Novel poly(a)-specific ribonuclease (PARN) nuclease activity inhibitors and methods of use thereof

Abstract

The present invention is directed to novel small-molecule inhibitors of PARN that were identified through high-throughput screening (HTS) of small molecule targets.

Description

[0001] NOVEL POLY(A)-SPECIFIC RIBONUCLEASE (PARN) NUCLEASE ACTIVITY INHIBITORS AND METHODS OF USE THEREOF

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This International PCT application claims the benefit of and priority to U.S. Provisional Application No. 63 / 446,235, filed February 16, 2023, the specification, claims and drawings of which are incorporated herein by reference in their entirety.

[0004] STATEMENT OF GOVERNMENT INTEREST

[0005] This invention was made with government support under grant number AT012346 awarded by the National Institutes of Health. The government has certain rights in the invention. TECHNICAL FIELD

[0006] The invention relates to novel inhibitors of Poly(A)-specific ribonuclease (PARN) and their methods of therapeutic use, preferably for the treatment of cancer.

[0007] BACKGROUND

[0008] Poly(A)-specific ribonuclease (PARN) is a 3’ to 5’ exonuclease that removes poly(A) or oligo(A) tails from the 3’ ends of RNAs. PARN is expressed ubiquitously in almost all tissues of eukaryotic organisms and has multiple functions in eukaryotes. In human cells, PARN primarily functions in an adenyl ation / deadenylati on regulatory pathway that regulates the decay rate of noncoding RNAs (ncRNAs) (Figure 1). In this pathway, Y RNAs, snoRNAs, the human telomerase RNA (hTR), and some miRNAs can be oligoadenylated by noncanonical poly(A) polymerase such as the paralogs PAPD5 and PAPD7. The presence of the oligo(A) tail can then recruit processive sequence-independent 3’ to 5’ exonucleases to degrade ncRNAs. Alternatively, the oligoadenylated tail can be removed by adenosine specific 3’ to 5’ exonucleases such as PARN to maintain stability of ncRNAs. Thus, when PARN is inhibited or defective, some ncRNAs are more rapidly degraded, including hTR.

[0009] PARN also stabilizes some miRNAs by removing poly(A) tails added by PAPD5, which prevents the recruitment of exonucleases DIS3L or DIS3L2 to degrade miRNAs. Importantly, several PARN-regulated miRNAs (miR-380-5p, miR-1285, miR-92, miR-214, miR-485, miR- 331, miR-665, miR-3126, and miR-25) either have been shown, or are predicted, to target the TP53 mRNA. P53 is tumor suppressor that prevents outgrowth of aberrant cells by inducing cell-cycle arrest, DNA repair or programmed cell death. It has been shown that numerous human cancers increase proliferation and resistance to DNA-damage agents by downregulating the p53 pathway. Moreover, depletion of PARN upregulates p53 and sensitizes cells to chemotherapeutic agents. Thus, inhibition of PARN might be an effective intervention to induce the expression of p53 in some tumors and thereby limit tumor progression.

[0010] Currently, only a limited number of PARN inhibitors exist. However, such known PARN inhibitors are only effective at high concentrations, or unable to enter cells. Thus, there exists a long-felt need for effective and bioavailable PARN inhibitors that can be applied in therapeutic setting. As detailed below, Applicant identified novel small-molecule inhibitors of PARN through high-throughput screening (HTS) of small molecule targets from a small molecule library of adenosine analogs. The combination of these two approaches allowed Applicants to identify three preferred lead compounds that inhibit PARN in vitro and also repress PARN activity in vivo.

[0011] SUMMARY OF THE INVENTION

[0012] Poly(A)-specific ribonuclease (PARN) is a 3 ’-exoribonuclease that removes poly(A) tails from the 3’ end of RNAs. PARN is known to deadenylate some ncRNAs, including hTR, YRNAs, and some miRNAs and thereby enhance their stability by limiting the access of 3’ to 5’ exonucleases recruited by oligo(A) tails. Several PARN-regulated miRNAs target p53 mRNA, and PARN knockdown leads to an increase of p53 protein levels in human cells. Thus, PARN inhibitors could be used to induce p53 levels in some human tumors and act as a therapeutic strategy to treat cancers caused by repressed p53 protein. Herein, Applicant’s demonstrate high- throughput screening (HTS) methods to identify small molecule inhibitors of PARN, coupled with validation with in vitro and cell-based assays.

[0013] In a preferred aspect, the invention includes one or more novel PARN inhibitors according to the Formulas I-III, or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein. In another preferred aspect, the invention includes a novel PARN inhibitor according to:

[0014] (Formula I), or ( ormu a II).

[0015] In another preferred aspect, the present invention includes novel PARN inhibitors identified herein as the compound according to Formulas I-III, (also referred to as a / the compound(s) or composition(s) of the invention), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein.

[0016] In another preferred aspect, the current invention include a compound of Formula I-III, or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof, for use in the treatment of a disease or conditions, and preferably cancer.

[0017] In another preferred aspect, the current invention include a compound of Formula I-III, or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof, for use in the treatment of cancer, and preferably a cancer having repressed p53 protein expression.

[0018] In another preferred aspect, the present invention provides systems, methods, and compositions for novel PARN inhibitors according to the compounds of Formula I-III, and a pharmaceutically acceptable carrier, which may preferably further include a method of treatment of the human or animal body using one or more of the novel compounds, or pharmaceutical compositions described herein.

[0019] In another preferred aspect, the present invention provides a method for treating a disease or condition, and preferably cancer, comprising: administering to a subject in need thereof, a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III, or a pharmaceutical composition containing a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III and a pharmaceutically carrier. In another preferred aspect, the present invention provides systems, methods, and compositions for inhibiting PARN activity in a cell, comprising contacting a cell with a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III, or a pharmaceutical composition containing a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III and a pharmaceutically carrier.

[0020] In another preferred aspect, the present invention provides systems, methods, and compositions for upregulating p53 expression in a cell, comprising contacting a cell with therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III, or a pharmaceutical composition containing a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III and a pharmaceutically carrier.

[0021] Additional aspects of the invention may become evident based on the specification and claims presented below.

[0022] BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1: PARN functions in an adenyl ation / deadenylati on regulatory pathway that regulates the decay rate of ncRNAs. ncRNAs could be targeted to adenylation by PAPD5 or deadenylation by PARN. In PARN deficient cells, the presence of oligo(A) tail can recruit 3’ to 5’ exonucleases to degrade ncRNAs

[0024] Figure 2: PARN purification and validation, a) SDS-PAGE gel of the fractions during PARNi -430 purification, b) SDS-PAGE gel of the fractions during PARNmut purification, c) Gel assay showing PARN1-430 and PARNmut’ s activity activity on poly(A) tail RNA at different time points (0-, 10-, 20-, and 30-minute post incubation), PARNmut shows no enzymatic activity on poly(A) RNA. d) Representative gel confirming PARN activity on poly(A) RNA and non-poly(A) RNA after 20 minutes of incubation. Poly(A) tail RNA sequence is a fluorescently labeled RNA with a CCUUUCC followed by a 9 nucleotides oligo(A) tail. Non-poly(a) RNA is a fluorescently labeled RNA with a CCUUUCCGC tail instead of 9 nucleotides oligo(A) tail. Full gels are presented in Fig. 9.

[0025] Figure 3: Developing a fluorescence assay for PARN inhibition, a) Cartoon depicting the inhibition fluorescence assay. Schematic diagram of the fluorescence-based deadenylase assay. The assay is based on a 5' FAM-labelled RNA oligonucleotide substrate. After incubation of the substrate in the presence of PARNi-430, the reaction is stopped and a 3' BHQ-labelled DNA oligonucleotide probe complementary to the RNA substrate is added. The fluorescence of intact substrate is quenched upon probe hybridization because of the proximity of the BHQ fluorophore. In contrast, the BHQ-labelled probe cannot hybridize to the FAM-labelled reaction product allowing detection of FAM fluorescence b) PARN1-430 inhibition assay with fluorescence as a readout with time course for PARN1-430 treatment (73 nM), PARN1-430 inhibition with 2.5 mM AMP, and no-enzyme control. 2-way ANOVA, multiple comparisons test, average + / - SD, n=3 replicates. *P<0.05, **P<0.005, ***P<0.001, ****P<0.0001, n.s. was not indicated c) Doseresponse curve of PARNI-430 enzymatic activity using different PARN1-430 concentrations (36.5 nM-730 nM). Dotted-line represents RNA and RNA+Quencher data. One-way ANOVA, multiple comparisons test, average + / - SD, n>3 replicates. *P<0.05, **P<0.005, ***P<0.001, ****p<0.0001, n.s. was not indicated d) PARNi -430 and PARNmut enzymatic activity measured at different time points. PARN showed an increase in activity versus time while PARNmut showed no activity up to 30 minutes incubation. Dotted-line represents RNA and RNA+Quencher data. 2- way ANOVA, multiple comparisons test, average + / - SD, n=3 replicates. *P<0.05, **P<0.005, ***p<0.001, ****P<0.0001, n.s. was not indicated.

[0026] Figure 4: Testing HTS hits using gel assay. Gels illustrating inhibitory effects of different drugs on PARNi-430. The reaction was performed the same as the fluorescence assay, heat inactivated, then loaded and visualized on gels. Full gels are presented in Supplementary Fig. 9

[0027] Figure 5: TH11, TH15, and TH16 inhibits PARN in cells, a) Representative western blots showing TH11, TH15, and TH16 treatments do not affect PARN level. Hela cells were treated with siPARN (or 10 pM TH11, TH15, or TH16) (scramble siRNA and DMSO as controls) for 2 days before lysed. The blot was blotted against anti-PARN antibody, b) Quantification of the changes in PARN levels of western blot using GAPDH as loading controls. siPARN and drug treatments were normalized to scramble siRNA and DMSO controls, respectively. siPARN and drug treatment data were compared to scr and DMSO data, respectively. One-way ANOVA, multiple comparisons test. Average + / -SD, N=3 biological replicates, n =1. c) RT-qPCR showing that hTR level reduced in siPARN compared to scr and DMSO controls, respectively. One-way ANOVA, multiple comparisons test, average + / - SD, N=3 biological replicates, n =2. f) Representative northern blot showing that miR-21-5p levels decreased in TH11, TH15, and TH16 treatments. Hela cells were treated with 10 pM of TH1-TH18 (DMSO as control) for 2 days before RNA extraction, d) Quantification of miR-21-5p levels normalized to U1 RNA. One-way ANOVA, multiple comparisons test, average + / - SD, N=3 biological replicates, n =1. e) RT-qPCR showing that hTR levels reduced in siPARN and drug treatments compared to scr and DMSO controls, respectively. One-way ANOVA, multiple comparisons test, average + / - SD, N=3 biological replicates, n =2. For nothern blot and RT-qPCR quantifications, Scr and DMSO controls were independently set to 1 and used as control for siPARN and drug treatments, respectively. *P<0.05, **P<0.005, ***P<0.001, ****P<0.0001, n.s. was not indicated. Full blots are presented in Fig. 9.

[0028] Figure 6: Cell death assay for PARN inhibitors, a) Numbers of cells at 2 days after DMSO and TH1-TH18 treatment. One-way ANOVA, multiple comparisons test, average + / - SD, N=3 biological replicates, n =1, b) Numbers of cells at 0 and 24h-post doxorubicin treatment. Hela cells were treated with siPARN, TH11, TH15, or TH16 for 2 days (scramble siRNA and DMSO as controls) before adding doxorubicin. Cells were collected for quantification after 0- and 24-h post doxorubicin treatment. 2-way ANOVA, multiple comparisons test, average + / - SD, N=3 biological replicates, n =1. *P<0.05, **P<0.005, ***P<0.001, ****P<0.0001, n.s. was not indicated.

[0029] Figure 7: gels illustrating inhibitory effects of different drugs on PARN1-430.

[0030] Figure 8: chemical structures of TH11, TH15, and TH16.

[0031] DETAILED DESCRIPTION OF THE INVENTION

[0032] The invention now being generally described will be more readily understood by reference to the following examples, which are included merely for the purposes of illustration of certain embodiments of the embodiments of the present invention. The examples are not intended to limit the invention, as one of skill in the art would recognize from the above teachings and the following examples that other techniques and methods can satisfy the claims and can be employed without departing from the scope of the claimed invention. Indeed, while this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

[0033] The present invention is directed to the identification of novel PARN inhibitors validated in both in vitro and in vivo systems. Applicants demonstrated that purified PARN and its poly(A) trimming activity was shown to be dose-dependent, which can be measured by a simple fluorescence assay (Figure 3). Using HTS, Applicants found multiples PARN inhibitors using the above referenced fluorescence assay. These together identified at least three (3) novel PARN inhibitors, namely TH11, TH15, and TH16 compounds that inhibit PARN (also referred to as the compounds of Formulas I-III, respectively). TH11, TH15, and TH16 were showed to inhibit PARN in a dose-dependent manner with a IC50 of 3.36, 2, and 7.9 pM, respectively, which are significantly lower compared to AMP (Figure 5d, 6b-d). Applicant’s also observed these compounds’ cause phenotypes consistent with PARN inhibition in cells with a reduction in hTR and miR-21-5p RNA levels similar to PARN KD (Figure 5).

[0034] Selective and effective PARN inhibitors can be a used for cancer treatment. PARN is a processive deadenylase and PARN KD has been shown to upregulate p53 protein in cancer cells, which causes cell-cycle arrest and prevents cell growth and development. Thus, targeting PARN offers a therapeutic approach for repressed p53 -induced cancers. Previous reports have described aminoglycosides, synthetic nucleotides with fluoro-glucopyranosyl sugar moiety and benzoyl- modified cytosine or adenine, glucopyranosyl analogs bearing uracil, 5-fluorouracil, or thymine as base moiety, and purine 2,6-dione derivatives as possible PARN inhibitors (Table 1), although these compounds required relatively high concentrations and / or have not been shown to inhibit PARN activity in cells. Since these previous compounds were either tested with a different substrate (poly(A)) or their IC50s were not determined so it is challenging for a direct comparison between these inhibitors’ effectiveness on PARN’s activity.

[0035] In the present invention Applicants identified TH11, TH15, and TH16 as PARN inhibitors. All the compounds are kinase inhibitors.

[0036] As shown in the figures, compounds of the invention TH11, TH15, and TH16 can inhibit PARN in cells. First, these drug treatments of cells decreased the levels of hTR and miR-21 (Figure 5), as is seen in PARN- deficient cells. Second, Applicant’s observed that TH11, TH15, and TH16 acted similarly to siRNA KD of PARN at increasing cell death in the presence of doxorubicin (Figure 6). Taken together, TH11, TH15, and TH16 can be used to inhibit PARN both in vitro and in cells.

[0037] The present invention includes novel PARN inhibitors identified herein as the compound according to Formulas I-III, or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein.

[0038] Another embodiment of the invention includes a novel PARN inhibitor according to Formula II (also referred to herein as TH11):

[0039]

[0040] (Formula I), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein.

[0041] Another embodiment of the invention includes a novel PARN inhibitor according to Formula III (also referred to herein as TH15):

[0042] (Formula II), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein.

[0043] Another embodiment of the invention includes a novel PARN inhibitor according to Formula III (also referred to herein as TH16): (Formula III), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein.

[0044] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Bond designations showing a bond, denotes different enantiomeric forms, which are specifically claimed. Specifically, where a chemical bond is shown as a “j” the claims and disclosure specifically claims racemic mixtures, as well as the isolated and mixtures of enantiomeric forms of the compound. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a 13C- or 14C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention. The term “stereoisomer” refers to a molecule that is an enantiomer, diastereomer or geometric isomer of a molecule. Stereoisomers, unlike structural isomers, do not differ with respect to the number and types of atoms in the molecule's structure but with respect to the spatial arrangement of the molecule's atoms. Examples of stereoisomers include the (+) and (-) forms of optically active molecules.

[0045] Another embodiment of the invention may include methods of treating a disease or condition, and preferably cancer, in a subject in need thereof, and preferably through the administration of a therapeutically effective amount of a PARN inhibitor of the invention. Another embodiment of the invention may include methods of treating a disease or condition in a subject in need thereof, and preferably through the administration of a therapeutically effective amount of a PARN inhibitor, wherein said PARN inhibitor is a small-molecule inhibitor selected from the group consisting of: Formula I-III, or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof as described herein..

[0046] Another embodiment of the invention may include methods of treating disease or condition in a subject in need thereof, preferably through the administration of a therapeutically effective amount of a PARN inhibitor of the invention which may be co-administered with a different therapy. In this preferred embodiment, the invention include of treating cancer in a subject need thereof, through the administration of a therapeutically effective amount of a PARN inhibitor of the invention which may be co-administered with a cancer therapy, including but not limited to radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy, or a combination thereof. In one preferred embodiment, a PARN inhibitor may include the compound selected from the group consisting of Formulas I-III, which is co-administered with a different cancer therapy.

[0047] A “cancer therapy” may include administration of a therapeutically effective amount of a “chemotherapeutic agent,” which is meant one or more chemical agents used in the treatment or control of proliferative diseases (e.g., cancer). Chemotherapeutic agents include cytotoxic and cytostatic agents. Exemplary chemotherapeutic agents may mediate DNA damage (e.g., alkylating chemotherapeutic agents). Non-limiting examples of chemotherapeutic agents are generally known in the art.

[0048] The present invention includes pharmaceutical compositions comprising a therapeutically effective amount of one or more novel PARN inhibitors of the invention and a pharmaceutically acceptable carrier. The present invention includes pharmaceutical compositions comprising a therapeutically effective amount of one or more novel PARN inhibitors according to the Formulas of I-V, and a pharmaceutically acceptable carrier.

[0049] As used herein, “pharmaceutical compositions” are compositions that include an amount (for example, a unit dosage) of the disclosed compound(s) together with one or more non-toxic pharmaceutically acceptable additives, including carriers, diluents, and / or adjuvants, and optionally other biologically active ingredients. Such pharmaceutical compositions can be prepared by standard pharmaceutical formulation techniques such as those disclosed in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (19th Edition). In another embodiment, a compound of the invention, and a compound according to Formula I-III may be in the form of a pharmaceutically acceptable salt or ester. The terms “pharmaceutically acceptable salt or ester” refers to salts or esters prepared by conventional means that include salts, e.g., of inorganic and organic acids, including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, malic acid, acetic acid, oxalic acid, tartaric acid, citric acid, lactic acid, fumaric acid, succinic acid, maleic acid, salicylic acid, benzoic acid, phenylacetic acid, mandelic acid, and the like.

[0050] As used herein, “therapeutically effective amount” of the disclosed compound, which may preferably be a compound according to Formula I-III, is a dosage of the compound that is sufficient to achieve a desired therapeutic effect, such as inhibition of or PARN, increase in p53, or treatment of a disease or disorder such as cancer. In some examples, a therapeutically effective amount is an amount sufficient to achieve tissue concentrations at the site of action that are similar to those that are shown to inhibit PARN expression or activity in tissue culture, in vitro, or in vivo. In some examples, a therapeutically effective amount is an amount sufficient to achieve tissue concentrations at the site of action that are similar to those that are shown to modulate expression of For example, a therapeutically effective amount of a compound of the invention, such as a compound according to Formula I-III, may be such that the subject receives a dosage of less than or about 0.1 pg / kg body weight / day to about 1000 mg / kg body weight / day, for example, a dosage of about 1 pg / kg body weight / day to about 1000 pg / kg body weight / day, such as a dosage of about 5 pg / kg body weight / day to about 500 pg / kg body weight / day, or more.

[0051] The terms “individual,” “subject,” and “patient,” used interchangeably herein, refer to a mammal, including, but not limited to, murines, simians, humans, mammalian farm animals, mammalian sport animals, and mammalian pets. Preferably, the subject herein is human. As used herein, the phrase “in need thereof’ means that the animal or mammal has been identified as having a need for the particular method or treatment. In some embodiments, the identification can be by any means of diagnosis. In any of the methods and treatments described herein, the animal or mammal can be in need thereof. In some embodiments, the animal or mammal is in an environment or will be traveling to an environment in which a particular disease, disorder, or condition is prevalent.

[0052] Such pharmaceutical compositions / formulations are useful for administration to a subject, in vivo or ex vivo. Pharmaceutical compositions and formulations include carriers or excipients for administration to a subject. As used herein the terms “pharmaceutically acceptable” and “physiologically acceptable” mean a biologically compatible formulation, gaseous, liquid, or solid, or mixture thereof, which is suitable for one or more routes of administration, in vivo delivery, or contact. Such formulations include solvents (aqueous or non-aqueous), solutions (aqueous or nonaqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions and suspensions may include suspending agents and thickening agents. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powder, granules, and crystals. Supplementary active compounds (e.g., preservatives, antibacterial, antiviral, and antifungal agents) can also be incorporated into the compositions. The formulations may, for convenience, be prepared or provided as a unit dosage form. In general, formulations are prepared by uniformly and intimately associating the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. For example, a tablet may be made by compression or molding. Compressed tablets may be prepared by compressing, in a suitable machine, an active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface-active or dispersing agent. Molded tablets may be produced by molding, in a suitable apparatus, a mixture of powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide a slow or controlled release of the active ingredient therein.

[0053] In certain embodiment, a “pharmaceutically acceptable carrier” includes a “pharmaceutically acceptable salt” which refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and other animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. The salts can be prepared during the final isolation and purification of the compounds or separately by reacting the appropriate compound in the form of the free base with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, L-ascorbate, aspartate, benzoate, benzenesulfonate (besylate), bisulfate, butyrate, camphorate, camphorsulfonate, citrate, digluconate, formate, fumarate, gentisate, glutarate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hippurate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethansulfonate (isethionate), lactate, maleate, malonate, DL-mandelate, mesitylenesulfonate, methanesulfonate, naphthylenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, phosphonate, picrate, pivalate, propionate, pyroglutamate, succinate, sulfonate, tartrate, L-tartrate, tri chloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, para-toluenesulfonate (p-tosylate), and undecanoate. Also, basic groups in the compounds disclosed herein can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dimethyl, diethyl, dibutyl, and diamyl sulfates; decyl, lauryl, myristyl, and steryl chlorides, bromides, and iodides; and benzyl and phenethyl bromides. Examples of acids which can be employed to form therapeutically acceptable salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid; and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid. “Basic addition salts” refer to salts derived from appropriate bases, these salts including alkali metal, alkaline earth metal, and quaternary amine salts. Hence, the present invention contemplates sodium, potassium, magnesium, and calcium salts of the compounds disclosed herein, and the like. Basic addition salts can be prepared during the final isolation and purification of the compounds, often by reacting a carboxyl group with a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation or with ammonia or an organic primary, secondary, or tertiary amine. The cations of therapeutically acceptable salts include lithium, sodium (by using, e.g., NaOH), potassium (by using, e.g., KOH), calcium (by using, e.g., Ca(0H)2), magnesium (by using, e.g., Mg(0H)2 and magnesium acetate), zinc, (by using, e.g., Zn(0H)2 and zinc acetate), and aluminum, as well as nontoxic quaternary amine cations such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N-dibenzylphenethylamine, 1 -ephenamine, and N,N-dibenzylethylenediamine. Other representative organic amines useful for the formation of base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, choline hydroxide, hydroxyethyl morpholine, hydroxyethyl pyrrolidone, imidazole, n-methyl-d-glucamine, N,N'- dibenzylethylenediamine, N,N'-di ethyl ethanolamine, N,N'-dimethylethanolamine, triethanolamine, and tromethamine. Basic amino acids (e.g., 1 -glycine and 1 -arginine) and amino acids which may be zwitterionic at neutral pH (e.g., betaine (N,N,N-trimethylglycine)) are also contemplated.

[0054] Cosolvents and adjuvants may be added to the formulation. Non-limiting examples of cosolvents contain hydroxyl groups or other polar groups, for example, alcohols, such as isopropyl alcohol; glycols, such as propylene glycol, polyethyleneglycol, polypropylene glycol, glycol ether; glycerol; polyoxyethylene alcohols and polyoxyethylene fatty acid esters. Adjuvants include, for example, surfactants such as, soya lecithin and oleic acid; sorbitan esters such as sorbitan trioleate; and polyvinylpyrrolidone. Supplementary active compounds (e.g., preservatives, antioxidants, antimicrobial agents including biocides and biostats such as antibacterial, antiviral, and antifungal agents) can also be incorporated into the compositions. Preservatives and other additives include, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases (e.g., nitrogen). Pharmaceutical compositions may therefore include preservatives, antimicrobial agents, antioxidants, chelating agents, and inert gases.

[0055] Preservatives can be used to inhibit microbial growth or increase stability of the active ingredient thereby prolonging the shelf life of the pharmaceutical formulation. Suitable preservatives are known in the art and include, for example, EDTA, EGTA, benzalkonium chloride or benzoic acid or benzoates, such as sodium benzoate. Antioxidants include, for example, ascorbic acid, vitamin A, vitamin E, tocopherols, and similar vitamins or provitamins.

[0056] Pharmaceutical compositions can optionally be formulated to be compatible with a particular route of administration. Exemplary routes of administration include administration to a biological fluid, an immune cell (e.g., T or B cell) or tissue, mucosal cell or tissue (e.g., mouth, buccal cavity, labia, nasopharynx, esophagus, trachea, lung, stomach, small intestine, vagina, rectum, or colon), neural cell or tissue (e.g., ganglia, motor or sensory neurons) or epithelial cell or tissue (e.g., nose, fingers, ears, cornea, conjunctiva, skin or dermis). Thus, pharmaceutical compositions include carriers (excipients, diluents, vehicles, or filling agents) suitable for administration to any cell, tissue, or organ, in vivo, ex vivo (e.g., tissue or organ transplant) or in vitro, by various routes and delivery, locally, regionally, or systemically.

[0057] Exemplary routes of administration for contact or in vivo delivery of a PARN inhibitor, such as a compound according to Formula I-III, is a dosage of the compound that is sufficient to achieve a desired therapeutic effect, such as can optionally be formulated include inhalation, respiration, intubation, intrapulmonary instillation, oral (buccal, sublingual, mucosal), intrapulmonary, rectal, vaginal, intrauterine, intradermal, topical, dermal, parenteral (e.g., subcutaneous, intramuscular, intravenous, intradermal, intraocular, intratracheal and epidural), intranasal, intrathecal, intraarticular, intracavity, transdermal, iontophoretic, ophthalmic, optical (e.g., corneal), intraglandular, intraorgan, and intralymphatic.

[0058] Formulations suitable for parenteral administration include aqueous and non-aqueous solutions, suspensions, or emulsions of the compound, which may include suspending agents and thickening agents, which preparations are typically sterile and can be isotonic with the blood of the intended recipient. Non-limiting illustrative examples of aqueous carriers include water, saline (sodium chloride solution), dextrose (e.g., Ringer's dextrose), lactated Ringer's, fructose, ethanol, animal, vegetable, or synthetic oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose). The formulations may be presented in unit-dose or multidose kits, for example, ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring addition of a sterile liquid carrier, for example, water for injections, prior to use.

[0059] For transmucosal or transdermal administration (e.g., topical contact), penetrants can be included in the pharmaceutical composition. Penetrants are known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. For transdermal administration, the active ingredient can be formulated into aerosols, sprays, ointments, salves, gels, pastes, lotions, oils, or creams as generally known in the art.

[0060] For topical administration, for example, to skin, pharmaceutical compositions typically include ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils. Carriers which may be used include Vaseline, lanolin, polyethylene glycols, alcohols, transdermal enhancers, and combinations thereof. An exemplary topical delivery system is a transdermal patch containing an active ingredient. For oral administration, pharmaceutical compositions include capsules, cachets, lozenges, tablets, or troches, as powder or granules. Oral administration formulations also include a solution or a suspension (e.g., aqueous liquid or a non-aqueous liquid; or as an oil-in- water liquid emulsion or a water-in-oil emulsion). For airway or nasal administration, pharmaceutical compositions can be formulated in a dry powder for delivery, such as a fine or a coarse powder having a particle size, for example, in the range of 20 to 500 microns which is administered in the manner by inhalation through the airways or nasal passage. Depending on delivery device efficiency, effective dry powder dosage levels typically fall in the range of about 10 to about 100 mg. Appropriate formulations, wherein the carrier is a liquid, for administration, as for example, a nasal spray or as nasal drops, include aqueous or oily solutions of the active ingredient.

[0061] For airway or nasal administration, aerosol and spray delivery systems and devices, also referred to as “aerosol generators” and “spray generators,” such as metered dose inhalers (MDI), nebulizers (ultrasonic, electronic, and other nebulizers), nasal sprayers and dry powder inhalers can be used. MDIs typically include an actuator, a metering valve, and a container that holds a suspension or solution, propellant, and surfactant (e.g., oleic acid, sorbitan trioleate, lecithin). Activation of the actuator causes a predetermined amount to be dispensed from the container in the form of an aerosol, which is inhaled by the subject. MDIs typically use liquid propellant and typically, MDIs create droplets that are 15 to 30 microns in diameter, optimized to deliver doses of 1 microgram to 10 mg of a therapeutic. Nebulizers are devices that turn medication into a fine mist inhalable by a subject through a face mask that covers the mouth and nose. Nebulizers provide small droplets and high mass output for delivery to upper and lower respiratory airways. Typically, nebulizers create droplets down to about 1 micron in diameter.

[0062] Dry-powder inhalers (DPI) can be used to deliver the compounds of the invention, either alone or in combination with a pharmaceutically acceptable carrier. DPIs deliver active ingredient to airways and lungs while the subject inhales through the device. DPIs typically do not contain propellants or other ingredients, only medication, but may optionally include other components. DPIs are typically breath-activated but may involve air or gas pressure to assist delivery.

[0063] Pharmaceutical formulations and delivery systems appropriate for the compositions and methods of the invention are known in the art (see, e g., Remington: The Science and Practice of Pharmacy (2003) 20. sup. th ed., Mack Publishing Co., Easton, Pa.; Remington's Pharmaceutical Sciences (1990) 18. sup. th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12. sup. th ed., Merck Publishing Group, Whitehouse, N.J.; Pharmaceutical Principles of Solid Dosage Forms (1993), Technonic Publishing Co., Inc., Lancaster, Pa.; Ansel and Stoklosa, Pharmaceutical Calculations (2001) l l.sup.th ed., Lippincott Williams & Wilkins, Baltimore, Md.; and Poznansky et al., Drug Delivery Systems (1980), R. L. Juliano, ed., Oxford, N.Y., pp. 253-315).

[0064] In the methods of the invention, a PARN inhibitor, such as a compound according to Formula I-III, may be administered in accordance with the methods at any frequency as a single bolus or multiple dose e.g., one, two, three, four, five, or more times hourly, daily, weekly, monthly or annually or between about 1 to 10 days, weeks, months, or for as long as appropriate. Exemplary frequencies are typically from 1-7 times, 1-5 times, 1-3 times, 2-times or once, daily, weekly, or monthly. Timing of contact, administration ex vivo or in vivo delivery can be dictated by the pathogenesis, symptom, pathology, or adverse side effect to be treated. For example, an amount can be administered to the subject substantially contemporaneously with, or within about 1-60 minutes or hours of the onset of a symptom or adverse side effect of treatment.

[0065] Doses may vary depending upon whether the treatment is therapeutic or prophylactic, the onset, progression, severity, frequency, duration, probability of or susceptibility of the symptom, the type of pathogenesis to which treatment is directed, clinical endpoint desired, previous, simultaneous or subsequent treatments, general health, age, gender or race of the subject, bioavailability, potential adverse systemic, regional or local side effects, the presence of other disorders or diseases in the subject, and other factors that will be appreciated by the skilled artisan (e.g., medical or familial history). Dose amount, frequency or duration may be increased or reduced, as indicated by the clinical outcome desired, status of the pathology or symptom, or any adverse side effects of the treatment or therapy. The skilled artisan will appreciate the factors that may influence the dosage, frequency and timing required to provide an amount sufficient or effective for providing a prophylactic or therapeutic effect or benefit.

[0066] Doses can be based upon current existing treatment protocols, empirically determined, determined using animal disease models or optionally in human clinical studies. A subject may be administered in single bolus or in divided / metered doses, which can be adjusted to be more or less according to the various consideration set forth herein and known in the art. Dose amount, frequency or duration may be increased or reduced, as indicated by the status of pathogenesis, associated symptom or pathology, or any adverse side effect(s). For example, once control or a particular endpoint is achieved, for example, reducing, decreasing, inhibiting, ameliorating, or preventing onset, severity, duration, progression, frequency, or probability of one or more symptoms associated with a telomere-associated disease or disorder. Another embodiment of this disclosure provides pharmaceutical kits containing a pharmaceutical composition of this disclosure containing a PARN inhibitor such as preferably a compound according to Formula I-III, prescribing information for the composition, and a container.

[0067] In another preferred aspect, the present invention provides a method for treating a disease or condition, and preferably cancer, comprising: administering to a subject in need thereof, a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III, or a pharmaceutical composition containing a therapeutically effective amount of a one or more compounds of the invention according to Formulas I-III and a pharmaceutically carrier. In one example, a subject is identified as having cancer cell(s) with an inactivated p53 pathway (e.g., cells with elevated or active PARN and an inactivated p53 pathway) may selectively benefit from the administration of one or more (e.g., two, three, four, or five) chemotherapeutic agent(s) relative to a patient having a cancer cell(s) with inhibited or inactivated PARN and / or p53 pathway. For example, cancer patients that are implicated as having a repressed p53 pathway may experience at least a 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) in one or more symptoms of cancer following treatment with one or more PARN inhibitors which may preferably be co-administered chemotherapeutic agents, compared to a cancer subject having cancer cells with active or elevated PARN and an inactivated p53 pathway following treatment with the same regime. Based on the present inventor’s discovery, a skilled physician may recommend to a patient having cancer cells with an inactivated p53 pathway (e.g., cancer cells with an elevated or active PARN and an inactivated p53 pathway), a therapeutic regime that includes the administration of one or more PARN inhibitors, and preferably and one or more chemotherapeutic agents (e.g. the administration of an additional dosage of a chemotherapeutic agent to a patient that has previously received a dosage of a chemotherapeutic agent). In addition, a cancer patient diagnosed as having a chemotherapy-sensitive cancer (e.g., by a diagnostic or clinical laboratory) using the diagnostic methods described herein, may be administered one or more chemotherapeutic agent(s) with or without the co-admini strati on of a PARN inhibitor.

[0068] A variety of chemotherapeutic agents are known in the art. Desirably, the chemotherapeutic agent administered induces apoptosis or necrosis of the cancer cells. Non-limiting examples of chemotherapeutic agents useful in these methods include: alemtuzumab, altretamine, aminoglutethimide, amsacrine, anastrozole, azacitidine, bleomycin, bicalutamide, busulfan, capecitabine, carboplatin, carmustine, celecoxib, chlorambucil, 2-chlorodeoxyadenosine, cisplatin, colchicine, cyclophosphamide, cytarabine, cytoxan, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, estramustine phosphate, etodolac, etoposide, exemestane, floxuridine, fludarabine, 5-fluorouracil, flutamide, formestane, gemcitabine, gentuzumab, goserelin, hexamethylmelamine, hydroxyurea, hypericin, ifosfamide, imatinib, interferon, irinotecan, letrozole, leuporelin, lomustine, mechlorethamine, melphalen, mercaptopurine, 6-mercaptopurine, methotrexate, mitomycin, mitotane, mitoxantrone, nilutamide, nocodazole, paclitaxel, pentostatin, procarbazine, raltitrexed, rituximab, rofecoxib, streptozocin, tamoxifen, temozolomide, teniposide, 6-thioguanine, topotecan, toremofine, trastuzumab, vinblastine, vincristine, vindesine, and vinorelbine. The methods of treatment provided by this disclosure may require the steps of determining the activity or expression level of PARN and, optionally, steps of determining the activity or inactivation of the p53 signaling pathway. Upon a determination that a cancer patient has an active or elevated level of PARN and / or an inactive p53 pathway, the patient is administered one or more dosages (e.g., at least two, three, four, five, six, seven, eight, nine, or ten dosages) of a one or more (e.g., two, three, four, or five) chemotherapeutic agents. Upon a determination that a cancer patient has an active or elevated level of PARN and / or an inactive p53 pathway, the patient is administered one or more dosages (e.g., at least two, three, four, five, six, seven, eight, nine, or ten dosages) or one or more (e.g., two, three, four, or five) PARN inhibitor(s) of the invention. In certain embodiments of these methods, the determination of the level or activity of PARN and, optionally the determination of inactivation of the p53 pathway, is performed by a diagnostic or clinical laboratory. Following a determination that a cancer patient has active or elevate PARN (e.g., a cancer patient having active or elevated PARN and an inactivated p53 pathway), the patient is administered one or more dosages (e.g., at least two, three, four, five, six, seven, eight, nine, or ten dosages) of one or more (e.g., two, three, four, or five) PARN inhibitors of the invention or one or more dosages (e.g., at least two, three, four, five, six, seven, eight, nine, or ten dosages) of one or more (e.g., two, three, four, or five) PARN inhibitors and one or more (e.g., two, three, four, or five) chemotherapeutic agents.

[0069] In any of the methods described herein, each of the one or more PARN inhibitors of the invention may be administered in a dosage between 0.1 mg and 1 g. The specific dosage of each PARN inhibitor to be administered to the subject may vary depending upon the chemical nature of the PARN inhibitor. The PARN inhibitor(s) may be formulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration. The PARN inhibitor may be administered to cancer patients once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, bi-weekly, tri-weekly, monthly, every two months, every three months, every four months, every five months, twice a year, three times a year, four times a year, five times a year, or six times a year. The specific dosage and administration schedule for a PARN inhibitor may be determined by a skilled physician based on a number of factors including the age, weight, and sex of the patient, the type of cancer, and the severity of one or more symptoms of cancer. In any of the methods described herein, each of the one or more chemotherapeutic agents may be administered in a dosage between 0.1 mg and 1 g. The specific dosage of each chemotherapeutic agent to be administered to the subject may vary depending upon the chemical nature of the chemotherapeutic agent. The chemotherapeutic agent(s) may be formulated for any known route of administration, including oral, intravenous, intraarterial, intraocular, intranasal, intramuscular, and subcutaneous administration. The chemotherapeutic agent may be administered to cancer patients once a day, twice a day, three times a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, seven times a week, biweekly, tri-weekly, monthly, every two months, every three months, every four months, every five months, twice a year, three times a year, four times a year, five times a year, or six times a year. The specific dosage and administration schedule for a chemotherapeutic agent may be determined by a skilled physician based on a number of factors including the age, weight, and sex of the patient, the type of cancer, and the severity of one or more symptoms of cancer.

[0070] In instances where a cancer patient is administered the combination of one or more (e.g., two, three, four, five, or six) PARN inhibitors of the invention and one or more (e.g., two, three, four, five, or six) chemotherapeutic agents, the one or more PARN inhibitors and the one or more chemotherapeutic agents may be administered at the same time (e.g., administered in the same formulated dose). In another example, the one or more PARN inhibitors of the invention may be administered to the cancer patient prior to the administration of the one or more chemotherapeutic agents (e.g., wherein the bioactive period of the one or more PARN inhibitors of the invention overlaps with the bioactive period of the one or more chemotherapeutic agents).

[0071] In a further example, the one or more chemotherapeutic agents may be administered to the cancer patient prior to the administration of the one or more PARN inhibitors of the invention (e.g., wherein the bioactive period of the one or more PARN inhibitors overlaps with the bioactive period of the one or more chemotherapeutic agents). The therapeutic methods provided by this disclosure may be performed alone or in conjunction with another cancer therapy and may be provided at home, the doctor's office, a clinic, a hospital's outpatient department, or a hospital. Treatment generally begins at a hospital so that the doctor can observe the therapy's effects closely and make any adjustments that are needed. The duration of the therapy depends on the age and condition of the patient, the stage of the patient's cancer, and how the patient responds to the treatment. Additionally, a person having a greater risk of developing cancer may be treated by the methods of this disclosure (e.g., a person who is genetically predisposed). Therapy, as provided by this disclosure, may be given in on-and-off cycles that include rest periods so that the patient's body has a chance to build healthy new cells and regain its strength. Therapy may be used to extend the patient's lifespan.

[0072] For cancer treatment, depending on the type of cancer and its stage of development, the therapy can be used to slow the spread of the cancer, to slow the cancer's growth, to kill or arrest cancer cells that may have spread to other parts of the body from the original tumor, or to relieve symptoms caused by the cancer.

[0073] In addition to the PARN inhibitors of the invention, chemotherapeutic agents, or the combination of PARN inhibitors and chemotherapeutic agents described above, the cancer patient may also be treated with one or more (e.g., two, three, four, or five) additional agents including one or more (e.g., one, two, three, four, or five) non-steroidal anti-inflammatory drug(s) (NSAID(s)), one or more (e g., two, three, four, or five) immunosuppressive agent(s), one or more (e.g., two, three, four, or five) calcineurin inhibitor(s), or one or more (e.g., two, three, four, or five) analgesic(s). Examples of NSAIDs, immunosuppressive agents, and analgesics are known in the art.

[0074] Depending on the type of cancer and its stage of development, the combination therapy can be used to treat cancer, to slow the spreading of the cancer, to slow the cancer's growth, to kill or arrest cancer cells that may have spread to other parts of the body from the original tumor, to relieve symptoms caused by the cancer, or to prevent cancer in the first place. Combination therapy can also help people live more comfortably by eliminating cancer cells that cause pain or discomfort.

[0075] The administration of any of the above combinations of agents (e.g., combination of PARN inhibitors of the invention and chemotherapeutic agents) of the present invention allows for the administration of lower doses of each compound, providing similar efficacy and lower toxicity compared to administration of either compound alone. Alternatively, such combinations result in improved efficacy in treating cancer with similar or reduced toxicity.

[0076] A skilled physician may monitor the effectiveness of treatment of a cancer by monitoring the severity or duration of one or more symptoms of cancer. Non-limiting examples of symptoms of cancer include: blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal swelling, vaginal bleeding, jaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death.

[0077] The methods of treatment provided by this disclosure may result in at least a 5% (e.g., at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% decrease) in one or more symptoms (e.g., two, three, four, or five symptoms) of cancer (e.g., those symptoms listed above). The methods of treatment may also provide a decrease in the toxicity normally observed for a PARN inhibitor of the invention and / or a chemotherapeutic agent. The methods of treatment may also provide for a reduction in the dosage of a PARN inhibitor or a chemotherapeutic agent necessary to achieve a therapeutic effect (e.g., a reduction in one or more symptoms of cancer). Desirably, the provided methods may result in a decrease in the metastasis or recurrence of cancer in a patient or may provide for an increase in the duration of remission in a patient.

[0078] As noted above, PARN can be a biomarker for use in identifying and directing cancer therapies, and specifically those that involve reduction in p53 function or signaling, or that can benefit from administration of a PARN inhibitor of the invention as described in Roy et al., PCT / US2019 / 045540, incorporated herein by reference. In one embodiment, the invention includes method of treating a subject having a cancer involving loss or reduction in p53 function or p53 signaling the method comprising: a) determining the level of poly(A)-specific ribonuclease (PARN) in: i) a test sample obtained from the subject, and ii) optionally a control sample; b) optionally obtaining a reference value corresponding to a level of PARN, wherein the level of PARN in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in p53 function in the subject; and, c) identifying the subject as having a cancer involving loss or reduction in p53 function based on the level of PARN in the test sample and administering an effective amount of a PARN inhibitor to the subject to treat the cancer, wherein said PARN inhibitor is selected from selected from the group consisting of:

[0079] or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof: or d) identifying the subject as having the cancer not involving loss or reduction in p53 function based on the level of PARN in the test sample and withholding the administration of the PARN inhibitor to the subj ect, and optionally, administering a cancer therapy other than the PARN inhibitor to the subject to treat the cancer. Patients with cancer cell(s) that have an active p53 signaling pathway are more sensitive to chemotherapeutic agents (e.g., DNA damaging agents). Thus, in determining the treatment regime for a cancer patient, a physician may suggest the administration of one or more chemotherapeutic agent(s) (e.g., an additional dosage of a chemotherapeutic agent) to a patient having cancer cell(s) with an inactivated p53 signaling pathway (e.g., a patient having cancer cell(s) with active or elevated PARN and an inactivated p53 signaling pathway). Similarly, such patient may selectively benefit from the administration of one or more PARN inhibitor(s) of the invention or a combination of one or more PARN inhibitor(s) of the invention and one or more chemotherapeutic agent(s). Thus, this disclosure provides methods that allow a physician to identify a specific subset of patients that may selectively benefit from the administration of one or more chemotherapeutic agent(s), or administration of one or more PARN inhibitor(s) of the invention or the combination of one or more PARN inhibitor(s) of the invention and one or more chemotherapeutic agent(s) (e.g., cancer patients having cancer cell(s) with active or elevated PARN and, optionally, an inactivated p53 pathway). These methods require steps for the determination of the activity or expression level of PARN and, optionally, steps for the determination of the inactivation of the p53 pathway. These methods allow a physician to identify a patient that may selectively benefit from the administration of a PARN inhibitor, a chemotherapeutic agent, or a combination of a PARN inhibitor and a chemotherapeutic agent. The identified patient would experience at least a decrease in one or more symptoms of cancer relative to another cancer patient receiving the same treatment.

[0080] DEFINITIONS

[0081] As used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes a plurality of such compounds, and reference to “the method” includes reference to one or more methods, method steps, and equivalents thereof known to those skilled in the art, and so forth.

[0082] By “poly(A)-specific ribonuclease” or “PARN” is meant a protein substantially identical to any one ofNCBI Accession Nos. NP— 002573.1, AAH50029.1, 095453.1 (SEQ ID NO: 3), and CAA06683.1, or a nucleic acid encoding a protein substantially identical to any one of NCBI Accession Nos. NP— 002573.1, AAH50029.1, 095453.1, and CAA06683.1. By “phosphorylated PARN” is meant a PARN protein that has been phosphorylated. For example, the term phosphorylated PARN includes a PARN protein that is phosphorylated at serine-557.

[0083] The term “compound” or “composition” “a compound of the invention” includes all solvates, complexes, polymorphs, radiolabeled derivatives, tautomers, stereoisomers, and optical isomers of compounds that inhibit PARN. For example, the invention includes all solvates, complexes, polymorphs, radiolabeled derivatives, tautomers, stereoisomers, and optical isomers of the PARN inhibitor compound according to Formulas I-III, generally described herein, and salts thereof, unless otherwise specified.

[0084] As used herein, “inhibits,” “inhibition” refers to the decrease in the activity of PARN relative to the normal wild-type level, or control level. In one embodiment, the invention include novel PARN inhibitors that specifically or nonspecifically inhibit the activity of PARN. In one embodiment, inhibiting PARN can decrease the activity of PARN by at least 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or more than 90%. PARN exonuclease inhibition may be indicated by one or more (e.g., two, three, four, five, or six) of the following features: decreased (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) PARN protein in the cytoplasm, decreased (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) PARN protein in the nucleus, and decreased (by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) levels of phosphorylated PARN (e.g., phosphorylation at serine 557).

[0085] The amount of PARN protein in the cytoplasm or the nucleus of a cell may be measured using an antibody that is specific for PARN. In one example, a cell may be differentially lysed to prepare a separate nuclear extract and / or cytosolic lysates. Immunoblotting may be performed using an PARN antibody to determine the levels of PARN protein found in the cytoplasm and / or the nucleus. Alternatively, the relative amount of PARN in the nucleus and cytoplasm may be measured by immunofluorescence microscopy using labeled PARN antibodies (e.g., fluorescently- labeled antibodies). The relative increase in PARN protein levels in the cytoplasm or the relative decrease in PARN protein levels in the nucleus of a cancer cell may be compared to a non- cancerous cell (e.g., a non-cancerous cell from the patient), or a cell that has been exposed to a genotoxic agent (e.g., a DNA-damaging or chemotherapeutic agent). The relative decrease in PARN protein levels in the cytoplasm or the relative increase in PARN protein levels in the nucleus of a cancer cell may be compared to a cancer cell or a cell that has been exposed to a genotoxic agent.

[0086] The total amount of phosphorylated PARN protein may be measured using methods known in the art. Such techniques often utilize an antibody that specifically recognizes the phosphorylated form of PARN protein. In one example, a cellular lysate from cancer cells may be prepared and immunoblotted using an antibody that specifically binds phosphorylated PARN. Alternatively, the total amount of phosphorylated PARN present in a cell may be measured using immunofluorescent microscopy or fluorescence-assisted cell sorting (FACS) that utilizes a fluorescently-labeled antibody that specifically binds to phosphorylated PARN. Similarly, the amount of phosphorylated PARN in the cytoplasm or nucleus may be measured using antibodies that specifically bind to the phosphorylated form of PARN. For example, a cytosolic extract or nuclear extract may be prepared from cancer cells using differential lysis and the prepared extract immunoblotted using an antibody that specifically binds to phosphorylated PARN. Similarly, immunofluorescence microscopy may be performed using a fluorescently-labeled antibody that specifically binds to phosphorylated PARN to measure the amount of phosphorylated PARN that is present in a cancer cell (e.g., the amount of phosphorylated PARN protein that is present in the cytosol or nucleus).

[0087] The relative increase in total phosphorylated PARN protein or the relative increase in phosphorylated PARN protein in the cytoplasm or nucleus of a cancer cell(s) may be compared to a non-cancerous cell (e.g., a non-cancerous cell from the patient) or a cell that has not been exposed to a genotoxic agent (e.g., a DNA-damaging or chemotherapeutic agent). The relative decrease in total phosphorylated PARN protein or the relative decrease in phosphorylated PARN protein in the cytoplasm or nucleus of a cancer cell(s) may be compared to a cancer cell or a cell that has been exposed to a genotoxic agent.

[0088] The phosphorylation of PARN (e.g., phosphorylation at serine 557), may also be measured using antibodies that specifically recognize the phosphorylated forms of PARN. As described above, antibodies that specifically bind to the phosphorylated form of PARN may be used to measure the total amount of the phosphorylated protein present in a cell or a cell extract. For example, these phosphorylation-specific antibodies may be used to perform immunoblotting on extracts prepared from cancer cell(s). Such methods may be automated or performed using protein chip assays. Alternatively, phosphosphorylation-specific antibodies may be fluorescently-labeled and used in FACS analysis or immunofluorescent microscopy to measure the total amount of the target phosphorylated protein present in a cancer cell. The relative increase in phosphorylated PARN may be compared to a non-cancerous cell (e.g., a non-cancerous cell from the patient) or a cell that has not been exposed to a genotoxic agent (e.g., a DNA-damaging or chemotherapeutic agent). The relative decrease in phosphorylated PARN may be compared to a cancer cell or a cell that has been exposed to a genotoxic agent.

[0089] As used herein, the term “cancer” is meant a disease characterized by the pathological proliferation of a cell or tissue and its subsequent migration to or invasion of other tissues or organs. Cancer growth is typically uncontrolled and progressive, and occurs under conditions that would not elicit, or would cause cessation of, multiplication of normal cells. Cancers can affect a variety of cell types, tissues, or organs, including but not limited to an organ selected from the group consisting of bladder, bone, brain, breast, cartilage, glia, esophagus, fallopian tube, gallbladder, heart, intestines, kidney, liver, lung, lymph node, nervous tissue, ovaries, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid, trachea, urogenital tract, ureter, urethra, uterus, and vagina, or a tissue or cell type thereof. Non-limiting examples of cancers include: acoustic neuroma, acute leukemia, acute lymphocytic leukemia, acute monocytic leukemia, acute myeloblastic leukemia, acute myelocytic leukemia, acute myelomonocytic leukemia, acute promyelocytic leukemia, acute erythroleukemia, adenocarcinoma, angiosarcoma, astrocytoma, basal cell carcinoma, bile duct carcinoma, bladder carcinoma, brain cancer, breast cancer, bronchogenic carcinoma, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, chronic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, colon cancer, colon carcinoma, craniopharyngioma, cystadenocarcinoma, embryonal carcinoma, endotheliosarcoma, ependymoma, epithelial carcinoma, Ewing's tumor, glioma, heavy chain disease, hemangioblastoma, hepatoma, Hodgkin's disease, large cell carcinoma, leiomyosarcoma, liposarcoma, lung cancer, lung carcinoma, lymphangioendotheliosarcoma, lymphangiosarcoma, macroglobulinemia, medullary carcinoma, medulloblastoma, melanoma, meningioma, mesothelioma, myxosarcoma, neuroblastoma, non-Hodgkin's disease, oligodendroglioma, osteogenic sarcoma, ovarian cancer, pancreatic cancer, papillary adenocarcinomas, papillary carcinoma, pinealoma, polycythemia vera, prostate cancer, rhabdomyosarcoma, renal cell carcinoma, retinoblastoma, schwannoma, sebaceous gland carcinoma, seminoma, small cell lung carcinoma, squamous cell carcinoma, sweat gland carcinoma, synovioma, testicular cancer, uterine cancer, Waldenstrom's fibrosarcoma, and Wilm's tumor.

[0090] By “reducing one or more symptoms” is meant a reduction (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) in the severity or duration of at least one (e.g., at least two, three, four, five, or six) symptoms of a disease (e.g., a cancer). For example, the methods of the invention may result in at a 10% reduction in at least one (e.g., at least two, three, four, five, or six) symptoms of cancer.

[0091] By the term “symptoms of cancer” is meant one or more (e.g., one, two, three, four, or five) of the physical manifestations of cancer. Non-limiting examples of symptoms of cancer include blood in urine, pain or burning upon urination, cloudy urine, pain in bone, fractures in bones, fatigue, weight loss, repeated infections, nausea, vomiting, constipation, numbness in the legs, bruising, dizziness, drowsiness, abnormal eye movements, changes in vision, changes in speech, headaches, thickening of a tissue, rectal bleeding, abdominal cramps, loss of appetite, fever, enlarged lymphnodes, persistent cough, blood in sputum, lung congestion, itchy skin, lumps in skin, abdominal swelling, vaginal bleedingjaundice, heartburn, indigestion, cell proliferation, and loss of regulation of controlled cell death.

[0092] By “treating” a disease, disorder, or condition is meant delaying an initial or subsequent occurrence of a disease, disorder, or condition; increasing the disease-free survival time between the disappearance of a condition and its reoccurrence; stabilizing or reducing one or more (e.g., two, three, four, or five) adverse symptom(s) associated with a condition; or inhibiting, slowing, or stabilizing the progression of a condition. The term “treating” also includes reducing (e.g., by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% the severity or duration of one or more (e.g., one, two, three, four, or five) symptoms of a disease (e.g., cancer) in a patient. Desirably, at least 20%, 40%, 60%, 80%, 90%, or 95% of the treated subjects have a complete remission in which all evidence of the disease disappears. In another desirable embodiment, the length of time a patient survives after being diagnosed with a condition and treated using the methods of the invention is at least 20%, 40%, 60%, 80%, 100%, 200%, or even 500% greater than (i) the average amount of time an untreated patient survives or (ii) the average amount of time a patient treated with another therapy survives.

[0093] In view of the characterization of the RNA regulatory effects of PARN activity and its importance for maintenance of p53 tumor suppression, this disclosure provides methods of reducing the severity of one or more symptoms of cancer in a patient, methods of identifying a cancer patient that may selectively benefit from the administration of one or more PARN inhibitor(s) or the combination of one or more PARN inhibitor(s) and one or more chemotherapeutic agent(s), methods of identifying a cancer patient that may selectively benefit from the administration of one or more chemotherapeutic agent(s), methods of diagnosing a chemotherapy-resistant cancer or a chemotherapy-sensitive cancer cell in a patient, and kits for diagnosing a chemotherapy-resistant or chemotherapy-sensitive cancer in a patient.

[0094] The p53 pathway has been shown to mediate cell cycle arrest, and p53 induction is associated with growth arrest and apoptosis. Specifically, in cancer cells, a mutation or truncation (e.g., one or more amino acid substitutions, deletions, and / or additions) of the p53 protein results in decreased activity or expression, resulting for example, in a decrease in DNA-binding activity, a decrease in the ability to induce p21 induction, or a decrease in the ability to mediate cell cycle arrest in response to genotoxic stress. Similarly, inactivation of p53 may occur in the cell by way of a gene translocation event which results in the formation of a p53 fusion protein. Further, inactivation of p53 may occur by a loss of heterozygosity mutation, where the mutation in a second allele of the p53 gene occurs following a mutation in the first allele of the p53 gene. Thus, loss of p53 signaling may be indicated by one or more (e.g., two, three, or four) of the following features: decreased (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) p53 mRNA or protein levels, expression of a mutant or truncated p53 with decreased (e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) expression or activity, and decreased (by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) p21 expression or activity. Various methods for measuring p53 pathway inactivation are known in the art and non-limiting examples are provided below.

[0095] The levels of p53 mRNA or protein may be measured using a number of molecular biology techniques known in the art. p53 mRNA may be measured using any nucleic acid that is complementary to a contiguous sequence present in p53 mRNA. For example, the amount of p53 mRNA may be detected using FISH using such an antisense nucleic acid. p53 mRNA levels may also be measured using techniques based on PCR using primers specifically designed to amplify an mRNA encoding p53 protein (e.g., reverse-transcriptase PCR, real-time qPCR, or gene array technology). p53 protein levels may be measured using an antibody that specific binds to p53 protein. For example, immunoblotting may be performed on whole cell extract using a p53 antibody. Similarly, a fluorescently-labeled p53 antibody may be used to perform immunofluorescence microscopy or FACS analysis on cancer cells. The relative decrease in p53 protein or mRNA levels may be compared to a non-cancerous cell (e.g., a non-cancerous cell from the patient). Importantly, measurements of p21 protein expression by immunoblotting, immunohistochemistry, or immunofluorescence microscopy, for example, may be used as highly sensitive assays of p53 function.

[0096] The expression of a mutant or truncated p53 protein with decreased expression or activity (e.g., decreased DNA-binding activity, ability to induce cell cycle arrest following genotoxic stress, and / or the ability to induce p21 gene expression) may be measured using molecular biology techniques known in the art. For example, mutations or truncations in p53 protein may be detected using PCR-based techniques using primers that specifically amplify the region of the p53 mRNA or gene (e.g., reverse-transcriptase PCR, real-time qPCR, or gene array technology). In addition, methods to analyze or determine the presence of a mutation in a second allele of the p53 locus may be identified using single-nucleotide polymorm orphism microarray analysis.

[0097] Inactivated p53 signaling may also be observed by a decrease in p21 mRNA or protein expression in a cell (e.g., reduced induction of p21 expression following genotoxic stress). p53 mRNA may be measured using any nucleic acid that is complementary to a contiguous sequence present in p53 mRNA. For example, the amount of p21 mRNA may be detected using FISH using such an antisense nucleic acid. p21 mRNA levels may also be measured using techniques based on PCR using primers specifically designed to amplify an mRNA encoding p21 protein (e.g., reverse-transcriptase PCR, real-time qPCR, or gene array technology). p21 protein levels may be measured using an antibody that specific binds to p21 protein. For example, immunoblotting may be performed on whole cell extract using a p21 antibody. Similarly, a fluorescently-labeled p21 antibody may be used to perform immunofluorescence microscopy or FACS analysis on cancer cells. The relative decrease in p21 protein or mRNA levels may be compared to a non-cancerous cell (e.g., a non-cancerous cell from the patient or a non-cancerous cell exposed to a genotoxic agent, such as a DNA-damaging chemotherapeutic agent).

[0098] This disclosure provides methods for treating cancer that include administering to a subject in need thereof, one or more PARN inhibitor(s) or the combination of one or more PARN inhibitor(s) which can further be co-administered with and one or more chemotherapeutic agent(s). In a preferred embodiment, a subject in need thereof includes a patient diagnosed as having a chemotherapy-resistant cancer that is administered one or more PARN inhibitor(s) and / or one or more chemotherapeutic agent(s).

[0099] By “chemotherapeutic agent” is meant one or more chemical agents used in the treatment or control of proliferative diseases (e.g., cancer). Chemotherapeutic agents include cytotoxic and cytostatic agents. Exemplary chemotherapeutic agents may mediate DNA damage (e.g., alkylating chemotherapeutic agents). Non-limiting examples of chemotherapeutic agents are described herein and are known in the art.

[0100] By “p53 protein” is meant a protein that is substantially identical to all or a part of any one of NCBI Accession Nos. BAC16799.1, AAC12971.1, P04637.4, NP— 000537.3, NP— 001119584.1, AAD28535.1, and AAD28628.1. By “p53 levels” or“p53 expression” is meant the amount of p53 protein or p53 mRNA present in a cell (e.g., a cancer cell or a control cell).

[0101] By “p53 mRNA” is meant an mRNA that encodes a protein that is substantially identical to all or a part of any one of NCBI Accession Nos. BAC 16799.1, AAC12971.1, P04637.4, NP — 000537.3, NP— 001119584.1, AAD28535.1, and AAD28628.1.

[0102] By “p53 gene” or “p53 genomic DNA” is meant a sequence of genomic DNA that encodes a wild type, mutant, or truncated p53 protein that encodes a protein that is substantially identical to all or a part of (e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, or 390 amino acids) any one of NCBI Accession Nos. BAC16799.1, AAC12971.1 , P04637.4, NP— 000537.3, NP— 001119584.1, AAD28535.1, and AAD28628.1. For example, a mutant p53 gene may encode a p53 protein that contains at one or more (e.g., at least two, three, four, five, six, seven, eight, nine, or ten) amino acid substitutions, deletions, and / or additions. A mutant p53 gene may encode a p53 protein that contains at least a 5 amino acid truncation (e.g., at least a 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid truncation) or at least a 5 amino acid addition (e.g., at least a 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid addition) (e.g., a fusion protein resulting from a gene translocation).

[0103] By “p53 activity” is meant an activity of wild type p53 protein in a cell. Non-limiting examples of p53 activity include DNA-binding activity, ability to mediate cell cycle arrest, and induction of p21 gene expression. Assays for measuring in vitro and in vivo p53 activity are known in the art. As used herein, the terms “comprising” (and any form of comprising, such as “comprise”, “comprises”, and “comprised”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”), are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0104] Each publication or patent cited herein is incorporated herein by reference in its entirety.

[0105] The invention now being generally described will be more readily understood by reference to the following examples, which are included merely for the purposes of illustration of certain aspects of the embodiments of the present invention. The examples are not intended to limit the invention, as one of skill in the art would recognize from the above teachings and the following examples that other techniques and methods can satisfy the claims and can be employed without departing from the scope of the claimed invention.

[0106] EXAMPLE

[0107] Example 1 : Purification of PARN for in vitro Assay.

[0108] To test the effects of compounds on PARN, Applicants purified the enzyme and developed an in vitro assay for PARN activity. Expression of full-length PARN led to aggregation, but expression of the C-terminal truncated protein (1-430 aa of PARN) was soluble. Previous work has shown that the D28A and F31A mutations in PARN inhibit PARN activity. Given this, Applicants expressed and purified the catalytic mutant PARN D28A F31A (PARNmut) as a negative control. Purification (see METHODS) yielded a dominant band for PARN1-430 and PARNmut on SDS-PAGE gels (Figure 2a and b).

[0109] Applicants found that purified PARN1-430 shows enzymatic activity on the poly(A) tail of test substrates. PARN1-430 was incubated with a fluorescently labeled RNA with a CCUUUCC (SEQ ID NO. 1) sequence followed by a 9 nucleotide-long poly(A) tail and the reaction product was visualized on denaturing acrylamide gels. Applicants observed that PARN removed the 3’ oligo(A) tail from the RNA substrate (Figure 2c and d). The activity was dependent on PARN since PARNmut protein showed no removal of the 3’ adenosines (Figure 2c). Moreover, Applicants observed that PARN is inhibited when treated with adenosine monophosphate (AMP), as has been reported previously. PARN1-430 showed reduced activity when incubated with an unadenylated RNA (Figure 2d), consistent with the finding that PARN1-430 preferentially degrades poly(A) tail. Example 2: Developing a High-Throughput PARN Inhibition Assay.

[0110] To easily screen compounds for inhibition of PARN activity, Applicants developed an assay in which fluorescence was used as the readout for monitoring PARNI-43O’S activity (Figure 3a). In this assay, PARN1-430 was incubated with a 5 ’-fluorescently labeled oligoadenylated RNA. In the absence of deadenylation, this substrate RNA can effectively hybridize to a complementary DNA oligonucleotide with a quencher on its 3’ end leading to a loss of fluorescence (Figure 3a). When the RNA substrate is deadenylated, the quenching oligonucleotide is no longer able to stably hybridize leading to an increase in fluorescence in the reaction.

[0111] This assay has several features that make it useful for assessing PARN activity. First, it is time-dependent (Figure 3b and d). Second, it is dependent on PARN concentration (Figure 3c). Third, Applicants observed that AMP, which is a product of PARN activity and can inhibit PARNi- 430 at high concentrations (>1 mM), effectively inhibited PARN1-430 (Figure 3b). Finally, Applicants observed that fluorescence correlates with shortening of the 3’ oligo A tail on the substrate by running the material on a gel and observing shortening of the substrate with PARNi- 430, but no shortening with PARNmut (Figure 2c and 3d). In this assay, PARN1-430 inhibition is inversely proportional to the reaction fluorescence measured as output, which can be used to test possible PARN inhibitors.

[0112] Example 3: High-Throughput Screening of Enamine Kinase Library.

[0113] To identify PARN inhibitors in a high-throughput manner, 24000 compounds from the Enamine kinase library were tested in a HTS utilizing the fluorescence assay (Figure 3a). The top 18 compounds with IC50s of less than 10 pM based on testing at different concentrations (Table 1) were then selected for further testing. To visualize the inhibitory effects of these compounds on PARN, the reactions were run on gels. Applicants showed all compounds could inhibit PARN at 20 pM by inhibiting PARN deadenylase activity, except for TH18 (Figure 4). This result was consistent with the fluorescence assay, suggesting that these compounds can inhibit PARN in vitro. Example 4: Inhibitory Effects of Identified Compounds on PARN in Cells.

[0114] Of the compounds from the HTS, TH11, TH 15, and TH 16 showed the strongest effects and reduced miR-21-5p level to -50% compared to the controls (Figure 5). These effects were similar to a PARN KD, which reduced miR-21-5p levels to -75% compared to siRNA controls. None of the compound reduced PARN protein levels in Hela cells (Figure 5). Moreover, RT-qPCR was done to examine the changes in hTR levels of the compounds, which confirmed a decrease in levels of hTR with compounds or siPARN treatments, compared to the controls, (Figure 5). This suggested that TH11, TH15, and TH16 treatments can inhibit PARN activity in cells and thereby decrease specific RNA levels.

[0115] Previous work has shown that PARN inhibition leads to cell death in combination with DNA damaging agent, which has been interpreted to occur through the induction of p53. Given this, Applicants examined if TH11, TH15, or TH16 affected cell growth either by itself or in combination with the chemotherapeutic agent, doxorubicin. Applicants observed that at 10 pM of TH11, TH15, and TH16, Hela cells showed growth defects compared to DMSO treatment (Figure 6). More importantly, Applicants observed that both PARN KD (as previously shown) and cells treated with these compounds showed increased cell death after 24 hours of doxorubicin treatment compared to the scramble siRNA and DMSO controls (Figure 6). This indicates that TH11, TH15, and TH16 increase the sensitivity of cells to the chemotherapeutic agent, possibly through upregulating p53.

[0116] Example 7: Materials and Methods.

[0117] High throughput screening: 2 pL of protein (100 nM final concentration) (stock protein is diluted in IX lysis buffer (HEPES KOH, pH 7.4, 30 mM, KOAc 100 mM, and Mg(OAc)2 2 mM) is added to wells using offline Multidrop Combi nL. The reaction is pre-incubated with 12.5 nL of Sygnature library (Enamine kinase library (HBL-24) (31.25 pM) for 15 minutes before 2 pL of RNA (10 pM) is added (DMSO was added to control wells using Echo 655). The reaction is incubated at 22°C for 20 minutes in Cytomat automatic incubator. After the incubation, the reaction is quenched by adding 4 pL of quencher solution (30 pM of 3’-BHQ labeled quench DNA in 1% SDS) using Multidrop Combi nL. The quenched reaction is incubated at room temperature for 10 minutes and fluorescence is measured using PHERAstar FSX (X485 / 520). For the counter screen, no protein was added to the reaction.

[0118] For active potency, dilution series of 10 mM of kinase library compounds (8 points 1 :3 dilution, final top concentration was 100 pM) was used to generate IC50 curves. Curves were fit within Genedata using SmartFit algorithm.

[0119] Plasmids and Purification of recombinant PARN: Human PARN ORF was codon- optimized using iDT codon optimizer tool for bacterial expression and the corresponding gene block fragment was purchased from iDT. PcoldLPARN plasmid with Chloramphenicol resistance containing the full-length human PARN ORF was a kind gift from Prof. Yukihide Tomari20. Full- length PARN ORF was cut from the Pcold-PARN plasmid using Ndel-Xhol restriction digest and the native vector was gel purified. PARN 1-430 ORF fragment was PCR amplified from the gene block using the following primers and gel purified.

[0120] Fwd primer: TAAGCACATATGATGGAAATCATTCGCTCC (SEQ ID NO. 2)

[0121] Rev primer: TGCTTACTCGAGTTAAATGTCCATCACACGCA (SEQ ID NO. 3)

[0122] The purified PCR product was ligated to the Pcoldl Ndel-Xhol digest vector using T4 DNA ligase I (NEB M0202S) and correct insertion was verified using Sanger sequencing. PARN D28A F31A double mutant was created by site-directed mutagenesis of the PARN 1-430 expressing plasmid using the following primers and mutation insertion was verified using sanger sequencing.

[0123] Fwd primer: TTTTTTGCAATTGCAGGGGAGGCTTCCGGTATTTCC (SEQ ID NO. 4)

[0124] Rev primer: GGAAATACCGGAAGCCTCCCCTGCAATTGCAAAAAA (SEQ ID NO. 5)

[0125] For recombinant protein purification, the vector was expressed in Rosetta 2 DE at 37°C overnight with Amp-Camp (50 pg / mL). The starter culture was transfered into 1 L of TB culture and incubated at 37°C to reach O.D. of 1. The proteins were induced with 1 mM IPTG for 2 days at 15°C. The proteins were purified using Ni-NTA column and buffer exchanged into storage buffer (30 mM Hepes KOH, pH 7.4, 100 mM KO Ac, 2 mM Mg(OAc)2, 30% glycerol, 1 mM TCEP). Proteins were verified on SDS gels and stored at -80°C. siRNAs: siRNAs targeting PARN (siGenome) was purchased from Dharmacon in the Smartpool formulation (M-011348-00-0005). All-stars negative control siRNA from QIAGEN (SI03650318) was used as negative control.

[0126] Cell culture: HeLa cells were purchased from ATCC (CCL2) and verified for absence of mycoplasma contamination. HeLa cells were cultured in DMEM containing 10% FBS, 1% Pen / Strep, at 37°C under ambient conditions. HeLa cells were seeded -100,000 cells / well in a six- well plate 24 hours before transfection / inhibitor treatment. siRNA transfection was performed using Lipofectamin RNAiMAX (Thermo Fisher Scientific) as per manufacturer’s protocol. 48 hours after transfection / drug treatment, cells were collected for either RNA or protein analysis.

[0127] RNA extraction and Northern blotting: Total RNA was extracted from cell lysates using TriZol as per manufacturer’s protocol and DNAse treated. After quantification on Nanodrop, total RNA was separated on an acrylamide 7 M Urea gel. RNA was transferred to a nylon membrane (Nytran SPC, GE Healthcare) using semiwet transfer. After UV / EDC crosslinking, the blot was pre-hybridized and hybridized in PerfectHyb Plus Hybridization Buffer (Sigma Aldrich) at 42°C. Northern probes have been previously described11,48. After hybridization and washing in 2x SSC 0.1% SDS wash buffer, blots were exposed to a cassette and imaged on a Typhoon FLA 9500 Phosphoimager. Band intensities were quantified using ImageJ and normalized to the U1 / 5S levels under each condition.

[0128] RT-qPCR: Extracted total RNA was reverse transcribed using Mir-X miRNA first strand synthesis kit to make cDNA and qPCR was perfomred with Mir-X miRNA qRT-PCR TB Green (Takara, Cat. No. 638314) for miR-21-5p RNA as per manufacturer’s protocol. For hTR, iQ SYBR Green Supermix (BioRad, Cat. No. 1708880) was used with CGCTGTTTTTCTCGCTGACT (forward primer) (SEQ ID NO. 6) and GCTCTAGAATGAACGGTGGAA (reverse primer) (SEQ ID NO. 7). The RNA levels were normalized using 5S rRNA as a housekeeping gene.

[0129] Western blotting: Cells was lysed with 2X lysis buffer (2.5% SDS, 4% BME, protease inhibitor) and was separated on a 4%-12% Bis-Tris NuPage gel (ThermoFisher) and transferred to protran membrane (Amer- sham). After blocking in 5% non-fat milk in IxTBST, blots were probed with anti-PARN (Abeam, ab 188333, 1 : 1000 dilution) overnight at 4°C and HRP anti-rabbit goat (Cell Signaling Technology, 7074S, 1 : 1000 dilution) secondary antibody for one hour. Blot was quantified using ImageJ and normalized to GAPDH levels (GAPDH antibody (0411) HRP) (Santa Cruz Biotechnology, sc-47724 HRP).

[0130] Inhibition fluorescence assay: 1 pL of protein (73 nM as final concentration) (stock protein is diluted in IX lysis buffer (HEPES KOH, pH 7.4, 30 mM, KO Ac 100 mM, and Mg(Oac)2 2 mM) was added to 4 pL of 2.5X reaction buffer (Tris-HCl pH 7.4, 10 mM, KC1 50 mM, MgCk 5 mM). If drug wass added, reaction was pre-incubated with drugs for 10 minutes before 5 pL of RNA (5 pM as final concentration) was added. The reaction was incubated at 37°C for 20 minutes. After the incubation, the reaction was either diluted with 2X loading buffer and heated to 95°C for 5 minutes for gel or quenched by adding 10 pL of quencher solution (30 pM of 3’-BHQ labeled quench DNA in 1% SDS). Quenched reaction was incubated at room temperature for 10-60 minutes and fluorescence was measured using Fluorescein wavelength measurement.

[0131] Gels: 15% TBE-Urea gel (Thermo Fisher Scientific) was prerun at 20W for 30 minutes. RNAs from the reaction was loaded into 15% TBE gels and run at 300 V for 35 minutes. The gel was visualized using iBright (Invitrogen FL1500).

[0132] Cell death assay: The same number of Hela cells were seed into 6 well-plates and treated with inhibitor (SelleckChem, S8140) or transfected for 2 days. Images and cell counting were done 2 days post-treatment. For doxorubicin (EMD Millipore, 504042) treatment, doxorubicin (1 pM) was added to cells. Cells were collected and counted at Oh and 24h after treatment.

[0133] TABLES

[0134] Table 1. List of exemplary compounds tested as PARN inhibitors with their corresponding properties.

[0135] REFERENCES

[0136] 1. Dehlin, E., Wormington, M., Kbrner, C. G. & Wahle, E. Cap-dependent deadenylation of mRNA. BO J 19, 1079-1086, doi: 10.1093 / emboj / 19.5.1079 (2000).

[0137] 2. Gao, M., Fritz, D. T., Ford, L. P. & Wilusz, J. Interaction between a poly(A)- specific ribonuclease and the 5' cap influences mRNA deadenylation rates in vitro. Mol Cell 5, 479-488, doi: 10.1016 / sl097-2765(00)80442-6 (2000).

[0138] 3. Kbrner, C. G. & Wahle, E. Poly(A) tail shortening by a mammalian poly(A)- specific 3 '-exoribonuclease. J Biol Chem 272, 10448-10456, doi: 10.1074 / jbc.272.16.10448 (1997).

[0139] 4. Martinez, J., Ren, Y. G., Nilsson, P., Ehrenberg, M. & Virtanen, A. The mRNA cap structure stimulates rate of poly(A) removal and amplifies processivity of degradation. J Biol Chem 276, 27923-27929, doi: 10.1074 / jbc.Ml 02270200 (2001).

[0140] 5. Copeland, P. R. & Wormington, M. The mechanism and regulation of deadenylation: identification and characterization of Xenopus PARN. RNA 7, 875-886, doi: 10.1017 / sl355838201010020 (2001).

[0141] 6. Kim, J. H. & Richter, J. D. Opposing polymerase-deadenylase activities regulate cytoplasmic polyadenylation. Mol Cell is, 173-183, doi: 10.1016 / j.molcel.2006.08.016 (2006).

[0142] 7. Kbrner, C. G. et al. The deadenylating nuclease (DAN) is involved in poly(A) tail removal during the meiotic maturation of Xenopus oocytes. EMBO J 17, 5427-5437, doi: 10.1093 / emboj / 17.18.5427 (1998).

[0143] 8. Berndt, H. et al. Maturation of mammalian H / ACA box snoRNAs: PAPD5- dependent adenylation and PARN-dependent trimming. RNA 18, 958-972, doi : 10.126 l / rna.032292.112 (2012).

[0144] 9. Shukla, S., Schmidt, J. C., Goldfarb, K. C., Cech, T. R. & Parker, R. Inhibition of telomerase RNA decay rescues telomerase deficiency caused by dyskerin or PARN defects. Nat Struct Mol Biol 23, 286-292, doi:10.1038 / nsmb.3184 (2016).

[0145] 10. Shukla, S. & Parker, R. PARN Modulates Y RNA Stability and Its 3'-End Formation. Mo! Cell Biol 37, doi: 10.1128 / MCB.00264-17 (2017).

[0146] 11.. Shukla, S., Bjerke, G. A., Muhlrad, D., Yi, R. & Parker, R. The RNase PARN Controls the Levels of Specific miRNAs that Contribute to p53 Regulation. Mol Cell 73, 1204- 1216.el204, doi: 10.1016 / j.molcel.2019.01.010 (2019). 12. Roake, C. M. etal. Disruption of Telomerase RN A Maturation Kinetics Precipitates

[0147] Disease. Mol Cell 74, 688-700.e683, doi: 10.1016 / j.molcel.2019.02.033 (2019).

[0148] 13. Ustianenko, D. et al. TUT-DIS3L2 is a mammalian surveillance pathway for aberrant structured non-coding RNAs. EMBO J 35, 2179-2191, doi: 10.15252 / embj .201694857 (2016).

[0149] 14. Chang, H. M., Triboulet, R., Thornton, J. E. & Gregory, R. I. A role for the Perlman syndrome exonuclease Dis312 in the Lin28-let-7 pathway. Nature 497, 244-248, doi: 10.1038 / naturel2119 (2013).

[0150] 15. Heo, I. etal. Lin28 mediates the terminal uridylation of let-7 precursor Mi croRNA. Mol Cell 32, 276-284, doi: 10.1016 / j.molcel.2008.09.014 (2008).

[0151] 16. Lardelli, R. M. & Lykke- Andersen, J. Competition between maturation and degradation drives human snRNA 3' end quality control. Genes Dev 34, 989-1001, doi: 10.1101 / gad.336891.120 (2020).

[0152] 17. Tseng, C. K. et al. Human Telomerase RNA Processing and Quality Control. Cell Rep 13, 2232-2243, doi:10.1016 / j.celrep.2015.10.075 (2015).

[0153] 18. Moon, D. H. et al. Poly(A)-specific ribonuclease (PARN) mediates 3'-end maturation of the telomerase RNA component. Nat Genet 47, 1482-1488, doi: 10.1038 / ng.3423 (2015).

[0154] 19. Son, A., Park, J. E. & Kim, V. N. PARN and TOE1 Constitute a 3' End Maturation Module for Nuclear Non-coding RNAs. Cell Rep 23, 888-898, doi:10.1016 / j.celrep.2018.03.089 (2018).

[0155] 20. Katoh, T., Hojo, H. & Suzuki, T. Destabilization of microRNAs in human cells by 3' deadenylation mediated by PARN and CUGBP1. Nucleic Acids Res 43, 7521-7534, doi: 10.1093 / nar / gkv669 (2015).

[0156] 21. Agarwal, V., Bell, G. W ., Nam, J. W. & Bartel, D. P. Predicting effective microRNA target sites in mammalian mRNAs. Elife 4, doi: 10.7554 / eLife.05005 (2015).

[0157] 22. Liu, J., Zhang, C., Zhao, Y. & Feng, Z. MicroRNA Control of p53. J Cell Biochem 118, 7-14, doi: 10.1002 / jcb.25609 (2017).

[0158] 23. Swarbrick, A. et al. miR-380-5p represses p53 to control cellular survival and is associated with poor outcome in MYCN-amplified neuroblastoma. Nat Med 16, 1134-1140, doi: 10.1038 / nm.2227 (2010). 24. Vlachos, I. S. et al. DIANA-miRPath v3.0: deciphering microRNA function with experimental support. Nucleic Acids Res 43, W460-466, doi:10.1093 / nar / gkv403 (2015).

[0159] 25. Burns, D. M., D'Ambrogio, A., Nottrott, S. & Richter, J. D. CPEB and two poly(A) polymerases control miR-122 stability and p53 mRNA translation. Nature 473, 105-108, doi: 10.1038 / nature09908 (2011).

[0160] 26. Rivlin, N., Brosh, R., Oren, M. & Rotter, V. Mutations in the p53 Tumor Suppressor Gene: Important Milestones at the Various Steps of Tumorigenesis. Genes Cancer 2, 466-474, doi:10.1177 / 1947601911408889 (2011).

[0161] 27. Bieging, K. T., Mello, S. S. & Attardi, L. D. Unravelling mechanisms of p53- mediated tumour suppression. Nat Rev Cancer 14, 359-370, doi:10.1038 / nrc3711 (2014).

[0162] 28. Joerger, A. C. & Fersht, A. R. The p53 Pathway: Origins, Inactivation in Cancer, and Emerging Therapeutic Approaches. Annu Rev Bi ochem 85, 375-404, doi: 10.1146 / annurev- biochem-060815-014710 (2016).

[0163] 29. Zhang, L. N. & Yan, Y. B. Depletion of poly(A)-specific ribonuclease (PARN) inhibits proliferation of human gastric cancer cells by blocking cell cycle progression. Biochim Biophys Acta 1853, 522-534, doi: 10.1016 / j.bbamcr.2014.12.004 (2015).

[0164] 30. Balatsos, N. A. et al. Competitive inhibition of human poly(A)-specific ribonuclease (PARN) by synthetic fluoro-pyranosyl nucleosides. Biochemistry 48, 6044-6051, doi: 10.1021 / bi900236k (2009).

[0165] 31. Balatsos, N. A., Anastasakis, D. & Stathopoulos, C. Inhibition of human poly(A)- specific ribonuclease (PARN) by purine nucleotides: kinetic analysis. J Enzyme InhibMed Chem 24, 516-523, doi: 10.1080 / 14756360802218763 (2009).

[0166] 32. Balatsos, N. et al. Kinetic and in silico analysis of the slow-binding inhibition of human poly(A)-specific ribonuclease (PARN) by novel nucleoside analogues. Biochimie 94, 214- 221, doi: 10.1016 / j .biochi.2011.10.011 (2012).

[0167] 33. Ren, Y. G., Martinez, J., Kirsebom, L. A. & Virtanen, A. Inhibition of KI enow DNA polymerase and poly(A)-specific ribonuclease by aminoglycosides. RNA 8, 1393-1400, doi : 10.1017 / s 1355838202021015 (2002).

[0168] 34. Jadhav, G. P. et al. Discovery, synthesis and biochemical profiling of purine-2,6- dione derivatives as inhibitors of the human poly(A)-selective ribonuclease Caf 1. Bioorg Med Chem Lett lS, 4219-4224, doi: 10.1016 / j.bmcl.2015.07.095 (2015). 35. Wu, M. et al. Structural insight into poly(A) binding and catalytic mechanism of human .724, 4082-4093, doi:10.1038 / sj.emboj.7600869 (2005).

[0169] 36. Martinez, J. et al. A 54-kDa fragment of the Poly(A)-specific ribonuclease is an oligomeric, processive, and cap-interacting Poly(A)-specific 3' exonuclease. J Biol Chem 275, 24222-24230, doi: 10.1074 / jbc.M001705200 (2000).

[0170] 37. Maryati, M. et al. A fluorescence-based assay suitable for quantitative analysis of deadenylase enzyme activity. Nucleic Acids Res 42, e30, doi: 10.1093 / nar / gkt972 (2014).

[0171] 38. Ren, Y. G., Martinez, J. & Virtanen, A. Identification of the active site of poly(A)- specific ribonuclease by site-directed mutagenesis and Fe(2+)-mediated cleavage. J Biol Chem 277, 5982-5987, doi:10.1074 / jbc.M111515200 (2002).

[0172] 39. Ren, Y. G., Kirsebom, L. A. & Virtanen, A. Coordination of divalent metal ions in the active site of poly(A)-specific ribonuclease. J Biol Chem 279, 48702-48706, doi: 10.1074 / jbc.M403858200 (2004).

[0173] 40. Lai, W. S., Kennington, E. A. & Blackshear, P. J. Tristetraprolin and its family members can promote the cell-free deadenylation of AU-rich element-containing mRNAs by poly(A) ribonuclease. Mol Cell Biol 23, 3798-3812, doi: 10.1128 / MCB.23.11.3798-3812.2003 (2003).

[0174] 41. Qin, X. et al. The Bcr-Abl inhibitor GNF-7 inhibits necroptosis and ameliorates acute kidney injury by targeting RIPK1 and RIPK3 kinases. Biochem Pharmacol 177, 113947, doi : 10.1016 / j .bcp.2020.113947 (2020).

[0175] 42. Liang, X. etal. Discovery of 2-((3-Amino-4-methylphenyl)amino)-N-(2-methyl-5- (3-(trifluoromethyl)benzamido)phenyl)-4-(methylamino)pyrimidine-5-carboxamide (CHMFL- ABL-053) as a Potent, Selective, and Orally Available BCR-ABL / SRC / p38 Kinase Inhibitor for Chronic Myeloid Leukemia. J Med Chem 59, 1984-2004, doi: 10.1021 / acs.jmedchem.5b01618 (2016).

[0176] 43. Nonami, A. et al. Identification of novel therapeutic targets in acute leukemias with NRAS mutations using a pharmacologic approach. Blood 125, 3133-3143, doi : 10.1182 / blood- 2014-12-615906 (2015).

[0177] 44. Friesner, R. A. et al. Glide: a new approach for rapid, accurate docking and scoring. 1. Method and assessment of docking accuracy. J Med Chem 47, 1739-1749, doi: 10.1021 / jm0306430 (2004). 45. Friesner, R. A. et al. Extra precision glide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes. J Med Chem 49, 6177-6196, doi: 10.1021 / jm051256o (2006).

[0178] 46. Halgren, T. A. Identifying and characterizing binding sites and assessing druggability. J Chem Inf Model 49, 377-389, doi:10.1021 / ci800324m (2009).

[0179] 47. Beckstein, O., Fourrier, A. & lorga, B. I. Prediction of hydration free energies for the SAMPL4 diverse set of compounds using molecular dynamics simulations with the OPLS-AA force field. J Comput Aided Mol Des 28, 265-276, doi: 10.1007 / sl0822-014-9727-l (2014).

[0180] 48. Xi, L. & Cech, T. R. Inventory of telomerase components in human cells reveals multiple subpopulations of hTR and hTERT. Nucleic Acids Res 42, 8565-8577, doi: 10.1093 / nar / gku560 (2014).

Claims

CLAIMSWhat is claimed is1. A PARN inhibitor according to Formula (I) comprising:(Formula I), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof.

2. A PARN inhibitor according to Formula (II) comprising:(Formula II), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof.

3. A PARN inhibitor according to Formula (III) comprising:(Formula III), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof.

4. A PARN inhibitor comprising a compound selected from the group consisting of:(Formula III), or a combination thereof.

5. The compound of claim 5, wherein the compounds is a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof.

6. A pharmaceutical composition comprising one or more of the compounds of any of claim 1-5, and at least one pharmaceutically acceptable carrier.

7. A pharmaceutical kit containing the pharmaceutical composition of claim 6, prescribing information for the composition, and a container.

8. A method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of one or more of the compounds of any of claim 1-5, to a subject in need thereof.

9. A method of treating cancer in s subject in need thereof, comprising administering a therapeutically effective amount of the pharmaceutical composition of claim 6, to a subject in need thereof.

10. The method of any of claims 8-9, further comprising administering a therapeutically effective amount of a cancer therapy.

11. The method of claim 10, wherein said cancer therapy is selected from radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy, or a combination thereof.

12. The method of claim 10, wherein said cancer therapy comprises a therapeutically effective amount of a chemotherapeutic agent.

13. The method of any of claims 8-12, wherein said chemotherapeutic agent is selected from the group consisting of: alerntuzumab, altretamine, aminoglutethimide, amsacrine, anastrozole, azacitidine, bleomycin, bicalutamide, busulfan, capecitabine, carboplatin, carmustine, celecoxib, chlorambucil, 2-chlorodeoxyadenosine, cisplatin, colchicine, cyclophosphamide, cytarabine, cytoxan, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, estramustine phosphate, etodolac, etoposide, exemestane, floxuridine, fludarabine, 5-fluorouracil, flutamide, formestane, gemcitabine, gentuzumab, goserelin, hexamethylmelamine, hydroxyurea, hypericin, ifosfamide, imatinib, interferon, irinotecan, letrozole, leuporelin, lomustine, mechlorethamine, melphalen, mercaptopurine, 6-mercaptopurine, methotrexate, mitomycin, mitotane, mitoxantrone, nilutamide, nocodazole, paclitaxel, pentostatin, procarbazine, raltitrexed, rituximab, rofecoxib, strcptozocin, tamoxifen, temozolomide, teniposide, 6-thioguanine, topotecan, toremofine, trastuzumab, vinblastine, vincristine, vindesine, and vinorelbine.

14. The method of any of claims 8-13, wherein said cancer is selected from the group consisting of: acoustic neuroma, acute leukemia, acute lymphocytic leukemia, acute monocytic leukemia, acute myeloblastic leukemia, acute myelocytic leukemia, acute myelomonocytic leukemia, acute promyelocytic leukemia, acute erythroleukemia, adenocarcinoma, angiosarcoma, astrocytoma, basal cell carcinoma, bile duct carcinoma, bladder carcinoma, brain cancer, breast cancer, bronchogenic carcinoma, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, chronic leukemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, colon cancer, colon carcinoma, craniopharyngioma, cystadenocarcinoma, embryonal carcinoma, endotheliosarcoma, ependymoma, epithelial carcinoma, Ewing's tumor, glioma, heavy chain disease, hemangioblastoma, hepatoma, Hodgkin's disease, large cell carcinoma, leiomyosarcoma, liposarcoma, lung cancer, lung carcinoma, lymphangioendotheliosarcoma, lymphangiosarcoma, macroglobulinemia, medullary carcinoma, medulloblastoma, melanoma, meningioma, mesothelioma, myxosarcoma, neuroblastoma, non-Hodgkin's disease, oligodendroglioma, osteogenic sarcoma, ovarian cancer, pancreatic cancer, papillary adenocarcinomas, papillary carcinoma, pinealoma, polycythemia vera, prostate cancer, rhabdomyosarcoma, renal cell carcinoma, retinoblastoma, schwannoma, sebaceous gland carcinoma, seminoma, small cell lung carcinoma, squamous cell carcinoma, sweat gland carcinoma, synovioma, testicular cancer, uterine cancer, Waldenstrom's fibrosarcoma, Wilm's tumor, and chemotherapy -resistant or chemotherapysensitive cancer.

15. The method of any of claims 8-14, wherein said cancer comprises a cancer involving loss or reduction in p53 function or p53 signaling.

16. The method of any of claims 8-14, wherein said cancer comprises a cancer involving an increase in PARN function or PARN signaling.

17. The method of any of claims 8-16, wherein said subject comprises a human.

18. A method of inhibiting PARN activity comprising contacting a cell with a therapeutically effective amount of one or more of the compounds of any of claim 1-5.

19. The method upregulating p53 expression or activity comprising contacting a cell with a therapeutically effective amount of one or more of the compounds of any of claim 1-5.

20. The method of any of claims 18 or 19, wherein contacting is comprised contacting a cell in vitro or in vivo.

21. The method of any of claims 18-20, wherein said cell is a cancer cell.

22. The method of claim 21, wherein said cancer cell comprises a human cancer cell.

23. A method of treating a subject having a cancer involving loss or reduction in p53 function or p53 signaling, the method comprising: a) determining the level of poly(A)-specific ribonuclease (PARN) in: i) a test sample obtained from the subject, and ii) optionally a control sample; b) optionally obtaining a reference value corresponding to a level of PARN, wherein the level of PARN in the test sample relative to the control sample or the reference value indicates the presence or absence of the cancer involving loss or reduction in p53 function in the subject; and, c) identifying the subject as having a cancer involving loss or reduction in p53 function based on the level of PARN in the test sample and administering an effective amount of a PARN inhibitor to the subject to treat the cancer, wherein said PARN inhibitor is selected from selected from the group consisting of:(Formula I),(Formula III), or a pharmaceutically acceptable salt, solvate, stereoisomer, tautomer, or prodrug thereof: or d) identifying the subject as having the cancer not involving loss or reduction in p53 function based on the level of PARN in the test sample and withholding the administration of the PARN inhibitor to the subj ect, and optionally, administering a cancer therapy other than the PARN inhibitor to the subject to treat the cancer.

24. The method of claim 23, wherein the control sample is obtained from: a) an individual belonging to the same species as the subject and not having cancer, b) an individual belonging to the same species as the subject and known to have a cancer not involving loss or reduction in p53 function or p53 signaling, or c) the subject prior to having the cancer, and the method comprises identifying the subject as having the cancer involving loss or reduction in p53 based on higher level of PARN in the test sample as compared to that of the control sample.

25. The method of claim 23, wherein the control sample is obtained from an individual belongingto the same species as the subject and known to have a cancer involving loss or reduction in p53 function or p53 signaling and the method comprises identifying the subject as having the cancer involving loss or reduction in p53 based on the level of PARN in the test sample not being different than that of the control sample.

26. The method of claim 23, wherein the reference value corresponds to the level of PARN associated with: a) the absence of a cancer, or b) the presence of a cancer not involving loss or reduction in p53 function or p53 signaling and the method comprises identifying the subject as having the cancer involving loss or reduction in LKB1 based on higher level of PARN in the test sample as compared to the reference value.

27. The method of claim 23, wherein the reference value corresponds to the level of PARN associated with the presence of a cancer involving loss or reduction in p53 function or p53 signaling and the method comprises identifying the subject as having the cancer involving loss or reduction in p53 based on the level of PARN in the test sample not being different than the reference value.

28. The method of claim 23, wherein a cancer therapy other than the PARN inhibitor is administered to the subject.

29. The method of claim 28, wherein the cancer therapy other than the PARN inhibitor is radiotherapy, chemotherapy, surgery, immunotherapy, kinase inhibition, monoclonal antibody therapy, or a combination thereof.

30. The method of claim 23, wherein the step of determining the level of PARN is performed by Northern blot analysis, Western blot analysis, quantitative or semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR), transcription- mediated amplification (TMA), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA).31 . The method of claim 23, wherein the subject is a mammal.

32. The method of claim 31, wherein the mammal is a human.

33. The method of claim 23, wherein the control sample and the test sample are obtained from the same type of organ or tissue.

34. The method of claim 33, wherein the organ or tissue is brain, eyes, pineal gland, pituitary gland, thyroid gland, parathyroid glands, thorax, heart, lung, esophagus, thymus gland, pleura, adrenal glands, appendix, gall bladder, urinary bladder, large intestine, small intestine, kidneys, liver, pancreas, spleen, stoma, ovaries, uterus, testes, prostate, skin, or blood.

35. The method of claim 33, wherein the organ or tissue is lung or white blood cells.

36. The method of claim 23, wherein the levels of PARN are determined my measuring levels ofPARN RNA transcripts in the test sample and / or control sample.

Images