Combining induction of ferroptosis with targeted agents for cancer therapy

Abstract

The present invention provides methods for the treatment of prostate cancer by administration of inhibitors of the androgen receptor and agents that induce ferroptosis to subjects in need thereof. The present invention also provides methods for the treatment of breast cancer by administration of inhibitors of the estrogen receptor and agents that induce ferroptosis to subjects in need thereof. The present invention further provides various related compositions and related methods.

Description

TITLECOMBINING INDUCTION OF FERROPTOSIS WITH TARGETED AGENTS FOR CANCER THERAPYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit and priority of U.S. Provisional Application Serial No. 63 / 461,055, filed on April 21, 2023, the contents of each of which are herein incorporated by reference in their entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grant number R01CA258622 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION BY REFERENCE

[0003] For the purpose of only those jurisdictions that permit incorporation by reference, all of the references cited in this disclosure are hereby incorporated by reference in their entireties. In addition, any manufacturers’ instructions or catalogues for any products cited or mentioned herein are incorporated by reference. Documents incorporated by reference into this text, or any teachings therein, can be used in the practice of the present invention.SEQUENCE LISTING

[0004] The instant application contains a Sequence Listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on April 3, 2024, is named MSKCC062WOl.xml and is 9,953 bytes in size.BACKGROUND

[0005] Ferroptosis is a specific form of regulated cell death, executed by iron-dependent phospholipid (PL) peroxidation that can lead to rupture of the plasma membrane (Stockwell et al., 2017; Dixon et al., 2012). Ferroptosis plays crucial roles in multiple pathological conditions including cancer, where it may operate as an innate tumor suppressive mechanismthat mediates the anticancer activity of multiple tumor suppressors (Gao et al., 2019; Jiang et al.. 2015; Zhang et al.. 2018). Evidence suggests that ferroptosis induction is a potential cancer therapeutic approach to selectively eliminate cancer cells of specific genetic backgrounds, either as a single-agent therapy or in combination with other targeted agents, including PI3K / mT0R pathway inhibitors and immune checkpoint blockades (Arensman et al., 2019; Badgley et al.. 2020; Wang et al., 2019; Wu et al., 2019; Yi et al., 2020; Zhang et al., 2019).

[0006] Prostate cancer is one of the most common cancers in men, and is the second most common cause of cancer-related deaths among men in the United States (Siegel et al., 2022). While patients are initially responsive to first-line androgen deprivation therapy (ADT), nearly all patients with advanced disease inevitably progress to a lethal castration-resistant prostate cancer (CRPC), during which androgen receptor (AR) signaling remains active (Maitland, 2021). And although therapies targeting AR can be effective, they are not curative and CRPC patients often eventually develop secondary resistance to the therapies (Ehsani et al., 2021).

[0007] Similarly, breast cancer is the most common cancer in women, projected to account for over 30% of all female cancers (Siegel et al., 2022). Moreover, approximately 67%-80% of breast cancer in women are estrogen receptor (ER) positive (Kohler et al., 2015; Joe, 2019). For treatment of ER positive (ER+) breast cancer, the suppression of ER function by inhibiting estrogen production with aromatase inhibitors or by blocking ER activity with antiestrogens is initially effective (Rugo et al., 2016; Tryfonidis et al., 2016). However, many ER+breast cancers recur in forms that have become resistant to standard-of-care aromatase inhibitors and / or antiestrogens, while de novo resistance also occurs, although the tumor cells continue to express ER (Clarke et al., 2015).

[0001] There remains a need for more effective therapies for these sex hormone-driven cancers, particularly therapies with different approaches for treating the disease.SUMMARY OF THE INVENTION

[0002] The present invention is based, in part, on a series of important discoveries that are described in more detail in the Examples section of this patent specification. For example, a new ferroptosis surveillance mechanism has now been discovered, mediated by membrane bound O-acyltransferase 2 (MBOAT2) and membrane bound O-acyltransferase 1(MB0AT1). MBOAT1 / 2 prevent ferroptosis by remodeling cellular PL composition, which leads to a decrease of PL with polyunsaturated fatty acid (PUFA) tails (PL-PUFAs) (substrate of PL peroxidation) and increase of PL with monosaturated fatty acid (MUFA) tails (PL- MUFAs) (inhibitors of ferroptosis). Further, it was found that MB0AT2 and MB0AT1 are directly upregulated by AR and ER, respectively, and that combination of ferroptosis induction with AR antagonist or ER antagonist significantly inhibited the growth of AR+prostate cancer and ER+breast cancer, respectively. Building on these discoveries, and other discoveries presented herein, the present invention provides a variety of new and improved methods for the treatment of sex hormone-driven cancers and cancers with overexpression of MB0AT2 or MB0AT1.

[0008] Accordingly, in one aspect, the present invention provides a method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more AR inhibitors, and (b) one or more ferroptosis- inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subject. In another aspect, the present invention provides a method of treating cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more AR inhibitors, and(b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size of and / or regression of the cancer cells in the subject. In another aspect, the present invention provides a method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more MB0AT2 inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subject. In yet another aspect, the present invention provides a method of treating a cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more MBOAT2 inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer cells in the subject.

[0009] In one aspect, the present invention provides a pharmaceutical composition comprising (a) one or more AR inhibitors, (b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically -acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In anotheraspect, the present invention provides a combination comprising (a) one or more AR inhibitors, and (b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In one aspect, the present invention provides a pharmaceutical composition comprising (a) one or more MB0AT2 inhibitors, (b) one or more ferroptosis-inducing agents, and (c) a pharmaceutically-acceptable earner, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In a further aspect, the present invention provides a combination comprising (a) one or more MB0AT2 inhibitors, and (b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof.

[0010] In some embodiments, the cancer is AR+. In certain embodiments, the AR+ cancer is prostate cancer or ovarian cancer.

[0011] In some embodiments, the cancer is marked by overexpression of MBOAT2. In certain embodiments, the cancer marked by overexpression of MBOAT2 is prostate cancer, pancreatic cancer, biliary' tract cancer, uterine cancer, bladder cancer, or liver cancer.

[0012] In some embodiments, the MBOAT2 inhibitor is an AR inhibitor.

[0013] In some embodiments, the AR inhibitor is selected from the group consisting of enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide, bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253, EPI-7386, EPI-506, EPI-002, and any combination thereof.

[0014] In some embodiments, the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent. In some embodiments, the ferroptosis-inducing agent is selected from the group consisting of erastin, MEII, PE, AE, imidazole ketone erastin (IKE), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin. sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

[0015] In some embodiments, the subject was previously treated with a single-agent hormonal treatment. In some embodiments, the subject is resistant to single-agent hormonaltreatment. In certain embodiments, the single-agent hormonal treatment comprises treatment wi th an AR inhibitor or an androgen antagonist.

[0016] In another aspect, the present invention provides a method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more ER inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the grow th of and / or causing a decrease in the size and / or regression of the cancer tumor in the subject. In another aspect, the present invention provides a method of treating cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more ER inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size of and / or regression of the cancer cells in the subject. In yet another aspect, the present invention provides a method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more MBOAT1 inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subject. In yet a further aspect, the present invention provides a method of treating a cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more MBOAT1 inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer cells in the subject.

[0017] In another aspect, the present invention provides a pharmaceutical composition comprising (a) one or more ER inhibitors, (b) one or more ferroptosis-inducing agents, and (c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In a further aspect, the present invention provides a combination comprising (a) one or more ER inhibitors, and (b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In another aspect, the present invention provides a pharmaceutical composition comprising (a) one or more MBOAT1 inhibitors, (b) one or more ferroptosis-inducing agents, and (c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof. In yet a further aspect, the present invention provides a combination comprising (a) one or moreMB0AT1 inhibitors, and (b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof, or for use in treatment of cancer cells in a subject in need thereof.

[0018] n some embodiments, the cancer is ER+. In certain embodiments, the ER+ cancer is breast cancer, uterine cancer, or ovarian cancer.

[0019] In some embodiments, the cancer is marked by overexpression of MBOAT1. In certain embodiments, the cancer marked by overexpression of MBOAT1 is breast cancer or liver cancer.

[0020] In some embodiments, the MBOAT1 inhibitor is an ER inhibitor.

[0021] In some embodiments, the ER inhibitor is a selective ER modulator (SERM), a selective ER downregulator (SERD), or a dual-mechanism ER inhibitor (DMERI). In some embodiments, the ER inhibitor is selected from the group consisting of enzalutamide, apalutamide. darolutamide, abiraterone. flutamide, mlutamide, bicalutamide. proxalutamide. BMS-641988, SHR3680, TRC-253, EPI-7386, EPI-506, EPI-002, and any combination thereof.

[0022] In some embodiments, the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent. In some embodiments, the ferroptosis-inducing agent is selected from the group consisting of erastin, MEII, PE, AE, imidazole ketone erastin (IKE), DPI2, BSO, SAS, lanpensone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

[0023] In some embodiments, the subject was previously treated with a single-agent hormonal treatment. In some embodiments, the subject is resistant to single-agent hormonal treatment. In certain embodiments, the single-agent hormonal treatment comprises treatment with an ER inhibitor or an androgen antagonist.

[0024] In a further aspect, the present invention provides a kit comprising (a) one or more AR inhibitors, or a pharmaceutical composition thereof, and (b) one or more ferroptosis- inducing agents, or a pharmaceutical composition thereof. In one aspect, the present invention provides a kit comprising (a) one or more MBOAT2 inhibitors, or a pharmaceuticalcomposition thereof, and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof. In another aspect, the present invention provides a kit comprising (a) one or more ER inhibitors, or a pharmaceutical composition thereof, and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof. In yet another aspect, the present invention provides a kit comprising (a) one or more MB0AT1 inhibitors, or a pharmaceutical composition thereof, and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof.

[0025] In some embodiments, the MBOAT2 inhibitor is an AR inhibitor.

[0026] In some embodiments, the AR inhibitor is selected from the group consisting of enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide, bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253, EPI-7386, EPI-506, EPI-002, and any combination thereof.

[0027] In some embodiments, the MBOAT1 inhibitor is an ER inhibitor.

[0028] In some embodiments, the ER inhibitor is a SERM, a SERD, or a DMERI. In certain embodiments, the ER inhibitor is selected from the group consisting of fulvestrant, elacestrant. etacstil, RU 58668, GW-7604, GDC-0810, AZD9496, GDC-0927, tamoxifen, bazedoxifene, lasofoxifene, giredestrant, amcenestrant, camizestrant, imlunestrant. OP- 1250, ARV -471, GDC-9545, H3B-6545, and any combination thereof.

[0029] In some embodiments, the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent. In certain embodiments, the ferroptosis- inducing agent is selected from the group consisting of erastin, MEII, PE, AE, imidazole ketone erastin (IKE). DPI2, BSO, SAS, lanperisone, SRS 13-45, SRS 13-60, RSL3, DPI7, DPI10. DPI12. DPI13. DPI17. DPI18. DPI19. ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

[0030] In certain embodiments, the kit further comprises instructions for use.

[0003] These and other aspects of the present invention are described further in the below Detailed Description, Drawings, Examples and Claims sections of this patent disclosure. Furthermore, one of skill in the art will recognize that the various embodiments of the presentinvention described throughout this patent disclosure can be combined in various different ways, and that such combinations are within the scope of the present invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0004] FIG. 1. Panels A-J show how MBOAT2 is a glutathione peroxidase 4 (GPX4) / ferroptosis suppressor protein 1 (FSPl)-independent ferroptosis suppressor, as described in the Example. Panel A shows a schematic plot summarizing the workflow of clustered regularly interspaced short palindromic repeats (CRISPR) activation screen in HT1080 cells. Panel B shows the top seven genes that were significantly enriched in both RSL3 and cystine starvation screen conditions are highlighted. Panel C shows visualization of enrichment for sgRNAs targeting top seven genes in cystine starvation (top) and RSL3 (bottom) screen conditions. Panel D shows Western blot confirming overexpression of MB0AT2 and group IIF secretory phospholipase A2 (PLA2G2F) in HT1080 cells. Panel E shows viability analysis of HT1080 cells expressing vector control. MB0AT2. or phospholipase A2 Group IIF (PLA2G2F) as indicated upon treatment with imidazole ketone erastin (IKE) (0.3 pM) for 24 h, in the absence or presence of 1 pM ferrostastin-1 (Feri) as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel F shows cell death time course of HT1080 cells expressing vector control, MB0AT2, or PLA2G2F as indicated. Ferroptosis was induced by cystine starvation. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel G shows viability' analysis of HT1080 cells expressing vector control, MB0AT2, or PLA2G2F as indicated. Ferroptosis was induced by RSL3 (0.1 pM) for 24 h, in the absence or presence of Fer-1 (1 pM). Data are presented as mean ± SD (n = 3 biologically independent samples). Panel H shows Western blot confirming knockout of GPX4 and / or FSP1 in HT1080 cells. Panels I and J show crystal violet staining of HT1080-GPX4KC)cells (Panel H) or HT1080-GPX4 / FSP1DKOcells (Panel I) overexpressing indicated genes cultured with or without Trolox for 72 h. Two independent experiments were performed, and representative images from one experiment are show n. Statistical analysis w as performed using 1-way analysis of variance (ANOVA) (Panels E and G). ****P<0.0001.

[0005] FIG. 2, Panels A-G further show how MB0AT2 is a GPX4 / FSP1 -independent ferroptosis suppressor, as described in the Example. Panel A shows viability analysis of HT1080-GPX4KO, HT1080- FSP1KOand HT1080-GPX4 / FSP1DKOcells cultured with orwithout 100 pM Trolox as indicated for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel B show's viability analysis of HT1080-GPX4KOcells expressing vector control, MB0AT2, and PLA2G2F. Cells were cultured with or without 100 pM Trolox as indicated for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel C shows Western blot analysis confirming overexpression of indicated genes in HT1080-GPX4KOcells. Panel D shows Western blot analysis confirming DOX-inducible NOS2 expression in HT1080-GPX4KOcells. Cells were treated with 1 pg / ml Dox for 48 h. Panel E shows quantification of lipid peroxidation in HT1080 cells with or without MB0AT2 overexpression as indicated. Cells were treated with 0. 1 pM RSL3 for 3 h prior to labeling with BODIPY -C 11. Panel F shows RNA-seq analysis identified genes upregulated (red) or downregulated (blue) by MBOAT2 overexpression in HT1080 cells. Panel G shows volcano plot showing the differential expression of ferroptosis-related genes (WikiPathways_ferroptosis) in HT1080 cells expressing MBOAT2 vs vector control. A cohort ferroptosis regulatory genes are shown without significant change of expression. Statistical analysis was performed using 1-way ANOVA (Panel B) or two- tailed t-test (Panel E). ****P<0.0001.

[0006] FIG. 3, Panels A-L show' how the ferroptosis-suppressing function of MB0AT2 requires either endogenous or exogenous MUFA, as described in the Example. Panel A shows viability analysis of HT1080-GPX4KOcells overexpressing GTP cyclohydrolase 1 (GCH1) or MB0AT2. Cells were treated for 48 h with 5-tetradecyloxy-2-furoic acid (TOFA) (5 pM) in the presence or absence of Trolox (100 pM) as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel B shows viability analysis of HT1080 cells overexpressing MB0AT2. Cells were pretreated with indicated concentration of TOFA for 24 h, followed by ferroptosis induction with RSL3 (0.1 pM) in the presence or absence of Trolox (100 pM) for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel C shows viability assay of HT1080 cells harboring vector control (Vec) or MBOAT2 overexpression as indicated. Cells were pretreated with TOFA (5 pM) where indicated for 24 h, prior to ferroptosis induction byindicated concentrations of RSL3, with or without TOFA, for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel D shows viability analysis of HT1080 cells harboring MBOAT2 overexpression. Cells were pretreated with indicated concentration of CAY 10566 for 24 h and then followed by ferroptosis inductionwith RSL3 (0. 1 pM), in the presence or absence of Trolox (100 pM) for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel E shows Western blot analysis showing expression of stearoyl-CoA desaturase 1 (SCD1) and MBOAT2 in indicated cells. Panel F shows time course of cell death of cells with indicated genetic background with or without MBOAT2 overexpression. Cells were originally cultured in the presence of Trolox, and ferroptosis was initiated by removing Trolox (that was the starting point of the time course). Data are presented as mean ± SD (n = 3 biologically independent samples). Panel G shows viability analysis ofHT1080-GPX4 / SCDDKOcells with or without MBOAT2 overexpression as indicated. Cells were pretreated with indicated concentration of oleic acid (OA) plus Trolox for 16 h. and ferroptosis was induced by removing Trolox but keeping same amount of OA, for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel H shows Western blot analysis confirming knockdown of MBOAT2 in HT1080 cells. Panels I-K show viability' analysis of HT1080 cells with control or MBOAT2 shRNA. Cells were pretreated with indicated concentrations of OA for 16 h and followed by ferroptosis induction with 0.1 pM RSL (Panel I), 1 pM ML210 (Panel J), or 0.5 pM IKE (Panel K) for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel L shows a working model to show that MBOAT2 utilizes either endogenous or exogenous MUFA to suppress ferroptosis. Statistical analysis was performed using 1-way ANOVA (Panels B and D) or tw?o-tailed t-test (Panels A, I, J, and K). **P<0.01, ***P<0.001, ****P<0.0001.

[0007] FIG. 4, Panels A-E further show how the ferroptosis-suppressing function of MBOAT2 requires either endogenous or exogenous MUFA, as described in the Example. Panels A and B show viability analysis of HT1080-GPX4KOcells overexpressing MBOAT2. Cells were treated with indicated concentration of TOFA (Panel A) or CAY 10566 (Panel B), in the presence or absence of Trolox as indicated for 48 h (n = 2 biologically independent samples). Panel C shows Western blot analysis confirming long-chain-fatty-acid — CoA ligase 3 (ACSL3) shRNA knockdown in HT1080-GPX4KOcells overexpressing MBOAT2. Panel D shows images showing viability of cells with indicated genetic background. Cells were cultured with or without Trolox as indicated for 24 h. Scale bar = 50 pM. Two independent experiments w ere performed, and representative images from one experiment are shown. Panel E shows cell death time course of HT1080-GPX4KOcells. Cells were either mock treated or pre-treated with 10 pM OA for indicated time before removing Troloxto initiate ferroptosis. Data are presented as mean ± SD (n = 3 biologically independent samples).

[0008] FIG. 5. Panels A-K show how MB0AT2 suppresses ferroptosis through phospholipid remodeling, as described in the Example. Panel A shows volcano plot showing upregulated lipid species (red) and downregulated lipid species (blue) by MB0AT2 overexpression in HT1080 cells. Cut-off: FC threshold = 2, P<0.01; two-tailed t-test (n = 5 biologically independent samples). Panels B-D show quantification of most abundant lyso- phosphatidyl ethanolamine (PE) lipids with MUFA tails (PE-MUFAs) (Panel B), lyso- phosphatidylcholine (PC) with MUFA tails (PC-MUFAs) (Panel C), and lyso-phosphatidyl ethanolamine (PE) with arachidonoyl tail (PE-AA) (Panel D) in HT1080 cells harboring vector control or MB0AT2 overexpression as indicated. Data are presented as mean ± SD (n = 5 biologically independent samples). Panels E and F show stacked bars showing relative abundance of indicated PE-OA and PE-AA in HT1080 cells harboring vector control or MB0AT2 overexpression as indicated. Panel G shows Western analysis showing the expression of MB0AT2 wildtype (WT) and H373A mutant in HT1080-GPX4KOcells. Panel H shows cell death time course of HT1080-GPX4KOcells overexpressing MB0AT2 WT or H373A mutant as indicated. Ferroptosis was initiated by removing Trolox from culture medium. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel I shows Western analysis showing knockdown of MB0AT2 in SUIT-2 cells. Panels J and K show viability analysis of SUIT-2 cells expressing control or MBOAT2 shRNA. Ferroptosis was induced by indicated concentration of RSL3 for 24 h. Statistical analysis was performed using two-tailed t-test (Panels B and D) or 1-way ANOVA (Panels J and K). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0009] FIG. 6, Panels A-N further show how MB0AT2 suppresses ferroptosis through phospholipid remodeling, as described in the Example. Panels A-D show quantification of abundant PLs other than those described in FIG. 5, Panels A-D as following: PL-MUFAs (Panel A), PL-AAs (Panel B), PL-long chain PUFAs (Panel C) and PE-long chain PUFAs (Panel D) in HT1080 cells expressing vector control or MB0AT2 as indicated. Data are presented as mean ±SD (n = 5 biological replicates). Panel E shows a w orking model depicting that MB0AT2 suppresses ferroptosis through PL remodeling. As a lyso-PE acyltrasferase (LPEAT) with MUFA preference, MB0AT2 competes with LPEATs with PUFA preference (e.g., LPCAT3). When MBOAT2 activity is dominant, cells have a highPE-MUFA / PE-AA ratio and therefore are more resistant to ferroptosis. Conversely, if lysophosphatidylcholine Acyltransferase 3 (LPCAT3) activity is dominant, cellular lipidome will be remodeled toward a low PE-MUFA / PE-AA ratio, thus more sensitive to ferroptosis. Panel F shows correlation of MB0AT2 mRNA level and RSL3 resistance score in pancreatic ductal adenocarcinoma (PDAC) cell lines (Adapted from DepMap Portal). R = 0.331, Pearson correlation. Panel G shows Western blot analysis showing endogenous MBOAT2 expression in a panel of PDAC lines. Panel H shows viability analysis of a panel of PDAC lines. Ferroptosis was induced by 1 pM RSL3 for 24 h, in the absence or presence of 10 pM Feri as indicated. Data are presented as mean ± SD (n = 3 biological independent samples). Panels I and K show Western analysis showing overexpression of ectopic MBOAT2 in PANC-1 and MIA PaCa-2 cells. Panels J and L show viability’ analysis of PANCI and MIA PaCa-2 cells harboring vector control or MBOAT2 overexpression. Ferroptosis was induced by indicated concentration of RSL3 for 24 h. Panels M and N show viability’ analysis of SUIT-2 cells expressing control or MBOAT2 shRNA. As indicated, cells were pretreated with or without adding 10 pM linoleic acid (LA) to culture medium for 24 h, and then ferroptosis was induced by 1 pM RSL3 (Panel M) or 1 pM IKE (Panel N), in the presence or absence of Feri, for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Statistical analysis was performed using 1-way ANOVA (Panels M and N). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0010] FIG. 7, Panels A-L show how AR signaling modulates ferroptosis sensitivity in prostate cancer cells through MB0AT2, as described in the Example. Panel A shows MB0AT2 mRNA expression in cancer patient samples (TCGA PanCancer Atlas Studies). MB0AT2 mRNA expression was batch normalized from Illumina HiSeq_RNASeqV2. Dash line indicated median. MBOAT2 mRNA was highly expressed in prostate cancer patient samples. Panel B shows Western blot analysis showing endogenous MBOAT2 expression in a panel of AR+and AR prostate cancer (PCa) lines. AR+PCa lines were either treated with dimethyl sulfoxide (DMSO or 5 pM enzalutamide (ENZ) for 48 h. Panel C shows viability analysis of a panel of AR+and AR PCa lines. Ferroptosis was induced by 3 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biological independent samples). Panel D shows visualization of AR and forkhead box protein Al (FOXA1) binding to the MB0AT2 ARE region (normalized by RPKM. GSE37345). Panel E shows ChlP-qPCR showing the occupancy of AR on the human MBOAT2 ARE region in LnAR cells with indicatedtreatment for 24 h. DHT: 100 nM; ENZ: 5 pM. Panel F shows Western blot analysis showing MBOAT2 expression in LNCaP prostate cancer cells with indicated treatment for 48 h. DHT: 100 nM; ENZ: 5 pM. Panel G shows Western blot analysis showing MB0AT2 expression in LnAR cells harboring Doxycycline (Dox)-inducible AR shRNA (LnAR-ishAR) wi th indicated treatment for 48 h. Dox: 1 pg ml-1. Panel H shows Western blot analysis showing MBOAT2 expression in PC3 and PC3-AR cells with indicated treatment for 48 h. DHT: 100 nM. Panel I shows Western blot analysis confirming MBOAT2 knockout in LnAR-gMBOAT2 cells. Panel J shows viability analysis of LnAR-Cas9 and LnAR- gMBOAT2 cells with indicated RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels K and L show quantification of differential PL- PUFAs (Panel K) and PL-MUFAs (Panel L) in LnAR-shNT and LnAR-ishMBOAT2 cells. Data are presented as mean ± SD (n = 5 biologically independent samples). Statistical analysis was performed using 2-way ANOVA (Panel C), 1-way ANOVA (Panel E) or two- tailed t-test (Panels K and L). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0011] FIG. 8. Panels A-N further show how AR signaling modulates ferroptosis sensitivity in prostate cancer cells through MBOAT2, as described in the Example. Panel A shows MBOAT2 rnRNA expression in normal human tissues (adapted from GTEx Portal). Expression levels are shown in TPM (transcripts per million). Box plots are shown as median and 25th and 75th percentiles. Panel B shows correlation of MBOAT2 mRNA level and AR mRNA level in human prostate cancer samples (TCGA PanCancer Atlas Studies). mRNA level was batch normalized from Illumina HiSeq_RNASeqV2 and shown as log2(RSEM+l). R = 0.36, Spearman correlation. Panel C shows Western blot analysis showing MBOAT2 expression in 22Pc-EP prostate cancer cells with indicated treatment for 48 h. DHT: 100 nM; ENZ: 5 pM. Panel D shows qRT-PCR analysis showing relative MBOAT2 mRNA level in LNCaP cells that were treated with either DMSO control or 5 pM ENZ for 48 h. Data are presented as mean ± SD (n = 3 biological independent samples). Panel E shows qRT-PCR analysis showing relative MBOAT2 mRNA level in LnAR-shNT and LnARshFOXAl cells. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel F shows, on the left, Potential of Heat-diffusion for Affinity -based Transition Embedding (PHATE) maps colored by MBOAT2 mRNA level; and on the right, PHATE map of luminal cells from all samples stratified by treatment. Data adapted from Single cell portal (https: / / singlecell.broadinstitute.org / single_cell / study / SCP864). Panel Gshows single-cell MB0AT2 mRNA expression in normal mouse prostate tissues after castration and androgen addback. Data adapted from Single cell portal (https: / / singlecell.broadinstitute.org / single_cell / study / SCP859). Panel H shows mRNA expression of multiple AR target genes was detected by qRT-PCR in 819 mouse normal prostate organoid treated with DMSO control (Ctrl) or 10 pM ENZ for 48 h. Data are presented as mean ± SD (n=3 biologically independent samples). Panel I shows MB0AT2 mRNA expression was detected by qRT-PCR in 819 and 819-AR cells mouse normal prostate organoid treated with 100 nM DHT for 24 h. Data are presented as mean ± SD (n=3 biologically independent samples). Panel J shows Western blot analysis confirming Dox- inducible shRNA knockdown of MB0AT2 in LnARishMBOAT2 cells. Dox treatment: 1 pg / ml for 48 h. Panel K shows viability analysis of LnAR-ishMBOAT2 cells. Cells were preincubated with or without 1 pg / ml Dox for 48 h as indicated, followed by ferroptosis induction with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biological independent samples). Panel L shows Western blot analysis confirming MB0AT2 knockdown in LNCaP-shMBOAT2 cells. Panel M shows viability analysis of indicated cells treated with RSL3 (1 pM) in the absence or presence of Feri (10 pM) as indicated for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). ***P<0.001; One way ANOVA. Panel N shows heatmap of lipid species that were significantly changed between LnAR-NT and LnARshMBOAT2 cells. Two-tailed t- test, FDR-corrected p-value < 0.05, fold change threshold = 1.5. Statistical analysis was performed using 1-way ANOVA (Panels E. I, and M) or two-tailed t-test (Panels D and H).**P<0.01, ***P<0.001, ****P<0.0001.

[0012] FIG. 9, Panels A-Q show how AR antagonist sensitizes AR+prostate cancer cells to ferroptosis in vitro and in vivo, as described in the Example. Panels A and C show Western blot analysis showing MB0AT2 and AR expression in LnAR prostate cancer cells with indicated treatment for 48 h. Panels B and D show Bliss synergy score surface plots of LnAR cells following treatment with a combination of ENZ and RSL3 (Panel B) or ARV- 110 and RSL3 (Panel D). Cells were pretreated with indicated ENZ (Panel B) or ARV-110 (Panel D) for 48 h, follow ed by treatment with indicated concentration of RSL3 for 24 h. Synergy scores and plots were generated by SynergyFinder 3.0 (https: / / synergyfinder.fimm.fi / ). Panel E shows quantification of lipid peroxidation. LnAR cells were pretreated with DMSO control (Ctrl) or 5 pM ENZ for 24 h, followed by RSL3 (1pM) for 3 h prior to labeling with B0DIPY-C11. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel F shows viability analysis of LnAR cells harboring vector or MB0AT2 overexpression. Cells were pretreated with DMSO control (ctrl) or 5 pM ENZ for 48 h, followed by ferroptosis induction with 1 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel G shows Western blot analysis showing expression of endogenous and ectopic MB0AT2 in LnAR cells harboring either vector control or overexpression of ectopic MB0AT2 (mCherry -tagged). Cells were treated with 5 pM ENZ as indicated for 48 h. Panel H shows viability of LnAR- shNT and LnAR-shMB0AT2 cells pretreated with DMSO or 5 pM ENZ for 48 h, followed by treatment with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel I shows Western blot analysis showing MB0AT2 expression in LnAR-shNT and LnAR-shMB0AT2 cells that treated with 5 pM ENZ as indicated for 48 h. Panel J shows viability analysis of LnAR cells pretreated with DMSO control or 5 pM ENZ for 24 h, followed by incubation with indicated OA for 16 h, and then ferroptosis induction with 10 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel K shows viability analysis of LnAR cells pretreated with DMSO control or 5 pM ENZ for 24 h, followed by incubation with indicated LA for 16 h, and then ferroptosis induction with 2 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel L shows viability analysis of VCaP cells pretreated with DMSO control or 5 pM ENZ for 24 h, followed by incubation with indicated 10 pM LA for 16 h, and then ferroptosis induction with indicated RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel M shows viability analysis of 22Pc-EP cells pretreated with DMSO control or 1 pM ARV-110 for 24 h, followed by incubation with indicated 10 pM LA for 16 h, and then ferroptosis induction with indicated RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel N show s grow th curves of tumors derived from LnAR- isgGPX4 cells in xenograft mouse models. Tumors w ere grown to a volume around 250 mm3, at which point mice were randomly divided into 4 groups: normal diet + Vehicle, normal diet + ENZ (10 mg / kg IP injection), Dox diet + Vehicle, and Dox diet + ENZ. Mice were treated for 15 days. Data are presented as mean ± SD (n = 7). Panel O show-s images of tumors with indicated treatment at day-15. Panel P show s w eight of tumors with indicated treatment at day-15. Data are presented as mean ± SD (n = 7). Panel Q shows representativehematoxylin and eosin (H&E) and immunostaining images of GPX4, Ki67, MB0AT2 and PTGS2, all counterstained with hematoxylin (blue), are shown from sections of xenograft tumors derived from LnAR-isgGPX4 cells with indicated treatment. Statistical analysis was performed using 1-way ANOVA (Panels F and P), 2-way ANOVA (Panel N), and two- tailed t-test (Panel E). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0013] FIG. 10, Panels A-Q further show how AR antagonist sensitizes AR+prostate cancer cells to ferroptosis in vitro and in vivo, as described in the Example. Panel A shows Western blot analysis showing MBOAT2 and AR expression in LNCaP and LnAR cells cultured either in medium containing 10% normal FBS or in medium containing 10% charcoalstripped FBS (CS-FBS), followed by indicated treatments for 48 h. ENZ: 5 pM; DHT:100 nM. Panels B and C show viability analysis of LNCaP (Panel B) and LnAR (Panel C) cells cultured either in medium containing 10% normal fetal bovine serum (FBS) or in medium containingl0% CS- FBS for 48 h, followed by ferroptosis induction with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels D and E show viability analysis of LNCaP (Panel D) and LnAR (Panel E) cells with indicated treatment. Cells were pretreated either with DMSO or 5 pM ENZ for 48 h, followed by RSL3 (3 pM) in the presence or absence of Feri (10 pM) for another 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels F and G show dose-response matrix of LnAR cells following treatment with a combination of ENZ and RSL3 (Panel F) or ARV-110 and RSL3 (Panel G). Matrix was generated by SynergyFinder 3.0 (https: / / synergy fmder.fimm.fi / ). Panel H shows Western blot analysis showing MBOAT2 and AR expression in VCaP prostate cancer cells with indicated treatment for 48 h. Panels I and J show dose-response matrix (Panel I) and Bliss synergy score surface plots (Panel J) of VCaP cells with a combination of ARV-110 and RSL3 treatment. Cells were pretreated with indicated ARV-110 for 48 h, followed by treatment with indicated concentration of RSL3 for 24 h. Synergy scores and plots w ere generated by SynergyFinder 3.0 (https: / / synergyfinder.fimm.fi / ). Panels K-M show viabilityanalysis of LNCaP (Panel K). 22Pc-EP (Panel L), and LERX’ (Panel M) cells. Cells were pretreated with DMSO vehicle control or 5 pM ENZ for 48 h, followed by ferroptosis induction with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel N shows viability analysis of LREX’ cells with or without pretreatment of 5 pM ENZ for 48 h as indicated. Ferroptosis was induced by 10pM IKE for 24 h, in the absence or presence of 10 pM Feri as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel O shows Western blot analysis showing MB0AT2 expression in LREX’ cells in response of the treatment of 1 pM ENZ for 48 h. Panel P shows Western blot analysis showing GPX4 expression in LnAR cells harboring Dox-inducible GPX4 knockout (LnAR-isgGPX4) treated with 1 pg / ml Dox for 0, 2, or 4 days as indicated. Panel Q shows viability analysis of LnAR-isgGPX4 cells with indicated treatment for 7 days. ENZ: 1 pM; Dox: 1 pg / ml; Trolox: 100 pM. Data are presented as mean ± SD (n = 3 biologically independent samples). Statistical analysis was performed using 1-way ANOVA (Panels D and E). or two tailed t test (Panel N). **P<0.01, ***P<0.001, ****P<0.0001.

[0014] FIG. 11, Panels A-W show how MBOAT1 suppresses ferroptosis and is regulated by ER signaling, as described in the Example. Panel A shows Western blot analysis showing ectopic expression of indicated genes in HT1080-GPX4KOcells. Panel B shows viability analysis of HT1080-GPX4KOcells ectopically overexpressing indicated genes. Cells were cultured in the presence of 100 pM Trolox, and ferroptosis was induced by removing Trolox for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels C and E show viability analysis of HT1080-MBOAT1 cells (HT1080 cells overexpressing MBOAT1). Cells were pretreated with indicated concentrations of TOFA (Panel C) or CAY 10566 (Panel E) for 24 h, followed by ferroptosis induction with 0. 1 pM RSL3 for another 24 h in the presence or absence of 100 pM Trolox as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel D shows viability of HT 1080- Vector and HT1080-MBOAT1 cells with or without pretreatment of 5 pM TOFA for 24 h, followed by ferroptosis induction with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels F and G show quantification of PE-MUFAs (Panel F). and PE-PUFAs (Panel G) in HT1080-Vec and HT1080-MBOAT1 cells. Data are presented as mean ± SD (n = 5 biological replicates). Panels H and I show stacked bars showing relative abundance of indicated PE-OA and PE- AA in HT1080-Vector and HT1080-MBOAT1 cells. Panel J shows quantification of lipid peroxidation level. HT1080-Vector or HT1080-MBOAT1 cells were treated with 0. 1 pM RSL3 for 3 h prior to labeling with BODIPY-C11. Data are presented as mean ± SD, n=3. Panel K shows MBOAT1 mRNA expression of different cancer patient samples (TCGA PanCancer Atlas Studies). MBOAT1 mRNA expression was batch normalized from IlluminaHiSeq_RNASeqV2. Dash line indicates median. Multiple female cancers (red color) show high expression of MB0AT1. Panel L shows Western blot analysis showing endogenous MB0AT1 expression in a panel of ER+and triple negative breast cancer (BCa) lines. ER+BCa lines were either treated with DMSO, 5 pM Tam or 0.5 pM Ful for 48 h. Panel M shows viability analysis of a panel of ER+and triple negative BCa lines. Ferroptosis was induced by 3 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biological independent samples). Panel N show s visualization of ER and FOXA1 binding to the MBOAT1 ERE region (normalized by RPKM, GSE72249). Panel O shows ChlP-qPCR showing the occupancy of ER on the human MBOAT1 ERE region in MCF7 cells with indicated treatment for 24h. Ful: 0.5 pM. Panel P shows MBOAT1 mRNA expression was detected by qRT-PCR in T47D cells treated with DMSO control (Ctrl) or 100 nM E2 for 48 h. Data are presented as mean ± SD (n=3 biologically independent samples). Panel Q shows MBOAT1 mRNA expression was detected by qRT-PCR in T47D cells treated with DMSO control, 1 pM Tamoxifen (Tam) or 0.5 pM Fulvestrant (Ful) for 48 h. Data are presented as mean ± SD (n=3 biologically independent samples). Panel R shows Western blot analysis showing MBOAT1 and ER expression in T47D-shNT and T47DshESRl cells. Panel S shows Western blot analysis confirming MBOAT1 knockout in T47D-gMBOATl cells. Panel T and U shows viability' analysis of T47D-Cas9 and T47D-gMBOATl cells with indicated RSL3 (Panel T) or ML210 (Panel U) for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels V and W show quantification of differential PL-PUFAs (Panel V) and PL-MUFAs (Panel W) between T47D-Cas9 and T47D- gMBOATl cells. Data are presented as mean ± SD (n = 5 biologically independent samples). Statistical analysis was performed using 1-way ANOVA (Panels B, C, E, and Q), two-tailed t-test (Panels F, G, J, O, P, V, and W) and 2-way ANOVA (Panel M). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0015] FIG. 12, Panels A-T, further show how MBOAT1 suppresses ferroptosis and is regulated by ER signaling, as described in the Example. Panel A shows Western blot analysis showing expression of MBOAT2 and SCD1 in HT1080-GPX4KOcells with SCD1 overexpression and / or MBOAT2 sgRNA knockout as indicated. Panel B shows viability analysis of indicated cells cultured with or without 100 pM Trolox for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel C shows crystal violet staining of HT1080-GPX4KOcells overexpressing indicated genes cultured with orwithout Trolox for 72 h. Two independent experiments were performed, and representative images from one experiment are shown. Panel D shows viability analysis of HT1080 cells overexpressing indicated genes. Ferroptosis was induced by 0. 1 pM RSL3 for 24 h in the absence or presence of 10 pM Feri as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel E shows viability analysis of HT 1080 cells overexpressing indicated genes. Cells were with or without MUFA pretreatment (10 pM OA) as indicated for 16 h, followed by ferroptosis induction with 1 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel F shows MBOAT1 mRNA expression in normal human tissues (adapted from GTEx Portal). Expression levels are shown in TPM (transcripts per million). Box plots are shown as median and 25th and 75th percentiles. Panels G and H show MBOAT1 expression was detected by Western blot (Panel G) or qRT-PCR (Panel H) in MCF7 cells that treated either with DMSO control (Ctrl) or 100 nM E2 for 48 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels I and J show MBOAT1 expression was detected by Western blot (Panel I) or qRT-PCR (Panel J) in MCF7 cells that treated either with DMSO Ctrl, 1 pM 4OHT, or 0.5 pM Fulvestrant (Ful) for 48 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels K and L show MBOAT1 and FOXA1 expression was detected by Western blot (Panel K) or qRT-PCR (Panel L) in MCF7-shNT and MCF7-shFOXAl cells. Data are presented as mean ± SD (n = 3 biologically independent samples). Panels M and N show MBOAT1 expression was detected by qRT-PCR (Panel M) or Western blot (Panel N) in T47D cells cultured with medium containing 10% FBS or CS-FBS for 48 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel O shows qRT-PCR analysis showing MBOAT1 and MBOAT2 mRNA level in LnAR cells treated with DMSO vehicle control or 5 pM ENZ for 48 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel P show-s Western blot analysis showing MBOAT2, AR, and ER expression in LnAR and MCF7 cells subjecting indicated treatment for 48 h. ENZ: 5 pM; 4OHT: 10 pM; Ful: 0.5 pM. Panel Q shows Western blot analysis showing MBOAT1 expression in MCF7-shNT and MCF7-shMBOATl cells. Panel R shows viability analysis of MCF7-shNT and MCF7- shMBOATl cells treated with 5 pM RSL3 for 24 h in the presence or absence of 10 pM Feri as indicated. Data are presented as mean ± SD (n = 4 biologically independent samples). Panel S shows heatmap of lipid species that were significantly changed between T47D-Cas9 and T47DgMBOATl cells. Two tailed t test, FDR-corrected p-value < 0.05, fold changethreshold = 1.5. Panel T shows viability analysis of T47D-Cas9 and T47D-gMBOATl cells treated with 10 pM LA for 24 h. followed with indicated concentration of RSL3 for 24h. Data are presented as mean ± SD (n = 3 biologically independent samples). Statistical analysis was performed using 1-way ANOVA (Panels B, D, J, and L) or two-tailed t-test (Panels H, M, O, and R). **P<0.01, ***P<0.001, ****P<0.0001.

[0016] FIG. 13, Panels A-M shows how Fulvestrant sensitizes hormone therapy-resistant ER+breast cancer to ferroptosis. as described in the Example. Panel A shows Western blot analysis showing MB0AT1 and ER expression in T47D breast cancer cells with indicated treatment for 48 h. Panels B and C show dose-response matrix (Panel B) and Bliss synergy score surface plots (Panel C) of T47D cells with a combination of Ful and RSL3 treatment. Cells were pretreated with indicated Ful for 48 h, followed by treatment with indicated concentration of RSL3 for 24 h. Matrix, synergy scores and plots were generated by SynergyFinder 3.0 (https: / / synerg rinder.fimm.fi / ). Panel D shows viability of HCC1428 cells pretreated with or without 0.5 pM Fulvestrant for 48 h, and then ferroptosis induction with indicated RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel E shows Western blot analysis showing expression of endogenous and ectopic MBOAT1 in T47D and T47D cells harboring either vector control or overexpression of ectopic MBOAT1 (mCherry tagged). Cells w ere treated with 0.5 pM Ful as indicated for 48 h. Panel F shows viability analysis of T47D cells harboring vector or MBOAT1 overexpression. Cells were pretreated with DMSO control (ctrl) or 0.5 pM Ful for 48 h, follow ed by ferroptosis induction with indicated RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel G shows viability of MCF7 cells pretreated with or without 0.5 pM Fulvestrant for 24 h, followed by incubation with indicated concentration LA for 24 h. Subsequently, ferroptosis was induced by 1 pM RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel H shows quantification of lipid peroxidation of MCF7 cells pretreated with or without 0.5 pM Fulvestrant for 24 h, followed by incubation with indicated concentration LA for 24 h. Subsequently, ferroptosis was induced by 1 pM RSL3 for 4 h prior to labeling with BODIPY-C11. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel I shows Western blot analysis of MBOAT1 and ER-alpha in MCF7-Parental, MCF7- TamR+and MCF7-FulR+cells with or without 0.5 pM Ful treatment for 48 h. Panel J shows cell death analysis of MCF7-TamR+ and MCF7-FulR+ cells that pretreated with eitherDMSO, or 1 pM Fulvestrant, or 10 pM 4OHT for 48 h, and followed with either 10 pM IKE, or 10 pM IKE plus 100 pM Trolox for 24h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel K shows growth curves of tumors derived from MCF7-FulR+cells in xenograft mouse models. Tumors were grown to a volume around 250 mm3, at which point mice were randomly divided into 4 groups: Vehicle. Ful (5 mg, SQ injection), IKE (40 mg / kg IP injection), and Ful + IKE. Mice were treated for 15 days. Data are presented as mean ± SD (n =5 or 6). Panel L shows representative H&E and immunostaining images of ER, Ki67, MBOAT1 and prostaglandin-endoperoxide synthase 2 (PTGS2), all counterstained with hematoxylin (blue), are shown from sections of tumors derived from MCF7-FulR+cells with indicated treatment. Panel M shows a working model showing that ER signaling upregulates MBOAT1 expression in ER+cancer cells, while AR signaling upregulates MBOAT2 expression in AR+cancer cells. Either MBOAT1 or MBOAT2 can utilize endogenous or exogenous MUFA to suppress ferroptosis through phospholipid remodeling. Statistical analysis was performed using 1-way ANOVA (Panel H), 2-way ANOVA (Panel K), and two-tailed t-test (Panel J). *P<0.05, **P<0.01, ***p<0.001, ****p<0.0001.

[0017] FIG. 14, Panels A-K further show how Fulvestrant sensitizes hormone therapyresistant ER+ breast cancer to ferroptosis, as described in the Example. Panels A and B show viability analysis of MCF7 (Panel A) or HCC1428 (Panel B) cells. As indicated, cells were pretreated with 0.5 pM Ful for 24 h, followed by incubation with 10 pM LA for 24 h. Subsequently, ferroptosis was induced with indicated concentration of RSL3 for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel C show s Western blot analysis showing expression of endogenous and ectopic MBOAT1 in MCF7 cells treated with 0.5 pM Fulvestrant as indicated for 48 h. Panels D and E show viability analysis of MCF7 cells harboring Vector or MBOAT1 overexpression as indicated. Cells were pretreated with or without 0.5 pM Fulvestrant (Ful) for 24 h, followed by incubation with 10 pM LA for 24 h. Subsequently, ferroptosis was induced by 1 pM RSL3 (Panel D) or 1 pM ML210 (Panel E) for 24 h. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel F shows images showing viability of HT1080-GPX4KOcells with indicated treatment for 24 h. Trolox: 100 pM; Tam: 10 pM. Veh: DMSO as vehicle control. Two independent experiments w ere performed, and representative images from one experiment are shown. Scale bar = 50 pm. Panels G and H show- cell death time course ofHT1080 cells treated either with 0.2 pM Erastin (Panel G) or 0.1 |aM RSL3 (Panel H) with the supplement of 100 pM Trolox or 10 pM 4OHT as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel I shows viability7analysis of MCF7- TamR+and MCF7-FulR+cells cultured with 10% FBS or 10% CSFBS for 48 h, followed by ferroptosis induction with 5 pM RSL3 for 24 h in the absence or presence of 10 pM Feri as indicated. Data are presented as mean ± SD (n = 3 biologically independent samples). Panel J shows viability analysis of T47D-Parental or T47D-FulR+cells. As indicated, cells were pretreated with or without 0.5 pM Ful for 48 h followed by ferroptosis induction with 5 pM RSL3 for another 24 h in the presence or absence of 10 pM Feri . Data are presented as mean ± SD (n = 3 biologically independent samples). Statistical analysis was performed using two tailed t test (Panel E). **P<0.01. Panel K shows body weight curve of mice from FIG. 13, Panel K. Data are presented as mean ± SD (n =5 or 6). Statistical analysis was performed using 1-way ANOVA (Panels D, E, and I) or two-tailed t-test (Panel J). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.DETAILED DESCRIPTION

[0018] While some of the main embodiments of the present invention are described in the Summary' of the Invention, Examples and Claims sections of this patent disclosure, this Detailed Description section provides certain additional description relating to the invention and is intended to be read in conjunction with all other sections of the present patent application.

[0019] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to yvhich this invention belongs.

[0020] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents, unless the context clearly dictates otherwise. The terms “a” (or “an”) as well as the terms “one or more” and “at least one” can be used interchangeably.

[0021] Furthermore, “and / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term “and / or” as used in a phrase such as “A, B. and / or C” is intendedto include A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A (alone); B (alone); and C (alone).

[0022] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges provided herein are inclusive of the numbers defining the range.

[0023] Where a numeric term is preceded by ‘'about” or “approximately,” the term includes the stated number and values ±10% of the stated number. Furthermore, whenever a numeric term is preceded by the qualifier "about," an alternative embodiment having the precise stated numeric value without the “about” qualifier is also contemplated and also falls within the scope of the present invention. Conversely, whenever an embodiment of the present invention refers to a specific numeric term, an alternative embodiment with an “about” qualification is also contemplated and also falls w ithin the scope of the present invention.

[0024] The terms “comprising,” “consisting of', and / or “consisting essentially of’ have their accepted meanings according to U.S. patent law. Wherever embodiments are described with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of’ and / or '‘consisting essentially of’ are included.

[0025] It is also to be appreciated that the various modes of treatment of medical diseases and conditions as described herein are intended to mean “substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.Active Agents & Compositions

[0026] The methods and compositions provided by the present invention involve various different active agents, including, AR inhibitors, MBOAT2 inhibitors, ER inhibitors. MBOAT1 inhibitors, and ferroptosis-inducing agents.

[0027] In embodiments of the present invention, the AR inhibitor may be an AR pathw ay inhibitor and / or an AR signaling inhibitor. Examples of AR inhibitors include, but are not limited to, enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide, bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253, EPI-7386, EPI-506, andEPI-002. In certain embodiments, the AR inhibitor comprises a nucleic acid molecule, such as dsRNA, shRNA, siRNA, or antisense RNA.

[0028] In embodiments of the present invention, the MBOAT2 inhibitor may be an AR inhibitor.

[0029] In embodiments of the present invention, the ER inhibitor may be a selective ER modulator (SERM), selective ER downregulator (SERD), or a dual -mechanism ER inhibitor (DMERI). Examples of ER inhibitors include, but are not limited to, fulvestrant, elacestrant, etacstil, RU 58668, GW-7604, GDC-0810, AZD9496, GDC-0927, tamoxifen, bazedoxifene, lasofoxifene, giredestrant, amcenestrant, camizestrant, imlunestrant, OP-1250, ARV -471, GDC-9545, and H3B-6545. In certain embodiments, the ER inhibitor comprises a nucleic acid molecule, such as dsRNA, shRNA, siRNA, or antisense RNA.

[0030] In embodiments of the present invention, the MBOAT1 inhibitor may be an ER inhibitor.

[0031] In embodiments of the present invention, the ferroptosis-inducing agent may be a class 1 ferroptosis inducer (system Xc' inhibitor) or a class 2 ferroptosis inducer (glutathione peroxidase 4 (GPX4) inhibitor). Examples of ferroptosis-inducing agents include, but are not limited to, erastin, MEIE PE, AE, imidazole ketone erastin (IKE), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

[0032] In some embodiments, the ferroptosis inducing agent is an antagonist of MBOAT2. MBOAT1, or GPX4. for example, an antibody or fragment thereof, a binding protein, a polypeptide, and any combination thereof, that targets MBOAT2, MBOAT1, or GPX4; or a nucleic acid molecule (e.g., double stranded ribonucleic acid (dsRNA), small hairpin RNA or short hairpin RNA (shRNA), small interfering RNA (siRNA), or antisense RNA) that targets MBOAT2. MBOAT1, or GPX4.

[0033] In some embodiments the present invention provides combinations comprising one or more of the active agents described herein. The combinations may be for use in the methods of treatment described herein.

[0034] In some embodiments the present invention provides pharmaceutical compositions comprising one or more of the active agents described herein and a pharmaceutically- acceptable carrier. As used herein, a “pharmaceutically-acceptable carrier’’ is, or comprises, a substance that is useful in preparing a composition suitable for administration to a living subject (such as a living human subject) and that is generally safe and non-toxic. Suitable pharmaceutically-acceptable carriers may be, or may comprise, a saline solution (e.g., a phosphate buffered saline solution), water, an emulsion (such as an oil / water or water / oil emulsion), a wetting agent, a diluent, a fdler, a salt, a buffer, a stabilizer, a solubilizer, a lipid, or any other substance known in the art for use in preparing a composition suitable for administration to a living subject. The pharmaceutical compositions may be for use in the methods of treatment described herein.Methods of Treatment

[0035] The present invention provides various methods of treatment. As used herein, the terms “treat,” “treating,” and “treatment” refer to improving (or to methods that improve), to a detectable degree, one or more clinical indicators or symptoms associated with a tumor (such as a tumor of a specified type). For example, such terms include, but are not limited to, reducing the rate of growth of a tumor (or of tumor cells), halting the grow th of a tumor (or of tumor cells), causing regression of a tumor (or of tumor cells), reducing the grade of a tumor, eliminating a tumor (or tumor cells), and the like. In some embodiments, treatment may refer to reducing the size of a tumor (for example, as measured in terms of tumor volume or tumor mass) by, for instance, 5% or more, 10% or more. 20% or more, 30% or more, 40% or more. 50% or more, 60% or more, 70% or more. 80% or more, or 90% or more

[0036] Thus, in one aspect, the present invention is directed to a method of treating cancer in a subject in need thereof, the method comprising administering to the subject (a) an effective amount of one or more AR inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents. In some embodiments, the present invention is directed to a method of reducing the rate of growth of a cancer tumor, or is directed to a method of reducing the rate of growth of cancer cells, or is directed to a method of halting the growth of a cancer tumor, or is directed to a method of halting the growth of cancer cells, or is directed to a method of reducing the size of a cancer tumor, or is directed to a method of reducing the number of cancer cells, or is directed to a method of causing regression of a cancer tumor, or is directed to a method of causing the regression of cancer cells, or is directed to a method ofreducing the grade of a cancer tumor, or is directed to a method of eliminating a cancer tumor, or is directed to a method of eliminating cancer cells; these method comprising administering to the subject (a) an effective amount of one or more AR inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents.

[0037] In another aspect, the present invention is directed to a method of treating cancer in a subject in need thereof, the method comprising administering to the subject (a) an effective amount of one or more MB0AT2 inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents. In some embodiments, the present invention is directed to a method of reducing the rate of growth of a cancer tumor, or is directed to a method of reducing the rate of grow th of cancer cells, or is directed to a method of halting the growth of a cancer tumor, or is directed to a method of halting the growth of cancer cells, or is directed to a method of reducing the size of a cancer tumor, or is directed to a method of reducing the number of cancer cells, or is directed to a method of causing regression of a cancer tumor, or is directed to a method of causing the regression of cancer cells, or is directed to a method of reducing the grade of a cancer tumor, or is directed to a method of eliminating a cancer tumor, or is directed to a method of eliminating cancer cells; these method comprising administering to the subject (a) an effective amount of one or more MB0AT2 inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents.

[0038] In some embodiments, the cancer is AR+. In certain embodiments, the AR+cancer is prostate cancer or ovarian cancer.

[0039] In some embodiments, the cancer is characterized by overexpression of MB0AT2. In certain embodiments, the cancer characterized by overexpression of MB0AT2 is prostate cancer, pancreatic cancer, biliary tract cancer, uterine cancer, bladder cancer, or liver cancer.

[0040] In some embodiments, the subject was previously treated with a single-agent hormonal treatment, for example, an antiandrogen therapy. The antiandrogen therapy may comprise an AR inhibitor as described herein, or an androgen antagonist, z.e., an agent that inhibits or suppresses androgen production. Examples of androgen antagonists include, but are not limited to, ketoconazole, abiraterone acetate, seviteronel, aminoglutethimide, finasteride, dutasteride, epristeride, alfatradiol, saw palmetto extract (Serenoa repens), cyproterone acetate, spironolactone, medrogestone, flutamide, nilutamide, and bi flurenol; as w ell as antigonadotropins, w hich suppress the release of gonadotropins and consequentactivation of gonadal androgen production. In certain embodiments, the subject is resistant to treatment with a single-agent hormonal treatment.

[0041] In certain embodiments, the subject has CRPC.

[0042] In another aspect, the present invention is directed to a method of treating cancer in a subject in need thereof, the method comprising administering to the subject (a) an effective amount one or more ER inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents. In some embodiments, the present invention is directed to a method of reducing the rate of growth of a cancer tumor, or is directed to a method of reducing the rate of growth of cancer cells, or is directed to a method of halting the growth of a cancer tumor, or is directed to a method of halting the growth of cancer cells, or is directed to a method of reducing the size of a cancer tumor, or is directed to a method of reducing the number of cancer cells, or is directed to a method of causing regression of a cancer tumor, or is directed to a method of causing the regression of cancer cells, or is directed to a method of reducing the grade of a cancer tumor, or is directed to a method of eliminating a cancer tumor, or is directed to a method of eliminating cancer cells; these method comprising administering to the subject (a) an effective amount of one or more AR inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents.

[0043] In yet another aspect, the present invention is directed to a method of treating cancer in a subject in need thereof, the method comprising administering to the subject (a) an effective amount of one or more MB0AT1 inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents. In some embodiments, the present invention is directed to a method of reducing the rate of grow th of a cancer tumor, or is directed to a method of reducing the rate of growth of cancer cells, or is directed to a method of halting the growth of a cancer tumor, or is directed to a method of halting the growth of cancer cells, or is directed to a method of reducing the size of a cancer tumor, or is directed to a method of reducing the number of cancer cells, or is directed to a method of causing regression of a cancer tumor, or is directed to a method of causing the regression of cancer cells, or is directed to a method of reducing the grade of a cancer tumor, or is directed to a method of eliminating a cancer tumor, or is directed to a method of eliminating cancer cells; these method comprising administering to the subject (a) an effective amount of one or more MB0AT1 inhibitors, and (b) an effective amount of one or more ferroptosis-inducing agents.

[0044] In some embodiments, the cancer is ER+. In certain embodiments, the ER+cancer is breast cancer, uterine cancer, or ovarian cancer.

[0045] In some embodiments, the cancer is characterized by overexpression of MBOAT1. In certain embodiments, the cancer characterized by overexpression of MBOAT1 is breast cancer or liver cancer.

[0046] In some embodiments, the subject was previously treated with a single-agent hormonal treatment, for example, an antiestrogen therapy. The antiestrogen therapy may comprise an ER inhibitor as described herein, or an estrogen antagonist, z.e., an agent that inhibits or suppresses estrogen production. Examples of estrogen antagonists include, but are not limited to, aromatase inhibitor such as aminoglutethimide, testolactone, anastrozole, letrozole, exemestane, vorozole , formestane, fadrozole, 1,4, 6- Androstatrien-3, 17-dione, and 4- Androstene-3, 6, 17-trione; CYP17A1 inhibitors such as ketoconazole, abiraterone acetate, orteronel, galeterone, and seviteronel; 3(3-hydroxysteroid dehydrogenase inhibitors such as azastene. cyanoketone, epostane, trilostane, medroxyprogesterone acetate, and medrogestone; cholesterol side-chain cleavage enzyme inhibitors such as mitotane; 17f>-hydroxy steroid dehydrogenase inhibitors; and steroid sulfatase inhibitors such as irosustat, estrone sulfamate, estradiol sulfamate, and danazol.

[0047] In certain embodiments, the subject is resistant to treatment with a single-agent hormonal treatment.

[0048] As used herein the term “subject” encompasses all mammalian species, including, but not limited to, humans, non-human primates, dogs, cats, rodents (such as rats, mice and guinea pigs), cows, pigs, sheep, goats, horses, and the like - including all mammalian animal species used in animal husbandry, as well as animals kept as pets and in zoos, etc. In some embodiments the subjects are human. Such subjects will ty pically have a tumor (or tumors) in need of treatment.

[0049] The efficacy of a given composition or method in treatment can be demonstrated or assessed using standard methods known in the art, such as methods that compare the efficacy of a given / “test” composition or method to a “control” composition or method. For example, the efficacy of a given composition or method in treating a tumor may be demonstrated or assessed by comparing its ability' to improve one or more clinical indicators or symptoms of a tumor as compared to that of a control composition or control method, such as a placebo control. For instance, a comparison can be made between different subjects(e.g., between a test group of subjects or a control group of subjects). Similarly, the efficacy of a given composition or method in treatment can be demonstrated or assessed in a single subject by comparing that subject’s tumor before and after treatment.

[0050] The term “tumor” is used herein in accordance with its normal usage in the art and includes a variety of different tumor types.

[0051] In carrying out the treatment methods described herein, any suitable method or route of administration can be used to deliver the active agents or combinations thereof described herein. The term “administration” includes any route of introducing or delivering the specified compositions or agents to subjects. In some embodiments the active agents or combinations thereof, are administered systemically. In some embodiments the active agents or combinations thereof, are administered locally. “Systemic administration” refers to introducing or delivering to a subject a specified composition or agent via a route which introduces or delivers the composition or agent to extensive areas of the subject’s body (e.g.. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to introducing or delivering to a subject a specified composition or agents via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject’s body.

[0052] In some embodiments, administration can be carried out by any suitable route known in the art, including intratumoral, intravenous, subcutaneous, oral, topical, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole. intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. Administration includes self-administration and administration by another. The suitability of a given route or means of administration can be readily determined by a physician.

[0053] Where two or more active agents are administered, the agents may be administered simultaneously, sequentially, or at overlapping times. Similarly, where two or more agents are administered, the agents may be administered together in the samecomposition or separately in different compositions. As used herein, the term ‘‘separate'’ or “separately” in the context of a therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes. As used herein, the term “sequential” or “sequentially” in the context of a therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case. Further, as used herein, the term “simultaneous” or “simultaneously” in the context of a therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.

[0054] As used herein the term “effective amount” refers to an amount of an active agent as described herein that is sufficient to achieve, or contribute towards achieving, one or more of the outcomes listed in the “treatment” description herein. An appropriate “effective” amount in any individual case may be determined using standard techniques known in the art, such as dose escalation studies, and may be determined taking into account such factors as the desired route of administration (e.g., systemic vs. local), the desired frequency of dosing, etc. Furthermore, an “effective amount” may be determined in the context of any coadministration to be used. One of skill in the art can readily perform such dosing studies (whether using single agents or combinations of agents) to determine appropriate doses to use, for example using assays such as those described in the Examples section of this patent application — which involve administration of the agents described herein to subjects — such as animal subjects routinely used in the pharmaceutical sciences for performing dosing studies.

[0055] For example, in some embodiments the dose of an active agent of the invention may be calculated based on studies in humans or other mammals carried out to determine efficacy and / or effective amounts of the active agent. The dose amount and frequency or timing of administration may be determined by methods know n in the art and may depend on factors such as pharmaceutical form of the active agent, route of administration, whether only one active agent is used or multiple active agents (for example, the dosage of a first activeagent required may be lower when such agent is used in combination with a second active agent), and patient characteristics including age, body weight, or the presence of any medical conditions affecting drug metabolism.

[0056] In those embodiments described herein that refer to specific doses of agents to be administered based on mouse studies, one of skill in the art can readily determine comparable doses for human studies based on the mouse doses, for example using the types of dosing studies and calculations described herein.

[0057] In some embodiments suitable doses of the various active agents described herein can be determined by performing dosing studies of the type that are standard in the art. such as dose escalation studies, for example using the dosages shown to be effective in mice in the Examples section of this patent application as a starting point.

[0058] Dosing regimens can also be adjusted and optimized by performing studies of the type that are standard in the art, for example using the dosing regimens shown to be effective in mice in the Examples section of this patent application as a starting point. In some embodiments the active agents are administered daily, or twice per week, or weekly, or every two weeks, or monthly.

[0059] In certain embodiments the compositions and methods of treatment provided herein may be employed together with other compositions and treatment methods known to be useful for tumor therapy, including, but not limited to, surgical methods (e.g, for tumor resection), radiation therapy methods, treatment with chemotherapeutic agents, treatment with antibodies, treatment with immunotherapeutic agents, treatment with cell therapy methods, treatment with tyrosine kinase inhibitors, and the like. Similarly, in certain embodiments the methods of treatment provided herein may be employed together with procedures used to monitor disease status / progression, such as biopsy methods and diagnostic methods (e g., MRI, X-ray, PET, or CAT methods, or other imaging methods).

[0060] For example, in some embodiments the methods described herein and / or the agents and compositions described herein may be employed or administered to a subject prior to performing surgical resection of a tumor, for example in order to shrink a tumor prior to surgical resection. In other embodiments the methods described herein and / or the agents and compositions described herein may be employed or administered to a subj ect both before and after performing surgical resection of a tumor.Kits

[0061] In one aspect, the present invention provides kits comprising the active agents disclosed herein.

[0062] For example, in some embodiments, the kit comprises (a) one or more AR inhibitors, or a pharmaceutical composition thereof, as disclosed herein; and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof, as disclosed herein. In some embodiments, the kit comprises (a) one or more MOAT2 inhibitors, or a pharmaceutical composition thereof, as disclosed herein; and (b) one or more ferroptosis- inducing agents, or a pharmaceutical composition thereof, as disclosed herein. In some embodiments, the kit comprises (a) one or more ER inhibitors, or a pharmaceutical composition thereof, as disclosed herein; and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof, as disclosed herein. In other embodiments, the kit comprises (a) one or more MO ATI inhibitors, or a pharmaceutical composition thereof, as disclosed herein; and (b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof, as disclosed herein.

[0063] In certain embodiments, the kit may further comprise instructions for use.

[0064] In some embodiments, the active agents may be packaged together, such as in the same container. In some embodiments, the active agents may be packaged separately, such as in separate containers.

[0065] In some embodiments, the kits may include instructions customarily included in commercial packages of therapeutic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and / or warnings concerning the use of such therapeutic products.***

[0066] The invention is further described in the following non-limiting Example, as well as the Figures referred to therein.EXAMPLE

[0067] Ferroptosis, a cell death process driven by iron-dependent phospholipid peroxidation, has been implicated in multiple diseases including cancer, ischemic organ injury, and neurodegeneration. There are two major surveillance mechanisms to suppressferroptosis: one mediated by GPX4 that catalyzes the reduction of phospholipid peroxides, and the other mediated by enzymes that produce metabolites with free radical-trapping antioxidant (RTA) activity. Both surveillance mechanisms are being explored as potential cancer therapeutic targets. In this study, through a whole genome CRISPR activation screen followed by mechanistic investigation, phospholipid modifying enzymes MB0AT1 and MB0AT2 were identified as new ferroptosis suppressors. MB0AT1 and MB0AT2 inhibit ferroptosis by remodeling the cellular phospholipid profile, and strikingly, their ferroptosis surveillance function is independent of GPX4 or RTA-generating enzyme FSP1. In addition, MB0AT1 and MB0AT2 were demonstrated to be transcriptionally upregulated by sex hormone receptors ER and AR, respectively, rendering cells more resistant to ferroptosis. Further, combination of ferroptosis induction with ER antagonist or AR antagonist significantly inhibited the growth of ER+breast cancer and AR+prostate cancer in vitro and in vivo, even when tumors were resistant to single-agent hormonal therapies.ResultsMB0AT2 is a novel ferroptosis suppressor independent of GPX4 and FSP1

[0068] To identify novel ferroptosis-suppressing genes, a genome-wide CRISPR activation screen was conducted in human fibrosarcoma HT1080 cells, with GPX4 inhibitor RSL3 and cystine starvation as ferroptosis inducers (FIG. 1, Panel A). sgRNAs of seven genes were found to be significantly enriched in cells that survived both RSL3 and cystine starvation (FIG. 1, Panels B and C). Among them, five gene were established ferroptosis suppressors: SLC7A11, NFE2L2 (encoding antioxidant transcription factor NRF2), FSP1, GCH1 and NOS2; the other two were lipid modifying enzymes MB0AT2 and PLA2G2F, which have not been reported as ferroptosis regulators. This result prompted an investigation of the potential role of MBOAT2 and PLA2G2F in ferroptosis.

[0069] As a member of MBOAT family, MB0AT2 possesses lyso-PL acyltransferase activity (LPLAT), preferentially transferring MUFA chains to the Sn2 position of PE, and likely also to PC and lyso-phosphatidic acid (PA) (Gijon et al., 2008; Hishikawa et al.. 2008). PLA2G2F is a secretory calcium-dependent phospholipase A2, which primarily targets extracellular phospholipids (Valentin et al., 2000). Both MB0AT2 and PLA2G2F are presumably involved in the PL remodeling pathway, Lands’ cycle — to de-acylate PLs by phospholipase Al / 2 (PLA1 / 2) and acylate lyso-PL by LPLATs — through which fatty acyl side chains of PLs are selectively replaced (O’Donnell, 2022). Because the composition ofplasma membrane PL determines ferroptosis sensitivity, enzymatic components of Lands’ cycle are potential regulators of ferroptosis (Liang et al., 2022). LPCAT3 (MB0AT5), another member of MBOAT family, promotes ferroptosis by incorporating PUFA into PLs to increase the level of PL-PUFAs, substrate of PL peroxidation (Dixon et al., 2015). iPLA2[3, also a member of PLA2 family, has been reported to negatively regulate ferroptosis possibly by removing oxidized acyl chains of PLs (Beharier et al.. 2020; Chen et al. , 2021 ; Sun et al. , 2021).

[0070] To validate whether MB0AT2 and PLA2G2F possess ferroptosis-suppressing function, each were overexpressed in HT1080 cells (FIG. 1, Panel D). It was found that overexpression of both genes indeed inhibited ferroptosis induced by IKE, an inhibitor of cystine / glutamate antiporter system xc’, and by cystine starvation (FIG. 1, Panels E and F). These inducers, known as class 1 ferroptosis inducers (FINs). trigger ferroptosis by depleting GPX4 cofactor GSH. Overexpression of MB0AT2 and PLA2G2F also inhibited ferroptosis induced by RSL3, a direct inhibitor of GPX4, a class II FIN (FIG. 1, Panel G). Next, HT1080-GPX4KOcells were established as a spontaneous ferroptosis model (FIG. 1. Panel H). These cells were maintained in the presence of antioxidant Trolox to prevent ferroptosis. After removal of Trolox, HT1080-GPX4KOcells underwent ferroptosis promptly (FIG. 2, Panel A). MBOAT2 overexpression, but not PLA2G2F, robustly suppressed spontaneous ferroptosis of HT1080-GPX4KOcells (FIG. 2, Panel B and C). MB0AT2 overexpression enabled the maintenance of long-term culture of HT1080-GPX4KOcells without Trolox, reminiscent of the GPX4-independent anti-ferroptosis function of RTA-generating enzymes FSP1, GCH1 and NOS2 (FIG. 1, Panel I; FIG. 2, Panels C and D). FSP1 was upregulated in HT1080-GPX4KOcells, likely through feedback regulation (FIG. 1, Panel H). To assess if FSP1 is required for the ferroptosis-suppressing function of MB0AT2, HT1080- GPX4 / FSP1DKOcells were established (FIG. 1, Panel H; FIG. 2. Panel A). MBOAT2 effectively rescued spontaneous ferroptosis and maintained long-term viability of GPX4 / FSP1DKOcells (FIG. 1, Panel J). Consistently, MB0AT2 inhibited RSL3-induced lipid peroxidation, a critical event for ferroptosis (FIG. 2, Panel E). Collectively, these data indicate that MB0AT2 is a potent ferroptosis-suppressing gene which functions independently of GPX4 activity and RTA-producing enzymes such as FSP1. Consistently, the RNA-seq analysis revealed that MB0AT2 overexpression did not alter the expression of known ferroptosis regulators such as GPX4, SLC7A11, GCH1, and ACSL4 (FIG. 2, Panels F and G).Ferroptosis-suppressing function of MBQAT2 requires either endogenous or exogenousMUFA

[0071] Since MB0AT2 is a member of LPLAT family, it was tested whether MB0AT2 suppresses ferroptosis through PL metabolism. MBOAT2 exhibits LPLAT activity by transferring oleic acid (OA; 18: 1), in its CoA-conjugated acyl donor form, preferentially to lyso-PE, and likely also to lyso-PC and lyso-PA (Gijon et al., 2008; Hishikawa et al., 2008). With OA as one of the most abundant cellular MUFAs, and both endogenous MUFA synthesis through SCD1 and exogenous MUFAs able to suppress ferroptosis in an ACSL3- dependent manner (Magtanong et al. , 2019; Yi et al. , 2020), it was hypothesized that MBOAT2 catalyzes MUFA incorporation into PL, competitively decreasing PL-PUFA content and ultimately leading to a ferroptosis-resistant cell state. This hypothesis predicted that either endogenous MUFA synthesis or exogenous MUFAs can mediate the ferroptosis- suppressing activity of MB0AT2.

[0072] The following experiments were conducted to test the role of endogenous MUFA synthesis:■ De novo hpogenesis of MUFAs starts with carboxylation of acetyl-CoA to form malonyl-CoA by acetyl-CoA carboxylase (ACC). ACC inhibitor TOFA induced ferroptosis in HT1080-GPX4KOcells with MBOAT2 overexpression in a dose dependent manner (FIG. 4, Panel A), but not in HT1080-GPX4KOcells with GCH1 overexpression (FIG. 3, Panel A), suggesting a MBOAT2-specific role of hpogenesis in ferroptosis suppression. Consistently, TOFA potentiated RSL3-induced ferroptosis in HT1080 cells overexpressing MBOAT2 in a dose dependent manner (FIG. 3, Panel B) and could reach complete abolishment of the ferroptosis-suppressing activity of MB0AT2 overexpression (FIG. 3, Panel C).■ De novo synthesized saturated fatty acids (SFAs) are converted to MUFAs by SCDL hence whether SCD1 is required for the ferroptosis-suppressing function of MB0AT2 was tested. Indeed, SCD1 inhibitor CAY10566 significantly ablated the protective activity of MB0AT2 against ferroptosis induced by RSL3 or GPX4 knockout (FIG.3, Panel D: FIG. 4, Panel B). Genetic knockout of SCD1 confirmed the effect of CAY- 10566 (FIG. 3, Panels E and F). Collectively, these results confirmed the role of de novo MUFA synthesis in mediating the ferroptosis-suppressing function of MBOAT2.■ Further, ACSL3 selectively converts MUFA into MUFA-CoA before they can be incorporated into PL. which is required for the ferroptosis-suppressing function of MUFA (Magtanong et al., 2019). In agreement with this finding, ACSL3 knockdown was shown to provoke spontaneous ferroptosis in HT1080-GPX4KOcells even with MBOAT2 overexpression (FIG. 4, Panels C and D).

[0073] In addition to de novo synthesis, dietary7FA is also an important source of MUFA pool, especially for cells deficient of lipid synthesis. Indeed, exogenous OA effectively attenuated ferroptosis in HT1080-GPX4KOcells (FIG. 4, Panel E). Importantly, upon MBOAT2 overexpression, the protective function of OA was further increased in HT1080- GPX4 / SCD1DKOcells (FIG. 3, Panel G), whereas MB0AT2 knockdown significantly diminished protection conferred by exogenous OA against ferroptosis triggered by various FINs (FIG. 3, Panels H-K). In conclusion, MB0AT2 mediates the ferroptosis-suppressing activity of both endogenous and exogenous MUFAs (see working model in FIG. 3, Panel L).MB0AT2 suppresses ferroptosis through phospholipid remodeling

[0074] As MB0AT2 suppresses ferroptosis in a MUFA-dependent manner, it was sought to determine whether MB0AT2 inhibits ferroptosis through PL remodeling. Untargeted lipidomic analysis was performed in HT1080 cells with or without MB0AT2 overexpression. In total, the relative abundance of 370 lipid species was quantitatively measured. Interestingly, PE lipids with PUFA tails (PE-PUFAs) were significantly downregulated by MB0AT2 overexpression, while PE-MUFAs were clustered among the top upregulated lipids in MBOAT2-overexpression cells (FIG. 5, Panel A). Previous studies suggest that PE with arachidonoyl tail (PE-AA, 20:4) or adrenoyl tail (PE-AdA, 22:4) are the major PL- PUFAs that are subjected to peroxidation during ferroptosis (Doll et al., 2017; Kagan et al., 2017). Since MB0AT2 mainly affects PE lipids, it was proposed that MB0AT2 selectively transfers MUFA-CoA to lyso-PE to competitively decrease the incorporation of PUFA-CoA to lyso-PE.

[0075] To demonstrate the selectivity of MB0AT2 to lyso-PE, alteration by MB0AT2 overexpression of major PE-MUFAs, PC-MUFAs, as w ell as other PL-MUFAs (ranked by relative abundance), was reexamined. Compared to control, overexpression of MB0AT2 selectively increased PE-MUFAs, especially PE-OA (18: 1); however, PC-MUFAs and other PL-MUFAs were not significantly affected (FIG. 5, Panels B and C; FIG. 6, Panel A). Ester linkage PE-MUFAs (e.g., PE 18:0 / 18: 1) and ether linkage PE-MUFAs (e.g., PE P-18:0 / 18: 1) increased in a similar trend (FIG. 5, Panel B), suggesting that the chemistry' of sn- 1 linkage does not affect the activity of MB0AT2. Despite previous in vitro studies reporting the activity of MBOAT2 towards other lyso-PLs such as lyso-PC and lyso-PA (Gijon et al., 2008; Hishikawa et al., 2008), untargeted cellular lipidomic analysis indicated that MB0AT2 selectively transfers OA-CoA to lyso-PE.

[0076] Next, how MB0AT2 regulates the PE-PUFA profde was investigated. It was confirmed that PE-PUFAs were significantly decreased upon MBOAT2 overexpression (FIG. 5, Panel D). while most of the other PL-PUFAs were not affected (FIG. 6, Panels B and C). Interestingly, among PE-PUFAs, PE-AA were significantly decreased (FIG. 5, Panel D); again, both ester linkage PE-AA (e.g., PE 18:0 / 20:4) and ether linkage PE-AA (e.g., PE 18:0 / 20:4) were similarly decreased (Figure 3D). However, PE-AdA and other PE- long chain PUFAs (e.g., 22:4, 22:5, 22:6) were not significantly affected (FIG. 6, Panel D). Considering that AA releases from PL much faster than AdA (Guijas et al., 2012), PE-AA might be subject to more active PL remodeling, which explains why PE-AA but not PE-AdA were altered by MBOAT2. Collectively, the data support a competitive PE remodeling model, in which MUFA-preferred lyso-PE acyltransferase (LPEAT) MBOAT2 competes with PUFA-preferred LPEAT (e.g., LPCAT3) on lyso-PE. Presumably, in specific cells or tissues with predominant MBOAT2 activity, PE remodeling would shift the cells towards a state of high PE-MUFA level but low PE-AA level, leading to ferroptosis resistance, and vice versa (FIG. 6, Panel E). In agreement with this competition model, the increase of PE-OA was very similar to the decrease of PE-AA that share same backbone of lyso-PE (e.g., PE 18:0 18: 1 vs PE 18:0_20:4; FIG. 5, Panels E and F). Furthermore, mutation of MBOAT2 enzymatic site H373 completely abolished its ferroptosis suppressing function (FIG. 5, Panels G and H), validating that the enzymatic activity of MBOAT2 is essential for ferroptosis inhibition.

[0077] The function of MBOAT2 to inhibit ferroptosis is not limited to HT1080 cells. Through an analysis of DepMap portal (https: / / depmap.org / portal / ), MB0AT2 mRNA expression was positively correlated with RSL3 resistance in PDAC cells (FIG. 6, Panel F). Indeed, in a panel of PDAC cells, MBOAT2-mid / high cells showed general more resistance to RSL3 comparing to MBOAT2-low cells (FIG. 6, Panels G and H). Moreover, overexpressing MB0AT2 in MBOAT2-low PANC-1 and MIA PaCa-2 cells significantly increased their resistance to ferroptosis induction (FIG. 6, Panels I-L), whereas knockingdown MBOAT2 in SUIT-2 cells significantly sensitized cells to RSL3 or IKE induced- ferroptosis (FIG. 5, Panels I-K). These results indicate that MB0AT2 can inhibit ferroptosis in various types of cancer cells.

[0078] Mammalian cells acquire the essential PUFAs, a-linolenic acid (ALA; 18:3n-3) and linoleic acid (LA; 18:2n-6), through diet and further synthesize other long chain PUFAs (e.g. , AA) through a chain of desaturation and elongation reactions (Liang et al. , 2022). In the context of tumor microenvironment, CD36-mediated fatty acid uptake increases PL- PUFA contents and promotes ferroptosis in tumor-infiltrating CD8+ T cells (Ma et al.. 2021). Since MBOAT2 competitively inhibits synthesis of PE-AAs, it was examined whether MBOAT2 is responsible for the resistance of exogenous PUFA-induced ferroptosis. Exogenous PUFA (Linoleic acid, 18:2) sensitized RSL3 or IKE-induced ferroptosis in SUIT- 2 cells, and this sensitization was significantly amplified by MB0AT2 knockdown (FIG. 6, Panels M and N), indicating that endogenous MBOAT2 plays a significant role in antagonizing exogenous PUFA-induced ferroptosis.Androgen receptor (AR) signaling modulates ferroptosis in prostate cancer through MBOAT2

[0079] Through a cross comparison of MBOAT2 mRNA level in various cancer tissues (TCGA PanCancer Atlas) as well as in normal tissues (GTEx Portal), MBOAT2 was found to be uniquely upregulated in prostate cancer (PC a) (FIG. 7, Panel A; FIG. 8, Panel A). Intriguingly, MBOAT2 mRNA was positively correlated with AR mRNA in human PCa samples (FIG. 8. Panel B; TCGA, PanCancer Atlas). By analyzing a panel of PCa cell lines, MBOAT2 was highly expressed in AR+PCa cell lines but not in AR PCa cell lines (FIG. 7, Panel B). Importantly, AR+PCa cell lines were generally more resistant to ferroptosis than AR PCa cell lines (FIG. 7, Panel C). These results prompted a proposal that AR signaling modulates ferroptosis in PCa through MB0AT2.

[0080] The analysis of previously published ChlP-Seq dataset (GSE37345, (Jin et al., 2014)) revealed that AR and its cofactor FOXA1 bind to a putative intronic androgen response element (ARE) with proximity to the transcription start site (TSS) o MBOAT2 (FIG. 7, Panel D). Through a ChlP-qPCR analysis, it was confirmed that binding of AR to this MBOAT2 ARE occurred, and that this binding was enhanced by AR agonist dihydrotestosterone (DHT) but inhibited by AR antagonist enzalutamide (ENZ) (FIG. 7. Panel E). These results indicate that AR directly upregulates MB0AT2 expression in PCa.Indeed. DHT significantly increased MB0AT2 expression in AR+PCa cell lines (FIG. 7, Panel F; FIG. 8. Panel C), while ENZ significantly decreased baseline MB0AT2 expression (FIG. 7, Panel B) and abolished DHT-induced MB0AT2 upregulation (FIG. 7, Panel F;FIG. 8. Panel C). Further, ENZ inhibited MB0AT2 expression transcriptionally (FIG. 8, Panel D). As expected, inducible shRNA knockdown of AR decreased MB0AT2 expression in LnAR cells (LNCaP cells with AR overexpression) (FIG. 7, Panel G), and ectopic expression of AR in AR-negative PC3 cell line induced MB0AT2 expression that can be further increased by DHT (FIG. 7, Panel H). Moreover, knockdown of F0XA1 decreased MB0AT2 gene expression in LnAR cells (FIG. 8, Panel E). All these data demonstrate that MB0AT2 is a bona fide target of AR in prostate cancer cells.

[0081] It was next examined whether AR regulates MB0AT2 expression in normal prostate tissues. An analysis of single-cell RNA-Seq datasets (Karthaus et al., 2020) showed that MBOAT2 expression in normal human prostate tissues decreased after androgen deprivation therapy (ADT) (FIG. 8, Panel F), and Mboat2 expression in normal mouse prostate tissues diminished after castration and restored rapidly after androgen addback (FIG.8, Panel G), suggesting that MBOAT2 expression was responsive to androgen signaling in normal prostate tissue. Experimentally, in mouse normal prostate organoids. Mboat2 was downregulated by ENZ (FIG. 8, Panel H) and upregulated by DHT and AR overexpression (FIG. 8, Panel I) Therefore, AR signaling regulates MBOAT2 expression in both normal prostate tissue and PCa.

[0082] It was subsequently examined whether MB0AT2 regulates ferroptosis sensitivity in AR+PCa. MB0AT2 knockout or knockdown significantly sensitized LnAR (FIG. 7, Panels I and J; FIG. 8, Panels J and K) and LNCaP cells (FIG. 8. Panels L and M) to RSL3-induced ferroptosis. Through lipidomic analysis (FIG. 8, Panel N), it was found that MB0AT2 knockdown remodeled phospholipid profile by significantly increasing the contents of PE-PUFAs (FIG. 7, Panel K) but decreasing that of selected PE-MUFAs (FIG.7, Panel L). Therefore, AR signaling promotes the resistance of AR+PCa cells to ferroptosis via upregulating MBOAT2 expression and subsequently remodeling cellular PL profile.AR antagonist sensitizes AR+prostate cancer to ferroptosis in vitro and in vivo

[0083] Since upregulated MB0AT2 in AR+PCa promotes ferroptosis resistance, would AR antagonization sensitize the tumor cells to ferroptosis induction by down regulating MB0AT2? If so, AR-inhibition in combination with ferroptosis induction might be apotential strategy for the treatment of AR+PCa. To test this possibility, the ferroptosis sensitivity of LNCaP (representing castration-sensitive PCa) and LnAR (representing castration-resistant PCa, CRPC) cells in normal medium and in medium with androgen depletion was compared. Androgen deprivation diminished MBOAT2 expression and sensitized LNCaP cells to ferroptosis (FIG. 10, Panels A and B). However, androgen deprivation did not significantly sensitize LnAR cells to ferroptosis (FIG. 10, Panel C).

[0084] Although deprivation of androgen from culture medium did not sensitize CRPC LnAR cells to ferroptosis induction, it was tested whether treatment with anti-androgen agents can do so. Enzalutamide (ENZ) is a second-generation, FDA-approved androgen- targeted therapeutic agent that can restore the sensitivity of CRPC to AR inhibition by binding to the ligand-binding domain of AR, preventing AR nuclear translocation, thus suppressing the transcriptional activity of AR (Tran et al., 2009). ARV-110 is a clinical stage PROTAC protein degrader selectively targeting AR (Milliard, 2019). Remarkably, both ENZ and ARV-110 were found to significantly inhibit endogenous MB0AT2 expression in a dosedependent manner (FIG. 9, Panels A and C; FIG. 10, Panel H) and strongly sensitized multiple AR+PCa cell lines to RSL3 -induced ferroptosis, including CRPC line LnAR (FIG. 9, Panels A-D; FIG. 10. Panels D-M). As a marker of ferroptosis. RSL3-induced lipid peroxidation was also potentiated by ENZ (FIG. 9, Panel E).

[0085] To test whether ENZ can sensitize ferroptosis through suppressing MB0AT2 expression, LnAR cell line expressing ectopic MB0AT2 was established (transcription of ectopic MB0AT2 is not regulated by AR signaling or ENZ) (FIG. 9, Panel G). Indeed, ENZ only sensitized ferroptosis in control LnAR cells but not in LnAR cells expressing ectopic MB0AT2 (FIG. 9, Panel F). Moreover, ENZ did not further sensitize ferroptosis in LnAR- shMBOAT2 cells (FIG. 9, Panels H and I), validating that ENZ sensitizes ferroptosis through downregulating endogenous MB0AT2.

[0086] It w as subsequently examined in AR+PCa cells whether ENZ could abolish the effect of exogenous MUFA on ferroptosis inhibition and promote the role exogenous PUFA in potentiating ferroptosis. Although exogenous OA inhibited RSL3-induced ferroptosis in a dose-dependent manner in untreated LnAR cells, ENZ treatment abolished the protective function of OA (FIG. 9, Panel J). Conversely, ENZ significantly enhanced ferroptosis in the presence of exogenous LA (FIG. 9, Panels K-M).

[0087] In the clinic, ENZ treatment will ultimately lead to ENZ resistance in patients through several possible mechanisms:(1) activation of AR-bypass signaling, in which other transcription factors (e.g., glucocorticoid receptor, GR) are induced to substitute AR to activate a similar but distinguishable set of target genes (Arora et al. , 2013; Shah et al. , 2017);(2) activation of AR-independent oncogenic signaling (reviewed in (Watson etal., 2015));(3) transition to a neuroendocrine prostate cancer (NEPC) phenotype (reviewed in (Watson et al., 2015)). An LnAR subline termed LREX' acquired resistance to ENZ in a GR-dependent manner (Arora et al. , 2013).Interestingly, a subset of AR target genes are still responsive to AR signaling in LREX’ cells, and ENZ was found to almost completely blocked MB0AT2 expression in these cells (FIG. 10. Panel O). Importantly, although ENZ alone failed to decrease the viability of LREX’ cells, it sensitized the cells to ferroptosis induction (FIG. 10, Panels M and N), suggesting the combination of ENZ with ferroptosis induction might overcome the resistance of AR+PCa to ENZ.

[0088] To validate whether ENZ sensitizes CRPC to ferroptosis in vivo, hence a potential combination therapy, a LnAR-iCas9-sgGPX4 (LnAR-isgGPX4) cell line was established, in which Cas9 expression can be induced by doxycycline (Dox). Similar to RSL3-induced ferroptosis, ferroptosis triggered by inducible GPX4 knockout in LnAR cells was also further potentiated by ENZ (FIG. 10, Panels P and Q). LnAR-isgGPX4 xenograft model was then generated. Although Dox-diet efficiently induced GPX4 knockout (FIG. 9, Panel Q), and ENZ clearly decreased MB0AT2 expression in the tumors (FIG. 9, Panel Q), Dox-diet or ENZ alone only moderately inhibited tumor growth (FIG. 9, Panels N-P). In contrast, Dox- diet in combination with ENZ completely inhibited tumor growth and caused notable tumor regression (FIG. 9, Panels N-P) As an in vivo marker of tumor ferroptosis, PTGS2 expression was significantly upregulated in the combination group (FIG. 9, Panel Q).MB0AT1 is an additional MUFA-preferred ferroptosis-suppressing LPLAT and is regulated by estrogen receptor (ER)

[0089] In HT1080-GPX4KOcells, SCD1 overexpression could promote cell survival even when MB0AT2 was knocked out (FIG. 12. Panels A and B), suggesting the presence ofother LPLAT(s) in addition to MB0AT2 that can also catalyze PL-MUFA synthesis. There are 14 identified LPLATs with ten from the AGP AT family and four from the MBOAT family (Valentine et al., 2022). Four MBOAT family members (MBOAT1, 2, 5, 7) and one AGP AT family member (LPCAT4) were overexpressed, as well as DGAT1 (a MBOAT family member but not a LPLAT) as control in HT1080 cells. In addition to MBOAT2, it was found that MBOAT1, but not other tested enzymes, could also rescue cells from ferroptosis induced by GPX4 knockout or RSL3 (FIG. 11, Panels A and B; FIG. 12, Panel D). Moreover, MBOAT1 was able to support long-term culture of GPX4KO cells without supplement of Trolox (FIG. 12, Panel C). Therefore, MBOAT1 is another LPLAT that can suppress ferroptosis independent of GPX4.

[0090] MBOAT1, also known as LPEAT1, had been shown to preferentially transfer OA (18: 1) to lyso-PE and lyso-phosphatidylserine (PS) (Hishikawa et al.. 2008). It was hypothesized that like MBOAT2, MBOAT1 suppresses ferroptosis through PL remodeling with a bias for PE-MUFA. ACC inhibitor TOFA or SCD1 inhibitor CAY10566 abolished the protection function of MBOAT1 (FIG. 11, Panels C-E), and the ferroptosis-suppressing activity of exogenous MUFAs were further potentiated by MBOAT1 overexpression (FIG. 12. Panel E). In a targeted lipidomic analysis to measure the relative abundance of several major PE-OAs and PE-AAs, three out of four PE-0 As were significantly increased, while three out of four PE-AAs were significantly decreased (FIG. 11, Panels F and G). Importantly, the increase of PE-OA was very similar to the decrease of PE-AA that share the same backbone of lyso-PE (e.g.. PE P-16:0 18: 1 vs PE P-16:0 20:4; FIG. 11, Panels H and I). Further, MB0AT1 significantly diminished RSL3-induced lipid peroxidation (FIG. 11, Panel J), likely as a consequence of PE-AA reduction.

[0091] Intriguingly and opposite to MBOAT2, patient database analysis indicated that MB0AT1 is highly expressed in female cancers, including ovarian cancer, breast cancer, and endometrial cancer (TCGA PanCancer Atlas; FIG. 11, Panel K) as well as in normal female tissues e.g., fallopian tube, uterus, cervix, ovary, and mammary tissue; GTEx Portal; FIG. 12, Panel F). This observation prompted an examination as to whether MBOAT 1 is regulated by estrogen receptor (ER) signaling. In a panel of ER+breast cancer (BCa) cell lines and triple negative BCa (TNBC) cell lines. MBOAT1 expression was uniquely upregulated in ER+BCa (FIG. 11. Panel L) and correlated with the ferroptosis resistance state of ER+BCas. Importantly, selective ER modulator (SERM) 4-hydroxyl-tamoxifen(Tam) and selective estrogen receptor down-regulator (SERD) fulvestrant (Ful) decreased MB0AT1 expression in this panel of ER1BCas (FIG. 11, Panel L). An analysis of ChlPSeq dataset (GSE72249) revealed that ER and FOXA1 bind to a putative intronic estrogen response element (ERE) proximal to MBOAT1 transcription start site (FIG. 11, Panel N). Our ChlP-qPCR analysis confirmed binding of ER a.{ M OATl ERE and further showed that Ful can decrease the binding of ER to this region (FIG. 11, Panel O). Consistently, in ER+breast cancer T47D and MCF7 cells, estradiol (E2) upregulated MB0AT1 mRNA, whereas Tam and Ful downregulated MBOAT1 transcription (FIG. 11, Panels P and Q; FIG. 12, Panels G-J). Knockdow n of ESRI (encoding ER-alpha), or F0XA1, the functional partner of ER, also decreased MB0AT1 expression (FIG. 11, Panel R; FIG. 12. Panels K and L). Additionally, depletion of estrogen from culture medium inhibited MB0AT1 expression (FIG. 12, Panels M and N). Collectively, these data demonstrate that MB0AT1 is a direct transcriptional target of ER. It should be emphasized that AR regulates MB0AT2 but not MB0AT1, whereas ER specifically regulates MB0AT1 but not MB0AT2 (see FIG. 12. Panels O and P). These results suggest that MB0AT1 and MB0AT2 are differentially regulated to suppress ferroptosis in ER+and AR+tumors, respectively.

[0092] Consistent with the anti-ferroptotic role of MBOAT 1 in HT1080 cells, MB0AT1 elimination was found to sensitize ER+BCa T47D cells and MCF7 cells to ferroptosis (FIG. 11, Panels S-U; FIG. 12, Panels Q and R). Through lipidomic analysis, MB0AT1 knockout was found to alter PL profile in T47D cells with multiple PE-PUFAs significantly increased and various PL-MUFAs decreased (FIG. 11, Panels V and W; FIG. 12, Panel S). Further, although exogenous LA failed to stimulate ferroptosis in parental T47D cells, this exogenous PUFA significantly promoted ferroptosis upon MB0AT1 knockout (FIG. 12, Panel T).Fulvestrant sensitizes hormone therapy-resistant ER+ breast cancer to ferroptosis

[0093] Since ER upregulates MB0AT1 in ER+BCa and contributes to ferroptosis resistance, it was questioned whether ER antagonization can sensitize ER+BCa to ferroptosis induction by downregulating MBOAT1 . Indeed, ER degrader Ful significantly downregulated endogenous MB0AT1 expression, and sensitized tested ER+BCa to ferroptosis (FIG. 13. Panels A-F; FIG. 14, Panels A and B). Remarkably, when LA was supplemented in culture medium, the effect of Ful on RSL3 or ML210-induced lipid peroxidation (FIG. 13, Panel H) and ferroptosis (FIG. 13, Panel G; FIG. 14, Panels A-E) was further enhanced. This sensitization effect of Ful was largely diminished by ectopicoverexpression of MB0AT1 (FIG. 13, Panel E and F; FIG. 14, Panels C-E), indicating that Ful sensitizes ferroptosis through downregulating endogenous MB0AT1.

[0094] Some ER+BCa patients are resistant to ER-targeted therapies (Dittmer, 2021). To study the underlying mechanism, ER+BCa cell lines resistant to ER-targeted therapies have been experimentally derived from ER+BCa cells initially sensitive to such therapies (Cheng et al., 2022). Interestingly, it was found that a Ful-resistant MCF7 cell line (MCF7-FulR+) and a Tamoxifen-resistant MCF7 cell line (MCF7-TamR+) were still as responsive as parental MCF7 cells to Ful-mediated ER degradation and subsequent MBOAT1 downregulation (FIG. 13, Panel I) This result prompted a test as to whether the combination of ER inhibition with ferroptosis induction might be a potential effective therapy. As expected, estrogen depletion increased ferroptosis in MCF7-FulR+and MCF7-TamR+cells (FIG. 14, Panel I). However, Ful but not Tam sensitized MCF7-FulR+and MCF7-TamR+cells to ferroptosis (FIG. 13, Panel J). This might be due to the fact that tamoxifen and its analogues are potent RTAs as reported previously (Dubey et al., 1999). In agreement with this report, it was shown that Tam can inhibit ferroptosis in HT1080 cells induced by various FINs (FIG. 14, Panels F-H). Similar to MCF7 cells, T47D-FulR+cells were also sensitized to ferroptosis upon Ful treatment (FIG. 14, Panel J). As such, in subsequent experiments, the focus was on Ful instead of Tam.

[0095] To test the potential therapeutical effect of Ful in combination with ferroptosis inducer IKE on Ful-resistant ER+BCa in vivo, a MCF7-FulR xenograft model was established. Ful or IKE alone did not inhibit tumor growth (FIG. 13, Panel K). In contrast, combination of Ful and IKE significantly inhibited the tumor growth (FIG. 13. Panel K) without affecting normal animal weight (FIG. 14. Panel K). Consistently, while Ful alone led to MBOAT1 downregulation in tumor tissues, only the combination of Ful with IKE caused an upregulation of PTGS2 expression (FIG. 13, Panel L). Therefore, combination of ER targeting with ferroptosis induction represents a potential new- therapy for the treatment of ER+BCa resistant to ER-targeted monotherapies.Discussion

[0096] Multiple surveillance mechanisms have evolved to suppress cellular PL peroxidation and subsequent ferroptotic cell death, making these pathways a pivotal point for ferroptosis regulation (Jiang et al.. 2021; Stockwell. 2022). GPX4 and various RTA- generating enzymes mediate two well-characterized surveillance mechanisms. In this study.another ferroptosis surveillance mechanism mediated by MB0AT1 and MB0AT2 was discovered. MB0AT1 / 2 prevent ferroptosis by remodeling cellular PL composition, leading to a decrease of PL-PUFAs (substrate of PL peroxidation) and increase of PL-MUFAs (inhibitors of ferroptosis), hence resistance to ferroptosis. Intriguingly, although MB0AT1 and MB0AT2 appear to inhibit ferroptosis via the same biochemical route, they are differentially regulated by sex hormone signaling, suggesting distinctive biological function (see FIG. 13, Panel M, as a working model).

[0097] This finding is important conceptually for the field of ferroptosis, as it reveals a new ferroptosis surveillance mechanism independent of GPX4 and RTA-generating enzy me FSP1, and is likely independent of RTAs in general. GPX4-mediated and RTA-mediated surveillances act at specific stages of PL peroxidation by reducing PL peroxides and terminating the PL oxidation loop, respectively. Different from these two mechanisms, MB0AT1 / 2 function upstream by altering cellular PL profile, causing an increase of PL- MUFAs and a corresponding decrease of PL-PUFAs, the substrate of PL peroxidation. However, whether decreasing the substrate of PL peroxidation is the sole mechanism underlying MBOATl / 2-mediated suppression of ferroptosis is debatable, because MB0AT1 / 2 overexpression could lead to highly potent ferroptosis inhibition and sustained cell survival even upon GPX4 / FSP1 double knockout, but it only caused a relatively modest decrease of PL-PUFAs (FIG. 5, Panel D, and FIG. 11, Panel G). Therefore, it is possible that ferroptosis requires an exquisite threshold of PL-PUFA level, only above which the cell can execute ferroptotic death. Or ferroptosis may require a much higher level of PL-PUFAs, but only at certain specifically confined membrane compartments or ‘■microdomains”, hence the change of PL-PUFA versus PLMUFA at the whole cell level remains to be modest. Alternatively, a fundamentally distinctive possibility is that PL-MUFAs inhibit ferroptosis via mechanism(s) beyond simply replacing PLPUFAs in the cellular lipidome, such as via regulating ayet-to-be identified mediator.

[0098] Biologically, differential regulation of MBOAT1 and MB0AT2 by ER signaling and AR signaling, respectively, provides intriguing insights into the potential role of ferroptosis suppression in specific contexts related to sex hormone signaling — MB0AT1 appears to be more important in female organs responsive to estrogens, whereas MB0AT2 more prominent in tissues responsive to androgens. Based on these observations, an interesting hypothesis is that in biological processes highly regulated by these sex hormones,such as reproductive development, MB0AT1 / 2 need to be upregulated to suppress ferroptosis in relevant organs. Further, as the biochemical activity of MB0AT1 and MB0AT2 in both PL anabolism and ferroptosis suppression are likely to be quite similar, it is intriguing that the organism uses these two different genes to mediate hormone signaling of opposite sex, instead of putting the same gene under regulation by both classes of sex hormones.Therefore, it is possible that in addition to their differential regulation by sex hormone signaling, these two enzymes may exert certain distinctive and sex-specific biochemical functions.

[0099] These findings are highly relevant to cancer. Ferroptosis induction has emerged as a promising cancer therapeutic approach. To induce ferroptosis, one can inhibit the ferroptosis surveillance pathways, especially if cancer cells upregulate such mechanisms and develop addiction to them. Therefore, our discovery that MBOAT1 / 2 represent a new ferroptosis-suppressing mechanism and are upregulated in specific cancers suggest that they are potential therapeutic targets. Inhibition of MB0AT1 / 2 will promote ferroptosis more effectively than inhibition of SCD1, a potential therapeutic target under active investigation (Tracz-Gaszewska and Dobrzyn. 2019). Effectiveness of SCD1 targeting is at least partially because SCD1 suppresses ferroptosis by generating MUFAs endogenously (Tesfay et al., 2019; Wohlhieter et al., 2020; Yi et al., 2020). However, cancer cells might also acquire MUFAs, extracellularly if they reside in a MUFA-rich environment — under such condition, targeting SCD1 might not have any therapeutic efficacy. On the other hand, both endogenous and exogenous MUFAs require downstream MB0AT1 / 2 activity to exert ferroptosis- suppressing function, suggesting that MB0AT1 / 2 are more effective therapeutic targets. Perhaps more importantly and provocatively, MBOAT1 is upregulated in ER+female tissues and cancers, whereas MBOAT2 is upregulated in AR+ prostate cancers. Although it is not known whether MBOAT1 / 2 are involved in the onset or progression of sex hormone-driven cancers, it has been demonstrated here that sex hormone-induced MBOAT1 / 2 upregulation renders these tumor cells more resistant to ferroptosis, and conversely, antagonizing ER / AR signaling sensitizes these cancer cells to ferroptosis induction. Remarkably, even in ER+ / AR+cancer cells resistant to ER / AR inhibitors, if the regulation of MB0AT1 / 2 by the sex hormone signaling persists, this combination therapy might still be effective in inducing tumor ferroptosis. This is clinically relevant, as there are ER+breast cancer patients and AR+prostate cancer patients who are not responsive to corresponding hormonal therapies (Hanker et al., 2020; Schmidt et al., 2021).Materials and MethodsMice

[0100] Five- to six-week old male athymic nu / nu mice (Charles River Laboratories) were used for prostate cancer xenograft model. Five- to six-week old female NOD / SCID mice (ENVIGO) were used for breast cancer xenograft model. Memorial Sloan Kettering Cancer Center Institutional Animal Care and Use Committee approved all procedures in accordance with the Guide for the Care and Use of Animals. All mice were housed in pathogen-free facilities, in a 12-hour light / dark cycle in ventilated cages, with chow and water supply ad libitum.Cell lines

[0101] HT1080, 293T, HP AC, MIA PaCa-2, PANC-1, Hs766T, Pane 05.04, Capan-1 ,22Pc-EP, VCaP, MCF7, PC3, DU145 cells, and their derived cell lines were cultured in DMEM (provided by Media Preparation Core Facility of MSKCC) with 10% Fetal bovine serum (Gibco). 2 mM L-glutamine and 100 u / mL Penicillin / Streptomycin (Gibco) at 37 °C and 5% CO2. HT1080-GPX4KOcells and their derived cell lines were maintained with 100 |j.M Trolox in the medium.

[0102] SUIT-2, BxPC3, AsPC-1, LNCaP, LnAR, LREX’, T47D, ZR751, HCC1428 cells, and their derived cell lines were cultured in RPMI (provided by Media Preparation Core Facility of MSKCC) with 10% Fetal bovine serum (Gibco). 2 mM L-glutamine and 100 u / mL Penicillin / Streptomycin (Gibco) at 37 °C and 5% CO2. LnAR-isgGPX4 cells were cultured in RPMI with 10% Tetracycline negative FBS (Gemini Bio-Products).

[0103] Normal mouse prostate organoid 819 was derived from the littermate control of PTEN-Flox / Flox, LSL-ERG mice from a mixed background (Chen et al., 2013). 819 organoids were maintained according to established organoid culture protocol (Karthaus et al., 2014).

[0104] All commercially obtained cells were authenticated by the vendors or by other groups who published these cells. All cell lines used in this study were regularly checked for the presence of mycoplasma by PCR.Constructs

[0105] MBOAT2, PLA2G2F, FSP1, ACSL3, MBOAT1, MBOAT5, MBOAT7, LPCAT3 cDNAs (GenScript, with Flag-tag at C-terminus), or SCD1. DGAT1, cDNAs were subcloned into the pQCXIP (with Puromycin selection) or pQCXIB (with Blasticidin selection) retroviral vectors between Agel and BamHI sites. MBOAT2-mCherry and MBOAT1- mCheriy were generated by overlapping PCR and subcloned into pQCXIP vector. AR cDNA was subcloned into pWZL Blast myc plasmid (Addgene #10674).

[0106] Site directed mutagenesis of MBOAT2 (H373A) was performed and verified by sanger sequencing. LT3G-ishMBOAT2 (target sequence:GCTCTTACAAAGACTACATTA (SEQ ID NO: 1) and LT3G-ishAR (target sequence: GCCAGCAGAAATGATTGCA (SEQ ID NO: 2)) were made by inserting miR-E shMBOAT2 or miR-E shAR fragment into LT3GEPIR vector (Addgene # 111177) between EcoRI and Xhol sites as reported (Fellmann et al.. 2013).Production of lentiviral and retroviral infectious particles

[0107] Retroviruses were produced by co-transfecting retroviral plasmid, packaging plasmid (gag / pol, Addgene# 14887), and pCMV-VSV-G (Addgene #8454) plasmid into 293T cells by Lipofectamine 3000 reagents. Lentiviruses were produced by co-transfecting lentiviral plasmid, packaging plasmid (pCMV-dR8.2 dvpr, Addgene# 84 5), and pCMV- VSV-G (Addgene #8454) plasmid into 293T cells by lipofectamine 3000 reagents. The supernatants containing infectious particles were collected 48 h post transfection and passed through 0.45-pm filter.Generation of CRISPR knockout cells

[0108] HT1080-GPX4KOcells were previously established by the lab through transient transfection of sgGPX4 and spCas9 in HT1080 cells (Gao et al., 2019). HT1080-GPX4KO- Cas9 cells were generated by infecting HT1080-GPX4KOcells with lentiCas9-Blast (Addgene #52962) lentivirus and selecting with 20 pg / ml Blasticidin. HT1080-GPX4 / FSP1DKOcells were generated by infecting HT1080-GPX4KO-Cas9 cells with sgAIFM2 lentivirus (Sigma #HS5000029901) and selecting with 2 pg / ml puromycin. HT1080-GPX4 / SCD1DKOcells were generated by infecting HT1080-GPX4KO-Cas9 cells with sgSCD lentivirus (Sigma #HS5000004019) and selecting with 2 pg / ml puromycin. HT1080-GPX4KO-Cas9- SCDl / gMBOAT2 cells were generated by infecting HT1080-GPX4KO-Cas9-SCD1 cells withsgMB0AT2 lentivirus (Sigma HS5000029185 and #HS5000029186) and sorting of BFP+ cells by FACS. HT1080-GPX4KOcells and their derived cell lines were maintained with 100 |j.M Trolox in the medium.

[0109] LnAR-iCas9 cells were generated by transiently transfecting LnAR cells with pAAVSl-tet-iCas9-BFP2 (Addgene #125519) and AAVS1 T2 CRIPR in pX330 (Addgene #72833) by Lipofectamine 3000 reagent. After transfection, cells were treated with 1 mg / ml Dox for 48 h and sorted BFP+ cells by FACS. LnAR-isgGPX4 cells were generated by infecting LnAR-iCas9 cells with sgGPX4-puro (TGATCTCTTCGTTACTCCCTGG (SEQ ID NO: 3); Sigma # HS5000001523) and sgGPX4-blast (CACGCCCGATACGCTGAGTG (SEQ ID NO:4)) lentivirus simultaneously and selecting with 2 mg / ml puromycin and 20 mg / ml Blasticidin in Tetracycline free medium. GPX4 knockout was induced by treated LnAR-isgGPX4 with 1 mg / ml Dox for at least 4 days. LnAR-gMBOAT2 cells were generated by infecting LnAR-iCas9 cells with sgMBOAT2#l (CTTTGTACAAGAAAGTGTAAGG (SEQ ID NO: 5); Sigma # HS5000029185) or sgMBOAT2#2 (TACTGCTTTGTGTTTGCTCTGG (SEQ ID NO: 6); Sigma # HS5000029186) lentivirus respectively and selecting with 2 mg / ml puromycin and 1 mg / ml Dox. T47D-gMBOATl cells were generated by infecting T47D-Cas9 cells with sgMBOATl#l (TCTGTGCATCTTTTTGTGCTGG (SEQ ID NO: 7); Sigma # HS5000018673) or sgMBOATl#2 (TCTGAGTGACAATCATCAGAGG (SEQ ID NO: 8); Sigma # HS5000018674) lentivirus simultaneously and selecting with 2mg / ml puromycin and 1 mg / ml Dox.Generation of shRNA expression cells

[0110] shMBOAT2 cells were generated by infecting HT1080, SUIT-2, LNCaP and LnAR cells with indicated shMBOAT2 lentiviruses (#1: TRCN0000035240; #2: TRCN0000370550) and selecting with 2 pg / ml puromycin. Inducible shMBOAT2 cells were generated by infecting indicated cells with LT3G-ishMBOAT2 and sorting of GFP+cells. shACSL3 cells were generated by infecting HT1080-GPX4KC)-MBOAT2 cells with indicated shACLS3 lentiviruses (#1 : TRCN0000045530; #2: TRCN0000045532) and selecting with 2 pg / ml puromycin. shFOXAl cells were generated by infecting indicated cells with shFOXAl lentiviruses (#1 : Addgene 70095; #2: Addgene 70096) and selecting with 2 pg / ml puromycin. ishAR cells were generated by infecting indicated cells with LT3G-ishAR and sorting of GFP cells. shMBOATl cells were generated by infecting indicated cells withshMBOATl lentiviruses (TRCN0000035315). shNT cells were generated by infecting indicated cells with shNT lentiviruses (Sigma #SHC016).Generation of stable expression cells

[0111] To generate MBOAT1, MBOAT2, MBOAT5, MBOAT7, LPCAT4, DGAT1, PLA2G2F, SCD, ACSL3, FSP1 and AR overexpression cells, indicated cells were infected with retroviruses and selected by either 2 mg / ml puromycin, 20 mg / ml Blasticidin or sorting of mCherry+cells. To generate NOS2 overexpression cells, indicated cells were infected with pLIX403-hNOS2 (Addgene #1 10800) lentiviruses; to generate GCH1 overexpression cells, indicated cells were infected with GCHl_pLX307 lentiviruses (Addgene #98336). Cells were selected with 2 mg / ml puromycin.CRISPR activation screen and data analysis

[0112] HT1080-dCas9 cells were established by infection of HT1080 cells with dCAS9_VP64_Blast lentiviral particles (Addgene 61425-LV) and selection with Blasticidin. HT1080-dCas9 / CRISPRa library cells w ere established by infection of HT1080-dCas9 cells with Human CRISPRa sgRNA library Calabrese Set A concentrated lentiviral particles (Sanson et al., 2018) (Addgene 92379-LVC) and selection with puromycin following Addgene’s protocol (https: / / www.addgene.org / pooled-library / broadgpp-human-crispra- calabrese-p65hsf / ). Briefly, 4.5 xlO7cells were infected at 50% infection efficiency to achieve a representation of -400 cells per sgRNA. Puromycin selected library cells were then expanded for one passage to total l.OxlO8cells. For control, 2.0xl07cells were harvested at day 0; for screening, 8.0xl07cells were equally seeded in 40 dishes (10-cm). The next day, screen cells were treated with 0. 1 mM RSL3 (10 dishes x 2 replicates) or cystine starvation medium (10 dishes x 2 replicates). 24 h post treatment, fresh normal medium was replaced. At this time, >98% cells w ere dead from ferroptosis, and only <2% cells were survived. The recovered cells were pooled together, expanded, and subjected to a second round of screening. After two rounds of selection, the ferroptosis resistant cells were harvested for sequencing (~2.0xl07cells of each replicate were collected).

[0113] Cellular DNA was extracted by Blood and Cell Culture DNA Midi Kit (Qiagen), and the sgRNA fragments were amplified by Ex Taq DNA polymerase (Clontech) with Guide-F pnmer: TTGTGGAAAGGACGAAACACCG (SEQ ID NO: 9) and Guide-R pnmer: TCTACTATTCTTTCCCCTGCACTGT (SEQ ID NO: 10). and purified with AMPure XPreagent followed Addgene’s protocol. The amplified DNAs were subjected to amplicon sequencing (PEI 00, ~30M reads for each sample) at the Integrated Genomics Operation (IGO) core of MSKCC.

[0114] Clean reads were obtained by filtering raw sequence file (FASTQs) to remove adapter sequences and low-quality bases with custom scripts, and were then analyzed with Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGeCK) (version 0.5.9)(Li et al., 2014). Read counts were initially obtained from individual samples with the count command in MAGeCK. in which the software fastqc was used to assess the quality of the sequencing data, and reads from high-quality samples were further mapped to the screening library. The top positively selected and negatively selected sgRNAs were identified with the test command in MAGeCK, and in this process, read counts were normalized on the basis of total count normalization to exclude the effect of sequencing depth. The robust rank aggregation (a-RRA) algorithm was then used to calculate the RRA score, which reflects the degree of positive or negative selection. Associated plots were created using R package ggplot2 (https: / / ggplot2.tidyverse.org).3'-RNA Ouant-seq and data analysis

[0115] Cells (I xlO6per treatment condition) were lysed in 350 pl of Buffer RLT plus, and total RNA was extracted from cell pellets using RNeasy Plus Mini kit (Qiagen, 74134) following manufacturer protocol. RNA yield and quality were assessed using the 2200 TapeStation (Agilent). Sequencing libraries were prepared using the QuantSeq 3'-mRNA Seq Library Prep Kit FWD for Illumina (Lexogen, SKU: 015.96) from 500 ng of total RNA spiked with ERCC RNA Spike-In Mix 1 (1: 1000, Thermofisher Scientific, 4456740). Briefly, first-strand (oligo(dT)) cDNA synthesis was followed by RNA removal and second- strand synthesis via random priming. The double-stranded library was bead purified to remove reaction components before PCR amplification with i7 single-index primers for 8 cycles. Amplified libraries were again bead purified according to the manufacturer’s protocol, and concentration was measured by Qubit assay. All samples were checked for fragment size distribution on Tapestation before pooling for 50 basepair single-end reads were sequencing on the Illumina NextSeq 550 platform.

[0116] Gene and 3' UTR annotations were obtained from the UCSC table browser (https: / / genome.ucsc.edu / cgi-bin / hgTables, hg38). Adapters were trimmed from raw readsusing cutadapt through the trim_galore wrapper tool with adapter overlaps set to 3 bp for trimming. For Quant-seq, concatenated fastq files were trimmed for adaptor sequence, and masked for low-complexity or low-quality7sequence using trim_galore, then mapped to hg38 whole genome using HISAT 2.2.1 with default parameters (Kim et al. , 2015). The number of reads mapped to the 3' UTR of genes was determined with featureCounts (Liao et al., 2014). Raw reads were normalized to counts per million (CPM). Analysis of differential gene expression was restricted to genes with > 10 reads in at least one condition. Differential gene expression calling was performed on raw read counts using DESeq2 with default settings. Downstream analysis was restricted to genes passing all internal filters for FDR estimation by DESeq2 (Love et al., 2014). Plots of differential gene expression were visualized using ggplot2 package in R with significant genes (Adjusted P value <0.01, |log2FC| > 1).Lipidomic analyses

[0117] For sample preparation, 5xl06HT1080-Vec, HT1080-MBOAT1, HT1080- MBOAT2, LnAR-shNT. LnAR-ishMBOAT2, T47D-Cas9, or T47D-gMBOATl cells (five replicates for each cell type) were harvested by scraping the cells in 3 ml cold PBS (containing 0.001 % W / V butylated hydroxytoluene, BHT). LnAR-shNT and LnAR- ishMBOAT2 cells were treated with 1 mg / ml Dox for 48 h to induce MBOAT2 knockdown before harvest. An aliquot of cells w as retained to determine protein concentration (BCA assay). The remaining cells were pelleted down and snap frozen in liquid nitrogen. The frozen cell pellets were sent to Mass Spectrometry Core Facility of Columbia University for lipidomic analysis. Briefly, lipid was extracted by homogenizing the cell pellets with 250 pl cold methanol containing 0.01% BHT and 1 pl of SPLASH lipidomics internal standard mix (Avanti Polar Lipids) by a microtip ultrasonic homogenizer. Cell lysates were then transferred into a prechilled glass vial with a Teflon-lined cap. 850 pl ice-cold methyl tertbutyl ether (MTBE) was added and the glass vial was vigorously vortex-mixed for 30s. The samples were incubated on ice for 2 h on the shaker, followed with the addition of 200 pl ice- cold water. The samples were incubated for 20 min on ice and centrifuged at 3,500 r.p.m. for 20 min at 4 °C to achieve phase separation. The top layer containing the lipids was transferred to a separate pre-chilled glass vial and dried under a gentle nitrogen stream. The dried samples were reconstituted with 2-propanol / acetonitrileAvater (4:3:1, v / v / v and 0.01% buty lated hydroxytoluene) before LC-MS analysis. A quality7control sample was preparedby combining 50 pl of each sample to assess the reproducibility of the features through the runs.

[0118] In regard to the LC conditions, lipids were separated using an Acquit ’ UPLC CSH column (2.1 x100 mm, 1.7 pm) over a 20-min gradient elution on a Waters Acquity UPLC I- Class system. Mobile phase A consisted of acetonitrile / water (60:40, v / v) and mobile phase B was 2-propanol / acetonitrile / water (85: 10:5, v / v / v) both containing 10 mM ammonium acetate and 0.1% acetic acid. After the injection, the gradient was held at 40% mobile phase B for 2 min. At 2.1 min, it reached to 50% B, then increased to 70% B in 12 min, at 12.1 min changed to 70% B and at 18 min increased to 90% B. The eluent composition returned to the initial condition in 1 min, and the column was re-equilibrated for an additional 1 min before the next injection was conducted. The oven temperature was set at 55 °C and the flow rate was 400 pl min The injection volume was 6 pl using the flow-through needle mode. The quality control sample was injected between the samples and at the beginning and end of the run to monitor the performance and the stability’ of the MS platform.

[0119] In regard to the MS conditions, the SYNAPT G2-Si -Q-ToF mass spectrometer was operated in both positive and negative electrospray ionization modes. For the positive mode, a capillary voltage and sampling cone voltage of 2 kV and 32 V were used. The source and desolvation temperatures were kept at 120 and 500 °C, respectively. Nitrogen was used as the desolvation gas with a flow rate of 800 1 h1. For the negative mode, a capillary’ voltage of 1.5 kV and a cone voltage of 30 V were used. The source temperature was 120 °C and the desolvation gas flow was set to 800 1 h '. Depending on the ionization mode, the protonated molecular ion of leucine encephalin ([M + H]+mass to charge ratio (m / z): 556.2771) or the deprotonated molecular ion ([M - H]", m / z: 554.2615) was used as a lock mass for mass accuracy and reproducibility’. The data were collected in duplicates in data-independent (MSE) mode over the mass range m / z: 50 to 1,200 Da. The quality control sample was also acquired in enhanced data-independent ion mobility (HDMSE) in both positive and negative modes for enhancing the structural assignment of lipid species. The electrospray ionization source settings for ion mobility were the same as described above. The travelling wave velocity’ was set to 650 m s ' and the wave height was 40 V. The helium gas flow in the helium cell region of the ion-mobility spectrometry cell was set to 180 ml min \ Nitrogen, used as the drift gas. was held at a flow rate of 90 ml min1in the ionmobility spectrometry cell. The low collision energy was set to 4 eV and the high collisionenergy was ramped from 25 to 60 eV in the transfer region of the TWave device to induce the fragmentation of mobility -separated precursor ions.Data preprocessing and statistical analysis

[0120] All raw data files were processed in Progenesis QI software. Multivariate and univariate statistical analyses were performed using MetaboAnalyst 4.0 (Chong et al., 2018) and also in an R environment. The signal intensity of each ion was then normalized to the measured protein concentrations. Group differences were calculated using either a two-tailed parametric Welch’s t test with a fold-change threshold of 1.5 (average signal intensities of treated over average signal intensities of vehicle groups) or one-way ANOVA. P values were corrected for multiple hypothesis testing and an FDR of 0.05 or less was considered significant.Structural assignment of identified lipids

[0121] The structural elucidation and validation of significant features were initially obtained by searching monoisotopic masses against the Lipid MAPS database (Fahy et al., 2009) with a mass tolerance of 5 ppm. Fragment ion information obtained by tandem MS (UPLC-HDMSE) was used for the further structural elucidation of significantly changed lipid species. HDMSE data were processed using MSE data viewer (version 1.3, Waters Corp.).Chromatin immunoprecipitation (ChIP)

[0122] ChIP experiments were carried out according to standard protocols (Wang et al. , 2023). The cells were fixed with 1% formaldehyde for 10 min, after which the reaction was quenched by the addition of glycine to the final concentration of 0. 125 M. The fixed cells were washed with PBS and resuspended in SDS buffer (100 mM NaCl, 50 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.5% SDS, 1 x protease inhibitor cocktail). The resulting nuclei were spun down, resuspended in the immunoprecipitation buffer at 1 mL per 16 million cells (SDS buffer and Triton Dilution buffer (100 mM NaCl, 100 mM TrisHCl pH 8.0, 5 mM EDTA, 5% Triton X-100) mixed in 2: 1 ratio with the addition of 1 x protease inhibitor cocktail from Roche) and processed on a Bioruptor Plus Sonicator (Diagenode) to achieve an average fragment length of 200-300 bps. The immunoprecipitation reactions were set up in 1 mL of the immunoprecipitation buffer as indicated below and incubated overnight at 4 °C. The nextday, BSA-blocked Protein G Dynabeads were added to the reactions and incubated for 3 hours at 4 °C. The beads were then washed three times with low-salt washing buffer (150 mM NaCl, 1% Triton X-100, 0.1% SDS, 2 mM EDTA, 20 mM TrisHCl pH8.0) and two times with high-salt washing buffer (500 mM NaCl, 1% Triton X-100, 0.1% SDS, 2 mM EDTA, 20 mM TrisHCl pH8.0). Beads were incubated in elution buffer (100 mM NaHCO3, 1% SDS) overnight at 65 °C shaking at 800 rpm for de-crosslinking. Decrosslinked DNA was purified using the Qiagen PCR Purification kit. qPCR analysis was carried out on ChlPed and input DNA. Data are presented as percent of input DNA, and error bars represent s.d. for technical duplicates of the qPCR analysis.Generating of drug resistant breast cancer cells

[0123] MCF7 / T47D fulvestrant resistant cells were generated by treating with fulvestrant from 100 nM to 400 nM, increasing the concentration gradually within 2 months and maintained in media containing 400 nM fulvestrant afterwards. MCF7 tamoxifen resistant cells were generated by treating with 4OHT from 500 nM to 2 pM increased gradually within 2 months and maintained in media containing 1 pM 4OHT afterwards. Parental cells were cultured in the meantime and used as control.Cell death assay

[0124] Cells were seeded at an appropriate cell density and cultured in normal condition for 24 h. Cells were then stained with Hoechst 33342 (0. 1 pg / mL) for 20 min followed by indicated treatments as described in individual experiments with Sytox green (5nM) to monitor cell death. Culture plates were read by Cytation5 at indicated time points.Percentage of cell death was calculated as Sytox green+cell number over Hoechst 33342+cell number.Cell viability7assay

[0125] Cells were seeded at appropriate cell density7and subjected to indicated treatments as described in individual experiments. At the end of treatment, cell viability7was measured by CellTiter-Glo Luminescent Cell Viability7Assay (Promega) following the manufacturer’s instructions. Relative viability was calculated by normalizing ATP levels of treatments to no treatment control.Measurement of lipid peroxidation.

[0126] Cells were seeded at appropriate density and subjected to indicated treatment followed by BODIPY Cl 1(5 pM; Thermo Fisher #D3861) staining for 30 min. Labeled cells were then trypsinized, resuspended in PBS plus 2% FBS, and subjected to flow cytometry analysis. Oxidation of BODIPY Cl 1 resulted in a shift of the fluorescence emission peak from 590 nm to 510 nm.Western blot

[0127] Cell lysates were resolved on SDS / PAGE gels and transferred to a nitrocellulose membrane. The membranes were blocked in 5% skim milk for 1 h at room temperature and then incubated with indicated diluted primary antibodies at 4 °C overnight. After three washes with TBST, membranes were incubated with goat anti-mouse HRP-conjugated antibody or donkey anti-rabbit HRP-conjugated antibody (Invitrogen) for 1 h at room temperature. After three washes with TBST, membranes were developed by Clarity Western ECL Substrate (Bio-Rad) and imaged by Amersham Imager 600 (GE Healthcare Life Sciences).RT-PCR

[0128] Cells were lysed by Trizol solution (Invitrogen) after indicated treatments. Total RNA was extracted following manufacturer’s instructions. cDNAs were synthesized by iScript Reverse Transcription Supermix (Bio-Rad). qPCR was performed using IQ™ SYBR® Green Supermix reagents (Bio-Rad). GAPDH was used as the internal control. The relative expression of indicated genes was calculated by AA CT method.Animal models

[0129] To create the prostate cancer xenograft mouse model, LnAR-isgGPX4 cells were subcutaneously (S.C.) inoculated into the right flank of 5-6 weeks old male athymic nu / nu mice (Charles River Laboratories, Wilmington, MA) by injecting IxlO7cells in 50% matrigel. Tumors were measured with calipers every 2 days and calculated as described (Yi et al., 2020). Once tumors were palpable (-250 mm3), mice were randomly placed into four groups:(1) Vehicle group daily intraperitoneal (i.p.) with vehicle (65% D5W (5% dextrose in water), 5% Tween-80 and 30% PEG-400) and normal diet;(2) Enzalutamide (ENZ) group daily i.p. with 10 mg / kg ENZ dissolved in vehicle and normal diet;(3) Doxycycline (DOX) group daily i.p. with vehicle and with DOX diet (625 ppm, ENVIGO);(4) ENZ + DOX group daily i.p. with 10 mg / kg ENZ and DOX diet.Mice were given i.p. injections of 0.9% sterile saline or DOX (100 mg / kg body weight) for two days before ENZ treatment. Two weeks post-treatments, mice were euthanized with CO2 and tumors were dissected for weight, histological and immunostaining analysis.

[0130] To construct the orthotopic breast cancer mouse model, first female NOD / SCID mice (ENVIGO), aged 5-6 weeks, were S.C. implanted with 17-P-estradiol 90-d release pellets (0.72 mg, Innovative Research of America) 3 days before tumor inoculations. Then Ix lO7MCF7-FulR+cells in 50% Matrigel were injected into the mammary fat pad of the anesthetized mice. Tumor growths were measured by external caliper every two days and calculated as described. Once tumors were palpable (-250 mm3), mice were randomly divided into 4 groups:(1) Vehicle group daily i.p. with vehicle (65% D5W (5% dextrose in water), 5% Tween- 80, 30% PEG-400),(2) Fulvestrant (Ful) group weekly S.C. with Ful 5 mg (Sandoz Inc., Cat: NDC 0781- 3492-12),(3) IKE group daily i.p. with 40 mg / kg IKE dissolved in vehicle;(4) Ful + IKE group weekly S.C. with Ful 5 mg and daily i.p. with 40 mg / kg IKE.Two weeks post-treatments, mice were euthanized with CO2and tumors were dissected for weight, histological and immunostaining analysis.

[0131] All protocols for animal experiments were approved by the Memorial Sloan Kettering Cancer Center Institutional Animal Care and Use Committee (IACUC).Immunohistochemistry

[0132] Formalin -fixed, paraffin-embedded specimens were collected, and a routine H&E slide was first evaluated. Antigen retrieval was performed with the Retrievagen A antigen retrieval system (550524, BD Biosciences) following manufacturer’s instructions.Immunohistochemical staining was performed using anti-mouse / rabbit HRP-DAB Cell & Tissue Staining Kit (R&D Systems) following manufacturer’s instructions. Primary antibody used for the staining were listed in key resources table.Quantification and statistical analysis

[0133] Please refer to the Brief Description of the Figures for description of sample sizes and statistical tests performed. Data were plotted and analyzed with GraphPad Prism 9.0 software. Differences were considered statistically significant when the p-value was less than 0.05, and otherwise not significant (ns).Sequences

[0134] Table 1 provides a summary of the nucleotide sequences involved in the present Example.Table 1. Nucleotide sequences involved in the present Example.REFERENCESAntonarakis ES, et al., AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. New England Journal of Medicine, 2014, 371(11): 1028-1038.Arensman MD, et al., Cystine-glutamate antiporter xCT deficiency suppresses tumor growth while preserving antitumor immunity, Proceedings of the National Academy of Sciences of the United States of America, 2019, 116(19): 9533-9542.Arora VK, et al.. Glucocorticoid receptor confers resistance to antiandrogens by bypassing androgen receptor blockade, Cell, 2013, 155(6): 1309-1322.Badgley MA, et al., Cysteine depletion induces pancreatic tumor ferroptosis in mice, Science,2020, 368(6486): 85-89.Beharier O, el al. , PLA2G6 guards placental trophoblasts against ferroptotic inj ury, Proceedings of the National Academy of Sciences of the United States of America, 2020, 117(44), 27319-27328.Chen D, el al., iPLA2p-mediated lipid detoxification controls p53-driven ferroptosis independent of GPX4, Nature Communications, 2021, 12(1): 3644.Chen Y, et al., ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss, Nature Medicine, 2013, 19(8): 1023-1029.Cheng GJ, et al. , In vitro breast cancer models for studying mechanisms of resistance to endocrine therapy, Exploration of Targeted Antitumor Therapy, 2022, 3(3): 297-320.Chong J, et al., Metabo Analyst 4.0: towards more transparent and integrative metabolomics analysis, Nucleic Acids Research, 2018, 46(W1): W486-W494.Clarke R, et al. , Endocrine resistance in breast cancer — an overview and update, Molecular and Cellular Endocrinology, 2015, 418: 220-234.Dittmer J, Nuclear mechanisms involved in endocrine resistance. Frontiers in Oncology.2021, 11: 736597.Dixon SJ, et al., Ferroptosis: an iron-dependent form of nonapoptotic cell death, Cell, 2012, 149(5): 1060-1072.Dixon SJ, et al., Human haploid cell genetics reveals roles for lipid metabolism genes in nonapoptotic cell death. ACS Chemical Biology, 2015, 10(7): 1604-1609.Doll S, et al., ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition, Nature Chemical Biology, 2017. 13(1): 91-98.Dubey RK. et al., Estrogen and tamoxifen metabolites protect smooth muscle cell membrane phospholipids against peroxidation and inhibit cell growth, Circulation Research, 1999, 84(2): 229-239.Ehsani M, etal., Androgen receptor-dependent mechanisms mediating drug resistance in prostate cancer, Cancers (Basel), 2021, 13(7): 1534.Fahy E, et al., Update of the LIPID MAPS comprehensive classification system for lipids, Journal of Lipid Research, 2009, 50 Suppl: S9-14.Gao M, et al.. Role of mitochondria in ferroptosis. Molecular Cell, 2019, 73(2): 354-363 e353.Gijon MA., et al., Lysophospholipid acyltransferases and arachidonate recycling in human neutrophils, Journal of Biological Chemistry, 2008. 283(44): 30235-30245.Guijas C. et al., Phospholipid sources for adrenic acid mobilization in RAW 264.7 macrophages. Comparison with arachidonic acid, Biochimica et Biophysica Acta, 2012, 1821(11): 1386-1393.Hanker AB, et al. , Overcoming endocrine resistance in breast cancer. Cancer Cell. 2020, 37(4):496-513.Hishikawa D, et al., Discovery’ of a lysophospholipid acyltransferase family essential for membrane asymmetry and diversity. Proceedings of the National Academy of Sciences of the United States of America, 2008, 105(8): 2830-2835.Jiang L, et al., Ferroptosis as a p53-mediated activity during tumour suppression, Nature, 2015, 520(7545): 57-62.Jiang X, et al., Ferroptosis: mechanisms, biology and role in disease, Nature Review. Molecular Cell Biology, 2021, 22: 266-282.Jin HJ, et al., Cooperativity and equilibrium with FOXA1 define the androgen receptor transcriptional program, Nature Communications, 2014, 5: 3972.Kagan VE, et al., Oxidized arachidonic and adrenic PEs navigate cells to ferroptosis. Nature Chemical Biology, 2017, 13(1), 81 -90.Karthaus WR, et al., Identification of multipotent luminal progenitor cells in human prostate organoid cultures, Cell, 2014, 159(1): 163-175.Karthaus WR, et al., Regenerative potential of prostate luminal cells revealed by single-cell analysis, Science, 2020, 368(6490): 497-505.Kim D, et al., HIS AT: a fast spliced aligner with low memory' requirements. Nature Methods, 2015, 12(4): 357-360.Kohler BA, et al., Annual report to the nation on the status of cancer, 1975-2011, featuring incidence of breast cancer subtypes by race / ethnicity. poverty, and state, Journal of the National Cancer Institute, 2015, 107(6): djv048.Joe BN, Clinical features, diagnosis, and staging of newly diagnosed breast cancer. In: UpToDate, Burstein HJ, Vora SR (eds.). Waltham, MA: UpToDate, 2019.Liang D, et al., Ferroptosis at the intersection of lipid metabolism and cellular signaling, Molecular Cell, 2022, 82(12): 2215-2227.Liao Y, et al., featureCounts: an efficient general purpose program for assigning sequence reads to genomic features, Bioinformatics, 2014, 30(7): 923-930.Love MI, et al., Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2, Genome Biology, 2014, 15(12): 550.Ma X, et al., CD36-mediated ferroptosis dampens intratumoral CD8(+) T cell effector function and impairs their antitumor ability. Cell Metabolism. 2021, 33(5): 1001-1012 el005.Magtanong L, et al.. Exogenous monounsaturated fatty acids promote a ferroptosis-resistant cell state, Cell Chemical Biology’, 2019, 26(3): 420-432 e429.Maitland NJ, Resistance to antiandrogens in prostate cancer: is it inevitable, intrinsic or induced? Cancers (Basel). 2021. 13(2): 327.Mullard, A, First targeted protein degrader hits the clinic. Nature Reviews. Drug Discovery, 2019.O’Donnell VB, New appreciation for an old pathway: the Lands Cycle moves into new arenas in health and disease, Biochemical Society Transactions . 2022, 50(1): 1-11.Rugo HS, et al. , Endocrine therapy for hormone receptor-positive metastatic breast cancer: American Society of Clinical Oncology guideline. Journal of Clinical Oncology, 2016. 34(25): 3069-3103.Schmidt KT, el al.. Resistance to second-generation androgen receptor antagonists in prostate cancer, Nature Review. Urology, 2021, 18(4): 209-226.Shah N, et al., Regulation of the glucocorticoid receptor via a BET-dependent enhancer drives antiandrogen resistance in prostate cancer, eLife, 2017. 6: e27861.Siegel R.L., et al., Cancer statistics, 2023, CA: A Cancer Journal for Clinicians, 2022, 72(1): 7-33.Stockwell BR, et al., Ferroptosis: a regulated cell death nexus linking metabolism, redox biology , and disease, Cell, 2017, 171(2): 273-285.Stockwell BR, Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022. 185(14): 2401-2421.Sun WY, et al. , Phospholipase iPL A2P averts ferroptosis by eliminating a redox lipid death signal, Nature Chemical Biology, 2021, 17(4): 465-476.Tesfay L, et al., Stearoyl-CoA desaturase 1 protects ovarian cancer cells from ferroptotic cell death. Cancer Research, 2019, 79(20): 5355-5366.Tracz-Gaszewska Z and Dobrzyn P, Stearoyl-CoA desaturase 1 as a therapeutic target for the treatment of cancer, Cancers (Basel), 2019 11(7): 948.Tran C, et al., Development of a second-generation antiandrogen for treatment of advanced prostate cancer. Science, 2009, 324(5928): 787-790.Tryfonidis K, et al., Endocrine treatment in breast cancer: cure, resistance and beyond. Cancer Treatment Reviews, 2016, 50: 68-81.Valentin E, et al., Cloning and recombinant expression of human group IIF-secreted phospholipase A2, Biochemical and Biophysical Research Communications, 2000. 279: 223- 228.Valentine WJ, et al., Update and nomenclature proposal for mammalian lysophospholipid acyltransferases, which create membrane phospholipid diversity, Journal of Biological Chemistry, 2022, 298(1): 101470.Wang H, et al., H3K4me3 regulates RNA polymerase II promoter-proximal pause-release, Nature, 2023, 615(7951): 339-348.Wang W, et al., CD8(+) T cells regulate tumour ferroptosis during cancer immunotherapy, Nature, 2019, 569(7755): 270-274.Watson PA, et al., Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer, Nature Review’ Cancer, 2015. 15(12): 701-711.Wohlhieter CA, et al., Concurrent mutations in STK11 and KEAP1 promote ferroptosis protection and SCD1 Dependence in Lung Cancer, Cell Reports, 2020, 33(9): 108444.Wu J, et al., Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling. Nature, 2019, 572(7769): 402-406.Yi J, et al., Oncogenic activation of PI3K-AKTmT0R signaling suppresses ferroptosis via SREBP-mediated lipogenesis, Proceedings of the National Academy of Sciences of the United States of America, 2020, 117(49): 31189-31197.Zhang Y, et al., BAP1 links metabolic regulation of ferroptosis to tumour suppression, Nature Cell Biology, 2018, 20(10): 1181-1192.Zhang Y, et al., Imidazole ketone erastin induces ferroptosis and slows tumor growth in a mouse lymphoma model, Cell Chemical Biology, 2019, 26(5): 623-633 e629.

Claims

CLAIMS1. A method of treating a cancer tumor in a subj ect in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more androgen receptor (AR) inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subject.

2. A method of treating cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more androgen receptor (AR) inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size of and / or regression of the cancer cells in the subject.

3. A method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more membrane bound O-acyltransferase-2 (MB0AT2) inhibitors, and (b) one or more ferroptosis- inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subj ect.

4. A method of treating a cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more membrane bound O-acyltransferase-2 (MB0AT2) inhibitors, and (b) one or more ferroptosis- inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer cells in the subj ect.

5. The method of any one of claims 1-4, wherein the cancer is ART6. The method of claim 5, wherein the cancer is prostate cancer or ovarian cancer.

7. The method of any one of claims 1-4, wherein the cancer is marked by overexpression of MB0AT2.

8. The method of claim 7. wherein the cancer is selected from prostate cancer, pancreatic cancer, biliary tract cancer, uterine cancer, bladder cancer, and liver cancer.

9. The method of any one of claims 3-8, wherein the MB0AT2 inhibitor is an AR inhibitor.

10. The method of any one of claims 1, 2, or 5-9, wherein the AR inhibitor is selected from the group consisting of enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide, bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253, EPI- 7386, EPI-506. EPI-002. and any combination thereof.

11. The method of any one of claims 1-10, wherein the subject was previosuly treated with a single-agent hormonal treatment.

12. The method of any one of claims 1-11. wherein the subject is resistant to single-agent hormonal treatment.

13. The method of claim 11 or 12, wherein the single-agent hormonal treatment comprises treatment with an AR inhibitor or an andorgen antagonist.

14. A method of treating a cancer tumor in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more estrogen receptor (ER) inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subj ect.

15. A method of treating cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more estrogen receptor (ER) inhibitors, and (b) one or more ferroptosis-inducing agents, thereby reducing the growth of and / or causing a decrease in the size of and / or regression of the cancer cells in the subj ect.

16. A method of treating a cancer tumor in a subject in need thereof, the methodcomprising administering to the subject an effective amount of both (a) one or more membrane bound O-acyltransferase- 1 (MB0AT1) inhibitors, and (b) one or more ferroptosis- inducing agents, thereby reducing the growth of and / or causing a decrease in the size and / or regression of the cancer tumor in the subj ect.

17. A method of treating a cancer cells in a subject in need thereof, the method comprising administering to the subject an effective amount of both (a) one or more membrane bound O-acyltransferase- 1 (MB0AT1) inhibitors, and (b) one or more ferroptosis- inducing agents, thereby reducing the grow th of and / or causing a decrease in the size and / or regression of the cancer cells in the subj ect.

18. The method of any one of claims 14-17, wherein the cancer is ER+.

19. The method of claim 18, wherein the cancer is breast cancer, uterine cancer, or ovarian cancer.

20. The method of any one of claims 14-17, wherein the cancer is marked by overexpression of MBOAT1.

21. The method of claim 20, wherein the cancer is selected from breast cancer and liver cancer.

22. The method of any one of claims 16-21, wherein the MBOAT1 inhibitor is an ER inhibitor.

23. The method of any one of claims 14, 15, and 18-22, wherein the ER inhibitor is a selective ER modulator (SERM), a selective ER downregulator (SERD), or a dualmechanism ER inhibitor (DMERI).

24. The method of any one of claims 14, 15, and 18-22, wherein the ER inhibitor is selected from the group consisting of fulvestrant, elacestrant, etacstil, RU 58668, GW- 7604, GDC-0810, AZD9496, GDC-0927, tamoxifen, bazedoxifene, lasofoxifene, giredestrant, amcenestrant. camizestrant, imlunestrant, OP-1250, ARV-471, GDC-9545.H3B-6545, and any combination thereof.

25. The method of any one of claims 14-24, wherein the subject was previosuly treated with a single-agent hormonal treatment.

26. The method of any one of claims 14-25, wherein the subject is resistant to single-agent hormonal treatment.

27. The method of claim 25 or 26, wherein the single-agent hormonal treatment comprises treatment with an ER inhibitor or an estrogen antagonist.

28. The method of any one of claims 1-27, wherein the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent.

29. The method of any one of claims 1-27. wherein the ferroptosis-inducing agent is selected from the group consisting of erastin, MEII, PE, AE, imidazole ketone erastin (IKE), DPI2, BSO, SAS, lanperisone, SRS13-45, SRS13-60, RSL3, DPI7, DPI10, DPI12, DPI13, DPI17, DPI18, DPI19, ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin. sulfasalazine, temozolomide, lapatinib in combination with siramesine. and any combination thereof.

30. A pharmaceutical composition comprising(a) one or more androgen receptor (AR) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof.

31. A combination of(a) one or more androgen receptor (AR) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof.

32. A pharmaceutical composition comprising(a) one or more androgen receptor (AR) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of cancer cells in a subject in need thereof.

33. A combination of(a) one or more androgen receptor (AR) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of cancer cells in a subject in need thereof.

34. A pharmaceutical composition comprising(a) one or more membrane bound O-acyltransferase 2 (MB0AT2) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof.

35. A combination of(a) one or more membrane bound O-acyltransferase 2 (MB0AT2) inhibitors, and(b) one or more ferroptosis-inducing agents. for use in treatment of a cancer tumor in a subject in need thereof.

36. A pharmaceutical composition comprising(a) one or more membrane bound O-acyltransferase 2 (MB0AT2) inhibitors.(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of cancer cells in a subject in need thereof.

37. A combination of(a) one or more membrane bound O-acyltransferase 2 (MB0AT2) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of cancer cells in a subject in need thereof.

38. The pharmaceutical composition or combination of any one of claims 30-37, wherein the cancer is AR1.

39. The pharmaceutical composition or combination of claim 38, wherein the cancer is prostate cancer or ovarian cancer.

40. The pharmaceutical composition or combination of any one of claims 30-37, wherein the cancer is marked by overexpression of MBOAT2.

41. The pharmaceutical composition or combination of claim 40, wherein the cancer is selected from prostate cancer, pancreatic cancer, biliary tract cancer, uterine cancer, bladder cancer, and liver cancer.

42. The pharmaceutical composition or combination of any one of claims 34-41, wherein the MBOAT2 inhibitor is an AR inhibitor.

43. The pharmaceutical composition or combination of any one of claims 30-33 and 38-42, wherein the AR inhibitor is selected from the group consisting of enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide, bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253. EP1-7386, EP1-506, EPI-002, and any combination thereof.

44. The pharmaceutical composition or combination of any one of claims 30-43, wherein the subject was previosuly treated with a single-agent hormonal treatment.

45. The pharmaceutical composition or combination of any one of claims 30-44, wherein the subject is resistant to single-agent hormonal treatment.

46. The pharmaceutical composition or combination of claim 44 or 45, wherein the single-agent hormonal treatment comprises treatment with an AR inhibitor or an andorgen antagonist.

47. A pharmaceutical composition comprising(a) one or more estrogen receptor (ER) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof.

48. A combination of(a) one or more estrogen receptor (ER) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof.

49. A pharmaceutical composition comprising(a) one or more estrogen receptor (ER) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of cancer cells in a subject in need thereof.

50. A combination of(a) one or more estrogen receptor (ER) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of cancer cells in a subject in need thereof.

51. A pharmaceutical composition comprising(a) one or more membrane bound O-acyltransferase 1 (MBOAT1) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of a cancer tumor in a subject in need thereof.

52. A combination of(a) one or more membrane bound O-acyltransferase 1 (MBOAT1) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of a cancer tumor in a subject in need thereof.

53. A pharmaceutical composition comprising(a) one or more membrane bound O-acyltransferase 1 (MBOAT1) inhibitors,(b) one or more ferroptosis-inducing agents, and(c) a pharmaceutically-acceptable carrier, for use in treatment of cancer cells in a subject in need thereof.

54. A combination of(a) one or more membrane bound O-acyltransferase 1 (MBOAT1) inhibitors, and(b) one or more ferroptosis-inducing agents, for use in treatment of cancer cells in a subject in need thereof.

55. The pharmaceutical composition or combination of any one of claims 47-54, wherein the cancer is ER+.

56. The pharmaceutical composition or combination of claim 38, wherein the cancer is breast cancer, uterine cancer, or ovarian cancer.

57. The pharmaceutical composition or combination of any one of claims 47-54, wherein the cancer is marked by overexpression of MBOAT1.

58. The pharmaceutical composition or combination of claim 57, wherein the cancer is selected from breast cancer and liver cancer.

59. The pharmaceutical composition or combination of any one of claims 51-58, wherein the MBOAT 1 inhibitor is an ER inhibitor.

60. The pharmaceutical composition or combination of any one of claims 47-50 and 55-59, wherein the ER inhibitor is a selective ER modulator (SERM), a selective ER downregulator (SERD), or a dual-mechanism ER inhibitor (DMERI).

61. The pharmaceutical composition or combination of any one of claims 47-50 and 55-59, wherein the ER inhibitor is selected from the group consisting of fulvestrant, elacestrant. etacstil, RU 58668, GW-7604, GDC-0810, AZD9496, GDC-0927, tamoxifen, bazedoxifene, lasofoxifene, giredestrant, amcenestrant, camizestrant. imlunestrant. OP- 1250,ARV -471, GDC-9545. EBB-6545, and any combination thereof.

62. The pharmaceutical composition or combination of any one of claims 47-61, wherein the subject was previosuly treated with a single-agent hormonal treatment.

63. The pharmaceutical composition or combination of any one of claims 47-62, wherein the subject is resistant to single-agent hormonal treatment.

64. The pharmaceutical composition or combination of any one of claims 47-63, wherein the single-agent hormonal treatment comprises treatment with an ER inhibitor or an estrogen antagonist.

65. The pharmaceutical composition or combination of any one of claims 47-64, wherein the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent.

66. The pharmaceutical composition or combination of any one of claims 47-64, wherein the ferroptosis-inducing agent is selected from the group consisting of erastin, MEII, PE. AE, imidazole ketone erastin (IKE). DPI2, BSO, SAS, lanperisone, SRS 13-45. SRS13- 60. RSL3, DP17. DPI10. DPI12. DPI13. DPI17. DPI18. DPI19. ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

67. A kit comprising(a) one or more androgen receptor (AR) inhibitors, or a pharmaceutical composition thereof, and(b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof.

68. A kit comprising(a) one or more membrane bound O-acyltransferase 2 (MBOAT2) inhibitors, or a pharmaceutical composition thereof, and(b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof.

69. The kit of claim 68, wherein the MBOAT2 inhibitor is an AR inhibitor.

70. The kit of claim 67 or 69, wherein the AR inhibitor is are selected from the group consisting of enzalutamide, apalutamide, darolutamide, abiraterone, flutamide, nilutamide. bicalutamide, proxalutamide, BMS-641988, SHR3680, TRC-253, EPI-7386. EPI- 506, EPI-002, and any combination thereof.

71. A kit comprising(a) one or more estrogen receptor (ER) inhibitors, or a pharmaceutical composition thereof, and(b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof.

72. A kit comprising(a) one or more membrane bound O-acyltransferase 1 (MBOAT1) inhibitors, or a pharmaceutical composition thereof, and(b) one or more ferroptosis-inducing agents, or a pharmaceutical composition thereof.

73. The kit of claim 72, wherein the MBOAT1 inhibitor is an ER inhibitor.

74. The kit of claim 71 or 73, wherein the ER inhibitor is a selective ER modulator (SERM), a selective ER downregulator (SERD), or a dual-mechanism ER inhibitor (DMERI).

75. The kit of claim 71 or 73, wherein the ER inhibitor is selected from the group consisting of fulvestrant, elacestrant, etacstil, RU 58668, GW-7604, GDC-0810, AZD9496, GDC-0927, tamoxifen, bazedoxifene, lasofoxifene, giredestrant, amcenestrant, camizestrant, imlunestrant. OP-1250, ARV-471. GDC-9545, H3B-6545, and any combination thereof.

76. The kit of any one of claims 67-75, wherein the ferroptosis-inducing agent is a class 1 ferroptosis-inducing agent or a class 2 ferroptosis-inducing agent.

77. The kit of any one of claims 67-75, wherein the ferroptosis-inducing agent isselected from the group consisting of erastin, MEII, PE. AE, imidazole ketone erastin (IKE). DPI2, BSO, SAS, lanperisone. SRS13-45. SRS13-60. RSL3, DPI7. DPI10. DPI12. DPI13. DPI17, DPI18, DPI19, ML160, ML-162, ML-210, sorafenib, artemisinin derivatives, altretamine, artesunate, BAY87-2243, cisplatin, ironomycin, lanperisone, salinomycin, sulfasalazine, temozolomide, lapatinib in combination with siramesine, and any combination thereof.

78. The kit of any one of claim 67-77, further comprising instructions for use.

Images