Medicine for prevention and / or treatment of pulmonary hypertension

Abstract

The present invention provides a medicine for the prevention and / or treatment of pulmonary hypertension. The medicine contains an aptamer capable of binding to interleukin-21 as an active ingredient and is administered subcutaneously. For the medicine, the single dose is 0.001 mg / kg to 50 mg / kg, and the frequency of administration is selected from once / 1 day to once / 28 days.

Description

Drug for preventing and / or treating pulmonary hypertension

[0001] The present invention relates to a pharmaceutical agent for preventing and / or treating pulmonary hypertension.

[0002] Pulmonary hypertension is an intractable disease with a poor prognosis that causes vascular remodeling (stenosis and obstruction) in the pulmonary arteries, leading to elevated pulmonary arterial pressure and right heart failure. Pulmonary hypertension is classified into Groups 1 to 5 based on the primary pathology (Non-Patent Document 1). Among these, pulmonary arterial hypertension, which is caused by pulmonary arterial remodeling such as pulmonary arterial medial thickening and intimal proliferative lesions, and chronic thromboembolic pulmonary hypertension, which is caused by chronic thrombus obstruction in the pulmonary artery, are designated as intractable diseases by the Ministry of Health, Labour and Welfare.

[0003] Currently, endothelin receptor antagonists (bosentan, ambrisentan, macitentan, etc.), phosphodiesterase (PDE) 5 inhibitors (sildenafil, tadalafil, etc.), soluble guanylate cyclase (sGC) stimulators (riociguat, etc.), prostacyclin receptor (IP receptor) agonists (epoprostenol, selexipag, beraprost, iloprost, treprostinil, etc.) are used to treat pulmonary hypertension. However, these treatments do not sufficiently improve the prognosis.

[0004] Although the BMPR2 signaling-related gene is known to be a genetic predisposition to pulmonary hypertension, the disease penetrance is low at approximately 20%, and inflammation and exposure to exogenous chemicals are thought to be important factors in the development of pulmonary hypertension. The present inventors have reported that the interleukin-6 (IL-6) / Th17 cell / interleukin-21 (IL-21) signaling axis is important in the pathogenesis of pulmonary hypertension (Non-Patent Document 2).

[0005] Patent Document 1 describes that pulmonary hypertension can be prevented and treated by a substance that inhibits signal transduction from IL-21 (e.g., an anti-IL-21 antibody). Patent Document 2 describes that an aptamer that binds to IL-21 is useful for the prevention and treatment of pulmonary hypertension.

[0006] JP 2016-056115 WO2021 / 256530 A1

[0007] J Am Coll Cardiol. 2013 Dec 24;62(25 Suppl):D34-41. doi: 10.1016 / j.jacc.2013.10.029.Proc Natl Acad Sci USA. 2015 May 19;112(20):E2677-86. doi: 10.1073 / pnas.1424774112.

[0008] An objective of the present invention is to provide a novel medical use of an aptamer that binds to IL-21, and a further objective is to provide a preferred method of administration and dosage of the aptamer that binds to IL-21 in said medical use.

[0009] The present invention encompasses the following inventions to solve the above-mentioned problems. [1] A pharmaceutical for preventing and / or treating pulmonary hypertension, characterized in that the pharmaceutical contains an aptamer that binds to interleukin-21 as an active ingredient and is administered subcutaneously. [2] The pharmaceutical according to [1], wherein a single dose of the aptamer is 0.001 mg / kg to 50 mg / kg. [3] The pharmaceutical according to [1], wherein the administration frequency is selected from once per day to once per 28 days. [4] The pharmaceutical according to [1], wherein the pulmonary hypertension is pulmonary arterial hypertension. [5] The pharmaceutical according to any of [1] to [4], which is administered in combination with an endothelin receptor antagonist. [6] The pharmaceutical according to any of [1] to [4], which is administered in combination with a soluble guanylate cyclase stimulator. [7] The pharmaceutical according to any of [1] to [4], which is administered in combination with a prostacyclin receptor agonist.

[0010] [8] A pharmaceutical for preventing and / or treating pulmonary hypertension, comprising an aptamer that binds to interleukin-21 as an active ingredient. [9] A method for treating pulmonary hypertension, comprising administering an effective amount of an aptamer that binds to interleukin-21 to a patient with pulmonary hypertension.

[10] A method for treating pulmonary hypertension, comprising subcutaneously administering an effective amount of an aptamer that binds to interleukin-21 to a patient with pulmonary hypertension.

[11] An aptamer that binds to interleukin-21 for use in the prevention and / or treatment of pulmonary hypertension.

[12] An aptamer that binds to interleukin-21 for use in the prevention and / or treatment of pulmonary hypertension by subcutaneous administration.

[13] Use of an aptamer that binds to interleukin-21 for producing a pharmaceutical for preventing and / or treating pulmonary hypertension.

[14] Use of an aptamer that binds to interleukin-21 for producing a pharmaceutical suitable for subcutaneous administration, for use in the prevention and / or treatment of pulmonary hypertension.

[0011] The present invention provides a pharmaceutical for preventing and / or treating pulmonary hypertension, which contains as an active ingredient an aptamer that binds to IL-21. The pharmaceutical of the present invention can exert superior therapeutic effects when administered subcutaneously compared to other administration routes.

[0012]

[0023] Figure 1 shows the experimental protocol for Example 1.

[0024] Figure 1 shows the results of confirming the therapeutic effect of an anti-rat IL-21 aptamer in a rat model of severe pulmonary hypertension, where (A) is right ventricular systolic pressure (RVSP), (B) is the right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) is an Elastica van Gieson-stained image of the pulmonary artery (EVG), (D) is the vascular occlusion rate, and (E) is the percentage of occluded blood vessels.

[0025] Figure 2 shows the experimental protocol for Example 2.

[0026] Figure 1 shows the results of measuring right ventricular systolic pressure (RVSP) after administering an anti-rat IL-21 aptamer to a rat model of severe pulmonary hypertension via different administration routes, where (A) is the result after intraperitoneal administration, (B) is the result after subcutaneous administration, (C) is the result after intravenous administration, and (D) is the result after intratracheal administration. 1 shows the results of measuring the right ventricle / left ventricle + septum weight ratio (RV / LV+S) after administration of an anti-rat IL-21 aptamer via different administration routes to a rat model of severe pulmonary hypertension, with (A) the result for intraperitoneal administration, (B) the result for subcutaneous administration, (C) the result for intravenous administration, and (D) the result for intratracheal administration. 1 shows the results of calculating the vascular occlusion rate after administration of an anti-rat IL-21 aptamer via different administration routes to a rat model of severe pulmonary hypertension, with (A) the result for intraperitoneal administration, (B) the result for subcutaneous administration, (C) the result for intravenous administration, and (D) the result for intratracheal administration. 1 shows the results of measuring the anti-rat IL-21 aptamer concentration in plasma and the right upper lobe of the lung. 1 shows the experimental protocol for Example 3. 1 shows the results of a dose-response test using subcutaneous administration of an anti-rat IL-21 aptamer, where (A) shows the right ventricular systolic pressure (RVSP), (B) shows the right ventricle / left ventricle plus septum weight ratio (RV / LV+S), (C) shows the vascular occlusion rate, and (D) shows the percentage of occluded blood vessels.

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090] [0

[0023] Figure 1 shows the results of confirming the therapeutic effect of a combination of an anti-rat IL-21 aptamer and a soluble guanylate cyclase (sGC) stimulator in a rat model of severe pulmonary hypertension, where (A) is the right ventricular systolic pressure (RVSP), (B) is the right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) is an Elastica-van Gieson stained image of the pulmonary artery (EVG), (D) is the vascular occlusion rate, and (E) is the percentage of occluded blood vessels. Figure 2 shows the experimental protocol for Example 6.

[0024] Figure 1 shows the results of confirming the therapeutic effect of a combination of an anti-rat IL-21 aptamer and a prostacyclin receptor (IP receptor) agonist in a rat model of severe pulmonary hypertension, where (A) is the right ventricular systolic pressure (RVSP), (B) is the right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) is an Elastica-van Gieson stained image of the pulmonary artery (EVG), (D) is the vascular occlusion rate, and (E) is the percentage of occluded blood vessels.

[0013] The present invention provides a pharmaceutical for preventing and / or treating pulmonary hypertension, which contains an aptamer that binds to IL-21 as an active ingredient (hereinafter referred to as "the pharmaceutical of the present invention"). The pharmaceutical of the present invention is preferably administered subcutaneously.

[0014] The aptamer that binds to IL-21, which is the active ingredient of the pharmaceutical of the present invention (hereinafter referred to as "anti-IL-21 aptamer"), is not particularly limited as long as it binds to human IL-21 and has the activity of inhibiting the function of human IL-21. For example, an aptamer that was confirmed to bind to human IL-21 and inhibit the activity of human IL-21 in a cell evaluation system in the above-mentioned Patent Document 2 (WO2021 / 256530 A1) can be preferably used. Specifically, an aptamer represented by the following formula (5): X １ CCKYCX ２ -N １ａ -X ３ CGRYKACYX ４ -N ２ａ -X ５ GYMCGX ６ (5) (In the formula, N １ａ is an arbitrary sequence of 3 to 7 bases in length, and N ２ａ is an arbitrary sequence of 3 to 8 bases in length, and X １ and X ６ , X ２ and X ５and X ３ and X ４ are complementary base sequences, R represents A or G, Y represents C or U, K represents G or U, and M represents A or C.

[0015] The anti-IL-21 aptamer, which is the active ingredient of the pharmaceutical of the present invention, may be an aptamer comprising the nucleotide sequences shown in SEQ ID NOs: 1 to 29. The nucleotide sequences shown in SEQ ID NOs: 1 to 29 (however, uracil may be thymine) are shown below. The underlined sequences indicate consensus sequences. SEQ ID NO: 1: GGGAGAAGAACCUUCAACACGCGACUACUCGUGAUUGCCCGUUCUGAGCCCAGACGCUCUGCGCU SEQ ID NO: 2: GGGAGAAGAACCUUCCACGACCGACUACUGUCAAUGGCCCGUUCUUUGCCCAGACGCUCUGCGCU SEQ ID NO: 3: GGGAGAAGAACCUUCAACACGCGACUACUCGUGAUUGCCCGUUCUGAGCCC SEQ ID NO: 4: GGAGAACCUUCAACACGCGACUACUCGUGAUUGCCCGUUCUCC SEQ ID NO: 5: GGACCUUCAACACGCGACUACUCGUGAUUGCCCGUCC SEQ ID NO: 6: GGCCUUCAACACGCGACUACUCGUGAUUGCCCGCC SEQ ID NO: 7: GACCUUCAACACGCGACUACUCGUGAUUGCCCGUC SEQ ID NO: 8: ACCUUCAACACGCGACUACUCGUGAUUGCCCGU SEQ ID NO: 9: GGACCUUCAACACGCGGCUACUCGUGAUUGCCCGUCC SEQ ID NO: 10: GAACCUUCAACACGCGACUACUCGUGAUUGCCCGUUC

[0016] SEQ ID NO: 11: GACCUUCAACACGCGGCUACUCGUGAUUGCCCGUC SEQ ID NO: 12: GGACCUUCAACACGCGAUUACUCGUGAUUGCCCGUCC SEQ ID NO: 13: GGACCUUCAACAAGCGAUUACUCUUGAUUGCACGUCC SEQ ID NO: 14: GGACCUUCAACCCGCGAUUACUCGGGAUUGCCCGUCC SEQ ID NO: 15: GGACCUUCAACCCGCGACUACUCGGGAUUGCCCGUCC SEQ ID NO: 16: GGCCCGCCAACACACGAUUACUUGUGAUUGUCCGGCC SEQ ID NO: 17: GGACCUUCAACGCGCGACUACUCGCGAUUGCCCGUCC SEQ ID NO: 18: GGACCGCCAACACACGAUUACUUGUGAUUGCCCGUCC SEQ ID NO: 19: GGACCUUCAACCCGCGAUUACUCGGGAUUGCACGUCC SEQ ID NO: 20: GGACCGCCAACACACGACUACUUGUGAUUGUCCGUCC

[0017] SEQ ID NO: 21: GGACCUUCAUCACGCGAUUACUCGUGAAUGCCCGUCC SEQ ID NO: 22: GGACCGCCAACAAACGAUUACUUUUGAUUGUCCGUCC SEQ ID NO: 23: GGACCUUCAACCCGCGGCUACUCGGGAUUGCCCGUCC SEQ ID NO: 24: GACCUUCAACCCGCGGCUACUCGGGAUUGCCCGUC SEQ ID NO: 25: GGACCGUCAACACGCGACUACUCGUGAUUGCCCGUCC SEQ ID NO: 26: GGACCUCCAACACGCGACUACUCGUGAUUGCCCGUCC SEQ ID NO: 27: GGACCUUCAACACGCGACGACUCGUGAUUGCCCGUCC SEQ ID NO: 28: GGACCUUCAACACGCGACUACCCGUGAUUGCCCGUCC SEQ ID NO: 29: GGACCUUCAACACGCGACUACUCGUGAUUGCACGUCC

[0018] The anti-IL-21 aptamer, which is the active ingredient of the pharmaceutical of the present invention, may be an aptamer that contains a base sequence in which one or several nucleotides have been substituted, deleted, inserted, or added in the aptamer containing the base sequence shown in SEQ ID NOs: 1 to 29, and that binds to human IL-21 and inhibits the activity of human IL-21. The number of substituted, deleted, inserted, or added nucleotides is not particularly limited, and may be, for example, 5, 4, 3, 2, or 1.

[0019] The anti-IL-21 aptamer may be a conjugate of multiple aptamers of one type selected from the aptamers comprising the nucleotide sequences shown in SEQ ID NOs: 1 to 29, or may be a conjugate containing at least one of each of two or more types of aptamers selected from the aptamers comprising the nucleotide sequences shown in SEQ ID NOs: 1 to 29.

[0020] Each nucleotide contained in the anti-IL-21 aptamer may be the same or different, and may be a nucleotide containing a hydroxy group at the 2'-position of ribose (i.e., a natural ribonucleotide), or a nucleotide in which the hydroxy group at the 2'-position of ribose has been substituted (modified) with any atom or group. Examples of such an atom or group include a hydrogen atom, a fluorine atom, an —O-alkyl group (e.g., an —O-Me group), an —O-acyl group (e.g., an —O-CHO group), an amino group (e.g., an —NH ２ Examples include:

[0021] The anti-IL-21 aptamer may have polyethylene glycol (PEG) attached to its terminal. The molecular weight of the PEG is not particularly limited and may be 1,000 to 100,000, or 30,000 to 90,000. The PEG may be linear or branched into two or more chains.

[0022] The medicament of the present invention can be used for the prevention and / or treatment of pulmonary hypertension, and is particularly suitable for the prevention and / or treatment of pulmonary arterial hypertension (PAH).

[0023] The medicament of the present invention can be formulated by appropriately blending pharmaceutically acceptable carriers or additives according to known methods for producing pharmaceutical preparations (e.g., methods described in the Japanese Pharmacopoeia, etc.). Specific examples include oral or parenteral preparations such as tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (including soft capsules and microcapsules), troches, syrups, liquids, emulsions, suspensions, controlled-release preparations (e.g., immediate-release preparations, sustained-release preparations, sustained-release microcapsules, etc.), aerosols, films (e.g., orally disintegrating films, oral mucosal patch films, etc.), injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections, etc.), drip infusions, transdermal preparations, ointments, lotions, patches, suppositories (e.g., rectal suppositories, vaginal suppositories, etc.), pellets, nasal preparations, pulmonary preparations (inhalants), and eye drops. The blending ratio of the carrier or additive can be appropriately set based on the range usually adopted in the pharmaceutical field. The carrier or additive that can be blended is not particularly limited, and examples thereof include various carriers such as water, physiological saline, other aqueous solvents, aqueous or oily bases, and various additives such as excipients, binders, pH adjusters, disintegrants, absorption enhancers, lubricants, colorants, flavorings, and fragrances.

[0024] Examples of additives that can be incorporated into tablets, capsules, etc. include binders such as gelatin, cornstarch, tragacanth, and gum arabic; fillers such as crystalline cellulose; bulking agents such as cornstarch, gelatin, and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose, or saccharin; and flavorings such as peppermint, saffron oil, and cherry. When the dosage unit is a capsule, the above-mentioned materials may further contain a liquid carrier such as an oil or fat. Sterile compositions for injection can be prepared according to standard formulation procedures (e.g., dissolving or suspending the active ingredient in a solvent such as water for injection or natural vegetable oil). Aqueous solutions for injection include, for example, physiological saline, isotonic solutions containing glucose or other adjuvants (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), and the like, which may be used in combination with appropriate solubilizing agents such as alcohols (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80, HCO-50, etc.). As the oily liquid, for example, sesame oil, soybean oil, etc. are used, and may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. Furthermore, the liquid may be blended with a buffer (e.g., phosphate buffer, sodium acetate buffer, etc.), a soothing agent (e.g., benzalkonium chloride, procaine hydrochloride, etc.), a stabilizer (e.g., human serum albumin, polyethylene glycol, etc.), a preservative (e.g., benzyl alcohol, phenol, etc.), an antioxidant, etc.

[0025] The administration route of the medicament of the present invention is not particularly limited, but subcutaneous administration is preferably used. It has been confirmed that the medicament of the present invention exhibits superior therapeutic effects when administered subcutaneously compared to administration by other routes. When administered as a medicament for subcutaneous administration, it can be administered in the form of an injection.

[0026] The anti-IL-21 aptamer has low toxicity and can be safely administered to humans and other mammals (e.g., rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.). The content of the anti-IL-21 aptamer in the formulation varies depending on the dosage form, administration method, carrier, etc., but is usually 0.01 to 100% (w / w) of the total amount of the formulation, and may be 0.1 to 95% (w / w).

[0027] The dosage of the anti-IL-21 aptamer varies depending on the severity of the disease, the drug tolerance, body weight, age, etc. of the subject, but is typically about 0.001 to about 50 mg / kg of the active ingredient per day for an adult, or may be about 0.01 to about 10 mg / kg, or may be about 0.1 to about 1 mg / kg. The administration frequency is selected from once per day to once per 28 days. The administration frequency may be once per day to once per 21 days, once per day to once per 14 days, or once per day to once per 7 days.

[0028] The medicament of the present invention may be used in combination with a known therapeutic agent for pulmonary hypertension. Known therapeutic agents for pulmonary hypertension include endothelin receptor antagonists, phosphodiesterase (PDE) 5 inhibitors, soluble guanylate cyclase (sGC) stimulators, prostacyclin (PGI ２ ) preparations, prostacyclin receptor (IP receptor) agonists, etc. Endothelin receptor antagonists include, for example, bosentan, ambrisentan, macitentan, etc. Phosphodiesterase 5 inhibitors include, for example, sildenafil, tadalafil, etc. Soluble guanylate cyclase stimulators include, for example, riociguat, etc. Prostacyclin preparations include, for example, epoprostenol, selexipag, beraprost, iloprost, treprostinil, etc.

[0029] The medicament of the present invention and the known therapeutic agent for pulmonary hypertension may be administered to a subject simultaneously or at different times. As used herein, "administered in combination" means that the administration of the medicament of the present invention and the known therapeutic agent for pulmonary hypertension overlap, and does not require simultaneous administration. The time difference between the start of administration of the medicament of the present invention and the start of administration of the known therapeutic agent for pulmonary hypertension is not particularly limited, and may be 1 day or more, 2 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, or 7 days or more. The dose of the known therapeutic agent for pulmonary hypertension may be similar to the dose used in clinical practice and can be appropriately selected depending on the subject, age and weight of the subject, symptoms, administration time, dosage form, administration method, combination, etc.

[0030] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0031] [Materials and Methods] (1) Experimental Animals. All experiments were performed on 6-week-old Sprague-Dawley (SD) rats purchased from Charles River Japan. For hypoxia, rats were continuously housed in a hypoxic chamber at 10% oxygen for 3 weeks, with the exception of opening the chamber for approximately 5 minutes twice a week for cleaning. Hypoxic gas was continuously delivered to the hypoxic chamber at a flow rate of 7 L / min. All rats were housed in a 24±1°C animal room with a 12-hour light / 12-hour dark cycle and provided with standard rat chow and water unless otherwise noted.

[0032] (2) Creation of a Rat Model of Severe Pulmonary Hypertension The SuHx rat model (Abe et al., Circulation 121, 2747, 2010) was used as a rat model of severe pulmonary hypertension. The SuHx rat model was created as previously described. Six-week-old SD rats were subcutaneously administered 20 mg / kg of SU5416 and housed in a hypoxic chamber with 10% oxygen for 3 weeks. They were then removed from the hypoxic chamber and housed under normoxic conditions for 5 weeks.

[0033] (3) Anti-rat IL-21 aptamer The anti-rat IL-21 aptamer specifically inhibits the activity of rat IL-21 by binding to it. In this example, the anti-rat IL-21 aptamer (ILba15-6Rb-10-21-53-3'P) provided by Ribomic Co., Ltd. was used. The aptamer was diluted to the specified concentration with a 5% glucose solution before use.

[0034] The sequence of the anti-rat IL-21 aptamer (ILba15-6Rb-10-21-53-3'P) contains the nucleotide sequence shown in SEQ ID NO: 30 (GGAGACCUCCUCUGCCACCAAGCUGCAAGGUGGAUCCAGACGCU), provided by Ribomic Co., Ltd. ILba15-6Rb-10-21-53-3'P further contains nucleotides modified with fluorine atoms or O-methyl groups, and has a structure in which polyethylene glycol (PEG) is attached to the 3' end. The structure of ILba15-6Rb-10-21-53-3'P is shown below. G(M)G(M)A(M)G(M)A(M)C(M)C(M)U(M)C(M)C(M)U(M)C(M)U(F)GC(M)C(M)A(M)C(M)C(F)A(M)A(M)G(M)C(F)U(F)GC(F)AAG(M)G(M)U(M)G(M)G(M)A(M)U(F)C(M)C(M)AG(M)A(M)C(F)G(M)C(M)U(M)_N(6)_X (where (F) and (M) represent modifications at the 2' position of the ribose in the RNA nucleotide, F represents a fluorine atom, and M represents an O-methyl group. N(6) represents an amino C6 linker, and X represents 40 kDa polyethylene glycol.)

[0035] (4) Right ventricular systolic pressure measurement. Anesthesia was induced with 3% isoflurane inhalation, and the trachea was incised and a ventilator attached. Respiratory control was performed with a tidal volume of 8-10 μL / g and a frequency of 60-80 breaths / min. Anesthesia was maintained with 1.5-2% isoflurane inhalation. The body temperature of the rats was maintained at 37-38°C during hemodynamic measurements using a thermostatically controlled heat pad linked to a rectal temperature monitor.

[0036] An 18-gauge BD AngioCut (trade name, intravenous catheter) was inserted into the right external jugular vein and advanced to the right ventricle to measure right ventricular pressure (RVP). The RVP signal was detected by a pressure transducer (MLT0670; AD Instruments), relayed to a pressure amplifier (ML117; AD Instruments), continuously sampled using a Power Lab system (AD Instruments, Colorado Springs, CO), and recorded on a computer using Chart software (AD Instruments). Mean arterial pressure (MAP) was measured using the same system as the venous catheter, using a polyethylene tube inserted into the right internal carotid artery before venous catheter insertion. Heart rate (HR) was calculated from the systolic peak of the arterial pressure waveform. Measurements were performed when MAP was ≥ 50 mmHg and heart rate was 200–500 beats / min. Measurements were excluded if MAP was less than 50 mmHg or HR was less than 200 beats / min.

[0037] (5) Right ventricle / left ventricle + septum weight ratio After hemodynamic measurements using a right heart catheter, rats were euthanized by exsanguination through the inferior vena cava, perfused with saline through the right heart catheter, and the left atrium was incised to remove blood. The hearts were excised, the atria were removed, and the right ventricle (RV) was separated from the left ventricle (LV) and septum. After blotting, the weights of the right ventricle and the left ventricle + septum were measured, and the weight ratio (RV / LV + septum ratio) was calculated to evaluate right ventricular hypertrophy.

[0038] (6) Histological Analysis. Lungs were harvested for histological analysis. Tracheas were perfused with 4% paraformaldehyde (PFA) and fixed under conditions that resulted in airway distention. Resected lung samples were fixed overnight in 4% PFA at 4°C, then replaced with PBS, paraffin-embedded, and sliced ​​at 4 μm thickness. For morphological analysis of pulmonary vessels, Elastica van Gieson staining and hematoxylin-eosin staining were performed. Images of pulmonary vessels were captured using a ScanScope CS (Leica) or NanoZoomer (Hamamatsu Photonics). Morphological analysis was performed using lung sections from randomly selected animals in each experimental group. Pulmonary vascular remodeling was assessed using the neointimal area index of the vascular lumen. The target vessels were pulmonary arteries in the lung parenchyma, small arteries at the terminal bronchioles, and arterioles at the pulmonary lobule level, with diameters of 30-100 μm. At least 40 vessels were selected for evaluation in each treatment group. The diameter of the middle pulmonary artery was determined using an Aperio ImageScope (Leica). The neointimal area index of the vascular lumen was calculated for each vessel as follows: no neointimal lesions (open), intimal lesions covering less than 50% of the vascular lumen (partially closed), or intimal lesions covering more than 50% of the vascular lumen (closed). The proportion of vessels in each group was evaluated.

[0039] (6) Statistical analysis All data are expressed as mean ± standard error. Significant differences between multiple groups were tested using one-way ANOVA and the Turkey-Kramer method. Differences between two groups were analyzed using the Student t-test. A P value of less than 0.05 was considered statistically significant. * indicates P<0.05, ** indicates P<0.01, and *** indicates P<0.001.

[0040] Example 1: Therapeutic Effect of Anti-Rat IL-21 Aptamer on Severe Pulmonary Hypertension in a Rat Model. The experimental protocol is shown in Figure 1. In the aptamer group, the anti-rat IL-21 aptamer was intraperitoneally administered (1 mg / kg / 3 days) to SuHx rat models every three days for three weeks, starting five weeks (5 weeks) after SU5416 administration (0 weeks). In the vehicle group, the vehicle (5% glucose solution) was intraperitoneally administered to SuHx rat models every three days for three weeks, starting at 5 weeks. In the control group, rats maintained under normoxic conditions throughout the experiment were intraperitoneally administered 5% glucose solution every three days for three weeks, starting at 5 weeks. Right ventricular systolic pressure was measured eight weeks after the start of the experiment (8 weeks). The rats were euthanized, and the hearts and lungs were excised. The tissue weights were measured and subjected to histological analysis.

[0041] The results are shown in Figure 2 (A) to (E). (A) shows right ventricular systolic pressure (RVSP), (B) shows right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) shows Elastica-van Gieson staining image of the pulmonary artery (EVG), (D) shows pulmonary artery medial thickening index, and (E) shows pulmonary artery obstruction rate. In the vehicle group (vehicle), right ventricular systolic pressure, right ventricle / left ventricle + septum weight ratio, and pulmonary artery medial thickening index were all significantly elevated compared to the control group (NOR), and the pulmonary artery obstruction rate was also increased. In contrast, the aptamer group (Aptamer) demonstrated significant suppression of pulmonary hypertension pathology.

[0042] Example 2: Therapeutic Effect of Anti-Rat IL-21 Aptamer Administration Route in a Rat Model of Severe Pulmonary Hypertension. The experimental protocol is shown in Figure 3. In the aptamer group, the anti-rat IL-21 aptamer (1 mg / kg / 3 days) was administered to SuHx rat models every three days for five weeks, starting three weeks after SU5416 administration (0 week). In the vehicle group, the vehicle (5% glucose solution) was administered to SuHx rat models every three days for five weeks, starting three weeks after SU5416 administration (0 week). In the control group, rats maintained under normoxic conditions were administered a 5% glucose solution every three days for five weeks, starting three weeks after SU5416 administration. Administration routes included intraperitoneal (ip), subcutaneous (sc), intravenous (iv), and intratracheal (it). The control group received only intraperitoneal administration. Eight weeks after the start of the experiment (8w), right ventricular systolic pressure was measured, blood was collected, and the rats were euthanized, their hearts and lungs were removed, and tissue weights were measured and subjected to histological analysis. Plasma and a portion of the right upper lobe of the lung were also used to measure aptamer concentrations. Blood and lung tissue were collected two days after the final administration.

[0043] The results for right ventricular systolic pressure (RVSP) are shown in Figure 4. Significant inhibitory effects were confirmed in the intraperitoneal and subcutaneous aptamer administration groups compared to the vehicle group. The results for the right ventricle / left ventricle + septum weight ratio (RV / LV+S) are shown in Figure 5. Significant inhibitory effects were confirmed in the intraperitoneal, subcutaneous, and intravenous aptamer administration groups compared to the vehicle group. The results for vascular occlusion rate are shown in Figure 6. Significant reductions in vascular occlusion rate were confirmed in the intraperitoneal and subcutaneous aptamer administration groups compared to the vehicle group. These results confirmed that the subcutaneous aptamer administration group exhibited a significant inhibitory effect on pulmonary hypertension pathology comparable to that of the intraperitoneal aptamer administration group.

[0044] Measurements of plasma and right upper lobe aptamer concentrations in the subcutaneous, intravenous, and intratracheal administration groups were performed by Ribomic Corporation, and the results are shown in Figure 7. Plasma and lung tissue homogenate supernatants were used as samples, and quantification was performed using the ELOSA (hybridization) method according to the method described by Judith M. Healy et al. (Pharmaceutical Research, December 2004, Volume 21, Issue 12, pp. 2234-2246). Plasma and right upper lobe aptamer concentrations were both higher after intravenous administration than after subcutaneous administration. This indicates that there is no positive correlation between plasma and right upper lobe aptamer concentrations and the inhibitory effect on pulmonary hypertension.

[0045] Example 3: Dose-Response Study of Subcutaneous Administration of Anti-Rat IL-21 Aptamer The experimental protocol is shown in Figure 8. In the aptamer group, the anti-rat IL-21 aptamer was administered to SuHx rat models every three days for five weeks, starting three weeks after SU5416 administration (0 week). Five dose levels were established: 0.1 μg / kg, 1 μg / kg, 10 μg / kg, 100 μg / kg, and 1000 μg / kg. In the vehicle group, the vehicle (5% glucose solution) was administered to SuHx rat models every three days for five weeks, starting at week 3. In the control group, rats maintained under normoxic conditions throughout the entire study period received a 5% glucose solution every three days for five weeks, starting at week 3. Eight weeks (8w) after the start of the experiment, right ventricular systolic pressure was measured, the rats were euthanized, the hearts and lungs were excised, the tissue weights were measured, and the tissues were subjected to tissue analysis.

[0046] The results are shown in Figure 9 (A) to (D). (A) shows right ventricular systolic pressure (RVSP), (B) shows the right ventricle / left ventricle plus septum weight ratio (RV / LV+S), (C) shows the vascular occlusion rate, and (D) shows the percentage of occluded blood vessels. The aptamer group significantly suppressed the increase in right ventricular systolic pressure (RVSP) at doses of 10 μg / kg / 3 days and 1000 μg / kg / 3 days. The aptamer group also significantly reduced the vascular occlusion rate at doses of 10 μg / kg / 3 days and 1000 μg / kg / 3 days.

[0047] Example 4: Therapeutic Effect of Anti-Rat IL-21 Aptamer and Endothelin Receptor Antagonist (ERA) in a Rat Model of Severe Pulmonary Hypertension. The experimental protocol is shown in Figure 10. Macitentan (MedChemExpress) was used as the ERA. Five groups were established: an anti-rat IL-21 aptamer group, an ERA group, a combination group, a vehicle group, and a control group. The SuHx rat model was administered SU5416 (0w) followed by a 3-week treatment period starting 5 weeks later (5w). The anti-rat IL-21 aptamer and combination groups received subcutaneous administration of the anti-rat IL-21 aptamer (1 mg / kg) every 3 days, while the ERA and vehicle groups received subcutaneous administration of a 5% glucose solution every 3 days. The ERA and combination groups received ERA in their diets, while the anti-rat IL-21 aptamer and vehicle groups received powdered standard rat chow. The rats were fed ad libitum using a Roden Cafe (Oriental Yeast) feeder. The daily ERA dose calculated based on food intake was approximately 30 mg / kg / day. The control group consisted of rats maintained under normoxic conditions throughout the experiment. Right ventricular systolic pressure was measured 8 weeks after the start of the experiment (8 w), and the rats were euthanized, their hearts and lungs were removed, and their tissue weights were measured before being subjected to histological analysis.

[0048] The results are shown in Figure 11 (A) to (E). (A) shows right ventricular systolic pressure (RVSP), (B) shows the right ventricle / left ventricle plus septum weight ratio (RV / LV+S), (C) shows Elastica-van Gieson stained images of the pulmonary artery (EVG), (D) shows the vascular occlusion rate, and (E) shows the percentage of occluded blood vessels. Both the aptamer-administered group and the ERA-administered group significantly suppressed each pulmonary hypertension pathology. Furthermore, the aptamer-ERA combination group showed an additive effect in suppressing pulmonary hypertension pathology.

[0049] Example 5: Therapeutic Effect of Anti-Rat IL-21 Aptamer and Soluble Guanylate Cyclase (sGC) Stimulator in a Rat Model of Severe Pulmonary Hypertension. The experimental protocol is shown in Figure 12. BAY41-2272 (Selleck) was used as the sGC stimulator. Five groups were established: an anti-rat IL-21 aptamer group, an sGC stimulator group, a combination group, a vehicle group, and a control group. In the SuHx rat model, SU5416 was administered for three weeks starting five weeks (5w) after administration of SU5416 (0w). The anti-rat IL-21 aptamer and combination groups received subcutaneous administration of the anti-rat IL-21 aptamer (1 mg / kg) every three days. The ERA and vehicle groups received subcutaneous administration of 5% glucose solution every three days. The sGC-treated and combination-treated groups received sGC stimulators in their diets, while the anti-rat IL-21 aptamer and vehicle groups were fed powdered standard rat chow. Feed was provided ad libitum using Roden Cafe (Oriental Yeast) feeders. The daily dose of sGC stimulator, calculated based on food intake, was approximately 10 mg / kg / day. The control group consisted of rats maintained under normoxic conditions throughout the entire experiment. Right ventricular systolic pressure was measured 8 weeks after the start of the experiment (8w), and the rats were euthanized. The hearts and lungs were removed, tissue weights were measured, and the tissues were subjected to histological analysis.

[0050] The results are shown in Figure 13 (A) to (E). (A) Right ventricular systolic pressure (RVSP), (B) right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) Elastica-van Gieson staining image of the pulmonary artery (EVG), (D) vascular occlusion rate, and (E) occluded vessel rate. (Replaced.) Furthermore, the combination of the aptamer and sGC stimulator demonstrated an additive effect in suppressing pulmonary hypertension pathology.

[0051] Example 6: Therapeutic Effect of Anti-Rat IL-21 Aptamer and Prostacyclin Receptor (IP Receptor) Agonist in a Rat Model of Severe Pulmonary Hypertension. The experimental protocol is shown in Figure 14. Selexipag (MedChemExpress) was used as the IP receptor agonist. Five groups were established: an anti-rat IL-21 aptamer group, an IP receptor agonist group, a combination group, a vehicle group, and a control group. SU5416 administration was administered to the SuHx rat model for three weeks, beginning five weeks after administration (5 weeks) of SU5416 (0 weeks). The anti-rat IL-21 aptamer and combination groups received subcutaneous administration of the anti-rat IL-21 aptamer (1 mg / kg) every three days. The IP receptor agonist and vehicle groups received subcutaneous administration of 5% glucose solution every three days for three weeks, beginning 5 weeks. The IP receptor agonist and combination groups received the IP receptor agonist in their diets. The anti-rat IL-21 aptamer and vehicle groups were fed standard powdered rat chow. Feed was provided ad libitum using Roden Cafe (Oriental Yeast) in the feeder. The daily dose of sGC stimulant, calculated based on food intake, was approximately 30 mg / kg / day. The control group consisted of rats maintained under normoxic conditions throughout the entire experiment. Right ventricular systolic pressure was measured 8 weeks after the start of the experiment (8w), and the rats were euthanized. The hearts and lungs were removed, tissue weights were measured, and the tissues were subjected to histological analysis.

[0052] The results are shown in Figure 15 (A) to (E). (A) Right ventricular systolic pressure (RVSP), (B) right ventricle / left ventricle + septum weight ratio (RV / LV+S), (C) Elastica-van Gieson staining image of the pulmonary artery (EVG), (D) vascular occlusion rate, and (E) vascular occlusion rate. The combination of the aptamer and IP receptor agonist significantly suppressed each pulmonary hypertension pathology. Furthermore, the additive effects of the aptamer and IP receptor agonist were observed in suppressing the increase in the right ventricle / left ventricle + septum weight ratio (RV / LV+S) and reducing the vascular occlusion rate.

[0053] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of the claims. The technical scope of the present invention also includes embodiments obtained by appropriately combining the technical means disclosed in different embodiments. Furthermore, all academic literature and patent documents described in this specification are incorporated herein by reference.

Claims

1. A pharmaceutical for preventing and / or treating pulmonary hypertension, which contains as an active ingredient an aptamer that binds to interleukin-21 and is administered subcutaneously.

2. The pharmaceutical composition according to claim 1, wherein the single dose of the aptamer is 0.001 mg / kg to 50 mg / kg.

3. The pharmaceutical composition according to claim 1, wherein the administration frequency is selected from once per day to once per 28 days.

4. The pharmaceutical composition according to claim 1, wherein the pulmonary hypertension is pulmonary arterial hypertension.

5. The pharmaceutical agent according to any one of claims 1 to 4, which is administered in combination with an endothelin receptor antagonist.

6. The pharmaceutical agent according to any one of claims 1 to 4, which is administered in combination with a soluble guanylate cyclase stimulant.

7. The pharmaceutical agent according to any one of claims 1 to 4, which is administered in combination with a prostacyclin receptor agonist.