Bioinformatically-identified control elements for regulated expression of a lentiviral vector to treat x-linked lymphoproliferative disease

Abstract

Isolated polynucleotides capable of expressing SLAM-associated protein (SAP) mimicking the lineage and stage expression patterns of endogenous SAP, and viral vectors comprising thereof. Further disclosed are methods for treating X-linked lymphoproliferative disease (XLP1).

Description

BIOINFORMATICALLY-IDENTIFIED CONTROL ELEMENTS FOR REGULATED EXPRESSION OF A LENTIVIRAL VECTOR TO TREAT X-LINKED LYMPHOPROLIFERATIVE DISEASECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] Benefit is claimed to United States Provisional Patent Application No. 63 / 502,617, filed on May 16, 2023, the contents of which are incorporated by reference herein in their entirety.SEQUENCE LISTING STATEMENT

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML format copy, created on May 15, 2024, is named P-633677-PC_05_15_2024_SL.xml and is 223.8 kilobytes in size.FIELD OF INVENTION

[0003] Disclosed herein are isolated polynucleotides capable of expressing SLAM-associated protein (SAP) mimicking the lineage and stage expression patterns of endogenous SAP, and viral vectors comprising thereof. Further disclosed are methods for treating X-linked lymphoproliferative disease (XLP1).BACKGROUND

[0004] X-linked lymphoproliferative disease (XLP1), also known as Duncan Disease, is an inborn error of immunity caused by mutations in the SH2D1A gene, affecting 1 in 1 million males. The SH2D1 A gene encodes the SLAM-associated protein (SAP), an adaptor molecule involved in the signaling of immune cell receptors of the SLAM family. SAP binds to the intracellular domain of SLAM family signaling receptors, and supports the activation or inhibition of immune cell signaling. SAP mRNA and protein expression are predominately expressed in human thymocytes, T cells, NK cells, and NKT cells. Patients with XLP1 suffer from impairments in CD4+ T cell function, CD8+ T cell cytotoxicity, NK cell cytotoxicity, plasma cell and memory B cell generation, and NKT cell development. XLP1 affects 1 in 500,000 to 1 million Caucasian males and. In over 90% of XLP1 cases, Epstein-Barr virus (EBV) primary infection is the major cause for clinical presentations of the disease. After EBV infection, XLP1 patients mount a dysregulated immune response, with nearly 60% of patientsdeveloping hemophagocytic lymphohistiocytosis (HLH). HLH treatment is highly immune suppressive and can be significantly toxic. As such, the mortality associated with HLH presentation is greater than 60%. Those that survive the EBV infection may develop malignant lymphoma, hypogammaglobulinemia, and lymphoproliferation, and are thus treated with continuous immunoglobulin replacement therapy (IRT) and immune suppression. The expense and inconvenience of life-long IRT, with administration requiring intravenous or subcutaneous injections, are drawbacks, but are accepted due to the important clinical benefits IRT confers.

[0005] The only curative treatment includes the use of an allogeneic hematopoietic stem cell (HSC) transplantation, in which CD34+ HSCs are taken from a healthy suitable-matched donor and transplanted into the patient to give rise to a fully functionally immune system. Many patients, unfortunately, lack this treatment as a viable option due to poor donor availability and immunologic complications. Thus, a more effective treatment for XLP1 remains an unmet need. A potential curative approach is an autologous HSC transplantation, where a patient’s own HSCs are harvested and transduced ex-vivo with a lentiviral vector to stably integrate a functional copy of the SH2D1A gene. This method of gene therapy provides the same benefit as an allogeneic transplant while eliminating any risk of graft rejection since each patient serves as their own donor.

[0006] A successful treatment of autologous HSC transplantation would require a lentiviral vector capable of expressing a functional copy of SH2D1A at therapeutic levels within the target cell populations. Previous viral vector therapies to combat XLP 1 implemented lentivirus- mediated gene transfer into hematopoietic stem and progenitor cells (HSPCs). However, the current lentiviral vectors (LVs) do not utilize the endogenous promoter of the encoded transgene, and fail to recapitulate the regulation and expression of the native gene. Accordingly, researchers resorted to strong ubiquitous promoters such as elongation factor 1 a promoter to drive expression of the SAP protein (EFS-SAP). One concern with this approach lies in the non-physiological pattern or expression of SAP in progenitor cell populations. Since SAP is a tightly regulated signaling molecule within T, NK, and NKT cells, gene transfer into off-target cell populations poses significant safety concerns including, but not limited to improper signaling of factors associated with aggressive lymphoid malignancies.

[0007] There is therefore a need for a rationally designed expression vectors that mimic SAP expression pattern, i.e., that selectively express SAP in the cell lineage and stages in which endogenous SAP is expressed, thus achieving functional restoration of humoral and cytotoxic defects in XLP1 patients through gene therapy, while avoiding off-target effects.SUMMARY

[0008] In some aspects, disclosed herein is an isolated polynucleotide comprising: (a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1 A enhancer region; (b) an SH2D1A promoter; and (c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0009] In some related aspects, the enhancer region is shorter by at least 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% than the endogenous SH2D1A enhancer region. In some related aspects, the enhancer region comprises less than 500, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some related aspects, the SH2D1 A enhancer region comprises a polynucleotide comprising a sequence as set forth in SEQ ID NO.: 1.

[0010] In some related aspects, the lineage expression pattern comprises expression in T cells, NK cells, and NKT cells, and low or no expression in monocytes, B cells, B-LCL cells, and myeloid cells. In some relates aspects, the isolated polynucleotide of claim 1, wherein said stage expression pattern comprises expression in stages 4a to 6 of NK cells.

[0011] In some related aspects, the E3 comprises a polynucleotide sequence as set forth in SEQ ID NO.: 4, said E20 comprises a polynucleotide sequence as set forth in SEQ ID NO.: 20, or said 5R comprises a polynucleotide sequence as set forth in SEQ ID NO.: 32, or any combination thereof.

[0012] In some relates aspects, the part of E3 enhancer element comprises enhancer elements E3L, E3GL, E3M, E3GS, E3S, E3GP, or E3P; the part of E20 enhancer element comprises enhancer elements E20La, E20Le, or E20R; the part of 5R enhancer element comprises enhancer elements 5RC, 5RUC, 5RS, or 5RL; or any combination thereof.

[0013] In some related aspects, the E3 enhancer element is E3M or E3GP. In some related aspects, the E20 enhancer element is E20R. In some related aspects, the 5R enhancer element is 5RL. In some related aspects, the E3L comprises a polynucleotide sequence as set forth in SEQ ID NO.: 34, the E3GL comprises a polynucleotide sequence as set forth in SEQ ID NO.: 49, said E3M comprises a polynucleotide sequence as set forth in SEQ ID NO.: 35, the E3GS comprises a polynucleotide sequence as set forth in SEQ ID NO.: 48, the E3S comprises a polynucleotide sequence as set forth in SEQ ID NO.: 36, the E3GP comprises a polynucleotide sequence as set forth in SEQ ID NO.: 50, or the E3P comprises a polynucleotide sequence as set forth in SEQ ID NO.: 37, or any combination thereof.

[0014] In some related aspects, the E20La comprises a polynucleotide sequence as set forth inSEQ ID NO.: 44, said E20Le comprises a polynucleotide sequence as set forth in SEQ ID NO.: 45, or said E20R comprises a polynucleotide sequence as set forth in SEQ ID NO.: 46. In some related aspects, the 5RC comprises a polynucleotide sequence as set forth in SEQ ID NO.: 32, said 5RS comprises a polynucleotide sequence as set forth in SEQ ID NO.: 33, or said 5RL comprises a polynucleotide sequence as set forth in SEQ ID NO.: 29.

[0015] In some related aspects, the E3M element comprises a polynucleotide sequence as set forth in SEQ ID NO: 35, or wherein said E3GP element comprises a polynucleotide sequence as set forth in SEQ ID NO: 50. In some related aspects, the E20R element comprises a polynucleotide sequence as set forth in SEQ ID NO: 46.

[0016] In some related aspects, the 5RL element comprises a polynucleotide sequence as set forth in SEQ ID NO: 29. In some related aspects, the E3 enhancer element is E3M, said E20 enhancer element is E20R, and said 5R enhancer element is 5RL. In some related aspects, the enhancer element comprises a polynucleotide sequence as set forth in SEQ ID NO.: 55.

[0017] In some related aspects, the E3 enhancer element is E3GP, said E20 enhancer element is E20R, and said 5R enhancer element is 5RL. In some related aspects, the enhancer element comprises a polynucleotide sequence as set forth in 56. In some related aspects, the SH2D1A promoter comprises a polynucleotide sequence as set forth in SEQ ID NO: 51, 57, or 58, or a sequence having at least 90% identity thereof.

[0018] In some related aspects, the sequence encoding SAP comprises a polynucleotide as set forth in SEQ ID NOs: 53, 54, or 70, or a sequence having at least 90% identity thereof; or wherein said SAP protein comprises a polypeptide sequence as set forth in 52, or a sequence having at least 90% identity thereof. In some related aspects, the isolated polynucleotide comprises a polynucleotide as set forth in SEQ ID NO: 62 or in SEQ ID NO: 63, or a sequence having at least 90% identity thereof.

[0019] In some aspects, disclosed herein is a viral vector comprising the isolated polynucleotide referenced above. In some related aspects, the viral vector is a lentiviral vector. In some related aspects, the lentiviral vector is an HIV-1 or HIV-2 derived vector.

[0020] In some related aspects, the vector comprises a post-translational regulatory element. In some related aspects, the posttranscriptional regulatory element is modified Woodchuck Post-transcriptional Regulatory Element (WPRE). In some related aspects, the vector comprises a polynucleotide as set forth in SEQ ID NO: 62 or 63.

[0021] In some aspects, disclose herein is a cell comprising the polynucleotide referenced above. In some related aspects, the cell is a stem cell. In some related aspects, the stem cell is derived from bone marrow, umbilical cord blood, or peripheral blood. In some related aspects,the cell is a human hematopoietic progenitor cell, a T cell, a NK cell, or a NKT cell.

[0022] In some aspects disclosed herein is a method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising: (a) obtaining a stem cell or progenitor cell; (b) transfecting the cell of (a) with the polynucleotide of claim 1 ; and (c) transplanting the cell of (b) into said subject.

[0023] In some aspects disclosed herein is a method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising: (a) obtaining a stem cell or progenitor cell; (b) transducing the cell of (a) with the viral vector referenced above; and (c) transplanting the cell of (b) into said subject.

[0024] In some aspects disclosed herein is a method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising transplanting to said subject the cell referenced above.

[0025] In some related aspects, the expression of SAP in said cell recapitulates in vivo the lineage and stage expression patterns of endogenous SAP. In some related aspects, the lineage expression pattern comprises expression in T cells, NK cells, and NKT cells, and low or no expression in monocytes, B cells, B-LCL cells, and myeloid cells. In some related aspects, the stage expression pattern comprises expression in stages 4a to 6 of NK cells. In some related aspects, the stem cell or progenitor cell is autologous or heterologous to the subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The subject matter regarded as expression cassettes for in vivo expression of SLAM- associated protein (SAP), a recombinant lentiviral vector (LV) comprising thereof, a host cell comprising thereof, and methods for treating X-linked lymphoproliferative disease (XLP1) described herein is particularly pointed out and distinctly claimed in the concluding portion of the specification. These composition and methods, however, may best be understood by reference to the following detailed description when read with the accompanying drawings in which:

[0027] Figure 1 illustrates the UCSC Genome Browser interface of the SH2D1A locus encoding the SAP protein, and the experimental methods for identifying regulatory regions. Distinctive DNase I hypersensitive sites (DHSs) are shown across different cell lineages. Transcription factor (TF) binding, along with peaks of bound H3K4mel, H3K27ac, and DHSs can be used to define the presence and boundaries of putative enhancer elements. Proviral maps of a series of XLP1 “SMART” lentiviral vector constructs each contain a putative regulatory element upstream of the endogenous SH2D1A promoter (SH2D1 A Pro) that drive expressionof an mCitrine (mCit) reporter cassette. A unique barcode (BC) is located upstream of the Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) to identify the ability for each element to drive lineage and stage specific expression of the mCit reporter. We transduced primary T, NKT, and NK cells with a pool of raw viral supernatant containing each of the 34 candidate XLP-SMART LVs, in duplicate with different BC, and the EFS-SAP vector as control. B-LCLs were transduced to measure off-target expression in the B lymphocyte lineage. 14 days post- transduction, cells were harvested for their gDNA and RNA fractions to measure BC expression and presence in gDNA via next-generation sequencing.

[0028] Figures 2A-2G illustrate SH2D1A enhancer activity of the expressing elements. Figure 2A illustrates the relative SH2D1A enhancer activity of the highest expressing elements. The relative enhancer expression was measured by next generation sequencing of vector barcodes. The highest expressing five enhancers are depicted, with the lowest level of expression (white) denoted as that of the SH2D1A promoter only (Pro). Elements of interest contain increased expression over the SH2D1A Pro (red). Minimal = 1-1.25-fold increase; Low = 1.25-1.5-fold increase; Medium = 1.5-2- fold increase; High = >2-fold increase. Figure 2B shows the effect of lentivirus proviral size on titer. Putative enhancers were cloned into the plasmid backbone of a therapeutic lentiviral vector (pCCL-c-MNDU3-X [Addgene Plasmid #81071]), packaged, titered head-to-head, and the quantity of infectious particles was plotted as a function of proviral length (bp). Each point in the plot represents an average of three individual 10-cm plates of virus tittered on HT-29 cells. Proviral length is defined as sequence length from the beginning of the 5' long terminal repeat (LTR) U3 through the end of the 3' LTR U5. n = 3 per arm. Linear regression analyses were used to determine the correlation between titer and proviral size (R2=0.51). Figure 2C shows enhancer screen bulk vector copy number. Primary T, NKT, and NK cells were transduced with a pool of raw viral supernatant containing 5xl04TU / mL of the 34 candidate XLPl-SMART-LVs and the EFS-mCitrine vector. B-LCLs were transduced to measure off-target expression. 14 days post-transduction, cells were harvested for their gDNA fraction to measure vector copy number using digital droplet PCR. Data are represented as mean ± SD of biological triplicates from one experiment. Figures 2D-2G show relative SH2D1A enhancer activity in T (Figure 2D), NK (Figure 2E), NKT (Figure 2F), and B-LCL (Figure 2G) cells. Primary T, NKT, and NK cells were transduced with a pool of raw viral supernatant containing each of the 34 candidate XLPl- SMART-LVs, in duplicate, and the EFS-mCit vector. Each candidate LV was cloned with two unique barcodes. B-LCLs were transduced to measure off-target expression. 14 days posttransduction, cells were harvested for their gDNA and RNA fractions to measure barcodeexpression via next-generation sequencing. The RNA barcode counts identify active enhancers within each lineage whereas each genomic barcode count is used normalize each barcode in the transcript to the genome. The number of RNA barcode reads, normalized to frequency of gDNA barcodes within each cell type, determined the relative expression of each element. Data are represented as mean ± SD of biological triplicates from two experiments. Statistical significance was analyzed using a one-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns non-significant, *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001).

[0029] Figures 3A-3C show the expression of refined enhancers in different cell types. Figure 3A shows proviral size of refined XLP-SMART LV vs titer. Putative enhancers were cloned into the plasmid backbone of a lentiviral vector (pCCL-c-MNDU3-X [Addgene Plasmid #81071]) with the MNDU3 promoter first removed, and the vectors were packaged and tittered head-to-head. The quantities of infectious particles were plotted as a function of proviral length (bp). Each point in the plot represents an average of three individual 10-cm plates of virus tittered on HT-29 cells. Proviral length is defined as sequence length from the beginning of the 5' long terminal repeat (LTR) U3 through the end of the 3' LTR U5. n = 3 per arm. Linear regression analyses were used to determine the correlation between titer and proviral size (R2=0.78). Figures 3B and 3C show the expression from LV with refined enhancer elements (via GFP Mean Fluorescence Intensity (MFI)) in T and NK cells, respectively. Healthy donor CD3+ T Cells or CD56+ NK cells were isolated from peripheral blood mononuclear cells (PBMCs). CD3+ T Cells and CD56+ NK cells were transduced with each XLP-SMART LV to achieve a VCN ranging from 0.1-0.2. 14 days post transduction (based on pre-determined titers), T cells were assessed for relative expression driven by each enhancer via mCitrine+ MFI using flow cytometry. Each enhancer was compared to basal SH2D1A promoter-driven expression (Pro) and the control LV (EFS). Data are represented as mean ± SD of biological triplicates from two experiments. Statistical significance was analyzed using a one-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). Statistical analysis was performed on all arms, but selected arms are shown. All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns = non-significant, *P < 0.05, **P < 0.01, ***P < 0.001,

[0030] Figures 4A-4F show the expression of vectors driven by different combinations of enhancers. Figure 4A shows schematically composite XLP1-SMART lentiviral vectors. Diagrams of the two XLP-SMART LV composite constructs are shown with their sequencelengths (kb). 5'LTR and 3' LTR designate the 5' and 3’ viral long terminal repeats (LTR), respectively; E3M, E3GP, 20R, and 5RL are SH2D1A enhancer elements; P designates the SH2D 1 A promoter; mCit, mCitrine reporter cassette; WPRE, Woodchuck Hepatitis Virus post- transcriptional regulatory element. Figure 4B shows a graph of the proviral size of composite XLP-SMART LVs vs titer. Enhancers were cloned into the plasmid backbone of a therapeutic lentiviral vector (pCCL-c-MNDU3-X [Addgene Plasmid #81071]) (with the MNDU3 promoter removed), packaged, and titered head-to-head. The quantities of infectious particles were plotted as a function of proviral length (bp). Each point in the plot represents an average of three individual 10-cm plates of virus titered on HT-29 cells. Proviral length is defined as sequence length from the beginning of the 5' long terminal repeat (LTR) U3 through the end of the 3' LTR U5. n = 3 per arm. Linear regression analyses were used to determine the correlation between titer and proviral size (R2=0.79). Figure 4C shows the on-target expression in T Cells in vitro of composite XLP-SMART LVs. Healthy donor CD3+ T cells were isolated from peripheral blood mononuclear cells (PBMCs). CD3+ T cells were transduced with each XLP-SMART LV to achieve a VCN ranging from 0.1-0.2. At 14 days post transduction, T cells were assessed for the relative expression driven by each enhancer via mCitrine+ MFI using flow cytometry. Each enhancer was compared to basal SH2D1A promoter expression (Pro), the control LV (EFS), and a non-transduced control (NTC). Figure 4D shows the on- target expression in NK cells in vitro of composite XLP-SMART LVs. Healthy donor CD56+ NK cells were isolated from peripheral blood mononuclear cells (PBMCs). CD56+ NK Cells were transduced with each XLP-SMART LV to achieve a VCN ranging from 0.1-0.2. At 14 days post transduction, NK cells were assessed for the relative expression driven by each enhancer via mCitrine+ MFI using flow cytometry. Each enhancer was compared to basal SH2D1A promoter expression (Pro) and the control LV (EFS). Figure 4E shows off-target expression in CB CD34+ differentiated monocytes cells by composite XLP-SMART LVs. Healthy donor CB CD34+ cells were differentiated into monocytes. Prior to differentiation, CB CD34+ cells were transduced with each XLP-SMART LV to achieve a VCN ranging from 0.1- 0.2. At 14 days post transduction and differentiation, CD14+CD16+ monocytes were assessed for the relative expression driven by each enhancer via mCitrine+ MFI using flow cytometry. Each enhancer was compared to basal SH2D1 A promoter expression (Pro) and the control LV (EFS). Figure 4F shows off-target expression in B-LCLs by composite XLP-SMART LVs. B- LCLs, cultured in R10, were transduced with each XLP-SMART LV to achieve a VCN ranging from 0.1-0.2. At 14 days post transduction, B-LCLs were assessed for the relative expression driven by each enhancer via mCitrine+ MFI using flow cytometry. Each enhancer wascompared to basal SH2D1A promoter expression (Pro) and the control LV (EFS). All data is represented as mean ± SD of biological triplicates from one experiment. Statistical significance was analyzed using a one-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). Statistical analysis was performed on all arms, but selected arms are shown. All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0031] Figures 5A-5J show the in vivo expressions of vectors driven by different enhancers. Mice were bled at 16 weeks post-transplant for the analysis from NSG-Tg(Hu-IL15) mouse. Figure 5A shows the vector copy in mouse bone marrow (BM). Genomic DNA was extracted from the BM suspension and analyzed for vector copy number by ddPCR. n = 4, Mock; n = 5, promoter only (Pro); n = 3, EFS-mCitrine (EFS); n = 4, E3M-20R-5RL-mCitrine (3M); n = 3, E3GP-20R-5RL-mCitrine (3GP). Figure 5B shows engraftment in BM. Whole BM was taken from each mouse at time of euthanasia and analyzed for engraftment by flow cytometry using an anti-hCD45 antibody, n = 5, Mock; n = 5, promoter only (Pro); n = 3, EFS-mCitrine (EFS); n = 4, E3M-20R-5RL-mCitrine (3M); n = 4, E3GP-20R-5RL-mCitrine (3GP). Figure 5C shows on-target XLP-SMART LV expression in peripheral blood. Lysed red blood cells were stained for various on-target lineages within the hCD45+ gate. Figure 5D shows off-target XLP-SMART LV expression in BM and peripheral blood (PB). Whole BM, processed into a single cell suspension, and red blood cell-lysed PB were stained for various off-target lineages within the hCD45+ gate. Figure 5E shows XLP-SMART LV expression across NK cell development in PB. Cells were stained for various stages of NK cell differentiation within the hCD45+CD33- gate (Stage 1 [data not shown]: hCD34+; Stage 2a [data not shown]: hCD34+, hCD117+, hCD122-; Stage 2b [data not shown]: hCD34+, hCD117+, hCD122+; Stage 3: hCD34-, hCD117+, hCD122+, hCD56-; Stage 4a: hCD34-, hCD117+, hCD122+, hCD56+, hCD94+; Stage 4b: hCD34-, hCD117-, hCD122+, hCD56+, hCD94+, hNKp80+; Stage 5: hCD34-, hCD117-, hCD122+, hCD56+, hCD94+, hNKp80+, hCD16+; and Stage 6: hCD34-, hCD117-, CD122+, hCD56+, hCD94+, hNKp80+, hCD16+, hCD57+). Figure 5F shows XLP-SMART LV expression across T cell development in PB. Cells were stained for various stages of mature T cell populations within the hCD45+hCD34-hCD14-hCD19-hCD56- hCD5+hCD7+TCRab+CD3+ gate (total CD4: hCD4+, hCD8-; CD4+CD45RA+: hCD4+, hCD8-, hCD45RA+, hCD45RO-; CD4+CD45RO+: hCD4+, hCD8-, hCD45RA-, hCD45RO+; total CD8: hCD4-, hCD8+; CD8+CD45RA+: hCD4-, hCD8+, hCD45RA+, hCD45RO-; CD8+CD45RO+: hCD4-, hCD8+, hCD45RA-, hCD45RO+). Figure 5G shows the frequency of hematopoietic populations in peripheral blood. Lysed red blood cells were stained forvarious lineages within the hCD45+ gate. Figure 5H shows XLP1-SMART-LV expression across NK cell development in BM. Single cells were stained for various stages of NK cell differentiation within the hCD45+hCD33- gate (Stage 1: hCD34+; Stage 2a: hCD34+ hCD117+ hCD122-; Stage 2b: hCD34+ hCD117+ hCD122+; Stage 3: hCD34- hCD117+ hCD122+ hCD56-). Figure 51 shows XLP1-SMART-LV expression across NK cell development in spleen. Lysed splenic single cells were stained for various stages of NK cell differentiation within the hCD45+hCD33- gate (Stage 1 : hCD34+; Stage 2a: hCD34+ hCD117+ hCD122-; Stage 2b: hCD34+ hCD117+ hCD122+; Stage 3: hCD34- hCD1 l7+ hCD122+ hCD56-; Stage 4a: hCD34- hCD117+ hCD122+ hCD56+ hCD94+; Stage 4b: hCD34- hCD117- hCD122+ hCD56+ hCD94+ hNKp80+; Stage 5: hCD34- hCD117- hCD122+ hCD56+ hCD94+ hNKp80+ hCD16+; and Stage 6: hCD34- hCD117- CD122+ hCD56+ hCD94+ hNKp80+ hCD16+ hCD57). Figure 5J shows XLP1-SMART-LV expression across T cell development in thymus. The single cell thymus suspension was stained for mature stages of T cell differentiation within the hCD45+ hCD34- hCD14- hCD19- hCD56- hCD5+ hCD7+ TCRab+ CD3+ gate (DP early: TCRab-CD3-CD8+CD4+; DP late: hCD4+ hCD8+; total CD4+: hCD4+ hCD8-; CD4+CD45RA+: hCD4+ hCD8- hCD45RA+ hCD45RO- ; CD4+CD45RO+: hCD4+ hCD8- hCD45RA- hCD45RO+; total CD8+: hCD4- hCD8+; CD8+CD45RA+: hCD4- hCD8+ hCD45RA+ hCD45RO-; CD8+CD45RO+: hCD4- hCD8+ hCD45RA- hCD45RO+). Each LV’s relative expression was measured via mCitrine+ MFI using flow cytometry. Each enhancer was compared to basal SH2D1A promoter expression (Pro) and the preclinical vector (EFS), both harboring an mCitrine reporter cassette. Data are represented as mean ± SD of biological triplicates from one experiment. We analyzed statistical significance using a two-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.).

[0032] Figures 6A-6D show SAP expression levels in human tissues and XLP1-SMART-LV Expression across T cell and NK cell in transplanted mice. Figure 6A shows SAP mean fluorescence intensity of T cell populations in human thymus. Healthy donor human thymic tissue was processed into a single cell suspension. The single cell suspension was stained for mature stages of T cell differentiation within the hCD45+ hCD34- hCD14- hCD19- hCD56- hCD5+ hCD7+ TCRab-i- CD3+ gate. SAP expression was determined via total SAP MFI within each target population using flow cytometry. Figure 6B shows SAP mean fluorescence intensity of mature NK cell populations in three healthy donor PBMC samples. CD56+ NK cells from (n=3) healthy donors (HD) were isolated from PBMCs. Cells were stained withmonoclonal antibodies for various stages of NK development (Stage 3: hCD34- hCD117+ hCD122+ hCD56-; Stage 4a: hCD34- hCD117+ hCD122+ hCD56+ hCD94+; Stage 4b: hCD34- hCD117- hCD122+ hCD56+ hCD94+ hNKp80+; Stage 5: hCD34- hCD117- hCD122+ hCD56+ hCD94+ hNKp80+ hCD16+; and Stage 6: hCD34- hCD117- CD122+ hCD56+ hCD94+ hNKp80+ hCD16+ hCD57). Figures 6C and 6D show XLP1-SMART-LV expression across T cell and NK cell development 16 weeks post-transplant in hIL15 NSG mice. The following graphs are representative data shown in Figure 5E and 5F. They depict XLP1-SMART-LV expression across T cell development (Figure 6C) and NK cell development (Figure 6D).

[0033] Figures 7A-7B show representative SAP and mCitrine expression within healthy donor PBSC CD34+ derived artificial thymic organoid cultures. To determine SAP expression and SMART-LV expression across T cell maturation, healthy donor mobilized peripheral blood CD34+ cells were transduced with XLP1 -SMART-LVs harboring an mCitrine reporter cassette and differentiated into T cells using the 3D artificial thymic organoid (ATO) system. At weeks 3, 7, and 12 of differentiation, ATOs were harvested and stained to measure their relative SAP expression after fixation and permeabilization (Figure 7A); or mCitrine expression using flow cytometry (Figure 7B). ATOs were stained to differentiate the following stages of T cell development: double negative (DN): hTCRab-hCD3-hCD4-hCD8-; immature single positive 4 (ISP4): hTCRab-hCD3-hCD4+hCD8-; double positive (DP) early: hTCRab-hCD3- hCD4+hCD8+; DP late: hTCRab+hCD3+hCD4+hCD8+; single positive (SP) 4: hTCRab+hCD3+hCD4+hCD8-; and SP8: hTCRab+hCD3+hCD4-hCD8+. A representative plot of the frequency of SAP+ cells (Figure 7A) and the frequency of mCitrine+ cells (Figure 7B) across weeks 3, 7, and 12 is shown, in which data were normalized to the VCN of the bulk ATO populations. VCNs were as follows: EFS = 0.39, E3M = 0.184, E3GP = 0.25. Data are represented as mean + SD of biological triplicates from one experiment across three timepoints (weeks 3, 7, and 12).

[0034] Figures 8A-8D. Figure 8A shows VCN of Jurkat cells 6 weeks post transduction with XLP-SMART-LV. SH2D1A - / - Jurkat cells were transduced at an equivalent vector copy number (VCN) with the E3M-E20R-5RL lentiviral vector harboring an SH2D1A cDNA cassette containing wildtype codons, GeneArt (GA), or Java Codon Adaptation Tool (JCAT) codon optimizations. 14 days after transduction, cells were harvested for VCN measurement by ddPCR. Figure 8B shows Western blot of cells transduced with XLP-SMART-LV. Protein was extracted from the transduced populations shown in panel Figure 8A. The reconstitution of SAP protein after transduction was measured by western blot using an anti-SAP antibody(clone 1C9; Abnova) with a 1:1000 dilution of primary antibody. Figure 8C shows Western blot for dose response transduction of Jurkat cells transduced with JCat codon optimized XLP 1 - SMART-LVs. SH2D1A - / - Jurkat cells were transduced with the JCat codon optimized E3M- E20R-5RL or E3GP-E20R-5RL lentiviral vectors to achieve VCNs of 1,3, and 5. 14 days after transduction, cells were harvested for VCN measurement by ddPCR. Protein was extracted from the transduced populations and measured by western blot using an anti-SAP antibody (clone 1C9; Abnova). Figure 8D shows densitometry quantification of Western Blot dose response. The western blot images produced in panel C were quantified for total Actin and SAP protein using densitometry via the ImageJ image processing and analysis tool. After quantification, SAP protein was normalized to the actin loading control. Relative SAP protein expression was determined by measuring the ratio of normalized SAP protein in the experimental condition to the normalized SAP protein of the wildtype Jurkat control.

[0035] Figures 9A-9F show colony forming unit (CFU) assays in XLP1 patient bone marrow (BM) CD34+ cells transduced with XLP-SMART LVs. BM CD34+ cells from a healthy donor and an XLP1 patient were prestimulated for 24 hours with 50 ng / mL each of human stem cell factor (hSCF), human thrombopoietin (hTPO), and human FMS-like tyrosine kinase 3 ligand (hFlt3-L) before transduction with XLP1-SMART LVs. 24-hours after transduction, 100, 300, and 900 BM CD34+ HSPCs per replicate were plated in MethoCult. After 14 days of culture at 5% CO2, 37°C and humidified atmosphere, the number of mature colonies were scored under the microscope for total colony forming units (CFU) at a VCN of 1.1 (Figure 9A) or 2.4 (Figure 9D); total hematopoietic progenitor cell counts at a VCN of 1.1 (Figure 9B) or 2.4 (Figure 9E), denoted as Myeloid (G / M / GM), Erythroid (BFU / E), or Mixed (GEMM); and finally, percentage of total Myeloid or Erythroid lineage distribution for cells at a VCN of 1.1 (Figure 9C) or 2.4 (Figure 9F). Data are represented as mean ± SD of biological duplicates from one experiment. Clonogenicity was analyzed for statistical significance using a one-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). CFU hematopoietic potential was analyzed for statistical significance using a two-way ANOVA followed by multiple paired comparisons for normally distributed data (Tukey test). Statistical analysis was performed on all arms, but selected arms are shown. All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0036] Figures 10A-10E show rescue of SAP expression inXLPl patients. Figure 10A shows a FACS representation of SAP protein restoration in XLP1 patient CD8+ T cells. CD8+ T cells from a healthy donor (HD) and an XLP1 patient were isolated from PBMCs and transducedwith XLP-SMART LVs. 10 days after transduction, cells were fixed, permeabilized and stained for SAP protein using an anti-SAP monoclonal antibody. Stained cells were then assessed for their SAP expression via total SAP MFI within each target subpopulation using flow cytometry. Figure 10B shows T cell restimulation induced cell death (RICD) assay of XLP1 patient CD8+ T cells transduced with XLP-SMART LVs. CD8+ T cells from a healthy donor (HD) and an XLP1 patient were isolated from PBMCs and transduced with XLP-SMART LVs. 10 days after transduction, cells were plated for RICD assay in OKT3 at final concentrations of 1000 ng / ml, 100 ng / ml and 10 ng / ml. After 24 hours, XLP-SMART LV transduced cells were taken to measure the recovery of RICD in comparison to an EFS-SAP transduced condition and a HD control. The number of live cells (PL) in stimulated controls were compared to unstimulated controls to measure the % cell loss = [l-(# PL restimulated cells / # PI- untreated cells)]xl00. Data are represented as mean + SD of biological triplicates from one experiment. Compared to SH2D1A knockout T cells (KO), the EFS, E3M, and E3GP conditions were deemed significant with a p value <0.0001 (data not shown). Figure 10C shows T cell restimulation induced cell death (RICD) assay of SH2D1A- / - CD8+ T cells transduced with XLPl-SMART-LVs. CD8+ T cells from a healthy donor (HD) and were isolated from PBMCs and transfected with sgRNAs targeting Exon 2 of the SH2D1A gene to knockout SAP expression. SH2D1A - / - T cells were transduced with XLPl-SMART-LVs (VCNs are EFS = 2.79, E3M = 2.5, E3GP = 2.46). 10 days after transduction, cells were plated for RICD in OKT3 at final concentrations of 1000 ng / ml, 100 ng / ml and 10 ng / ml. After 24 hours, the recovery of RICD in XLP1-SMART-LV transduced cells was compared to a HD control. The number of live cells (PL) in stimulated controls were compared to unstimulated controls to measure the % cell loss = [l-(# PL restimulated cells / # PL untreated cells)]xl00. Compared to XLP knockout samples, EFS was deemed significant with a p value <0.05; E3M was deemed significant with a p value <0.0001 ; and E3GP was deemed significant with a p value <0.0001. Figure 10D shows K562 NK cell cytotoxicity assay of XLP1 patient bone marrow (BM) CD34+ cells transduced with XLP-SMART LVs. BM CD34+ cells from a healthy donor (HD) and an XLP1 patient were transduced with XLP-SMART LVs and differentiated into CD56+ NK cells using the StemSpan™ NK Cell Generation Kit. On day 28 of differentiation, CD56+ NK cells were enriched using magnetic bead isolation and serially diluted with target cells at various effector to target (K562) ratios - 2.5:1, 1.25:1, 1 :1.6, 1:3.2, 1:6.8, 1:12.8. After 18 hours of incubation, GFP+ tumor cells were counted via FACS to assess NK cytotoxicity and normalized to target only control wells. Due to limited XLP1 patient cells, data are represented as single replicates from one experiment. Compared to XLP1 patientsamples, Healthy donor was deemed significant at a p value <0.05; EFS was deemed significant with a p value <0.001; E3M was deemed not significant; and E3GP was deemed significant with a p value <0.0001. Figure 10E shows Raji NK cell cytotoxicity assay of XLP1 patient bone marrow (BM) CD34+ cells transduced with XLP-SMART LVs. BM CD34+ cells from a healthy donor (HD) and an XLP1 patient were transduced with XLP-SMART LVs and differentiated into CD56+ NK cells using the StemSpan™ NK Cell Generation Kit. On day 28 of differentiation, CD56+ NK cells were enriched using magnetic bead isolation and serially diluted with target cells at various effector to target (Raji) ratios - 2.5:1 , 1.25:1 , 1 :1.6, 1 :3.2, 1 : 6.8, 1 : 12.8. After 18 hours of incubation, 7AAD+ CFSE+ tumor cells were counted via FACS to assess NK cytotoxicity and normalized to target only control wells. Due to insufficient patient cells, data are represented as single replicates from one experiment. Compared to XLP1 patient samples, EFS was deemed not significant; E3M was deemed significant with a p value <0.0001; and E3GP was deemed significant with a p value <0.0001.DETAILED DESCRIPTION

[0037] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of polynucleotides, the viral vectors, and the methods for treating X-linked lymphoproliferative disease (XLP1) disclosed herein. However, it will be understood by those skilled in the art that these methods may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the method of skin rejuvenation described herein. Isolated Polynucleotides

[0038] Disclosed herein is an isolated polynucleotide comprising:(a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than SLAM- associated protein (SAP) endogenous enhancer;(b) an SH2D1A promoter; and(c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0039] It is disclosed herein that only a part of the endogenous SH2D1A enhancer region is needed for the SAP protein to have its characteristic lineage and stage expression patterns. The identification of said critical segments of SH2D1A enhancer allows creating shorter SAP expression vectors that, once transfected into cells, mimic the expression pattern of endogenousSAP.

[0040] A skilled artisan would appreciate the enhancer refers to 50-1500 bp region of DNA that can be bound by gene activators or transcriptions factors to increase the likelihood that transcription of a particular gene will occur. The enhancer can be found up to 1 million base pairs (Mbp) away from the gene, upstream or downstream from the start site, or in the gene, for example, in non-transcribed regions of the gene.

[0041] In some embodiments, the endogenous SH2D1A enhancer region comprises a polynucleotide sequence as set forth in SEQ ID NO: 1 .

[0042] In some embodiments, the isolated polynucleotide enhancer region comprises one or more of elements Enhancer (E)l, E2, E3, E4, E5, E6, E7, E8, E9, E10, El l, E12, E13, E14, E15, E16, E17, E18, E19, E20, E21, E22, E23, E24, E25, E26, E30, E31, Inti, 5RL, 3R, 5R, 5RC, 5RS, E3L, E3M, E3S, E3P, E4LL, E4RL, E4LS, E4RS, E5M, E5L, E20La, E20Le, E20R, E7S, E3GS, E3GL, and E3GP.

[0043] In some embodiments, the isolated polynucleotide enhancer region comprises element El. In some embodiments, El comprises a nucleotide sequence as set forth in SEQ ID NO.: 2. In some embodiments, El comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 2, or a part thereof.

[0044] In some embodiments, the isolated polynucleotide enhancer region comprises element E2. In some embodiments, E2 comprises a nucleotide sequence as set forth in SEQ ID NO.: 3. In some embodiments, E2 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 3, or a part thereof.

[0045] In some embodiments, the isolated polynucleotide enhancer region comprises element E3. In some embodiments, E3 comprises a nucleotide sequence as set forth in SEQ ID NO.: 4. In some embodiments, E3 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 4, or a part thereof.

[0046] In some embodiments, the isolated polynucleotide enhancer region comprises element E4. In some embodiments, E4 comprises a nucleotide sequence as set forth in SEQ ID NO.: 5. In some embodiments, E4 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 5, or a part thereof.

[0047] In some embodiments, the isolated polynucleotide enhancer region comprises element E5. In some embodiments, E5 comprises a nucleotide sequence as set forth in SEQ ID NO.: 6. In some embodiments, E5 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 6, or a part thereof.

[0048] In some embodiments, the isolated polynucleotide enhancer region comprises elementE6. In some embodiments, E6 comprises a nucleotide sequence as set forth in SEQ ID NO.: 7. In some embodiments, El comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 7, or a part thereof.

[0049] In some embodiments, the isolated polynucleotide enhancer region comprises element E7. In some embodiments, E7 comprises a nucleotide sequence as set forth in SEQ ID NO.: 8. In some embodiments, E7 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 8, or a part thereof.

[0050] In some embodiments, the isolated polynucleotide enhancer region comprises element E8. In some embodiments, E8 comprises a nucleotide sequence as set forth in SEQ ID NO.: 9. In some embodiments, E8 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 9, or a part thereof.

[0051] In some embodiments, the isolated polynucleotide enhancer region comprises element E9. In some embodiments, E9 comprises a nucleotide sequence as set forth in SEQ ID NO.:10. In some embodiments, E9 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 10, or a part thereof.

[0052] In some embodiments, the isolated polynucleotide enhancer region comprises element E10. In some embodiments, E10 comprises a nucleotide sequence as set forth in SEQ ID NO.:11. In some embodiments, E10 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 11, or a part thereof.

[0053] In some embodiments, the isolated polynucleotide enhancer region comprises element El 1. In some embodiments, El 1 comprises a nucleotide sequence as set forth in SEQ ID NO.:12. In some embodiments, El l comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 12, or a part thereof.

[0054] In some embodiments, the isolated polynucleotide enhancer region comprises element E12. In some embodiments, E12 comprises a nucleotide sequence as set forth in SEQ ID NO.:13. In some embodiments, E12 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 13, or a part thereof.

[0055] In some embodiments, the isolated polynucleotide enhancer region comprises element E13. In some embodiments, E13 comprises a nucleotide sequence as set forth in SEQ ID NO.:14. In some embodiments, El 3 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 14, or a part thereof.

[0056] In some embodiments, the isolated polynucleotide enhancer region comprises element E14. In some embodiments, E14 comprises a nucleotide sequence as set forth in SEQ ID NO.:15. In some embodiments, E14 comprises a nucleotide sequence comprising at least 70%, 80%,90%, or 95% of SEQ ID NO.: 15, or a part thereof.

[0057] In some embodiments, the isolated polynucleotide enhancer region comprises element E16. In some embodiments, E16 comprises a nucleotide sequence as set forth in SEQ ID NO.:16. In some embodiments, El 6 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 16, or a part thereof.

[0058] In some embodiments, the isolated polynucleotide enhancer region comprises element E17. In some embodiments, E17 comprises a nucleotide sequence as set forth in SEQ ID NO.:17. In some embodiments, El 7 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 17, or a part thereof.

[0059] In some embodiments, the isolated polynucleotide enhancer region comprises element E18. In some embodiments, E18 comprises a nucleotide sequence as set forth in SEQ ID NO.:18. In some embodiments, El 8 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 18, or a part thereof.

[0060] In some embodiments, the isolated polynucleotide enhancer region comprises element E19. In some embodiments, E19 comprises a nucleotide sequence as set forth in SEQ ID NO.:19. In some embodiments, E19 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 19, or a part thereof.

[0061] In some embodiments, the isolated polynucleotide enhancer region comprises element E20. In some embodiments, E20 comprises a nucleotide sequence as set forth in SEQ ID NO.:20. In some embodiments, E20 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 20, or a part thereof.

[0062] In some embodiments, the isolated polynucleotide enhancer region comprises element E21. In some embodiments, E21 comprises a nucleotide sequence as set forth in SEQ ID NO.:21. In some embodiments, E21 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 21, or a part thereof.

[0063] In some embodiments, the isolated polynucleotide enhancer region comprises element E22. In some embodiments, E22 comprises a nucleotide sequence as set forth in SEQ ID NO.:22. In some embodiments, E22 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 22, or a part thereof.

[0064] In some embodiments, the isolated polynucleotide enhancer region comprises element E23. In some embodiments, E23 comprises a nucleotide sequence as set forth in SEQ ID NO.:23. In some embodiments, E23 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 23, or a part thereof.

[0065] In some embodiments, the isolated polynucleotide enhancer region comprises elementE25. In some embodiments, E25 comprises a nucleotide sequence as set forth in SEQ ID NO.:24. In some embodiments, E25 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 24, or a part thereof.

[0066] In some embodiments, the isolated polynucleotide enhancer region comprises element E26. In some embodiments, E26 comprises a nucleotide sequence as set forth in SEQ ID NO.:25. In some embodiments, E26 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 25, or a part thereof.

[0067] In some embodiments, the isolated polynucleotide enhancer region comprises element E30. In some embodiments, E30 comprises a nucleotide sequence as set forth in SEQ ID NO.:26. In some embodiments, E30 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 26, or a part thereof.

[0068] In some embodiments, the isolated polynucleotide enhancer region comprises element E31. In some embodiments, E31 comprises a nucleotide sequence as set forth in SEQ ID NO.:27. In some embodiments, E31 comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 27, or a part thereof.

[0069] In some embodiments, the isolated polynucleotide enhancer region comprises element Inti. In some embodiments, Inti comprises a nucleotide sequence as set forth in SEQ ID NO.:28. In some embodiments, Inti comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 28, or a part thereof.

[0070] In some embodiments, the isolated polynucleotide enhancer region comprises element 5RL. In some embodiments, 5RL comprises a nucleotide sequence as set forth in SEQ ID NO.:29. In some embodiments, 5RL comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 29, or a part thereof.

[0071] In some embodiments, the isolated polynucleotide enhancer region comprises element 3R. In some embodiments, 3R comprises a nucleotide sequence as set forth in SEQ ID NO.:30. In some embodiments, 3R comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 30, or a part thereof.

[0072] In some embodiments, the isolated polynucleotide enhancer region comprises element 5R. In some embodiments, 5R comprises a nucleotide sequence as set forth in SEQ ID NO.:31. In some embodiments, 5R comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 31, or a part thereof.

[0073] In some embodiments, the isolated polynucleotide enhancer region comprises element 5RC. In some embodiments, 5RC comprises a nucleotide sequence as set forth in SEQ ID NO.:32. In some embodiments, 5RC comprises a nucleotide sequence comprising at least 70%,80%, 90%, or 95% of SEQ ID NO.: 32, or a part thereof.

[0074] In some embodiments, the isolated polynucleotide enhancer region comprises element 5RS. In some embodiments, 5RS comprises a nucleotide sequence as set forth in SEQ ID NO.:33. In some embodiments, 5RS comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 33, or a part thereof.

[0075] In some embodiments, the isolated polynucleotide enhancer region comprises element E3L. In some embodiments, E3L comprises a nucleotide sequence as set forth in SEQ ID NO.:34. In some embodiments, E3L comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 34, or a part thereof.

[0076] In some embodiments, the isolated polynucleotide enhancer region comprises element E3M. In some embodiments, E3M comprises a nucleotide sequence as set forth in SEQ ID NO.: 35. In some embodiments, E3M comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 35, or a part thereof.

[0077] In some embodiments, the isolated polynucleotide enhancer region comprises element E3S. In some embodiments, E3S comprises a nucleotide sequence as set forth in SEQ ID NO.:36. In some embodiments, E3S comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 36, or a part thereof.

[0078] In some embodiments, the isolated polynucleotide enhancer region comprises element E3P. In some embodiments, E3P comprises a nucleotide sequence as set forth in SEQ ID NO.:37. In some embodiments, E3P comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 37, or a part thereof.

[0079] In some embodiments, the isolated polynucleotide enhancer region comprises element E4LL. In some embodiments, E4LL comprises a nucleotide sequence as set forth in SEQ ID NO.: 38. In some embodiments, E4LL comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 38, or a part thereof.

[0080] In some embodiments, the isolated polynucleotide enhancer region comprises element E4RL. In some embodiments, E4RL comprises a nucleotide sequence as set forth in SEQ ID NO.: 39. In some embodiments, E4RL comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 39, or a part thereof.

[0081] In some embodiments, the isolated polynucleotide enhancer region comprises element E4LS. In some embodiments, E4LS comprises a nucleotide sequence as set forth in SEQ ID NO.: 40. In some embodiments, E4LS comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 40, or a part thereof.

[0082] In some embodiments, the isolated polynucleotide enhancer region comprises elementE4RS. In some embodiments, E4RS comprises a nucleotide sequence as set forth in SEQ ID NO.: 41. In some embodiments, E4RS comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 41, or a part thereof.

[0083] In some embodiments, the isolated polynucleotide enhancer region comprises element E5M. In some embodiments, E5M comprises a nucleotide sequence as set forth in SEQ ID NO.: 42. In some embodiments, E5M comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 42, or a part thereof.

[0084] In some embodiments, the isolated polynucleotide enhancer region comprises element E5L. In some embodiments, E5L comprises a nucleotide sequence as set forth in SEQ ID NO.: 43. In some embodiments, E5L comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 43, or a part thereof.

[0085] In some embodiments, the isolated polynucleotide enhancer region comprises element E20La. In some embodiments, E20La comprises a nucleotide sequence as set forth in SEQ ID NO.: 44. In some embodiments, E20La comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 44, or a part thereof.

[0086] In some embodiments, the isolated polynucleotide enhancer region comprises element E20Le. In some embodiments, E20Le comprises a nucleotide sequence as set forth in SEQ ID NO.: 45. In some embodiments, E20Le comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 45, or a part thereof.

[0087] In some embodiments, the isolated polynucleotide enhancer region comprises element E20R. In some embodiments, E20R comprises a nucleotide sequence as set forth in SEQ ID NO.: 46. In some embodiments, E20R comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 46, or a part thereof.

[0088] In some embodiments, the isolated polynucleotide enhancer region comprises element E7S. In some embodiments, E7S comprises a nucleotide sequence as set forth in SEQ ID NO.: 47. In some embodiments, E7S comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 47, or a part thereof.

[0089] In some embodiments, the isolated polynucleotide enhancer region comprises element E3GS. In some embodiments, E3GS comprises a nucleotide sequence as set forth in SEQ ID NO.: 48. In some embodiments, E3GS comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 48, or a part thereof.

[0090] In some embodiments, the isolated polynucleotide enhancer region comprises element E3GL. In some embodiments, E3GL comprises a nucleotide sequence as set forth in SEQ ID NO.: 49. In some embodiments, E3GL comprises a nucleotide sequence comprising at least70%, 80%, 90%, or 95% of SEQ ID NO.: 49, or a part thereof.

[0091] In some embodiments, the isolated polynucleotide enhancer region comprises element E3GP. In some embodiments, E3GP comprises a nucleotide sequence as set forth in SEQ ID NO.: 50. In some embodiments, E3GP comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 50, or a part thereof.

[0092] In some embodiments, the isolated polynucleotide enhancer region comprises element E3GP. In some embodiments, E3GP comprises a nucleotide sequence as set forth in SEQ ID NO.: 50. In some embodiments, E3GP comprises a nucleotide sequence comprising at least 70%, 80%, 90%, or 95% of SEQ ID NO.: 50, or a part thereof.

[0093] In some embodiments, the isolated polynucleotide enhancer region comprises elements E3M, E20R, and 5RL. In some embodiments, the isolated polynucleotide enhancer region consists of elements E3M, E20R, and 5RL. In some embodiments, an enhancer region consisting of elements E3M, E20R, and 5RL comprises a nucleotide sequence as set forth in SEQ ID NO.: 55.

[0094] In some embodiments, the isolated polynucleotide enhancer region comprises elements E3GP, E20R, and 5RL. In some embodiments, the isolated polynucleotide enhancer region consists of elements E3GP, E20R, and 5RL. In some embodiments, an enhancer region consisting of elements E3GP, E20R, and 5RL comprises a nucleotide sequence as set forth in SEQ ID NO.: 56.

[0095] The enhancer region of the isolated polynucleotide is shorter than the whole endogenous enhancer region of SH2D1A gene. That allows an easier manipulation and increased efficiency of the polynucleotide. A skilled artisan would understand that as used herein, the term shorter is to be understood as having at least one nucleotide less than the endogenous enhancer region of SH2D1 A gene.

[0096] In some embodiments, the enhancer region of the isolated polynucleotide is shorter by at least 10, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3500, 4000, 4500, or 5000 nucleotides less than the endogenous enhancer region of SH2D1A gene.

[0097] In some embodiments, the enhancer region of the isolated polynucleotide comprises less than 300, 400, 500, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3500, 4000, 4500, or 5000 nucleotides.

[0098] In some embodiments, the enhancer region of the isolated polynucleotide is shorter by at least 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% than the endogenous SH2D1Aenhancer region.

[0099] In some embodiments, the isolated polynucleotide comprises an SH2D1 A promoter. A skilled artisan would appreciate that the SH2D 1 A promoter comprises a region of DNA located upstream of a gene, and that initiates the process of transcription. In some embodiments, the SH2D1A promoter comprises a nucleotide sequence as set forth in SEQ ID NO.: 51. In some embodiments, the SH2D1A promoter comprises a nucleotide sequence as set forth in SEQ ID NO.: 57. In some embodiments, the SH2D1A promoter comprises a nucleotide sequence as set forth in SEQ ID NO.: 58.

[0100] In some embodiments, the isolated polynucleotide further comprises a sequence encoding SLAM-associated protein (SAP). In some embodiments, said SAP is human SAP. A skilled artisan would appreciate that SAP can also be termed SH2D1A, DSHP, EBVS, IMD5, LYP, MTCP1, SAP / XLP, XLPD, XLPD1, SH2 domain containing 1A. In some embodiments, SAP has the amino acid sequence of NCBI Reference Sequence: NP_001108409.1.

[0101] In some embodiments, SAP comprises an amino acid sequence as set forth in SEQ ID NO.: 52. In some embodiments, SAP comprises an amino acid sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 52. In some embodiments, the isolated polynucleotide comprises a sequence encoding only an active part of SAP.

[0102] A skilled artisan would appreciate that it is not necessary to include in the isolated polypeptide the whole sequence of SH2D1A coding region to express the protein. A number of methods are available to the artisan to optimize the gene by reducing its size. In some embodiments, a SH2D1A coding region is optimized by using the JCat codon optimization algorithm or the GeneArt algorithm.

[0103] The jCAT tool adapts gene codon usage to most sequenced prokaryotes and various eukaryotic gene expression hosts. In contrast to many tools, JCat does not require the manual definition of highly expressed genes and is, therefore, a very rapid and easy method. Further options of JCat for codon adaptation include the avoidance of unwanted cleavage sites for restriction enzymes and Rho-independent transcription terminators. The output of JCat is both graphically and as Codon Adaptation Index (CAI) values given for the input sequence and the newly adapted sequence. JCat tool is available online at www jc t. e.

[0104] Another codon optimization tool is IDT. The IDT codon optimization tool was developed to optimize a DNA or protein sequence from one organism for expression in another by reassigning codon usage based on the frequencies of each codon’s usage in the new organism. For example, valine is encoded by 4 different codons (GUG, GUU, GUC, and GUA). In human cell lines, however, the GUG codon is preferentially used (46% use vs. 18, 24, and12%, respectively). The codon optimization tool takes this information into account and assigns valine codons with those same frequencies. In addition, the tool algorithm eliminates codons with less than 10% frequency and re-normalizes the remaining frequencies to 100%. Moreover, the optimization tool reduces complexities that can interfere with manufacturing and downstream expression, such as repeats, hairpins, and extreme GC content. The IDT optimization tool is available from IDT (Integrated DNA Technologies, Coralville, Iowa) and can be found at ww.idtdna.com / CodonOpt.

[0105] In some embodiments, codon optimization tools include but are not limited to CodonW an open source software program that can be found at codonw.sourceforge.net, and the OPTIMUM GENETM algorithm from GenScript.

[0106] In some embodiments, SH2D1A coding region comprises the nucleotide sequence as set forth in SEQ ID NO.: 53. In some embodiments, SH2D1A coding region comprises nucleotide sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 53. In some embodiments, SH2D1 A coding region comprises a nucleotide sequence as set forth in NCBI Reference Sequence: NM_002351.5.

[0107] In some embodiments, an optimized SH2D1 A coding region comprises the nucleotide sequence as set forth in SEQ ID NO.: 54. In some embodiments, an optimized SH2D1 A coding region comprises nucleotide sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 54.

[0108] In some embodiments, an optimized SH2D1A coding region comprises the nucleotide sequence as set forth in SEQ ID NO.: 70. In some embodiments, an optimized SH2D1 A coding region comprises nucleotide sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 70.

[0109] In some embodiments, the isolated polynucleotide comprises a sequence as set forth in SEQ ID NO.: 62. In some embodiments, the isolated polynucleotide comprises a sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 62.

[0110] In some embodiments, the isolated polynucleotide comprises a sequence as set forth in SEQ ID NO.: 63. In some embodiments, the isolated polynucleotide comprises a sequence comprising at least 70%, 80%, 90%, or 95% identity to SEQ ID NO.: 63.

[0111] In some embodiments, when the isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP. In other words, when transfected into a cell, the isolated polynucleotide will have a level of expression similar to that of native SAP has in that cell. In some embodiments, a similar level of expression refers to a level of expression lower or higher in less than 1%, 5%, 10%, 15%, 20%, 25%, or 30%.

[0112] In some embodiments, the isolated polynucleotide can be expressed in T cells. In some embodiments, the isolated polynucleotide can be expressed in NK cells. In some embodiments, the isolated polynucleotide can be expressed in NKT cells. In some embodiments, the isolated polynucleotide has no expression or low expression in monocytes. In some embodiments, the isolated polynucleotide has no expression or low expression in B cells. In some embodiments, the isolated polynucleotide has no expression or low expression in B cells B-LCL cells. In some embodiments, the isolated polynucleotide has no expression or low expression in myeloid cells. In some embodiments, the isolated polynucleotide can be expressed in T cells, NK cells, and NKT cells, and has low or no expression in monocytes, B cells, B-LCL cells, and myeloid cells. In some embodiments, the polynucleotide can be expressed in NK cells in stages 4a to 6, in similar levels to that of the native SAP protein.

[0113] In some embodiments, disclosed herein is an expression cassette for in vivo expression of SAP, comprising the isolated polynucleotide encoding SAP.Lentiviral Vectors

[0114] In some embodiments, disclosed herein is a viral vector comprising a polynucleotide comprising:(a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1A enhancer region;(b) an SH2D1A promoter; and(c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0115] A skilled artisan would appreciate that a viral vector comprises a modified virus engineered to deliver the isolated polynucleotide or expression cassette of SAP, either to a living organism or in cell culture. These vectors take advantage of the natural ability of viruses to insert their genome into host cells via transduction. In some embodiments, the genetic material delivered by the viral vector is a DNA vector. In some embodiments, the genetic material delivered is RNA vector. In some embodiments, the vector is single-stranded or double-stranded.

[0116] A number of viral vectors are known in the art, and the teachings disclosed herein can be applied to any of those. In some embodiments, the viral vector is a retrovirus. In some embodiments, the viral vector is a lentivirus. In some embodiments, the viral vector is an adenovirus. In some embodiments, the viral vector is an adeno-associated virus (AAV). Insome embodiments, the viral vector is a Herpes Simplex virus.

[0117] In some embodiments, the viral vector integrates its genetic material into the host cell genome, allowing for stable and long-term expression. In some embodiments, the viral vector is capable of infecting both dividing and non-dividing cells. In some embodiments, the viral vector infects dividing cells. In some embodiments, the viral vector infects non-dividing cells.

[0118] In some embodiments, the expression cassettes described herein are provided in lentiviral vectors. In some embodiments, the lentiviral vectors described herein comprise a TAT-independent, self-inactivating (SIN) configuration. Thus, in some embodiments, an LTR region is employed that has reduced promoter activity relative to wild-type LTR. Such constructs can be provided that are effectively self-inactivating which provides a biosafety feature. SIN vectors are ones in which the production of full-length vector RNA in transduced cells is greatly reduced or abolished altogether. This feature minimizes the risk that replication- competent recombinants (RCRs) will emerge. Furthermore, it reduces the risk that cellular coding sequences located adjacent to the vector integration site will be aberrantly expressed.

[0119] In some embodiments, a SIN design reduces the possibility of interference between the LTR and the promoter that is driving the expression of the transgene. SIN LV s can often permit full activity of the internal promoter. In some embodiments, the SIN design increases the biosafety of the LVs. In some embodiments, the majority of the HIV LTR is comprised of the U3 sequences. The U3 region contains the enhancer and promoter elements that modulate basal and induced expression of the HIV genome in infected cells and in response to cell activation. Several of these promoter elements are essential for viral replication. Some of the enhancer elements are highly conserved among viral isolates and have been implicated as critical virulence factors in viral pathogenesis. The enhancer elements may act to influence replication rates in the different cellular target of the virus.

[0120] A skilled artisan would appreciate that, since a viral transcription starts at the 3’ end of the U3 region of the 5' LTR, those sequences are not part of the viral mRNA and a copy thereof from the 3' LTR acts as template for the generation of both LTR's in the integrated provirus. If the 3’ copy of the U3 region is altered in a retroviral vector construct, the vector RNA is still produced from the intact 5' LTR in producer cells but cannot be regenerated in target cells. Transduction of such a vector results in the inactivation of both LTR's in the progeny virus. Thus, the retrovirus is self-inactivating (SIN) and those vectors are known as SIN transfer vectors.

[0121] In some embodiments, self-inactivation is achieved through the introduction of a deletion in the U3 region of the 3' LTR of the vector DNA, i.e., the DNA used to produce thevector RNA. During RT, this deletion is transferred to the 5' LTR of the pro viral DNA. Typically, it is desirable to eliminate enough of the U3 sequence to greatly diminish or abolish altogether the transcriptional activity of the LTR, thereby greatly diminishing or abolishing the production of full-length vector RNA in transduced cells. However, it is generally desirable to retain those elements of the LTR that are involved in polyadenylation of the viral RNA, a function typically spread out over U3 (or delta U3), R and U5. Accordingly, in certain embodiments, it is desirable to eliminate as many of the transcriptionally important motifs from the LTR as possible while sparing the polyadenylation determinants.

[0122] The SIN design is described in detail in the art. A skilled artisan would appreciate that there are limits to the extent of the deletion at the 3' LTR. First, the 5' end of the U3 region serves another essential function in vector transfer, being required for integration (terminal dinucleotide+att sequence). Thus, the terminal dinucleotide and the att sequence may represent the 5' boundary of the U3 sequences which can be deleted. In addition, some loosely defined regions may influence the activity of the downstream polyadenylation site in the R region. Excessive deletion of U3 sequence from the 3’LTR may decrease polyadenylation of vector transcripts with adverse consequences both on the titer of the vector in producer cells and the transgene expression in target cells.

[0123] In some embodiments, the lenti viral sequences removed from the LTRs are replaced with comparable sequences from a non-lentiviral retrovirus, thereby forming hybrid LTRs. In particular, the lentiviral R region within the LTR can be replaced in whole or in part by the R region from a non-lentiviral retrovirus. In certain embodiments, the lentiviral TAR sequence, a sequence which interacts with TAT protein to enhance viral replication, is removed, preferably in whole, from the R region. The TAR sequence is then replaced with a comparable portion of the R region from a non-lentiviral retrovirus, thereby forming a hybrid R region. The LTRs can be further modified to remove and / or replace with non-lentiviral sequences all or a portion of the lentiviral U3 and U5 regions.

[0124] In some embodiments, the SIN configuration provides a retroviral LTR comprising a hybrid lentiviral R region that lacks all or a portion of its TAR sequence, thereby eliminating any possible activation by TAT, wherein the TAR sequence or portion thereof is replaced by a comparable portion of the R region from a non-lentiviral retrovirus, thereby forming a hybrid R region. In a particular embodiment, the retroviral LTR comprises a hybrid R region, wherein the hybrid R region comprises a portion of the HIV R region lacking the TAR sequence, and a portion of the MoMSV R region comparable to the TAR sequence lacking from the HIV R region.

[0125] Suitable lentiviruses from which the R region can be derived include, for example, HIV (HIV-1 and HIV-2), EIV, SIV and FIV. Suitable retroviruses from which non-lentiviral sequences can be derived include, for example, MoMSV, MoMLV, Friend, MSCV, RSV and Spumaviruses. In one illustrative embodiment, the lentivirus is HIV and the non-lentiviral retrovirus is MoMSV.

[0126] In some embodiments, the LTR comprising a hybrid R region is a left (5’) LTR and further comprises a promoter sequence upstream from the hybrid R region. Preferred promoters are non-lentiviral in origin and include, for example, the U3 region from a non-lentiviral retrovirus (e.g., the MoMSV U3 region). In some embodiments, the left (5') LTR further comprises a lenti viral U5 region downstream from the hybrid R region. In one embodiment, the U5 region is the HIV U5 region including the HIV att site necessary for genomic integration.

[0127] In some embodiments, the LTR comprising a hybrid R region is a right (3') LTR and further comprises a modified (e.g., truncated) lentiviral U3 region upstream from the hybrid R region. The modified lentiviral U3 region can include the att sequence, but lack any sequences having promoter activity, thereby causing the vector to be SIN in that viral transcription cannot go beyond the first round of replication following chromosomal integration. In a particular embodiment, the modified lentiviral U3 region upstream from the hybrid R region consists of the 3’ end of a lentiviral (e.g., HIV) U3 region up to and including the lentiviral U3 att site.

[0128] In some embodiments, the right (3') LTR further comprises a polyadenylation sequence downstream from the hybrid R region.

[0129] In the case of HIV based LV, it has been discovered that such vectors tolerate significant U3 deletions, including the removal of the LTR TATA box, without significant reductions in vector titers. These deletions render the LTR region substantially transcriptionally inactive in that the transcriptional ability of the LTR in reduced to about 90% or lower.

[0130] In some embodiments, the trans-acting function of Tat becomes dispensable if part of the upstream LTR in the transfer vector construct is replaced by constitutively active promoter sequences. In some embodiments, the expression of rev in trans allows the production of high- titer HIV-derived vector stocks from a packaging construct which contains only gag and pol. This design makes the expression of the packaging functions conditional on complementation available only in producer cells. The resulting gene delivery system, conserves only three of the nine genes of HIV-1 and relies on four separate transcriptional units for the production of transducing particles.

[0131] In some embodiments, the cassette expressing an SH2D1A nucleic acid is placed in thepCCL LV backbone, which is a SIN vector with the CMV enhancer / promoter substituted in the 5’ LTR. It will be recognized that the CMV promoter typically provides a high level of nontissue specific expression. Other promoters with similar constitutive activity include, but are not limited to the RSV promoter, and the SV40 promoter. Mammalian promoters such as the beta-actin promoter, ubiquitin C promoter, elongation factor lapromoter, tubulin promoter, etc., may also be used.

[0132] The foregoing SIN configurations are illustrative and non-limiting. Numerous SIN configurations are known to those of skill in the art. As indicated, in certain embodiments, the LTR transcription is reduced by about 95% to about 99%. In certain embodiments LTR may be rendered at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95% at least about 96%, at least about 97%, at least about 98%, or at least about 99% transcriptionally inactive.

[0133] In some embodiments, to further enhance biosafety, insulators are inserted into the lentiviral vectors described herein. Insulators are DNA sequence elements present throughout the genome. They bind proteins that modify chromatin and alter regional gene expression. The placement of insulators in the vectors described herein offer various potential benefits including, shielding of the vector from positional effect variegation of expression by flanking chromosomes, and shielding flanking chromosomes from insertional trans-activation of gene expression by the vector. Thus, insulators can help to preserve the independent function of genes or transcription units embedded in a genome or genetic context in which their expression may otherwise be influenced by regulatory signals within the genome or genetic context

[0134] In the present context insulators may contribute to protecting lentivirus-expressed sequences from integration site effects, which may be mediated by cis-acting elements present in genomic DNA and lead to deregulated expression of transferred sequences. In various embodiments LVs are provided in which an insulator sequence is inserted into one or both LTRs or elsewhere in the region of the vector that integrates into the cellular genome.

[0135] In some embodiments, the chromatin insulator is located within the chicken P-globin locus control region. This element, which contains a DNase-I hypersensitive site-4 (cHS4), appears to constitute the 5' boundary of the chicken P-globin locus. A 1.2-kb fragment containing the cHS4 element displays classic insulator activities, including the ability to block the interaction of globin gene promoters and enhancers in cell lines, and the ability to protect expression cassettes in Drosophila (Id.), transformed cell lines, and transgenic mammals from position effects. Much of this activity is contained in a 250-bp fragment. Within this stretch is a 49-bp cHS4 core that interacts with the zinc finger DNA binding protein CTCF implicated inenhancer-blocking assays.

[0136] In some embodiments, a suitable insulator is FB (FIPBEAD-A), a 77 bp insulator element, that contains the minimal CTCF binding site enhancer-blocking components of the chicken |3-globin 5' HS4 insulators and a homologous region from the human T-cell receptor alpha / delta blocking element alpha / delta I (BEAD-I) insulator. The FB “synthetic” insulator has full enhancer blocking activity. This insulator is illustrative and non-limiting. Other suitable insulators may be used including, for example, the full-length chicken beta-globin HS4 or insulator sub-fragments thereof, the ankyrin gene insulator, and other synthetic insulator elements.

[0137] In some embodiments, the vectors described herein further comprise a packaging signal. A "packaging signal," "packaging sequence," or "psi sequence" is any nucleic acid sequence sufficient to direct packaging of a nucleic acid whose sequence comprises the packaging signal into a retroviral particle. The term includes naturally occurring packaging sequences and also engineered variants thereof. Packaging signals of a number of different retroviruses, including lentiviruses, are known in the art, and any of them can be used in the viral vectors described herein. In some embodiments, the packaging signal comprises a sequence as set forth in SEQ ID NO.: 59.

[0138] In some embodiments, the lentiviral vectors described herein comprise a Rev response element (RRE) to enhance nuclear export of unspliced RNA. RREs are well known to those of skill in the art. Illustrative RREs include, but are not limited to RREs such as that located at positions 7622-8459 in the HIV NL4-3 genome (Genbank accession number AF003887) as well as RREs from other strains of HIV or other retroviruses. Such sequences are readily available from Genbank or from the database with URL hiv-web.lanl.gov / content / index. In some embodiments, the RRE comprises a sequence as set forth in SEQ ID NO: 60.

[0139] In some embodiments, the lentiviral vectors described herein further include a central polypurine tract. Insertion of a fragment containing the central polypurine tract (cPPT) in lentiviral (e.g., HIV-1) vector constructs is known to enhance transduction efficiency drastically, reportedly by facilitating the nuclear import of viral cDNA through a central DNA flap.

[0140] In some embodiments, the lentiviral vectors (LVs) described herein may comprise any of a variety of posttranscriptional regulatory elements (PREs) whose presence within a transcript increases expression of the heterologous nucleic acid at the protein level. PREs may be particularly useful in certain embodiments, especially those that involve lentiviral constructs with modest promoters. In some embodiments, the PRE is an intron positioned within theexpression cassette, which can stimulate gene expression. However, introns can be spliced out during the life cycle events of a lentivirus. Hence, if introns are used as PRE's they are typically placed in an opposite orientation to the vector genomic transcript.

[0141] Posttranscriptional regulatory elements that do not rely on splicing events offer the advantage of not being removed during the viral life cycle. Some examples are the posttranscriptional processing element of herpes simplex virus, the posttranscriptional regulatory element of the hepatitis B virus (HPRE) and the woodchuck hepatitis virus (WPRE). The WPRE is typically preferred as it contains an additional cis-acting element not found in the HPRE. This regulatory element is typically positioned within the vector so as to be included in the RNA transcript of the transgene, but outside of stop codon of the transgene translational unit.

[0142] WPRE is an RNA export element that mediates efficient transport of RNA from the nucleus to the cytoplasm. It enhances the expression of transgenes by insertion of a cis-acting nucleic acid sequence, such that the element and the transgene are contained within a single transcript. Presence of the WPRE in the sense orientation was shown to increase transgene expression by up to 7- to 10-fold. Retroviral vectors transfer sequences in the form of cDNAs instead of complete intron-containing genes as introns are generally spliced out during the sequence of events leading to the formation of the retroviral particle. Introns mediate the interaction of primary transcripts with the splicing machinery. Because the processing of RNAs by the splicing machinery facilitates their cytoplasmic export, due to a coupling between the splicing and transport machineries, cDNAs are often inefficiently expressed. Thus, the inclusion of the WPRE in a vector results in enhanced expression of transgenes. In some embodiments, the WPRE comprises a nucleotide sequence as set forth in SEQ ID NO.: 63.

[0143] In some embodiments, the lentiviral vector disclosed herein comprises a nucleotide as set forth in SEQ ID NO.: 62. In some embodiments, the lentiviral vector disclosed herein consists of a nucleotide as set forth in SEQ ID NO.: 62. In some embodiments, the lentiviral vector disclosed herein comprises a sequence comprising at least 70%, 80%, or 90% identity to nucleotide as set forth in SEQ ID NO.: 62.

[0144] In some embodiments, the lentiviral vector disclosed herein comprises a nucleotide as set forth in SEQ ID NO.: 63. In some embodiments, the lentiviral vector disclosed herein consists of a nucleotide as set forth in SEQ ID NO.: 63. In some embodiments, the lentiviral vector disclosed herein comprises a sequence comprising at least 70%, 80%, or 90% identity to nucleotide as set forth in SEQ ID NO.: 63.Host Cells

[0145] In some embodiments, disclosed herein is a host cell comprising an isolated polynucleotide comprising(a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1 A enhancer region;(b) an SH2D1A promoter; and(c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0146] In some embodiments, disclosed herein is a host cell infected with a virus comprising an isolated polynucleotide comprising(a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1A enhancer region;(b) an SH2D1A promoter; and(c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0147] The viral vectors described herein are capable of transferring a heterologous SH2D1A nucleic acid encoding SLAM-associated protein (SAP) protein sequence into a mammalian cell. In various embodiments, for delivery to cells, vectors described herein are preferably used in conjunction with a suitable packaging cell line or co-transfected into cells in vitro along with other vector plasmids containing the necessary retroviral genes to form replication incompetent virions capable of packaging the vectors of the present invention and infecting cells.

[0148] In some embodiments, the vectors are introduced via transfection into the packaging cell line. The packaging cell line produces viral particles that contain the vector genome. Methods for transfection are well known by those of skill in the art. After cotransfection of the packaging vectors and the transfer vector to the packaging cell line, the recombinant virus is recovered from the culture media and titered by standard methods used by those of skill in the art. Thus, the packaging constructs can be introduced into human cell lines by calcium phosphate transfection, lipofection or electroporation, generally together with or without a dominant selectable marker, such as neomycin, DHFR, Glutamine synthetase, followed by selection in the presence of the appropriate drug and isolation of clones. In certain embodiments the selectable marker gene can be linked physically to the packaging genes in the construct.

[0149] Stable cell lines wherein the packaging functions are configured to be expressed by a suitable packaging cell are known. In general, for the production of virus particles, one may employ any cell that is compatible with the expression of lend viral Gag and Pol genes, or any cell that can be engineered to support such expression. For example, producer cells such as 293T cells and HT1080 cells may be used.

[0150] The packaging cells with a lentiviral vector incorporated therein form producer cells. Producer cells are thus cells or cell-lines that can produce or release packaged infectious viral particles carrying SH2D1 A. These cells can further be anchorage dependent which means that these cells will grow, survive, or maintain function optimally when attached to a surface such as glass or plastic. Some examples of anchorage dependent cell lines used as lentiviral vector packaging cell lines when the vector is replication competent are HeLa or 293 cells and PERC.6 cells.

[0151] Accordingly, in certain embodiments, methods are provided of delivering a gene to a cell which is then integrated into the genome of the cell, comprising contacting the cell with a virion containing a lentiviral vector described herein. The cell, which can be in the form of tissue or an organ can be contacted or infected with the virion ex vivo and then delivered to a subject in which the SAP protein will be expressed.

[0152] In some embodiments the cell can be autologous to the subject or it can be non- autologous to the subject. Moreover, because the vectors described herein are capable of being delivered to both dividing and non-dividing cells, the cells can be from a wide variety including, for example, bone marrow cells, mesenchymal stem cells, and other primary cells derived from human and animal sources. Alternatively, the virion can be directly administered in vivo to a subject or a localized area of a subject, as the bone marrow.

[0153] In some embodiments, the cells are human hematopoietic progenitor cells or a hematopoietic stem cells. In some embodiments, the cells are obtained from the bone marrow, the peripheral blood or the umbilical cord blood. In some embodiments, the cells are CD4+ T cells, NK cells, or NKT cells. In certain embodiments particularly preferred targets are CD34+ hematopoietic stem and progenitor cells.Methods of treatment

[0154] Disclosed herein are methods of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising:(a) obtaining a stem cell or progenitor cell;(b) transfecting the cell of (a) with a polynucleotide; and(c) transplanting the cell of (b) into said subject;wherein said polynucleotide comprises an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1A enhancer region; an SH2D1A promoter; and a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0155] Disclosed herein are methods of treating XLP1 in a subject, said method comprising:(a) obtaining a stem cell or progenitor cell;(b) transfecting the cell of (a) with a viral vector comprising a polynucleotide; and(c) transplanting the cell of (b) into said subject; wherein said polynucleotide comprises an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1A enhancer region; an SH2D1A promoter; and a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0156] Disclosed herein are methods of treating XLP1 in a subject, said method comprising providing to said subject a cell comprising a polynucleotide; said polynucleotide comprises an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1 A enhancer region; an SH2D1 A promoter; and a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

[0157] In some embodiments, the methods of treatment comprise contacting a population of human cells that include hematopoietic stem cells with one of the foregoing lentivectors under conditions to effect the transduction of a human hematopoietic progenitor cell in said population by the vector. The stem cells may be transduced in vivo or in vitro, depending on the ultimate application. Even in the context of human gene therapy, such as gene therapy of human stem cells, one may transduce the stem cell in vivo or, alternatively, transduce in vitro followed by infusion of the transduced stem cell into a human subject. In one aspect of this embodiment, the human stem cell can be removed from a human, e.g., a human patient, using methods well known to those of skill in the art and transduced as noted above. The transduced stem cells are then reintroduced into the same or a different human.

[0158] In some embodiments the lentivectors described herein are useful for the transduction of human hematopoietic progenitor cells or hematopoietic stem cells (HSCs), obtained either from the bone marrow, the peripheral blood or the umbilical cord blood, as well as in thetransduction of a CD4+ T cell, a peripheral blood B or T lymphocyte cell, and the like. In certain embodiments particularly preferred targets are CD34+ hematopoietic stem and progenitor cells.

[0159] When cells, for instance CD34+ cells, dendritic cells, peripheral blood cells or tumor cells are transduced ex vivo, the vector particles are incubated with the cells using a dose generally in the order of between 1 to 50 multiplicities of infection (MOI) which also corresponds to 1 x 10sto 50 x 105transducing units of the viral vector per 10scells. This can include amounts of vector corresponding to 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI. Typically, the amount of vector may be expressed in terms of HT-29 transducing units (TU).

[0160] In certain embodiments cell-based therapies involve providing stem cells and / or hematopoietic precursors, transduce the cells with the lentivirus encoding SLAM-associated protein (SAP) and then introduce the transformed cells into a subject suffering from X-linked lymphoproliferative disease (XLP1).

[0161] In certain embodiments the methods involve isolating population of cells, e.g., stem cells from a subject, optionally expand the cells in tissue culture, and administer the lentiviral vector whose presence within a cell results in production of SLAM-associated protein (SAP) in the cells in vitro. The cells are then returned to the subject, where, for example, they may provide a population of red blood cells, or of leukocytes, which produce the SLAM-associated protein (SAP).

[0162] In some embodiments, a population of cells, which may be cells from a cell line or from an individual other than the subject, can be used. Methods of isolating stem cells, immune system cells, etc., from a subject and returning them to the subject are well known in the art. Such methods are used, e.g., for bone marrow transplant, peripheral blood stem cell transplant, etc., in patients undergoing chemotherapy.

[0163] Where stem cells are to be used, it will be recognized that such cells can be derived from a number of sources including bone marrow (BM), cord blood (CB), mobilized peripheral blood stem cells (mPBSC), and the like. In certain embodiments the use of induced pluripotent stem cells (IPSCs) is contemplated. Methods of isolating hematopoietic stem cells (HSCs), transducing such cells and introducing them into a mammalian subject are well known to those of skill in the art.

[0164] In certain embodiments a lentiviral vector described herein is used in stem cell gene therapy for XLP1 by introducing the SH2D1A nucleic acid into the bone marrow stem cells of patients with XLD1 followed by autologous transplantation.

[0165] In certain embodiments direct treatment of a subject by direct introduction of the vector(s) described herein is contemplated. The lentiviral compositions may be formulated for delivery by any available route including, but not limited to parenteral, intravenous, intradermal, subcutaneous, oral, inhalation, transdermal, topical, transmucosal, rectal, and vaginal.

[0166] In various embodiments pharmaceutical compositions can include an LV in combination with a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0167] In some embodiments, active agents, i.e., a lentiviral described herein and / or other agents to be administered together the vector, are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such compositions will be apparent to those skilled in the art. Liposomes can also be used as pharmaceutically acceptable carriers.

[0168] In some embodiments the composition is targeted to particular cell types or to cells that are infected by a virus. For example, compositions can be targeted using monoclonal antibodies to cell surface markers, e.g., endogenous markers or viral antigens expressed on the surface of infected cells.

[0169] It is advantageous to formulate compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit comprising a predetermined quantity of a LV calculated to produce the desired therapeutic effect in association with a pharmaceutical carrier.

[0170] A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Unit dose of the LV described herein may conveniently be described in terms of transducing units (T.U.) of lentivector, as defined by titering the vector on a cell line such as HeLa or 293. In certain embodiments unit doses can range from 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013 T.U. and higher.

[0171] Pharmaceutical compositions can be administered at various intervals and overdifferent periods of time as required, e.g., one time per week for between about 1 to about 10 weeks; between about 2 to about 8 weeks; between about 3 to about 7 weeks; about 4 weeks; about 5 weeks; about 6 weeks, etc. It may be necessary to administer the therapeutic composition on an indefinite basis. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Treatment of a subject with a LV can include a single treatment or, in many cases, can include a series of treatments.

[0172] Illustrative, but non-limiting, doses for administration of gene therapy vectors and methods for determining suitable doses are known in the art. It is furthermore understood that appropriate doses of a LV may depend upon the particular recipient and the mode of administration. The appropriate dose level for any particular subject may depend upon a variety of factors including the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate: of excretion, other administered therapeutic agents, and the like.

[0173] In certain embodiments lentiviral gene therapy vectors described herein can be delivered to a subject by, for example, intravenous injection, local administration, or by stereotactic injection. In certain embodiments vectors may be delivered orally or inhalationally and may be encapsulated or otherwise manipulated to protect them from degradation, enhance uptake into tissues or cells, etc. Pharmaceutical preparations can include a LV in an acceptable diluent, or can comprise a slow release matrix in which a LV is imbedded. Alternatively or additionally, where a vector can be produced intact from recombinant cells, as is the case for retroviral or lentiviral vectors as described herein, a pharmaceutical preparation can include one or more cells which produce vectors. Pharmaceutical compositions comprising a LV described herein can be included in a container, pack, or dispenser, optionally together with instructions for administration.Method for identifying control elements

[0174] In some embodiments, disclosed herein is a method of identifying control elements for regulated expression of a gene from a lentiviral vector, said method comprising:(a) identifying putative enhancers for a target gene from one or more enhancer databases;(b) for each putative enhancer element, providing a lentiviral construct (LV) comprising each enhancer element upstream from an endogenous promoter of said target gene where said promoter drives expression of a reporter gene and where a DNA barcode is downstream of said reporter gene where each barcode is unique to each enhancer element;(c) transducing on- target cell populations and off-target cell populations with the barcoded LVs;(d) determining the relative enhancer activity of each putative enhancer and selecting the enhancers that provide normal or elevated on-target expression of said reporter gene.

[0175] In some embodiments, the method further comprises determining the relative enhancer activity of each putative enhancer and selecting the enhancers that provide reduced or no off- target expression of said reporter gene.

[0176] In some embodiments, the enhancer database comprises one or more databases selected from the group consisting of ENCODE, VISTA, FANTOM, and Ensembl.

[0177] In some embodiments, the barcode is read by DNA sequencing.

[0178] As used herein, the term "pattern of expression" refers to the pattern of cells in which a gene is upregulated or downregulated. The term "Recombinant" is used consistently with its usage in the art to refer to a nucleic acid sequence that comprises portions that do not naturally occur together as part of a single sequence or that have been rearranged relative to a naturally occurring sequence. A recombinant nucleic acid is created by a process that involves the hand of man and / or is generated from a nucleic acid that was created by hand of man (e.g., by one or more cycles of replication, amplification, transcription, etc.). A recombinant virus is one that comprises a recombinant nucleic acid. A recombinant cell is one that comprises a recombinant nucleic acid.

[0179] As used herein, the term "recombinant lentiviral vector" or "recombinant LV” refers to an artificially created polynucleotide vector assembled from an LV and a plurality of additional segments as a result of human intervention and manipulation.

[0180] The term "an effective amount" is meant the amount of a required agent or composition comprising the agent to ameliorate or eliminate symptoms of a disease relative to an untreated patient. The effective amount of the composition(s) used to practice the methods described herein for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.

[0181] The term “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. As used herein, the terms “heterologous promoter” and “heterologous control regions” refer to promoters and other control regions that are notnormally associated with a particular nucleic acid in nature. For example, a “transcriptional control region heterologous to a coding region” is a transcriptional control region that is not normally associated with the coding region in nature.

[0182] The term "sequence identity" refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. "Identity" can be readily calculated by methods known in the art. An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is typically represented as the identity fraction multiplied by 100. As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) as compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison).

[0183] The foregoing compositions, methods and uses are intended to be illustrative and not limiting. Using the teachings provided herein other variations on the compositions, methods and uses will be readily available to one of skill in the art.Sequences

[0184] Table 1 summarizes the amino acid and nucleotide sequences referenced throughout the present disclosure.

[0185] Table 1 - Sequences (H: Human; A: Artificial; D: DNA; P: Protein)EXAMPLES

[0186] The following examples are offered to illustrate, but not to limit the claimed invention.EXAMPLE 1 - Methods

[0187] Elucidation of putative enhancer elements: Genomic regions containing putative regulatory elements of the SH2D1A gene were compiled using data from ENCODE, Ensembl, FANTOM, and VISTA. Functional boundaries of the putative enhancer elements were defined using lineage-specific DNase I accessibility, transcription factor binding, epigenetic histone modification, and vertebrate sequence conservation. Primers were then designed to amplify these putative enhancer regions from human genomic DNA for downstream cloning into plasmid lentiviral transgene cassettes.

[0188] Vector Packaging and Titration: Lentiviruses were packaged by transient transfection of PKR - / - 293T cells with fixed amounts of HIV Gag / Pol, Rev, and VSV-G envelope expression plasmids and equimolar amounts of transfer plasmid using TransIT-293 (Mirus Bio; Madison, WI) as described in Cooper et al. Viral supernatants were then directly used for titer determination or concentrated by tangential flow filtration. To titer the lentivirus, 1x10sHT- 29 cells per sample were plated in 2mL of culture medium in 6-well plates (#3516; Coming Inc.; Coming, NY). 24 hours after plating, cells were transduced with a 1 :10 dilution of viral supernatant in ImL of culture medium. 24 hours after transduction, culture medium was refreshed on all wells. 72 hours after transduction, cells were harvested to determine VCNs by ddPCR. Vector titer (TU / mL) was calculated as TU=VCN x (cell count at day of transduction) x vims dilution. Cell counts were measured with a Vi-CELL XR automated cell counter (Beckman Coulter; Brea, CA).

[0189] Lentiviral Vector Transduction: Primary human T, NK, and NKT cells (5 x 104per sample) isolated from peripheral blood mononuclear cells were plated on retronectin (20 ug / ml) (Takara Bio Inc.; Kusatsu, Shiga, Japan)-coated plates with XVIVO15 medium (Lonza Biosciences; Basel, Switzerland) supplemented with Img / mL poloxamer synperonic F108 (Kolliphor P338; BASF Pharma; Ludwigshafen, Germany) for 24 hours during lentiviral transduction. Cell counts were measured with a Vi-CELL XR automated cell counter. For transduction of CD34+ cells, cells were prestimulated with 50 ng / mL each of human stem cell factor (hSCF), human thrombopoietin (hTPO), and human FMS-like tyrosine kinase 3 ligand(hFlt3-L) (Peprotech; Rocky Hill, NJ) for 24 hours before lentiviral transduction. During LV transduction of CD34+ cells, lOuM prostaglandin E2 (PGE2) was also added for 24 hours. LV supernatant (raw or concentrated) was added to the culture medium for 24 hours at various concentrations to achieve the necessary VCN.

[0190] Droplet Digital PCRfor VCN and Titer (TU / mL) Quantification: Genomic DNA from transduced cells was extracted using PureLink Genomic DNA Mini Kit (KI 82002; Invitrogen, Waltham, MA). VCN was calculated by using the vector HIV-1 PSI gene primers (oPAF-PSI, oPAR-PSI, SEQ ID NOs.: 68 and 69) and probes (oPAP-PSI, SEQ ID NO.: 65) and an endogenous human diploid gene control (SCD4 (Human Syndecan 4) primers (oPAF-SDC4 and OPAR-SDC4, SEQ ID NOs.: 66 and 67) and probe (oPAP-SDC4, SEQ ID No.: 64) as a reference. Reaction mixtures of 22uL volume, comprising lx droplet digital (dd)PCR Master Mix (#1863010; Bio-Rad; Hercules, CA), 400 nmol / L primers and 100 nmol / L probe for each set, 40 U Dral (R0129S; New England Biolabs; Ipswich, MA) and 30- 100 g of the gDNA were prepared and incubated at 37°C for 1 hour. Droplet generation was performed as described in Hindson et al. with 20 uL of each reaction mixture. The droplet emulsion was then transferred with a multichannel pipet to a 96-well twin.tec® real-time PCR Plate (Eppendorf; Hamburg, Germany), heat sealed with foil, and amplified in a conventional thermal cycler (TWO Thermal Cycler; Bio-Rad; Hercules, CA). Thermal cycling conditions consisted of 95 °C 10 min (1 cycle), 94°C 30 s and 60°C 1 min (55 cycles), 98°C 10 min (1 cycle) and 12°C hold. After PCR, the 96-well plate was transferred to a droplet reader (Bio-Rad; Hercules, CA). Acquisition and analysis of the ddPCR data was performed with the QuantaSoft software (BioRad; Hercules, CA), provided with the droplet reader. Vector Titer (TU / mL) was calculated as TU=VCN x (cell count at day of transduction) x virus dilution.

[0191] NSG-Tg(hu-IL15) Xenografts: Transduced human cord blood (CB) CD34+ cells were washed and incubated with lug / lOOuL of OKT3 (Tonbo Biosciences; San Diego, CA) for 30 minutes at 4°C to prevent contaminating T cell-derived graft- versus-host disease. Immediately before transplant, 1- to 3-day-old neonatal NSG-Tg(hu-IL-15) mice (NQD.Cg- Prkdc'"dIl2rgtmlWjlTg(IL15)lSz / SzJ, Strain #030890, The Jackson Laboratory; Bar Harbor, ME) were irradiated at a dose of 150 rads with a Cesium- 137 source. Each mouse was injected intra- hepatically with 1 x 105to 5 x 105cells. 16 weeks post-transplant, mouse bone marrow, spleen, thymus, and peripheral blood were harvested into single cell suspensions for downstream flow cytometry analysis. The mice were maintained at UCLA under an approved protocol by the UCLA Animal Research Committee under the Division of Laboratory Medicine.

[0192] Plasmid Generation: All LVs were cloned into an empty pCCL backbone. Fragmentsof transcriptional regulatory elements were synthesized as gBlocks (Integrated DNA Technologies; Coralville, IA) or amplified from genomic DNA by polymerase chain reaction with compatible ends to be cloned using NEBuilder HiFi DNA Assembly Kit (New England Biolabs; Ipswich, MA). Enhancer elements were inserted upstream of a 600bp SH2D1A promoter to drive expression of the SLAM-associated protein or an mCitrine (mCit) reporter cassette. Furthermore, each vector contains the Woodchuck Hepatitis Virus post- transcriptional regulatory element (WPRE) in replacement of the endogenous SH2D1A 3’ UTR.

[0193] Cell Culture: CD34+ cells were cultured in X-VIV015 medium (Lonza Biosciences; Basel, Switzerland) supplemented with IX Penicillin-Streptomycin-Glutamine (P / S / G), with 50 ng / mL each of human stem cell factor (hSCF), human thrombopoietin (hTPO), and human FMS-like tyrosine kinase 3 ligand (hFlt3-L) for 24 hours before LV transduction. CD3+ T cells were isolated from peripheral blood mononuclear cells (PBMCs) through CD3+ positive magnetic selection (Miltenyi Biotec; Bergisch Gladbach, Germany). Isolated cells were then activated using anti-CD3 / CD28 Immunocult (StemCell Technologies; Vancouver, Canada) and cultured in X-V1VO15 medium (Lonza Biosciences; Basel, Switzerland), 5% human serum, and 100 U / mL of human recombinant IL-2. NKT cells were isolated from PBMCs through iNKT Va24+ positive magnetic selection (Miltenyi Biotec; Bergisch Gladbach, Germany). NKT cells were cultured in RPMI 1640, 1% Pen / Strep (P / S), 10% fetal bovine serum(FBS), 1% MEM non-essential amino acids, lOmM HEPES, ImM Sodium Pyruvate, and 50pM 2-mercaptoethanol. NKT cells were stimulated at a ratio of 1 :1 with autologous PBMCs loaded with 5ng / mL of a-GalCer (Cayman Chemical, Ann Arbor, Michigan; Catalog 158021- 47-7) and irradiated at 6000rpm. The cocultured cells were subsequently cultured with lOng / mL of IL- 15 and IL-7. NK cells were enriched from PBMCs using the CD56+ positive magnetic selection (Miltenyi Biotec; Bergisch Gladbach, Germany). Isolated NK cells were cultured in NK MACS medium (Miltenyi Biotech; Bergisch Gladbach, Germany) supplemented with 5% human AB serum, 1% P / S, lOng / mL hIL-15 and 500U / mL of hIL-2 at 5% CO2 and 37 °C humidified atmosphere.

[0194] Artificial Thymic Organoid (ATO) Generation: ATOs were generated from human mobilized peripheral blood (mPB) stem cells as previously described. Previously frozen MS5- hDLL4 cells were thawed and resuspended in serum free ATO culture medium (“RB27”) composed of RPMI 1640 (Corning, Manassas, VA), 4% B27 supplement (ThermoFisher Scientific; Grand Island, NY), 30 pM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma- Aldrich; St. Louis, MO) reconstituted in PBS, 1% penicillin / streptomycin(Gemini Bio-Products, West Sacramento, CA), and 2% Glutamax (ThermoFisher Scientific; Grand Island, NY). RB27 lasts 3 weeks at 4°C. MS5-hDLL4 cells and CD34+ mPB cells edited with XLP1 -SMART LVs or mock control were combined in Eppendorf tubes at a concentration of 150K MS5-hDLL4 and 5000 mPB per ATO to make 24 ATOs per group. Cells were centrifuged at 300 g for 5 min at 4°C in a swinging bucket centrifuge. Supernatants were carefully removed, and the cell pellet was resuspended in 5 pl RB27 per ATO and mixed by brief vortexing. ATOs were plated on 0.4 pm Millicell transwell inserts (EMD Millipore; Billerica, MA; Cat. PICM0RG50) in 6-well plates containing 1 ml complete RB27 (RB27 with the addition of 5 ng / ml rhFLT3L, 2.5 ng / ml rhIL-7, and 5ng / ml hSCF (Peprotech; Rocky Hill, NJ) per well. Two ATOs were plated per insert. Medium was changed completely every 3-4 days by aspiration from around the cell insert followed by replacement with 1 ml of fresh RB27 / cytokines. hSCF is only added for the first week of culture. ATOs are kept in an incubator at 37°C with 5% CO2. At weeks 3, 7, and 12, six ATOs (3 inserts) per group per timepoint were harvested by adding FACS buffer (PBS / 0.5% bovine serum albumin / 2mM EDTA) to each well and briefly disaggregating the ATO by pipetting, followed by passage through a 50 pm nylon cell strainer. Cells were stained in 96 well plates. At weeks 3 and 7, 200K cells per ATO were stained without fixation to determine mCitrine levels and T cell differentiation kinetics, and the remaining cells (no more than 2M cells per stained sample) were fixed and permeabilized to assess intracellular SAP expression and T cell differentiation. At week 12, half of the ATO cells were stained without fixation and half were stained with fixation (no more than 2M cells per stained sample).

[0195] Acquisition ofXLPl patient cells: XLP1 patient cells were acquired after patient and parental informed consent (UCLA IRB# 10-001399). Collection of BM CD34+ cells after bone marrow aspirate and acquisition of PBMCs from peripheral blood were procured under Institutional Review Board-approved protocol at the David Geffen School of Medicine at UCLA, protocol no. 10-001399. The XLP1 patient harbored a pathogenic missense mutation in exon 1 of the SH2D1A gene.

[0196] Colony Forming Unit ( CFU) Assay: 100, 300, and 900 BM CD34+ HSPCs per replicate were plated in MethoCult (Cat. # 04445, StemCell Technologies; Vancouver, Canada) 24 hours after LV transduction. After 14 days of culture at 5% CO2, 37°C and humidified atmosphere, the number of mature colonies were counted and scored under the microscope based on their specific morphology.

[0197] Generation ofSH2D!A knockout cell lines: To generate anXLPl model cell line, Jurkat T cells were modified to knockout SH2D1A by electroporation of SpCas9 recombinant protein(QB3 Macrolab, UC Berkeley; Berkeley, CA) complexed to sgRNA 5’AACAGGTTCTTGGAGTGCTG3’ (SEQ ID NO.: 73) (Synthego; Redwood City, CA) and FACS single-cell sorted and cultured in R20 (RPMI 1640 [Gibco; Grand Island, NY] / 20% FBS [Gibco; Grand Island, NY] / lx Penicillin / Streptomycin / Glutamine [PSG, Gemini Bio Products]). Primers for amplification of the SH2D1A locus were used to confirm knock-out (OPAF605: TCCTATGAATGCAATGACACCA (SEQ ID NO.: 72) and oPAR340: TGTGGCAATTTTCAGGAGTTCAC (SEQ ID NO.: 73) by Synthego ICE. Absence of SAP expression was confirmed by Western blot analysis. Cells were cultured in RIO at 37°C with 5% CO2.

[0198] Western Blot: For immunoblots, cells were lysed in RIPA Lysis and Extraction Buffer (Cat: 89901; ThermoFisher Scientific; Grand Island, NY) with added HALT protease inhibitor (Cat: 87786; ThermoFisher Scientific; Grand Island, NY) at a 1 x concentration following the manufacturer's protocols. Lysate concentrations were determined using the Pierce BCA protein assay (Cat: 23227; ThermoFisher Scientific, Grand Island, NY) following the manufacturer's protocol. Samples were treated for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with NuPAGE LDS Sample Buffer (Cat: NP0007; ThermoFisher Scientific; Grand Island, NY) and NuPAGE Sample Reducing Agent (Cat: NP0009; ThermoFisher Scientific; Grand Island, NY), each to a 1 x concentration. Lysates were diluted to contain equivalent amounts of total protein for immunoblot gel loading, using lysate from the SAP- deficient Jurkat cells to keep the total amount of protein loaded per lane constant to allow for valid loading controls. Wild-type Jurkat lysate was used as a control to indicate the relative expression levels of the SH2D1A codon optimized XLP1 lentiviral vectors. SAP levels were detected using Abnova monoclonal antibody, Clone 1C9 (Catalog H00004068-M01). Protein quantification was assessed through densitometry via the ImageJ software. SAP protein levels were normalized to the actin protein levels after quantification.

[0199] Flow Cytometry. Intracellular staining of SAP was performed using the eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (Invitrogen; Waltham, MA) using the manufacturer’s protocol. The primary antibody was rat anti-human SAP antibody, PE (Catalog# 12-9787-42, Invitrogen; Waltham, MA). To discern the various hematopoietic cell lineages, cell populations were gated as follows: NK Cell: CD56+,CD16-; NKT: CD3+, CD56+; iNKT: CD3+, TCR Va24+, CD56+; B Cell: CD19+, CD3-; T Cell: CD3+, CD19-, CD4+ / CD8+; Monocytes: CD33-, CD16-, CD14+. To discern the various T cell subpopulations and thymocyte populations in ATOs, we used the following monoclonal antibodies for staining: hCD45, hCD56, hCD34, hCD5, hCD7, hTCRab, hCD4, hCD8a,hCD8b, hCD3, hCD45RA, hCD45RO. To discern the various NK cell subpopulations, we used the following monoclonal antibodies for staining: hCD122, hCD16, hCD117, hCD45, hNKP80, hCD56, hCD34, hCD94, hCD57. Live / Dead dyes used for staining include DAPI and Zombie Fixable Viability Dye (BioLegend; San Diego, CA) for unfixed and fixed cells, respectively (Table 2)

[0200] Table 2: Human PBMC NK Dev. Flow

[0201] Next Generation Sequencing Library Preparation: 14 days after transduction, genomic DNA and mRNA were harvested from the primary T cells, primary NK cells, primary NKT cells, and the B-LCLs. For library preparation, an initial PCR was completed to amplify the barcodes using primers oPAF255 - XLP Barcode Amp for NGS and oPARl 19 - XLP Barcode Amp for NGS. A second PCR was completed to add Illumina adapters and indexes. Following Illumina barcoding, PCR products were pooled at equal concentrations, purified twice using AMPure XP beads (Beckman Coulter; Brea, CA), and then quantified by ddPCR (QX 200; Bio-Rad Laboratories Inc.; Hercules, CA). The high-throughput sequencing was performed at the UCLA Technology Center for Genomics & Bioinformatics (TCGB) using an Illumina MiSeq instrument 2 x 150 paired-end reads (Illumina; San Diego, CA).

[0202] Restimulation Induced Cell Death (RICD) RICD was assessed using an established protocol. LV modified or unmodified T cells were cultured for 10 days, before plating at 5xl04cells / well in a 96 well plate in 100 pl media. Dilutions of OKT3 antibody (Tonbo Biosciences; San Diego, CA) were prepared at 2000 ng / ml, 200 ng / ml, and 20 ng / ml, and 100 pl added to the cells to make final concentrations of 1000 ng / ml, 100 ng / ml and 10 ng / ml OKT3 in the wells. After 24h, a final concentration of lug / mL of Propodium Iodide (PI) was added before running a fixed volume of cell suspension from each well for flow cytometry. The number of live cells (PI-) in stimulated controls were compared to unstimulated controls to measure the % cell loss = [l-(# PI- restimulated cells / # PI- untreated cells)]xl00.

[0203] NK Differentiation: Untransduced or transduced healthy donor and XLP1 patient BM CD34+ cells were differentiated into CD56+ NK cells over 28 days of culture using the StemSpan™ NK Cell Generation Kit (Catalog # 09960, StemCell Technologies; Vancouver, Canada) following manufacturer’ s protocol. 1X104BM CD34+ cells were plated on non- tissue culture treated plates coated with StemSpan™ Lymphoid Differentiation Coating Material. Half-volume media changes were performed using StemSpan™ Lymphoid Progenitor Expansion Medium until day 14. The cells were then replated at IxlO5cells / mL in StemSpan™ NK Cell Differentiation Medium and cultured for another 14 days. On day 28, the cells were harvested and enriched using CD56+ positive magnetic selection (Miltenyi Biotec; Bergisch Gladbach, Germany). The differentiated NK cells were then assessed for cytotoxic capabilities in further assays.

[0204] NK Killing Assay: BM CD34+ cells differentiated into CD56+ NK cells were counted and resuspended in NK medium at 5xl04cells per 200uL and added to row B on a 96 well plate. IOOUL of NK medium was added to rows C through G. Six serial dilutions were performed of the resuspended NK cells using IOOuL multichannel pipette from rows B to G (from 2.5xl04cells per well to 800 cells per well). Target cells were either K562 cells expressing one copy of a GFP reporter cassette or Raji cells labeled with CellTrace™ CFSE (C34554; Invitrogen, Waltham, MA) resuspended in R10 (RPMI 1640, 10% FBS, 1% P / S / G) at IxlO4cells per IOOuL. IOOuL of the target cells were added to rows A through G to generate the following effector to target ratios - 2.5: 1, 1.25:1, 0.625:1, 1:3, 1:6, 1 :12.5. The plate was incubated for 18 hours at 5% CO2, 37°C. After incubation, GFP+ tumor cells were counted via FACS using a BD FACSCelesta™ Cell Analyzer (BD Biosciences; Franklin Lakes, NJ) and normalized to target only control wells (rows A and G) to normalize the killing percentage.

[0205] Monocyte Differentiation'. CB CD34+ HSCs were cultured in X-VIVO15 medium (Lonza Biosciences; Basel, Switzerland), 4% FBS (Gibco; Grand Island, NY), IX Pen / Strep / Glut (PSG, Gemini Bio Products), 50ng hSCF, 15ng / mL hTPO, 30ng / mL hIL3, and 30ng / mL hFlt3-L (all cytokines: Peprotech; Rocky Hill, NJ) for 9 days. After 9 days of culture,the CB CD34+ cells were differentiated in the following medium for 7 days: STEMSpan II (StemCell Technologies; Vancouver, Canada), 20% FBS (Gibco; Grand Island, NY), IX Pen / Strep / Glut (PSG, Gemini Bio Products), 25ng hSCF, 30ng / mL M-CSF, 30ng / mL hIL3, and 30ng / mL hFlt3-L (all cytokines: Peprotech; Rocky Hill, NJ). On day 16 of culture, cells were confirmed for NK differentiation and purity by flow cytometry using anti-CD14 and antiCD 16 antibodies.

[0206] T Cell Electroporation to Knock-Out SH2D1A: After isolation from PBMCs, CD3+ primary T cells were counted by hemocytometer via trypan blue exclusion prior to electroporation. 1 x 106cells per condition were centrifuged at 300xg for 10 min at RT, resuspended in 20uL of P3 electroporation buffer (Lonza Biosciences; Basel, Switzerland). lOOpmol of SpCas9 recombinant protein (QB3 Macrolab, UC Berkeley; Berkeley, CA) was combined with 120pmol of each sgRNA to SH2D1A (sgRNA4: 5’- GACGCAGTGGCTGTGTATCA-3’ (SEQ ID NO.: 74); sgRNA7: 5’- AACAGGTTCTTGGAGTGCTG-3’ (SEQ ID NO.: 75) both from Synthego; Redwood City CA) for 15 minutes at RT for RNP complex formation. The cell and RNP mixtures were combined and electroporated using the EH- 100 setting on the Amaxa 4D Nucleofector X Unit (Lonza Biosciences; Basel, Switzerland). Cells were rested in 16-well electroporation strips (Lonza Biosciences; Basel, Switzerland) for 10 min at RT and then recovered with 480uL of T cell medium. 24 hours after electroporation, SH2D1A knockout T cells were transduced with XLP-SMART LVs and used for an RICD assay 10 days post electroporation.

[0207] Statistical Analysis: All data are reported as mean ± SD unless otherwise stated. All statistical analyses were carried out using GraphPad Prism version 10.0.0 (GraphPad Software; San Diego, CA). The statistical significance between two averages was established using unpaired t tests. When the statistical significance between three or more averages was evaluated, a one-way ANOVA was applied, followed by multiple paired comparisons for normally distributed data (Tukey’s test). When the statistical significance between two or more categorical variables was evaluated, a two-way ANOVA was applied, followed by multiple paired comparisons for normally distributed data (Tukey’s test). Linear regression analyses were used to determine the correlation between titer and proviral size. All statistical tests were two-tailed and a p value of < 0.05 was deemed significant (ns non-significant, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Details of statistical tests used, including all p values, are indicated in the relevant figure legend.EXAMPLE 2 - Putative Elements for SH2D1A Expression

[0208] Objective', to elucidate the putative elements responsible for the lineage- and stagespecific expression of the endogenous SH2D1A locus.

[0209] Methods'. A bioinformatics-guided approach was employed utilizing GeneHancer, a bioinformatic tool that links over 285,000 candidate enhancer elements across the human genome to their respective target genes. GeneHancer integrates four genome-wide enhancer databases (ENCODE, Ensembl, FANTOM and VISTA), to generate a comprehensive list of putative regulatory elements for each gene. The potential regulatory elements were cloned into a series of lentiviral vectors (XLP1 -SMART LVs) to test each element’s enhancer capability independently (Figure 1). The elements were inserted upstream of a 600 bp SH2D1 A promoter, identified via the Eukaryotic Promoter Database (EPD), to drive expression of an mCitrine (mCit) reporter cassette. The mCitrine gene is a variant of eGFP, with increased fluorescent intensity over the traditional GFP fluorophore. Furthermore, each vector was designed with the Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) replacing the endogenous 3’ UTR of SH2D1 A to enhance expression of the transgene cassette. To multiplex the series of vectors, unique 20 bp barcodes were cloned directly upstream of the WPRE (Figure 1). At this location, the barcode remains within the transcript and vector provirus genome for identification and normalization by RNA or DNA, respectively, but it will not be translated to affect any protein function. The barcodes were designed, each with a Hamming Distance of 10, to tolerate accidental mutations. Each of the 34 vectors was cloned twice — each with its own unique barcode — to further assess any potential biases from transduction, recombination, or PCR amplification. A lentiviral vector used in pre-clinical XLP1 gene therapy studies, EFS-SAP, was cloned in duplicate as a control. The SH2D1A gene was replaced with an mCit reporter and termed EFS-mCit.

[0210] To mimic the endogenous expression of SAP, each lentiviral vector construct was tested for its ability to drive high-level expression in primary T cells, NKT cells, and NK cells, each isolated from healthy donor peripheral blood mononuclear cells (PBMCs). B-lymphoblastoid cell lines (B-LCLs) were utilized to assess off-target B lymphoid expression of each regulatory element. Each cell population was transduced with the 34 candidate vectors and the EFS control. 14 days post-transduction, cells were harvested to isolate their gDNA and mRNA fractions. Bulk vector copy number (VCN) of the transduced populations was assessed via droplet-digital (dd)PCR.

[0211] The barcode-containing DNA regions were PCR amplified from the gDNA fraction and assessed via next-generation sequencing. Furthermore, the barcode-containing regions were PCR amplified from the RNA fraction after cDNA conversion and assessed via next-generationsequencing. The RNA barcode counts are proportionate to the transcriptional activity of the enhancers within each lineage. The genomic (DNA) barcode count is used to normalize each barcode in the transcript to account for potential differences in transduction efficiency of the vectors. The number of RNA barcode reads normalized to frequency of gDNA barcodes within each cell type determined the relative expression directed by each element (Figure 1).

[0212] Results: 34 potential regulatory elements of SH2D1A were identified within a 200 kb window of the SH2D1A transcription start site. Each genomic coordinate was entered into the UCSC Genome Browser to examine the corresponding regulatory elements (Figure 1).

[0213] Of the 34 regulatory elements tested, elements 3 and 5R demonstrated T cell-specific enhancer expression (Figures 2A-2D).

[0214] Elements 3, 4, 5, 7, 20, and 5R demonstrated NK and NKT cell-specific enhancer expression (Figures 2A, 2E and 2F). All 34 regulatory elements tested demonstrated minimal to no off-target expression in B-LCLs (Figure 2 A, 2G).

[0215] Enhancers 3, 4, 5, 7, 20, and 5R were refined to decrease their size (thereby increasing the vector titers and gene transfer) with the goal of retaining high enhancer-driven function (Figure 3A-C). LV plasmids were designed with the refined enhancer fragments and the 600 bp SH2D1 A promoter driving expression of an mCit cassette. LV plasmids were packaged and titered head-to-head using methods previously described by our laboratory (Figure 3A). Primary T and NK cells were transduced with the refined LVs to achieve equivalent vector copy numbers (VCNs) ranging from -0.10 to 0.20 to increase the probability of each transduced cell containing a single integrant. The mean fluorescence intensity (MFI) of the mCit-i- populations were assessed via flow cytometry to compare the ability of each refined enhancer element to drive mCit expression in T cells (Figure 3B) and NK cells (Figure 3C). Enhancers E3M and 5RL retained 90% and 100% of the full-length enhancer activity in T cells, while reducing the enhancer sizes by 3.5 kb and 4 kb, respectively from the original elements (Figure 3B). Enhancers 3M, 3GP, 20R, and 5RL retained 120%, 110%, 130%, and 100% of the full-length enhancer activity in NK cells, while reducing the enhancer sizes by 3.5 kb. 4.2 kb, 1 kb, and 4 kb, respectively (Figure 3C). Enhancers 4, 5, and 7 and their shortened iterations did not significantly increase expression in T cells or NK cells when compared to the promoter only control (Pro) and were thus removed from subsequent analyses (Figures 3B and 3C). After refining the enhancers, the elements were combined to assess additive and / or synergistic effects on expression.EXAMPLE 3 - Expression of Cassettes Driven by Different Combinations of Enhancers

[0216] Objective'. To evaluate the combination of different enhancers and their capability to drive expression in different cell types.

[0217] Methods: Enhancer E3M was combined with either 20R, 5RL or both 20R and 5RL and a 600bp SH2D1 A promoter to drive expression of an mCit cassette (Figure 4A). Similarly, LV plasmids were packaged and tittered head-to-head using methods previously described in Example 1 (Figure 4B), which are briefly summarized herein. Primary T and NK cells were transduced for evaluating on-target expression (Figures 4C and 4D). Transduced cord blood (CB) CD34+ cells were differentiated into monocytes and along with B-LCLs, were used to determine off-target expression levels (Figures 4E and 4F).

[0218] Results'. Enhancers E3M / E3GP, 20R, and 5RL demonstrated additive expression levels when combined and evaluated in primary T and NK cells (Figures 4C and 4D). The combination vectors (XLP1 -SMART LVs) increased mCit expression in T cells up to 4-fold compared to the promoter only control and up to 1.8-fold greater than the control EFS vector (Figure 4C). Further, the combination vectors increased mCit expression in NK cells 2-fold greater than the promoter only control and 1.5-fold greater than the EFS preclinical vector (Figure 4D). XLP1-SMART LVs that included E3M showed minor levels of off-target expression, with the E3M combination XLP-SMART LV (E3M-20R-5RL-mCit) harboring a 1.25 or 1.67-fold increase in mCit expression levels in monocytes and B cells, respectively, over the promoter only control. However, the E3GP combination XLP-SMART LV (E3GP- 20R-5RL-mCit) showed no significant levels of off-target expression (Figures 4E and 4F).EXAMPLE 4 - Expression of Cassettes Driven by Different Combinations of Enhancers in vivo

[0219] Objective: To evaluate the combination of different enhancers and their capability to drive expression in different cell types in vivo.

[0220] Methods: To determine the lineage and stage-specific expression of the XLPLSMART LVs, the ability of each LV to drive mCit reporter expression in vivo in NSG-Tg(Hu-IL15) immunodeficient mice was tested. Healthy human donor CB CD34+ HSCs were pre-stimulated for 24 hours in 50 ng / mL of human hSCF, hTPO, and hFT3L before transduction with 2e7 TU / mL of our XLP-SMART LVs. The E3M-20R-5RL and E3GP-20R-5RL LVs were compared to both mock transduced cells and to CB CD34+ HSCs transduced with 2e7 TU / mL of the control EFS-mCit vector. The transduced cells were transplanted via intra-hepatic injection into sub-lethally irradiated NOD.Cg-Prkdcscid I12rgtmlWjl Tg (IL15)lSz / SzJ (NSG-Tg[HuIL15]) neonatal pups receiving 150 rads of irradiation. These NSG-Tg(HuIL15) mice express human IL- 15 to help enhance the development of human NK cells in mice engrafted with human CD34+ cells. Furthermore, the transplantation of NSG neonatal pups supports more efficient human T cell development after HSC injection than adult NSG mice.

[0221] Mice were sacrificed 16 weeks post-transplantation to assess engraftment and vector- mediated gene expression in multiple human hematopoietic cell lineages. Bone marrow, thymus, and spleen were processed into single cell suspensions and peripheral blood was collected.

[0222] Results: The vector copy number (VCN) was determined for the transplanted cells within the bone marrow of each mouse (Figure 5A) and the bone marrow engraftment (Figure 5B) of each mouse was quantified via the percent hCD45+ human cells via flow cytometry. Average VCNs for Promoter Only (Pro), EFS-mCit (EFS), E3M-20R-5RL-mCit (3M), and E3GP-20R-5RL-mCit (3GP) in the bone marrow compartment of NSG-Tg(Hu-IL15) mice were 2.17, 1.72, 0.81, and 1.57, respectively. With exception of one mouse that did not engraft in the E3GP-20R-5RL-mCit group, average human cell engraftment was 75% for all groups.

[0223] Lineage-specific expression of the XLP-SMART LVs was evaluated by analyzing the MFI of mCit-i- expression in different on-and off-target populations of hCD45+ cells. Mice transplanted with CB CD34+ HSCs transduced with the E3M-20R-5RL-mCit LV contained 7.1-fold, 2.8-fold, and 4.3-fold brighter mCit-i- expression than the EFS-mCit vector in T cells, NK cells, and NKT cells, respectively (Figure 5C). Mice transplanted with CB CD34+ HSCs transduced with the E3GP-20R-5RL-mCit LV contained 2.0-fold, 1.6-fold, and 2.0-fold brighter mCit-i- expression than the EFS-mCit vector in T cells, NK cells, and NKT cells, respectively (Figure 5C). Furthermore, mice transplanted with CB CD34+ HSCs transduced with E3M-20R-5RL-mCit or E3GP-20R-5RL-mCit LVs contained no off-target expression in myeloid cells or B cells in both the bone marrow and peripheral blood compartments, unlike the EFS-mCit counterpart (Figure 5D).

[0224] To evaluate the stage-specific expression of the XLP1-SMART LVs, the bone marrow, thymus, and spleen cell suspensions were stained with a NK cell or T cell differentiation antibody panel and evaluated their mCit-i- expression via flow cytometry (Figures 5E-5J). Mice transplanted with CB CD34+ HSCs transduced with the E3M-20R-5RL-mCit LV contained 1.7-fold to 3.7-fold brighter mCit-i- expression than the EFS-mCit vector in mature NK lineages (Stage 4a to Stage 6; Figure 5E). Mice transplanted with CB CD34+ HSCs transduced with the E3GP-20R-5RL-mCit LV contained 2.1-fold to 3.5-fold brighter mCit-i- expression than the EFS-mCit vector in mature NK lineages (Stage 4a to Stage 6; Figure 5E).Further, the mCit+ expression in mature NK lineages from mice treated with E3M-20R-5RL- mCit LV mirrors the natural SAP expression seen in mature NK lineages of a healthy donor's peripheral blood (Figure 6B and 6D).

[0225] The mice with the E3M-20R-5RL-mCit LV had 4.7-fold to 5.0-fold brighter mCit-i- expression than cells in mice receiving the EFS-mCit vector in mature T lineages (Figure 5F- 5J). The mice with the E3GP-20R-5RL-mCit LV had 2.0-fold to 4.4-fold brighter mCit-i- expression than cells in mice receiving the EFS-mCit vector in mature T lineages. (Figure 5F- 5J). In addition, the mCit-i- expression measured across mature T lineages in the thymus of mice with the E3M-20R-5RL-mCit LV mirrored the pattern of SAP expression across T development from a heathy donor thymus (Figure 6A and 6C).

[0226] To further test the stage specificity of the XLP1-SMART LVs, the Artificial Thymic Organoid (ATO) system was used, which fully recapitulates thymopoiesis from multiple stem cell sources. Human CD34+ mobilized peripheral blood (mPB) cells were transduced with E3M-20R-5RL-mCit LV, E3GP-20R-5RL-mCit LV, and EFS-mCit at equivalent vector copy number. Transduced mPB cells and a mock nontransduced control were combined with the MS5-hDLL4 stromal cell line which constitutively expresses human Notch delta-like ligand 4 (DLL4). Cell count and T cell differentiation kinetics were measured at weeks 3, 7, and 12 using flow cytometry, and the percentage of mCitrine expression was compared to endogenous SAP expression to assess the temporal specificity of the XLP1 -SMART LVs across multiple stages of T cell differentiation. Thymocytes from ATOs with XLP1 -SMART LVs expressed mCitrine at all stages of T cell development, consistent with the presence of SAP expression throughout T cell differentiation from uncommitted to mature thymocytes. (Figure 7A-7B).

[0227] To assess both the clonogenic potential of human hematopoietic progenitor cells after transduction with the LV and the functional restoration of the XLP 1 phenotype, the mCitrine open reading frame of the XLP 1 -SMART LVs was replaced with the coding region of human SH2D1A, codon optimized using the JCat codon optimization algorithm (Figures 8A-8B). Both JCat and GeneArt algorithms were tested, changing the codons of wildtype SH2D1 A with synonymous human codon changes to thus increase protein production. The algorithms differ based on their considerations of codons that assist in ribosome stalling, mRNA translation, mRNA stability and premature termination of translation. Both optimizations were tested in SH2D1A- / - Jurkat cells for their relative protein production via Western blotting, with JCat producing the most protein per vector copy number (Figures 8A-8B).

[0228] After determining the increased SH2D1A expression using a JCat codon optimization, in comparison to wildtype SH2D1A, codon optimized XLP1-SMART LV plasmids werepackaged and titered head-to-head using methods previously described. To measure the efficacy of XLP1-SMART LVs to produce SH2D1A protein, we conducted a dose response in the SH2D1A- / - Jurkat cells, transducing the cells with the JCat codon optimized XLP1- SMART LVs to achieve VCNs of 1, 3, and 5. At equal protein concentrations, XLP1-SMART LVs harboring the E3M enhancer demonstrated detectable levels of SH2D1 A protein at VCNs of 3 and 5, reaching approximately 23% and 34% wildtype SAP protein, respectively (Figures 8C-8D; Table 3). Furthermore, XLP1-SMART LVs harboring the E3GP enhancer demonstrated detectable levels of SH2D1 A protein at VCNs of 3 and 5, reaching approximately 10% and 31% wildtype SAP protein, respectively (Figure 8C-8D; Table 3).

[0229] Table 3 - Densitometry Western BlotEXAMPLE 5 - Assessment of XLP1-SMART LVs as a Gene Therapy Tool

[0230] Objective: To assess the viability of XLP1-SMART LVs as a gene therapy tool for XLP1 patients.

[0231] Methods: XLP1-SMART LVs were tested for their functional correction of XLP1 in patient cells. BM CD34+ were obtained from XLP1 patients after their informed consent (UCLA IRB# 10-001399). XLP1 patient CD34+ cells were pre- stimulated for 24 hours in 50 ng / mL of human hSCF, hTPO, and hFT3L before transduction with the XLP1-SMART LVs. Cells were transduced to achieve equivalent vector copy numbers of ~1.1 and -2.4 (EFS = 1.1 and 3.0; E3M = 0.9 and 1.7; E3GP = 1.2 and 2.52) (based on prior dose response testing of VCN produced by each LV across a range of concentrations). Transduced CD34+ cells were used to conduct a colony -forming unit (CFU) assay for progenitor cell clonogenic potential and were also differentiated to NK cells to assess XLP1 functional restoration via an NK cell cytotoxicity assay.

[0232] Transduced XLP1 patient cells were seeded in semi-solid methylcellulose medium and cultured for 14 days before quantifying vector effect on clonogenicity and generation ofhematopoietic progenitor colonies.

[0233] Results'. At a VCN of 1, XLP1 -SMART LVs demonstrated no changes to clonogenicity or hematopoietic lineage skewing in comparison to a healthy donor control (Figure 9A-9C). Similarly, patient cells transduced with the EFS-SAP vector, at a VCN of 1.1 , demonstrated no significant skewing (p<0.05) into the myeloid lineage when compared to a healthy donor control (Figures 9B-9C). At a VCN of 1.7, E3M-20R-5RL-SAP (3M-SAP) XLP1 -SMART LVs still demonstrated no changes to clonogenicity or hematopoietic lineage skewing in comparison to a healthy donor control (Figure 9D-9F). Conversely, patient cells transduced with the EFS-SAP vector at a VCN of 3.0 demonstrated significant skewing (p<0.05) into the myeloid lineage, with a 1.3-fold increase in granulocyte-macrophage (GM) colonies compared to a healthy donor control (Figures 9E-9F). At a VCN of 2.52, E3GP-20R-5RL-SAP (3GP- SAP) also demonstrated significant skewing into the myeloid lineage with a 1.15-fold increase in GM colonies compared to a healthy donor control (Figures 9E-9F).EXAMPLE 6 - Levels of Rescued SAP Expression in XLP1 Patients

[0234] Objective'. To measure levels of rescued SAP expression in XLP1 patient cells.

[0235] Methods'. SAP expression was compared after transduction by XLP1 -SMART LVs to wildtype SAP expression from healthy donor CD8+ T cells via flow cytometry (Figure 10A). Briefly, transduced XLP1 patient CD8+ T cells were fixed, permeabilized and stained for SAP protein using an anti-SAP monoclonal antibody to assess the rescue of SAP protein expression via flow cytometry. At a VCN of 1, XLP1-SMART LVs restored SAP expression in XLP1 patient CD8+ T cells to healthy donor levels (Figure 10A).

[0236] It has also been demonstrated that patients with XLP1 are resistant to apoptosis- mediated T-cell receptor (TCR) restimulation, as SAP expression is required for TCR-induced apoptosis. As such, XLP1 patient peripheral blood CD8+ T cells were transduced with XLP1- SMART LVs at equivalent vector copy numbers to assess functional restoration using a restimulation induced cell death (RICD) assay. 14 days post transduction, transduced patient CD8+ T cells were quantified for recovery of RICD by flow cytometry. Transduced XLP1 patient T cells with the EFS-SAP, E3M-SAP, and E3GP-SAP vectors restored T cell RICD activity to healthy donor levels at an equal vector copy number of 1 (Figure 10B).

[0237] Healthy donor human CD8+ cells were also transfected using the CR1SPR / Cas9 system to knockout the SH2D1 A gene. Knockout T cells were transduced with XLP1-SMART LVs to assess their RICD activity. The E3M-20R-5RL-SAP LV at a VCN of 2 restored RICD activity to healthy donor levels. Conversely, EFS-SAP and E3GP-20R-5RL-SAP LV transducedSH2D1A knockout T cells did not restore T cell RICD activity to healthy donor levels at an equivalent VCN of 2 (Figure 10C).

[0238] Transduced XLP1 patient BM CD34+ were also differentiated into NK cells and tested for functional recovery of NK cell cytotoxicity in a tumor killing assay with NK sensitive target cells that express SLAM family receptors (Raji) and those that do not (K562).

[0239] Results: MHC -independent killing was observed in K562 cells, with equal levels of killing of K562 by healthy donor and non-transduced / transduced XLP1 patient cells (VCN: EFS = 6, E3M = 0.9, and E3GP = 1 .2) (Figure 10D). In a parallel assay with SLAM expressing Raji cells, E3M-20R-5RL-SAP transduced XLP1 patient BM CD34+ cells restored NK cell cytotoxicity to near healthy donor levels (VCN: EFS = 1, E3M = 1.7, E3GP = 2.52) (Figure 10E). Conversely, E3GP-20R-5RL-SAP and EFS-SAP transduced XLP1 patient BM CD34+ cells did not fully restore NK cell cytotoxicity to healthy donor levels (Figure 10E).EXAMPLE 7 - Summary of Examples 1-6

[0240] Autologous hematopoietic stem cell gene therapy (GT) could provide a safe and effective curative treatment for XLP1 if methods can achieve precise, regulated SAP expression in the correct lineages, at therapeutic levels, at the right developmental stage. There are also far fewer risks with autologous GT that hamper allogeneic HSCT, such as GVHD and graft rejection. For the treatment of XLP1 , a gene therapy candidate that can restore appropriate SH2D1A gene expression after an autologous HSCT in the appropriate hematopoietic cell lineages is required since SAP expression is tightly regulated in T, NK, and NKT cells. There are various gene therapy efforts underway to target XLP1 including gene editing and viral vector mediated approaches. Recently, attempts to combat XLP1 through gene editing were reported, specifically through the use of TALEN, CRISPR-Cas9, and CRISPR-12a nucleases. The benefit of gene editing for XLP1 is the ability to use endogenous regulatory elements of the SH2D1A gene to ensure the tight control necessary for appropriate SAP expression. However, the delivery of these gene editing reagents utilizes an adeno-associated virus serotype 6 (AAV6)-based vector, which can cause issues with immunogenicity and toxicity in treated patients. Furthermore, the utilization of nucleases and the induction of double stranded breaks (DSBs) is a safety -profile concern, specifically due to off-target effects, chromosomal translocation, and chromothripsis. Even newer nuclease-based technologies that overcome these safety concerns such as base-editing and prime editing have disadvantages. Base-editing is restricted to single-nucleotide changes, so diseases like XLP1 with multiple mutations are ineligible for this treatment. Prime editing, although capable of inserting or deleting largerfragments of DNA without the need for DSBs, lacks the repair efficiency required to provide a therapeutic advantage. Consequently, the utilization of a lentiviral vector-based therapy for XLP1 is a promising alternative that may offer a stronger safety profile, so long as the designed lentiviral vector maintains the tight regulation of SH2D1A.

[0241] The use of lentiviral vector gene therapy to treat XLP1 has been attempted previously. However, this method utilized a ubiquitously active elongation factor 1 a short promoter to drive expression of the SAP protein (EFS-SAP). One concern with this approach lies in the non-physiological expression of SAP in all hematopoietic cell populations. Since SAP expression is tightly regulated within T, NK, and NKT cells, gene expression in off-target cell populations like myeloid and B cells may pose safety concerns, including improper signaling of factors associated with autoimmune diseases and an elevated apoptotic response to DNA damage. Previous researchers have demonstrated significant skewing induced by the EFS-SAP vector of hematopoietic potential in the bone marrow compartment via a colony forming unit (CFU) assay.

[0242] An analysis of the topologically associated domain of SH2D1A revealed 3 genomic elements responsible for the physiological expression pattern of the SH2D1A gene. Element 5R, located 3kb directly downstream of the SH2D1A promoter, was shown to be a T, NK, and NKT-specific enhancer, lacking activity in B cell and myeloid cell lineages. Chromatin immunoprecipitation sequencing (ChlP-seq) data from ENCODE revealed various lymphoid- associated transcription factor binding sites such as MEIS2, TALI, and SPI1 within element 5R. These transcription factors are known to regulate expression of NK cell-activating ligands, T cell decision fate, and homeostasis of lymphoid cells. Element 3, located 125 kb upstream of the SH2D1 A promoter, presented as a T, NK, and NKT-specific enhancer, lacking activity in B cell and myeloid cell lineages. ChlP-seq transcription factor analysis revealed various lymphoid- associated transcription factor binding sites within element 3, such as FOXA1, RUNX3, GATA2, and JUND. These transcription factors are important in T cell development, expression of T and NK cytotoxic lymphocytes, proliferation and maintenance of HSPCs, and modulation of expression of T cell differentiation and activation. Finally, element 20, located within intron 1 of the SH2D1A gene, presented as an NK and NKT-specific enhancer lacking activity in T cell, B cell, and myeloid cell lineages. ChlP-seq transcription factor analysis revealed various lymphoid- associated transcription factor binding sites within element 20, such as SPI1, GATA2, and BRD4. These transcription factors are known to regulate lymphocyte homeostasis and HSPC differentiation, proliferation, and maintenance. Taken together, these three enhancers can recapitulate the expression of SAP in all physiologically expressedlineages.

[0243] The therapeutic potential of an LV is greatly influenced by both gene transfer and expression. Enhancing gene transfer not only increases the percentage of transduced cells, but also results in more integrated LV copies within each cell, amplifying the overall cellular expression. Conversely, boosting expression directly results in a higher production of the therapeutic protein for every integrated copy. Enhancer E3M was reduced in size from 1.9 kb to 1 kb to generate the E3GP enhancer. These reductions in enhancer element lengths increased titer by 2-fold and gene transfer by 1 .5-fold. Such improvements in titer and gene transfer are of significant value for the clinical application of gene therapy because they substantially decrease the cost of vector production and reduce the volume of LV production lots needed for each patient’s treatment. With these modifications, there is a potential concern about the regulation and expression being compromised. However, even after these adjustments, over 90% of the intended MFI was maintained, and any unintended activity remained minimal. Further modifications to refine the enhancer elements and retain vector expression can be made.

[0244] Multiple enhancers were strung together within a single LV to measure the additive effects on mCitrine expression in on-target and off-target cells. While enhancer 3 demonstrated minimal off-target expression in B-LCLs and monocytes, when combined with enhancer 5RL alone or 5RL-20R, off-target expression was abrogated, most likely a result of repressor elements within the 5R enhancer region. This result was further confirmed by in vivo studies, in which the XLP1-SMART LVs contained no significant off-target expression when compared to the promoter only control in both the bone marrow and peripheral blood compartments.

[0245] Using reporter gene experiments in transduced human CB CD34+ cells that were then transplanted into NSG-Tg(Hu-IL15) neonates, it was observed that the XLP1-SMART LVs were predominantly expressed in mature human T, NK, and NKT lineages. Importantly, there was no detectable expression in the B- and myeloid-cell lineages. Furthermore, the E3GP-20R- 5RL XLP1-SMART LV exhibited lower levels of mCitrine expression in T, NK, and NKT cells compared to the E3M-20R-5RL XLP1 -SMART LV.

[0246] It was next assessed if the XLP1-SMART LVs will affect hematopoietic skewing. While the E3M-20R-5RL-SAP XLP-SMART LV demonstrated no lineage skewing at VCNs of 1 and 1.7, the EFS-SAP LVs illustrated significant HSC skewing into the myeloid lineage, further indicating the potential adverse effects of ectopic SAP expression within hematopoietic cells. The lineage skewing demonstrated in the CFU assay may be attributed to the increasedSAP expression within off-target lineages. The skewing into the myeloid lineage of the E3GP- 20R-5RL XLP-SMART LV may be attributed to the differences in enhancer sequences of enhancer 3. Alternatively, the lack of skewing in the E3M-20R-5RL-SAP XLP-SMART LV may be due to vector copy number differences between that sample and the EFS and E3GP counterparts (EFS = 3, E3M = 1.7, E3GP = 2.52).

[0247] The dysregulated immune response seen in XLP1 patients can be attributed to their reductions in T cell function and NK cell cytotoxicity. XLP-SMART LVs efficacy was first assessed in an alternative disease model: SH2D1 A -I- Jurkat cell lines. The dose response, ranging from a VCN of 1 to 5, demonstrated that at VCN of 3 and 5, the E3M and E3GP vectors reached -30% of wildtype SH2D1A protein levels. Future studies are required to determine if this decrease in SH2D1A protein expression will affect function and treatment outcomes. That said, it is possible that wildtype levels are not necessary to alleviate the XLP1 phenotype, as evidenced by the fact that female carriers of XLP are healthy.

[0248] The ability of XLP1 patient cells transduced with XLP-SMART LVs to restore T cell and NK cell function to healthy donor levels was then studied. E3M-20R-5RL-SAP (E3M) and EFS-SAP transduced XLP1 patient CD8+ T cells restored R1CD activity to HD levels at an average VCN of 1; in contrast, studies conducted in healthy donor samples - in which the SH2D1 A was knocked out with CRISPR / Cas9 technology - demonstrated larger discrepancies of RICD restoration between the EFS, E3M, and E3GP vectors at equal vector copy number (e.g. EFS and E3GP vectors were not capable of restoring RICD levels to healthy donor levels at a VCN of 2).

[0249] When assessing restoration of NK cytotoxic activity in XLP1 patient cells, the XLP1- SMART LVs demonstrated greater cytolytic activity than the EFS-SAP vector. This phenotype is likely due to the increased SAP expression in NK cells with the E3M / GP, 5RL, and E20R enhancers. The reduction of NK expression in the E3GP sample compared to E3M may be due to core transcription factor binding sites and epigenetic modifications that were removed in the interest of decreasing vector size for an increased titter and gene transfer. The lack of EFS-SAP vector NK cytolytic activity is potentially a result of reduced SAP expression within NK cells due to a lower VCN seen in the EFS transduced populations compared to the E3M and E3GP counterparts (VCNs were EFS=1.1, E3M =1.7, E3GP = 2.52). The limited access to more XLP1 patient CD34+ cells and PBMCs prevented repeated studies at equal vector copy numbers. Future in vivo studies utilizing the C57BL / 6 SH2D1A- / - mouse model will help elucidate the ability for XLP-SMART LVs to restore the humoral defects and the NKT developmental block seen in XLP1 patients.

[0250] The outcomes of this study have elucidated a streamlined approach for the identification and incorporation of key elements into a vector cassette that can properly regulate a target gene (SMART LVs). This offers a novel, effective, and efficient approach for enhanced expression and regulation of transgenes required to correct various inborn errors of immunity, as evidenced by these highly specific XLP- SMART LVs for the treatment of XLP1. In conjunction with these studies, the regulated expression by enhancers 3, 20, and 5R within the T, NK, and NKT lineages provides a useful approach towards a lentiviral gene therapy for Hereditary Lymphocytic Histiocytosis (HLH) disorders, such as Perforin deficiency, which share similar expression profiles and regulation to that of XLPL

Claims

CLAIMSWhat is claimed is:

1. An isolated polynucleotide comprising:(a) an enhancer region comprising at least one enhancer element selected from E3, E20, and 5R, or parts thereof, wherein said enhancer region is shorter than the endogenous SH2D1A enhancer region;(b) an SH2D1A promoter; and(c) a sequence encoding SLAM-associated protein (SAP); and wherein when said isolated polynucleotide is transfected into a cell, it mimics the lineage and stage expression patterns of endogenous SAP.

2. The isolated polynucleotide of claim 1, wherein said enhancer region is shorter by at least 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% than the endogenous SH2D1A enhancer region.

3. The isolated polynucleotide of claim 1, wherein said enhancer region comprises less than 500, 1000, 2000, 3000, 4000, or 5000 nucleotides.

4. The isolated polynucleotide of claim 1, wherein said SH2D1A enhancer region comprises a polynucleotide comprising a sequence as set forth in SEQ ID NO.: 1.

5. The isolated polynucleotide of claim 1, wherein said lineage expression pattern comprises expression in T cells, NK cells, and NKT cells, and low or no expression in monocytes, B cells, B-LCL cells, and myeloid cells.

6. The isolated polynucleotide of claim 1 , wherein said stage expression pattern comprises expression in stages 4a to 6 of NK cells.

7. The isolated polynucleotide of claim 1, wherein said E3 comprises a polynucleotide sequence as set forth in SEQ ID NO.: 4, said E20 comprises a polynucleotide sequence as set forth in SEQ ID NO.: 20, or said 5R comprises a polynucleotide sequence as set forth in SEQ ID NO.: 32, or any combination thereof.

8. The isolated polynucleotide of claim 1 , wherein said part of E3 enhancer element comprises enhancer elements E3L, E3GL, E3M, E3GS, E3S, E3GP, or E3P; said part of E20 enhancer element comprises enhancer elements E20La, E20Le, or E20R; said part of 5R enhancer element comprises enhancer elements 5RC, 5RUC, 5RS, or 5RL; or any combination thereof.

9. The isolated polynucleotide of claim 8, wherein said E3 enhancer element is E3M or E3GP.

10. The isolated polynucleotide of claim 8, wherein said E20 enhancer element is E20R.

11. The isolated polynucleotide of claim 8, wherein said 5R enhancer element is 5RL.

12. The isolated polynucleotide of claim 8, wherein said E3L comprises a polynucleotide sequence as set forth in SEQ ID NO.: 34, said E3GL comprises a polynucleotide sequence as set forth in SEQ ID NO.: 49, said E3M comprises a polynucleotide sequence as set forth in SEQ ID NO.: 35, said E3GS comprises a polynucleotide sequence as set forth in SEQ ID NO.: 48, said E3S comprises a polynucleotide sequence as set forth in SEQ ID NO.: 36, said E3GP comprises a polynucleotide sequence as set forth in SEQ ID NO.: 50, or said E3P comprises a polynucleotide sequence as set forth in SEQ ID NO.: 37, or any combination thereof.

13. The isolated polynucleotide of claim 8, wherein said E20La comprises a polynucleotide sequence as set forth in SEQ ID NO.: 44, said E20Le comprises a polynucleotide sequence as set forth in SEQ ID NO.: 45, or said E20R comprises a polynucleotide sequence as set forth in SEQ ID NO.: 46.

14. The isolated polynucleotide of claim 8, wherein said 5RC comprises a polynucleotide sequence as set forth in SEQ ID NO.: 32, said 5RS comprises a polynucleotide sequence as set forth in SEQ ID NO.: 33, or said 5RL comprises a polynucleotide sequence as set forth in SEQ ID NO.: 29.

15. The isolated polynucleotide of claim 8, wherein said E3M element comprises a polynucleotide sequence as set forth in SEQ ID NO: 35, or wherein said E3GP element comprises a polynucleotide sequence as set forth in SEQ ID NO: 50.

16. The isolated polynucleotide of claim 8, wherein said E20R element comprises a polynucleotide sequence as set forth in SEQ ID NO: 46.

17. The isolated polynucleotide of claim 8, wherein said 5RL element comprises a polynucleotide sequence as set forth in SEQ ID NO: 29.

18. The isolated polynucleotide of claim 8, wherein said E3 enhancer element is E3M, said E20 enhancer element is E20R, and said 5R enhancer element is 5RL.

19. The isolated polynucleotide of claim 18, wherein said enhancer element comprises a polynucleotide sequence as set forth in SEQ ID NO.: 55.

20. The isolated polynucleotide of claim 8, wherein said E3 enhancer element is E3GP, said E20 enhancer element is E20R, and said 5R enhancer element is 5RL.

21. The isolated polynucleotide of claim 20, wherein said enhancer element comprises apolynucleotide sequence as set forth in 56.

22. The isolated polynucleotide of claim 1, wherein said SH2D1A promoter comprises a polynucleotide sequence as set forth in SEQ ID NO: 51, 57, or 58, or a sequence having at least 90% identity thereof.

23. The isolated polynucleotide of claim 1, wherein said sequence encoding SAP comprises a polynucleotide as set forth in SEQ ID NOs: 53, 54, or 70, or a sequence having at least 90% identity thereof; or wherein said SAP protein comprises a polypeptide sequence as set forth in 52, or a sequence having at least 90% identity thereof.

24. The isolated polynucleotide of claim 1 , comprising a polynucleotide as set forth in SEQ ID NO: 62 or in SEQ ID NO: 63, or a sequence having at least 90% identity thereof.

25. A viral vector comprising the isolated polynucleotide of any one of claims 1-24.

26. The viral vector of claim 25, wherein said viral vector is a lentiviral vector.

27. The viral vector of claim 26, wherein said lentiviral vector is an HIV-1 or HIV-2 derived vector.

28. The vector of claim 25, further comprising a post-translational regulatory element.

29. The vector of claim 28, wherein said posttranscriptional regulatory element is modified Woodchuck Post-transcriptional Regulatory Element (WPRE).

30. The vector of claim 25, comprising a polynucleotide as set forth in SEQ ID NO: 62 or 63.

31. A cell comprising the polynucleotide of any one of claims 1-24.

32. The cell of claim 31, wherein said cell is a stem cell.

33. The cell of claim 31, wherein said stem cell is derived from bone marrow, umbilical cord blood, or peripheral blood.

34. The cell of claim 31, wherein said cell is a human hematopoietic progenitor cell, a T cell, a NK cell, or a NKT cell.

35. A method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising:(a) obtaining a stem cell or progenitor cell;(b) transfecting the cell of (a) with the polynucleotide of claim 1 ; and(c) transplanting the cell of (b) into said subject.

36. A method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising:(a) obtaining a stem cell or progenitor cell;(b) transducing the cell of (a) with the viral vector of claim 25; and(c) transplanting the cell of (b) into said subject.

37. A method of treating X-linked lymphoproliferative disease (XLP1) in a subject, said method comprising transplanting to said subject the cell of claim 31.

38. The method of claims 35-37, wherein the expression of SAP in said cell recapitulates in vivo the lineage and stage expression patterns of endogenous SAP.

39. The method of claim 38, wherein said lineage expression pattern comprises expression in T cells, NK cells, and NKT cells, and low or no expression in monocytes, B cells, B- LCL cells, and myeloid cells.

40. The method of claim 38, wherein said stage expression pattern comprises expression in stages 4a to 6 of NK cells.

41. The method of claims 35-37, wherein said stem cell or progenitor cell is autologous or heterologous to said subject.

Images