In addition to TUBB3, which has been identified as a marker for caudal neurons, the expression levels of at least one, at least two, or at least three genes selected from a large number of HOX genes that control caudal regionalization can be used as indicators of whether they are substantially not expressed or below a certain standard. The methods for using the markers listed in Table 6 are not limited to these, and the markers can be used for various purposes by selecting an appropriate marker depending on the application and measuring its expression.
[0417] More preferably, one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR and HOXA2 in Table 6 are not substantially expressed or are expressed at or below a reference value.
[0418] The uses of the cerebral organoids produced by the production method defined in the present invention are not necessarily limited, and they may be used for the following purposes.
[0419] <Cerebral Use (Substance Screening)> Small molecular weight compounds, antibodies, nucleic acids, and other substances may be added to cerebral organoids prepared by the production method of the present invention to examine their effects. That is, cerebral organoids can be used to clarify the effects, toxicity, and usefulness of small molecular weight compounds, antibodies, and other substances. In this case, the effects of organized neurons and organized neural networks formed in cerebral organoids can be examined. In particular, the cerebral organoid production method and selection method defined in the present invention make it possible to produce a large number of cerebral organoids with relatively uniform expression profiles, shapes, etc., or tissue structure. In this case, the quality evaluation method for cerebral organoids described in 13 above may be used to objectively evaluate the quality of cerebral organoids. By using cerebral organoids with relatively uniform expression profiles, shapes, etc., or tissue structure, multiple tests can be easily performed, and reproducibility, which was previously difficult, can be easily achieved.
[0420] <Cerebral applications (disease cerebral organoids)> In addition, cerebral organoids induced from pluripotent stem cells derived from specific genotype cells can be produced, and the above-mentioned substance screening can be applied to specific diseases. In this case, when producing cerebral organoids using the method for producing cerebral organoids described in 2 above, the optimal process can be appropriately adjusted depending on the properties of the derived pluripotent stem cells. In particular, cerebral organoids induced from pluripotent stem cells derived from cells collected from patients with schizophrenia, bipolar disorder, autism spectrum disorder, Alzheimer's disease, dementia, microcephaly, etc. (mental disease cerebral organoids) can be produced, and the effects of drugs can be examined, as well as used to elucidate the mechanisms of disease. More specifically, this includes comparing excitatory neurons such as glutamatergic neurons, inhibitory neurons such as GABAergic neurons, glial cells, etc. with healthy individuals, and analyzing cellular characteristics such as gene expression, protein expression, metabolic state, and electrophysiological properties.
Claims
1. A method for producing cerebral organoids from pluripotent stem cells in the absence of supporting cells, comprising: (1) culturing pluripotent stem cells in a culture medium substantially free of bFGF and not substantially inducing TGFβ signal; and (2) inducing differentiation of the cells obtained in step (1) into neural cells. A method comprising the above steps.
2. Step (2) comprises: (2a) culturing the cells obtained in step (1) in suspension in a culture medium containing a TGFβ signal inhibitor and a Wnt signal transduction inhibitor to obtain cell aggregates; and (2b) culturing the cell aggregates obtained in step (2a) in suspension in a culture medium substantially free of a TGFβ signal inhibitor and a Wnt signal transduction inhibitor to obtain cerebral organoids. The method according to claim 1, comprising the above steps.
3. The method according to claim 2, wherein the suspension culture in step (2a) is a static culture.
4. The method according to claim 2, wherein the suspension culture in step (2b) is a shaking culture.
5. The method according to claim 1, wherein the culture period in step (1) is less than 3 days.
6. The method according to claim 1, wherein the culture period in step (1) is 12 hours or more and 2 days or less.
7. The method according to claim 1, wherein the culture medium in step (1) contains a TGFβ signal inhibitor selected from the group consisting of SB431542, A-83-01, and XAV-939.
8. The method according to claim 2, wherein the culture media in steps (1), (2a), and (2b) are serum-free culture media.
9. The method according to claim 1, wherein the pluripotent stem cells are human induced pluripotent stem cells or human embryonic stem cells.
10. The method according to claim 1, further comprising a step of selecting a cerebral organoid from a plurality of cell masses obtained in step (2), using at least one selected from the group consisting of the shape, internal structure, size, surface color or pattern, and gene expression of the cell masses as an index.
11. A cell culture produced by using the method according to any one of claims 1 to 9, comprising a plurality of spherical cell masses, wherein the proportion of cerebral organoids in the plurality of spherical cell masses is 40% or more.
12. The cell culture according to claim 11, wherein the proportion of the cerebral cortex-like structure in the cerebral organoid is 40% or more.
13. The cerebral organoid further has the following (1) to (5): (1) being a spherical cell mass, (2) having a cerebral cortex-like structure inside the cell mass, (3) having no pigmentation on the surface, (4) having none of cystic shape, protrusion shape, and balloon shape in a part of the cell mass, and (5) expressing at least one marker selected from the group consisting of NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3 The cell culture according to claim 12, which is a cell mass having one or more characteristics selected therefrom.
14. (a) the number of proliferative marker-positive cells is 10% or less of the total number of cells, (b) the number of cells positive for one or more markers selected from the group consisting of a neuronal marker, a cortical layer V / VI marker, and a forebrain marker is 70% or more of the total number of cells, and (c) substantially free of neuroepithelium or a cerebral cortex-like structure, a cerebral cortex cell mass.
15. the proliferative marker in (a) is Ki67, the neuronal marker in (b) is βIII-Tubulin, the cortical layer V / VI marker is Ctip2, and the forebrain marker is FOXG1, the cerebral cortex cell mass according to claim 14.
16. (d) further expressing at least one marker selected from the group consisting of NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3, the cerebral cortex cell mass according to claim 14.
17. expressing SLC17A7, the cerebral cortex cell mass according to claim 16.
18. substantially not expressing one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2, the cerebral cortex cell mass according to claim 15.
19. A method for producing a cerebral cortex cell mass from pluripotent stem cells in the absence of supporting cells, (i) a step of obtaining a cerebral organoid from pluripotent stem cells; (ii) a step of culturing the cerebral organoid obtained in step (i) in a culture solution containing a Notch signal inhibitor to obtain a cerebral cortex cell mass; A method comprising:
20. In the step (i), the cerebral organoid is obtained from pluripotent stem cells by the method according to any one of claims 1 to 10. The method according to claim 19.
21. (A) The number of proliferative marker-positive cells is 5% or less of the total number of cells, (B) The number of cells positive for one or more markers selected from a neuronal marker, a cortical layer V / VI marker, and a forebrain marker is 70% or more of the total number of cells, and (C) Substantially free of neuroepithelium or cerebral cortex-like structures A high-purity cerebral cortex cell mass, characterized by:
22. The proliferative marker in (A) is Ki67, The neuronal marker in (B) is βIII-Tubulin, the cortical layer V / VI marker is Ctip2, and the forebrain marker is FOXG1. The high-purity cerebral cortex cell mass according to claim 21.
23. The high-purity cerebral cortical cell mass according to claim 21, which expresses at least one gene selected from the group consisting of (D) NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3.
24. The high-purity cerebral cortical cell mass according to claim 23, which expresses one or more genes selected from the group consisting of SLC17A7, NEUROD6, and EMX1.
25. The high-purity cerebral cortical cell mass according to claim 21, which does not substantially express one or more genes selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2.
26. A method for producing a high-purity cerebral cortical cell mass from pluripotent stem cells in the absence of supporting cells, comprising: (i) obtaining a cerebral organoid from pluripotent stem cells; (ii) culturing the cerebral organoid obtained in step (i) in a culture medium; (iii) dispersing the cell culture obtained in step (ii) into single cells or aggregates of 2 to 5 cells; (iv) culturing the cell culture obtained in step (ii) or the cell population obtained in step (iii) in a culture medium containing one or more neurotrophic factors, ascorbic acid, and a cAMP activator to obtain a cell mass; and the culture medium in step (ii) and / or the culture medium in step (iv) contains a Notch signal inhibitor.
27. In the step (i), the method according to claim 26, wherein a cerebral organoid is obtained from pluripotent stem cells by the method according to any one of claims 1 to 10.
28. The method according to claim 19 or 26, wherein the cerebral organoid to be subjected to the step (ii) is a cerebral organoid 28 to 44 days after the start of induction of differentiation into nerve cells.
29. The method according to claim 19 or 26, wherein the culture period of the step (ii) is 2 to 6 days.
30. The method according to claim 19 or 26, wherein the culture period of the step (iv) is 2 to 14 days.
31. The method according to claim 19 or 26, wherein the Notch signal inhibitor is a γ-secretase inhibitor.
32. The method according to claim 31, wherein the γ-secretase inhibitor is N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) or Compound E.
33. A cell population comprising the highly purified cerebral cortex cell mass according to claim 21, wherein the size, shape or constituent cell composition of the highly purified cerebral cortex cell mass is uniform.
34. A pharmaceutical composition comprising, as an active ingredient, the cerebral cortex cell mass according to any one of claims 14 to 18, the highly purified cerebral cortex cell mass according to any one of claims 21 to 25, or the cell population according to claim 33, or a cell population obtained by dispersing them into constituent cells.
35. A tissue for transplantation comprising the cerebral cortex cell mass according to any one of claims 14 to 18, the highly purified cerebral cortex cell mass according to any one of claims 21 to 25, or the cell population according to claim 33, or a cell population obtained by dispersing them into constituent cells.
36. A therapeutic agent for cerebrovascular disorders, comprising, as an active ingredient, a cerebral cortex cell mass according to any one of claims 14 to 18, a highly pure cerebral cortex cell mass according to any one of claims 21 to 25, or a cell population according to claim 33, or a cell population obtained by dispersing them into constituent cells.
37. (aa) A step of measuring the expression level of at least one gene selected from the group consisting of GAD2, COL1A1, TYR, TTR, and HOXA2, a protein encoded by the gene, or a fragment thereof in a cerebral organoid or a cerebral cortex cell mass, and (bb) A step of evaluating that the amount of unwanted cells contained in the cerebral organoid or the cerebral cortex cell mass is below a reference value when the expression level of the gene is below a reference value based on the measurement result of step (aa), A method for evaluating the quality of a cerebral organoid or a cerebral cortex cell mass, comprising the above steps.
38. (AA) A step of measuring the expression level of at least one gene selected from the group consisting of NEUROD6, NEUROD2, SSTR2, TBR1, ZBTB18, NHLH1, IGFBPL1, NRN1, RTN1, THSD7A, NRXN1, BHLHE22, CALB2, KHDRBS3, CCSAP, PDE1A, NEUROD1, NPTX1, NXPH4, NTS, NEUROG2, OLFM1, PRDM8, CORO2B, TP53I11, ZFPM2, PCDH9, NELL2, SRRM4, SCG3, DCC, EPB41L3, SLC17A7, ST18, NSG2, EMX1, CAP2, SYT4, NSMF, ANK3, MYT1L, FSTL5, CELF4, B3GAT1, EPHA5, NHLH2, and DLL3 in a cerebral organoid or a cerebral cortex cell mass, and (BB) A step of evaluating that the amount of target cells contained in the cerebral organoid or the cerebral cortex cell mass is above a reference value when the expression level of the gene is above a reference value based on the measurement result of step (AA), A method for evaluating the quality of a cerebral organoid or a cerebral cortex cell mass, comprising the above steps.