Nucleic acid targeting hydroxysteroid 17-β dehydrogenase 13 and use thereof

Abstract

The present invention relates to the technical field of biology, and discloses a nucleic acid targeting hydroxysteroid 17-β dehydrogenase 13 and a use thereof. The provided nucleic acid can effectively inhibit the expression of hydroxysteroid 17-β dehydrogenase 13, and can thus treat and / or prevent diseases associated with hydroxysteroid 17-β dehydrogenase 13 activation.

Description

Nucleic acids targeting 17-beta-hydroxysteroid dehydrogenase 13 and uses thereof

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This invention claims priority to Chinese patent application No. 202310718422.1 filed on June 16, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention relates to the field of biotechnology, in particular to a nucleic acid targeting 17-beta-hydroxysteroid dehydrogenase 13 and a use thereof. Background Art

[0004] 17-β-Hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13) is an enzyme expressed by the HSD17B13 gene (also known as FLDP, HMFN0376, NIIL497, SCDR9, SDR16C3). HSD17B13 belongs to the HSD17 protein family, which includes 15 enzymes that play a major role in regulating fatty acid metabolism, cholesterol synthesis, bile synthesis, and sex hormone activation. HSD17B13 is specifically expressed in hepatocytes and localized to the surface of lipid droplets (MacParland, SA et al., Nat. Commun. 2018, 9:4383). HSD17B13 expression is significantly elevated in patients with nonalcoholic fatty liver disease (NAFLD) (Su W et al., Proc. Natl. Acad. Sci. USA 2014, 111:11437–42.). GWAS studies have also found that multiple HSD17B13 gene variants are associated with NAFLD (Anstee QM et al., J. Hepatol. 2020, 73:505–515), and a loss-of-function variant in HSD17B13 (rs72613567:TA) is associated with a reduced risk of NAFLD (Abul-Husn NS et al., N. Engl. J. Med. 2018, 378:1096–1106). In animal models, overexpression of HSD17B13 significantly increases the number and size of lipid droplets (Su W et al., Proc. Natl. Acad. Sci. USA 2014, 111:11437–42.). Currently, the number of patients with NAFLD is increasing significantly, and the number of cases of nonalcoholic steatohepatitis (NASH) is also increasing. However, there are currently no effective treatments. Targeting HSD17B13 may provide a potential treatment for NAFLD.

[0005] RNA interference (RNAi) refers to the highly conserved phenomenon of evolutionarily efficient and specific degradation of homologous mRNA induced by double-stranded small interfering RNA (siRNA). RNAi drugs also have the advantage of longer-lasting efficacy compared to antibodies. Therefore, the research and development of siRNA targeting HSD17B13 is of great significance.

[0006] Summary of the Invention

[0007] The purpose of the present invention is to overcome the problems existing in the prior art and provide a new nucleic acid targeting HSD17B13 and its use.

[0008] In a first aspect, the present invention provides a nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having more than 80% sequence identity with the sequence shown in any one of SEQ ID NOs: 1 to 80, and the antisense strand comprises a sequence having more than 80% sequence identity with the sequence shown in any one of SEQ ID NOs: 81 to 160.

[0009] A second aspect of the present invention provides a targeted drug delivery system, which comprises a targeting group, a linking group, and the nucleic acid as described above connected to the targeting group via the linking group.

[0010] The third aspect of the present invention provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system as described above and a pharmaceutically acceptable carrier.

[0011] The fourth aspect of the present invention provides a method for inhibiting the expression of 17-β-hydroxysteroid dehydrogenase 13 gene in a cell, the method comprising: contacting the cell with the nucleic acid, targeted drug delivery system or pharmaceutical composition as described above to inhibit the expression of 17-β-hydroxysteroid dehydrogenase 13 gene in the cell.

[0012] The fifth aspect of the present invention provides the use of the nucleic acid, targeted drug delivery system or pharmaceutical composition as described above in any of the following aspects: 1) treating and / or preventing diseases related to 17-β-hydroxysteroid dehydrogenase 13; 2) preparing drugs for treating and / or preventing diseases related to 17-β-hydroxysteroid dehydrogenase 13.

[0013] The nucleic acid of the present invention can effectively reduce the level of HSD17B13 and can effectively prevent or treat related diseases, such as non-alcoholic fatty liver disease. DETAILED DESCRIPTION

[0014] The following describes specific embodiments of the present invention in detail. It should be understood that the specific embodiments described herein are intended only to illustrate and explain the present invention and are not intended to limit the present invention. Those skilled in the art may make various modifications and variations to the present invention without departing from the scope or spirit of the present invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.

[0015] Explanation of terms

[0016] Unless otherwise indicated, all terms (including technical and scientific terms) used to disclose the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are provided to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0017] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0018] As used herein, the terms "comprising," "including," and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0019] The recitation of numerical ranges herein by endpoints includes all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0020] Concentration values ​​used in this invention include fluctuations within a certain range. For example, fluctuations within a certain precision range are permitted. For example, for 2%, fluctuations within ±0.1% are permitted. For larger values ​​or values ​​that do not require overly precise control, greater fluctuations are permitted. For example, for 100 mM, fluctuations within ±1%, ±2%, ±5%, etc. are permitted. Regarding molecular weight, fluctuations within ±10% are permitted.

[0021] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0022] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0023] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0024] In the present invention, the terms "optionally," "optional," "optionally," "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If multiple "optional" or "optional" terms appear in a technical solution, unless otherwise specified and there are no contradictions or constraints, each "optional" or "optional" term is independent of the others.

[0025] In the present invention, the term "nucleic acid" refers to a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can degrade or inhibit (e.g., degrade or inhibit under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. The nucleic acid can act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism of mammalian cells (RNA-induced silencing complex or RISC)), or through any alternative mechanism or pathway. The scope of the nucleic acids disclosed herein, including sense and antisense strands, includes, but is not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates.

[0026] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown" when referring to the expression of a given gene mean that the expression of the gene is reduced when the cell, cell population, tissue, organ, or subject is treated with a nucleic acid described herein, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, compared to a second cell, cell population, tissue, organ, or subject that has not been so treated.

[0027] As used herein, "fully complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, all (100%) bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0028] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0029] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0030] In the present invention, the term "at least partially complementary" means that the first oligonucleotide and the second oligonucleotide are partially complementary, substantially complementary or completely complementary in a hybridization pair of nucleobase or nucleotide sequence molecules.

[0031] As used herein, the term "treating" refers to methods or steps taken to provide relief or alleviation of the number, severity, and / or frequency of one or more disease symptoms in a subject. Such treatment may include prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject.

[0032] In the present invention, the term "connection" means that two compounds or molecules are joined by a covalent bond. Unless otherwise indicated, as used herein, the term "connection" may refer to a connection between a first compound and a second compound with or without any intermediate atoms or groups of atoms.

[0033] Nucleic Acids

[0034] The present invention provides a (modified or unmodified) nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) or more sequence identity to the sequence of any one of SEQ ID NOs: 81 to 160, and the antisense strand comprises a sequence having 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) or more sequence identity to the sequence of any one of SEQ ID NOs: 81 to 160.

[0035] In some embodiments, the antisense strand has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0036] In some embodiments, the sense strand has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0037] In specific implementations, those skilled in the art can combine the sequences provided in the present invention in consideration of the complementarity of the sense strand and the antisense strand, thereby obtaining a combined nucleic acid (siRNA).

[0038] In a preferred embodiment of the present invention, as shown in Table 1, the nucleic acid is selected from at least one of siRNA-1 having a sense chain sequence of SEQ ID NO: 1 and an antisense chain sequence of SEQ ID NO: 81, siRNA-2 having a sense chain sequence of SEQ ID NO: 2 and an antisense chain sequence of SEQ ID NO: 82, siRNA-3 having a sense chain sequence of SEQ ID NO: 3 and an antisense chain sequence of SEQ ID NO: 83, siRNA-4 having a sense chain sequence of SEQ ID NO: 4 and an antisense chain sequence of SEQ ID NO: 84, siRNA-5 having a sense chain sequence of SEQ ID NO: 5 and an antisense chain sequence of SEQ ID NO: 85..., siRNA-78, siRNA-79, and siRNA-80.

[0039] In some preferred embodiments, the antisense strand contains at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that differ from the sequence shown in any one of SEQ ID NOs: 81 to 160 by no more than 0, 1, 2 or 3 nucleotides, and the positive strand contains a nucleotide sequence that is at least partially complementary (e.g., partially complementary, substantially complementary or fully complementary) to the antisense strand.

[0040] In some preferred embodiments, the positive strand contains at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that differ from the sequence shown in any one of SEQ ID NOs: 1 to 80 by no more than 0, 1, 2 or 3 nucleotides.

[0041] In the present invention, the sense strand and the antisense strand may have the same length or different lengths.

[0042] All nucleotide groups in the above nucleic acid may be chemically unmodified, or may contain at least one modified nucleotide group, and the modification may be on the nucleotide at any position.

[0043] In some embodiments, the sense and antisense strands can be partially complementary, substantially complementary, or fully complementary to each other.

[0044] In some preferred embodiments, the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence of any one of SEQ ID NOs: 89, 100, 106, 109, 135, 136, 149, 150, 152, 153, 154, 156, 157, 158, 159, and 160, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand. When the antisense strand has the above sequence, the double-stranded RNA has a significantly better inhibitory effect on HSD17B13.

[0045] In some embodiments, the sense strand contains a nucleotide sequence that differs from any one of SEQ ID NOs: 9, 20, 26, 29, 55, 56, 69, 70, 72, 73, 74, 76, 77, 78, 79, and 80 by 0, 1, or 2 nucleotides.

[0046] In some embodiments, the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence of any one of SEQ ID NOs: 109, 135, 136, 149, 150, 152, 153, 154, 156, 157, 158, and 159, and the sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand. When the antisense strand has this sequence, the inhibitory effect of the double-stranded RNA with various modifications on HSD17B13 is further enhanced.

[0047] In some embodiments, the sense strand contains a nucleotide sequence that differs from any one of SEQ ID NOs: 29, 55, 56, 69, 70, 72, 73, 74, 76, 77, 78, and 79 by 0, 1, or 2 nucleotides.

[0048] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 109 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 29 by 0, 1 or 2 nucleotides.

[0049] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 135 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 55 by 0, 1 or 2 nucleotides.

[0050] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 136 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 56 by 0, 1 or 2 nucleotides.

[0051] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 149 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 69 by 0, 1 or 2 nucleotides.

[0052] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 150 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 70 by 0, 1 or 2 nucleotides.

[0053] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 152 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 72 by 0, 1 or 2 nucleotides.

[0054] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 153 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 73 by 0, 1 or 2 nucleotides.

[0055] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 154 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 74 by 0, 1 or 2 nucleotides.

[0056] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 156 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 76 by 0, 1 or 2 nucleotides.

[0057] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 157 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 77 by 0, 1 or 2 nucleotides.

[0058] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 158 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 78 by 0, 1 or 2 nucleotides.

[0059] In some preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 159 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 79 by 0, 1 or 2 nucleotides.

[0060] In some embodiments, even if the sequence identity of the sense or antisense strand of the nucleic acid to the corresponding sequence described herein is less than 100% or differs by more than one nucleotide, the nucleic acid still exhibits a similar or comparable inhibitory effect on HSD17B13 as the corresponding sequence. For example, the UU residue at the 3' end of the antisense strand of the nucleic acid is replaced with AA, CC, GG, or UG, or a combination of any two nucleic acids. Such nucleic acid sequences also fall within the scope of protection of the present invention.

[0061] The above-mentioned technical solutions for naked sequences (i.e., unmodified sequences) mentioned in the present invention have advantages that are independent of the modification method or the choice of targeting vector. The following describes applicable modification solutions and further preferred modification solutions:

[0062] According to the nucleic acid of the present invention, the nucleic acid contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group and a base. Preferably, the nucleic acid contains at least one modified nucleotide group. The modified nucleic acid has an inhibition efficiency of no less than 50% (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) against HSD17B13.

[0063] According to the nucleic acid of the present invention, wherein the modified nucleotide group is a nucleotide group in which a phosphate group and / or a ribose group is modified. The modified site can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of the sense strand and / or the antisense strand.

[0064] For example, phosphate group modification involves the modification of the oxygen in the phosphate group, including phosphorothioate and boranophosphate modifications. As shown in the formulas below, the oxygen in the phosphate group is replaced with sulfur, borane, amine, alkyl, or alkoxy groups. These modifications stabilize the structure of nucleic acids and maintain high base pairing specificity and affinity.

[0065] In the above structural formula, BASE represents the base A, U, C, G, or T. X can be oxygen (O) or sulfur (S). R in the above structure can be the same or different, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, amino, cyanoethyl, acetyl, etc. R' and R" can each independently be hydrogen (H), methyl (CH3), ethyl (CH2CH3), propyl (CH2CH2CH3), isopropyl (CH(CH3)2), allyl, propargyl, acyloxybenzyl, or acyloxyethyl.

[0066] Ribose modification refers to modifications to the 2'-hydroxyl group (2'-OH) of the ribose group. The introduction of certain substituents, such as methoxy or fluorine, at the 2'-hydroxyl position of the ribose group makes the nucleic acid less susceptible to cleavage by ribonucleases, thereby increasing its stability and making it more resistant to nuclease hydrolysis. Modifications of the 2'-hydroxyl group in nucleotide pentoses include 2'-fluoro modification (such as 2'-arabino-fluoro modification), 2'-methoxy modification (2'-OME), 2'-methoxyethyl modification (2'-MOE), 2'-2,4-dinitrophenol modification (2'-DNP modification), 2',4'-constrained ethyl modification, 2'-amino modification, 2'-deoxy modification, BNA, acyclic nucleic acid modification, staggered nucleic acid modification, and L-type nucleic acid modification. BNA (internal ring bridged nucleotide) refers to a constrained or inaccessible nucleotide. BNA can contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C 3'-endo sugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose ring to provide a 2', 4'-BNA nucleotide, such as a locked ethyl modification (LNA), a ring locked ethyl modification (ENA) and an ethyl locked nucleic acid modification (cET BNA). Acyclic nucleic acids are nucleotides formed by opening the sugar ring of the nucleotide, such as unlocked nucleic acid (UNA) nucleotides and glycerol nucleic acid (GNA) nucleotides. Misplaced nucleic acid modification refers to the replacement of a 3', 5'-phosphate bond link by a 2', 5'-phosphate bond chain. L-type nucleic acid modification refers to the replacement of a naturally occurring D-type nucleic acid with its mirror image stereo equivalent, an L-type nucleic acid.

[0067] Wherein, BASE represents the base A, U, C, G or T. R in the above structure can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, acetyl, etc.

[0068] According to the nucleic acid of the present invention, preferably, the nucleotide group in which the ribose group is modified is a nucleotide group in which the 2'-OH of the ribose group is substituted by a methoxy group or a fluorine group.

[0069] According to a particularly preferred embodiment of the present invention, the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is a nucleotide group in which the ribose group is modified, that is, the 2'-OH of the ribose group in the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is replaced by a methoxy group or a fluorine. More preferably, the 3' end of the sense strand and the antisense strand of the nucleic acid can be connected with dTdT; or, the 3' end of the antisense strand of the nucleic acid can be connected with AA or UU or a combination of any two nucleic acids (which can be but is not limited to CC, GG or UG), so that the sequence has a specific inducement to mRNA degradation. The nucleic acid with the above modifications shows a more excellent inhibitory effect in vivo, and the above modifications can further reduce the immunogenicity of the nucleic acid of the present invention in vivo.

[0070] The nucleic acids of the present invention may also include modifications that include a nucleoside monophosphate attached to the 5' end of the antisense strand. The 5'-monophosphate at the terminal end of the siRNA guide strand is important for RISC recognition. Phosphorylation of the 5'-hydroxyl group plays a role in the effective loading of siRNA onto Ago2 within cells. The monophosphate at the 5' end of the siRNA guide strand interacts with Argonaute-2 (Ago2) through H-bonding, thereby ensuring accurate targeting and precise cleavage of the mRNA target. Commonly used 5'-monophosphate nucleoside derivatives include the following. These phosphate nucleoside derivatives have been shown to exhibit a certain degree of stability in biological metabolic media and to be effective in promoting the loading of siRNA guide strands onto Ago2 within cells (Nucleic Acids Research, 2015, 43, 2993–3011). In the nucleic acids of the present invention, trans-vinyl phosphate (VP) is preferably used as the primary moiety, but monophosphate nucleoside derivatives other than those mentioned above may also be included.

[0071] In the above structures, BASE represents the base A, U, C, G, or T. R in the above structures can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, amino, acetyl, etc.

[0072] In some embodiments, at least one nucleotide in the nucleic acid is a modified nucleotide or includes a modified linkage.

[0073] In some preferred embodiments, the modified nucleotides are selected from one or more of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-open ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides and 3'-O-methyl nucleotides; the modified nucleotides are further preferably selected from one or more of 2'-O-methyl nucleotides and 2'-fluoro nucleotides.

[0074] In some preferred embodiments, the modified internucleotide bond is preferably selected from one or more of a thiophosphate internucleotide bond and a methylphosphonate internucleotide bond; the modified internucleotide bond is further preferably selected from one or more of a thiophosphate monoester internucleotide bond and a thiophosphate diester internucleotide bond.

[0075] In some embodiments, the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and the 3' end, respectively, and contains 4 to 6 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

[0076] In some embodiments, the 5' end of the sense strand contains two phosphorothioate internucleotide bonds and 2 to 4 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

[0077] In some preferred embodiments, the antisense strand has 2'-fluoro nucleotides at the 2nd, 4th, 6th, 14th and 16th nucleotides counted from the 5' end.

[0078] In some preferred embodiments, the sense strand has 2'-fluoro nucleotides at the 7th, 9th, and 11th nucleotides counted from the 5' end.

[0079] In some preferred embodiments, the antisense strand has at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that differ from the antisense strand sequence of any one of Table 2 by no more than 0, 1, 2 or 3 nucleotides, and the sense strand has at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that differ from the sense strand sequence of any one of Table 2 by no more than 0, 1, 2 or 3 nucleotides.

[0080] In some preferred embodiments, the sense strand and the antisense strand form an siRNA having any one of the sequences shown in Table 3.

[0081] In some preferred embodiments, the antisense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs from the following nucleotide sequence by 0, 1 or 2 nucleotides:

[0082] SN-5553: asUfsaGfaUfcucuucuCfuGfuugcusgsc;

[0083] SN-5564: asUfsaCfaGfgccuaaaUfcUfugugcsusu;

[0084] SN-5573:usAfsaGfuAfuuccaucUfaUfcagacsusu;

[0085] SN-5577: csAfsuAfuCfauuaucaUfgCfauacasusc;

[0086] SN-5606:usUfsaUfaCfagaagacAfgAfaucaasgsu;

[0087] SN-5607: asGfsuUfaUfacagaagAfcAfgaaucsusu;

[0088] SN-52389: asCfsuAfuUfcauaucaUfuAfucaugscsa;

[0089] SN-52391:usCfsaUfaAfuguaucuUfaUfaagacsusa;

[0090] SN-52393: asCfsaAfaGfaaaaaggUfuAfucaugsusu;

[0091] SN-52394: asUfsuAfcAfaagaaaaAfgGfuuaucsusu;

[0092] SN-52395: asUfsaUfaUfgaaagcaUfaAfauuacsusu;

[0093] SN-52397: asCfsaAfgAfuuagucuUfgAfugaugsusg;

[0094] SN-52398: asAfsaAfcAfagauuagUfcUfugaugsusa;

[0095] SN-52399: asCfsaCfaCfaaaacaaGfaUfuagucsusu;

[0096] SN-52400:usAfsuAfaUfacaugugAfaAfaacacsasc;

[0097] SN-52401:usCfsuAfuAfauacaugUfgAfaaaacsasc;

[0098] The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0099] In some preferred embodiments, the sense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs from any one of the following nucleotide sequences by 0, 1 or 2 nucleotides:

[0100] SN-2553: asgscaacAfgAfgAfagagaucuau;

[0101] SN-2564:gscsacaaGfaUfuAfuggccuguau;

[0102] SN-2573:gsuscugaUfaGfaUfggaauacuua;

[0103] SN-2577:usgsuaugCfaUfgAfuaaugauaug;

[0104] SN-2606:ususgauuCfuGfuCfuucuguuaa;

[0105] SN-2607: gsasuucuGfuCfuUfcuguauaacu;

[0106] SN-22389:csasugauAfaUfgAfuaugaauagu;

[0107] SN-22391: gsuscuuaUfaAfgAfuacauuauga;

[0108] SN-22393: csasugauAfaCfcUfuuuucuuugu;

[0109] SN-22394:gsasuaacCfuUfuUfucuuuguaau;

[0110] SN-22395:gsusaauuUfaUfgCfuuucauauau;

[0111] SN-22397: csusacauCfaAfgAfcuaaucuugu;

[0112] SN-22398: csasucaaGfaCfuAfaucuuguuuu;

[0113] SN-22399:gsascuaaUfcUfuGfuuuugugu;

[0114] SN-22400:gsusguuuUfuCfaCfauguauuaua;

[0115] SN-22401: gsusuuuuCfaCfaUfguauuauaga.

[0116] In each sequence of the present invention, a nucleotide represented by a lowercase letter indicates that the nucleotide is a 2'-O-methyl nucleotide; f indicates that the nucleotide adjacent to the left is a 2'-fluoro nucleotide; s indicates that the two adjacent nucleotides on the left and right are connected by a phosphorothioate diester bond.

[0117] In some preferred embodiments, the antisense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs from the following nucleotide sequence by 0, 1 or 2 nucleotides:

[0118] SN-5577: csAfsuAfuCfauuaucaUfgCfauacasusc;

[0119] SN-5606:usUfsaUfaCfagaagacAfgAfaucaasgsu;

[0120] SN-5607: asGfsuUfaUfacagaagAfcAfgaaucsusu;

[0121] SN-52389: asCfsuAfuUfcauaucaUfuAfucaugscsa;

[0122] SN-52391:usCfsaUfaAfuguaucuUfaUfaagacsusa;

[0123] SN-52393: asCfsaAfaGfaaaaaggUfuAfucaugsusu;

[0124] SN-52394: asUfsuAfcAfaagaaaaAfgGfuuaucsusu;

[0125] SN-52395: asUfsaUfaUfgaaagcaUfaAfauuacsusu;

[0126] SN-52397: asCfsaAfgAfuuagucuUfgAfugaugsusg;

[0127] SN-52398: asAfsaAfcAfagauuagUfcUfugaugsusa;

[0128] SN-52399: asCfsaCfaCfaaaacaaGfaUfuagucsusu;

[0129] SN-52400:usAfsuAfaUfacaugugAfaAfaacacsasc;

[0130] The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0131] In some preferred embodiments, the sense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs from any one of the following nucleotide sequences by 0, 1 or 2 nucleotides:

[0132] SN-2577:usgsuaugCfaUfgAfuaaugauaug;

[0133] SN-2606:ususgauuCfuGfuCfuucuguuaa;

[0134] SN-2607: gsasuucuGfuCfuUfcuguauaacu;

[0135] SN-22389:csasugauAfaUfgAfuaugaauagu;

[0136] SN-22391: gsuscuuaUfaAfgAfuacauuauga;

[0137] SN-22393: csasugauAfaCfcUfuuuucuuugu;

[0138] SN-22394:gsasuaacCfuUfuUfucuuuguaau;

[0139] SN-22395:gsusaauuUfaUfgCfuuucauauau;

[0140] SN-22397: csusacauCfaAfgAfcuaaucuugu;

[0141] SN-22398: csasucaaGfaCfuAfaucuuguuuu;

[0142] SN-22399:gsascuaaUfcUfuGfuuuugugu;

[0143] SN-22400: gsusguuuUfuCfaCfauguauuaua.

[0144] In specific implementations, those skilled in the art can combine the aforementioned sense and antisense strand sequences, taking into account the complementarity of the sense and antisense strands. In a preferred embodiment, sense and antisense strand sequences with the same last three digits of their numbers are combined to produce the corresponding nucleic acid (siRNA). For example, SN-5577 and SN-2577 are combined, and SN-52389 and SN-22389 are combined to produce the corresponding nucleic acid (siRNA).

[0145] The nucleic acids according to the present invention can be obtained by conventional methods in the art, such as solid phase synthesis and liquid phase synthesis. Solid phase synthesis is commercially available on a custom basis and can therefore be purchased commercially. The modified nucleotide groups can be introduced by nucleotide monomers having corresponding modifications.

[0146] Based on the nucleic acid (siRNA) synthesized above, the present invention can further construct an shRNA expression plasmid having the same or similar function as the above siRNA. The method for constructing the expression plasmid is well known to those skilled in the art and will not be described in detail here.

[0147] The present invention also provides a targeted gene site of the nucleic acid as described above. In some embodiments, the targeted gene site is as marked in any one of the first columns of Table 1.

[0148] Table 1

[0149] Note: The first column indicates the position of the first base of the targeted gene in the HSD17B13 gene sequence, and so on; the numbers in the third and fifth columns indicate the sequence numbers, for example, "1" indicates SEQ ID NO: 1.

[0150] The reference sequence of the targeted gene is the coding sequence of human HSD17B13 NM_178135.5

[0151] (SEQ ID NO: 161):

[0152] Targeted drug delivery system

[0153] The present invention also provides a targeted drug delivery system, characterized in that the targeted drug delivery system comprises a targeting group, a linking group and the nucleic acid as described above connected to the targeting group via the linking group.

[0154] In conjunction with common sense in the art, nucleic acid (siRNA) of the present invention, when applied to different targeted drug delivery systems, all has a better inhibitory effect. In other words, the effect advantage of the naked sequence and the modified sequence in the present invention does not depend on the selection of the targeting vector. In order to further improve the bioavailability and therapeutic effect of siRNA, the present invention has also optimized the targeted drug delivery system and obtained the following technical scheme.

[0155] In some embodiments, the linker is linked to the 3' end or the 5' end of the sense strand or the antisense strand of the nucleic acid.

[0156] In some embodiments, the linker is attached to the 3' end of the sense strand of the nucleic acid.

[0157] In some embodiments, the targeted drug delivery system comprises a ligand and the nucleic acid linked to the ligand.

[0158] In some embodiments, the ligand is a GalNAc derivative.

[0159] In some embodiments, the ligand is one or more GalNAc derivatives connected by a single-stranded, double-stranded, or triple-stranded branched linker.

[0160] In some preferred embodiments, the structure of the targeted drug delivery system is shown in Formula I below:

[0161] In Formula I, Nu represents the nucleic acid (siRNA). In some embodiments, the compound portion of the system can be connected to the 5' end or 3' end of the sense strand of the siRNA via a phosphodiester bond, or can be connected to the 5' end or 3' end of the antisense strand of the siRNA via a phosphodiester bond. This targeted drug delivery system utilizes the structural characteristics on its left side to improve the cell penetration ability of the nucleic acid drug (Nu), enhance its intracellular stability, and has a simple preparation process and strong practicality.

[0162] Pharmaceutical composition

[0163] The present invention also provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system as described above and a pharmaceutically acceptable carrier.

[0164] The pharmaceutical composition can be prepared from the nucleic acid and the pharmaceutically acceptable carrier by conventional methods. For example, the pharmaceutical composition can be an injection. The injection can be used for subcutaneous, intramuscular, or intravenous injection.

[0165] According to the pharmaceutical composition of the present invention, there are no special requirements for the amount of the nucleic acid or targeted drug delivery system and the pharmaceutically acceptable carrier. Generally, relative to 1 part by weight of the nucleic acid (or 1 part by weight of the targeted drug delivery system calculated as nucleic acid), the content of the pharmaceutically acceptable carrier can be 1-100,000 parts by weight (such as 1 part by weight, 5 parts by weight, 10 parts by weight, 50 parts by weight, 100 parts by weight, 500 parts by weight, 1,000 parts by weight, 5,000 parts by weight, 10,000 parts by weight, 50,000 parts by weight, 100,000 parts by weight or any value between any two of the above values).

[0166] According to the pharmaceutical composition of the present invention, wherein the pharmaceutically acceptable carrier can be various carriers conventionally used in the art, for example, can include at least one of a pH buffer, a protective agent and an osmotic pressure regulator. The pH buffer can be a tris hydroxymethylaminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. The protective agent can be at least one of inositol, sorbitol and sucrose. Based on the gross weight of the pharmaceutical composition, the content of the protective agent can be 0.01-30 weight % (such as 0.01 weight %, 0.05 weight %, 0.1 weight %, 0.5 weight %, 1 weight %, 5 weight %, 10 weight %, 15 weight %, 20 weight %, 25 weight %, 30 weight % or any value between any two of the above values). The osmotic pressure regulator can be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition be 200-700 mOsmole / kg. According to the desired osmotic pressure, those skilled in the art can determine the content of the osmotic pressure regulator.

[0167] According to a preferred embodiment of the present invention, the pharmaceutically acceptable carrier is a liposome. The liposome can be any liposome capable of encapsulating nucleic acid, and its diameter can be 25-1000 nm, and can include but not limited to cholesterol and its analogs or derivatives.

[0168] The dosage of the pharmaceutical composition of the present invention can be a conventional dosage in the art, and can be determined based on various parameters, particularly the age, weight, and sex of the subject. For example, for female mice aged 3-4 months and weighing 25-30 g, the dosage of the pharmaceutical composition can be 0.01-100 mg / kg body weight, preferably 1-10 mg / kg body weight, based on the amount of the nucleic acid in the pharmaceutical composition.

[0169] Methods and uses

[0170] The present invention also provides a method for inhibiting the expression of 17-β-hydroxysteroid dehydrogenase 13 gene in a cell, the method comprising: contacting the cell with the nucleic acid, targeted drug delivery system or pharmaceutical composition as described above to inhibit the expression of 17-β-hydroxysteroid dehydrogenase 13 gene in the cell.

[0171] In some embodiments, the cell is in a subject, eg, a human subject, eg, a subject suffering from a 17-β-hydroxysteroid dehydrogenase 13-associated disease.

[0172] In some embodiments, the cells are located in vitro. The methods are for research purposes or for constructing animal models.

[0173] In some embodiments, contacting the cell with the nucleic acid inhibits expression of HSD17B13 by at least 50%, 60%, 70%, 80%, 90%, or 95% (e.g., compared to the level of HSD17B13 expression before the cell is first contacted with the nucleic acid; e.g., before the first dose of the nucleic acid is administered to the subject). In certain embodiments, inhibiting expression of HSD17B13 reduces the level of HSD17B13 protein in a serum sample of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%, e.g., compared to the level of HSD17B13 expression before the cell is first contacted with the nucleic acid.

[0174] The present invention also provides uses of the nucleic acid, targeted drug delivery system or pharmaceutical composition described above in any of the following aspects: 1) treating and / or preventing diseases associated with 17-β-hydroxysteroid dehydrogenase 13; 2) preparing drugs for treating and / or preventing diseases associated with 17-β-hydroxysteroid dehydrogenase 13.

[0175] In some embodiments, the disease is: (i) a disease associated with increased or elevated levels of 17-β-hydroxysteroid dehydrogenase 13; or (ii) a disease that would benefit from decreased expression of 17-β-hydroxysteroid dehydrogenase 13.

[0176] In some embodiments, the disease is selected from one or more of the following: non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), liver fibrosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), cirrhosis, hepatitis, hepatitis C virus (HCV)-related cirrhosis, drug-induced liver injury, and hepatocellular necrosis.

[0177] In the present invention, the subject can be a mammal, including primates (such as humans, non-human primates, such as monkeys and chimpanzees), non-primates (such as cattle, pigs, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats or mice) or birds. In some embodiments, the subject is preferably a primate, more preferably a human. Administration can be carried out in a variety of ways, depending on whether local treatment or systemic treatment is required. The mode of administration can be, but is not limited to, intravenous administration, intra-arterial administration, subcutaneous administration, intraperitoneal administration, transdermal administration (such as by implantation of a device) and administration into soft tissue. The dosage can be referred to above and will not be repeated here.

[0178] In some embodiments, the nucleic acid, the targeted drug delivery system, or the pharmaceutical composition is administered to the subject by subcutaneous administration, intravenous administration, and / or intramuscular administration.

[0179] Example

[0180] The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. For experimental methods in the following examples where specific conditions are not specified, reference is made to the guidance provided in the present invention, and may also be made to experimental manuals or conventional conditions in the art, other experimental methods known in the art, or conditions recommended by the manufacturer.

[0181] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0182] Example 1 In vitro screening of siRNA

[0183] After screening to obtain the sense strand and antisense strand sequences shown in Table 1, each sense strand and antisense strand was modified, and the modified sequences are shown in Table 2.

[0184] Table 2

[0185] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0186] The sense strand and antisense strand in Table 2 were synthesized into the modified double-stranded siRNA in Table 3 by solid phase synthesis.

[0187] Table 3

[0188] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0189] The small interfering nucleic acids (siRNAs) listed in Table 3 and SN-252704, used as a control, were applied to HEK293T cells transfected with the HSD17B13 / luciferase plasmid to test their knockdown effects on HSD17B13 expression. SN-252704, used as a control, was prepared based on the disclosed information of US11180757B1. The sense strand sequence (5'-3') is AUGCUUUUGCAUGGACUAUCU (SEQ ID NO: 162), which was modified to asusgcuuUfuGfCfAfuggacuaucu, and the antisense strand sequence (5'-3') is AGAUAGUCCAUGCAAAAGCAUUC (SEQ ID NO: 163), which was modified to asGfsauaguccaugcAfaAfagcaususc. The letters in the modified sequences have the same meanings as described in Table 3.

[0190] The experimental procedure is as follows: 25,000 HEK293T cells in 50 μL of cell culture medium (DMEM, 10% calf serum) were added to a gelatin-coated 96-well dish and incubated overnight before siRNA transfection. A 20X sample working solution was prepared in Opti-MEM. Separately, plasmids containing the human HSD17B13 gene and a luciferase-renilla fragment were prepared in Opti-MEM to a final concentration of 5 ng / mL. 0.5 mL of Lipofectamine was added to 24.5 mL of Opti-MEM. 12 mL of the 20X sample working solution was mixed with 48 mL of plasmid and Opti-MEM. Then, 60 mL of the Lipofectamine mixture was added and incubated at room temperature for 30 minutes. 50 mL of this mixture was added to each well of the HEK293T cells that had been incubated overnight and incubated for 5 hours. The culture medium was then aspirated and replaced with fresh cell culture medium (DMEM, 10% calf serum) and incubated for 43 hours. 75 mL of Glo-Luciferase was added to each well and incubated at room temperature for 15 minutes. Luminescence was then measured at 590 nm. After this reading, 75 mL of stop solution was added and incubated for 15 minutes. Renilla fluorescence was then measured across the entire wavelength range. The ratio of renilla fluorescence to firefly fluorescence was used to calculate the efficacy of HSD17B13 silencing. The results are shown in Table 4.

[0191] Table 4. Knockdown effect of siRNA on HSD17B13 expression in HEK293T cells transfected with HSD17B13 / luciferase plasmid

[0192] Example 2 Verification of the effect of siRNA

[0193] To further verify the activity of the siRNA compounds, human and monkey homologous siRNAs (Table 5) were screened in the above HEK293T cell system at 8 doses (0.001, 0.011, 0.033, 0.06, 0.11, 0.33, 1.1, and 3.3 nM).

[0194] Table 5

[0195] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0196] The dose required for 50% knockdown of HSD17B13 (IC 50 ) as shown in Table 6.

[0197] Table 6 IC of siRNA inhibiting HSD17B13 expression 50 value

[0198] The results indicate that SN-25577, SN-252397, SN-252398, SN-252400, SN-25606, SN-25607, SN-252389, SN-252391, SN-252393, SN-252394, SN-252395, and SN-252399 significantly outperformed the other groups in knocking down HSD17B13. Furthermore, they also significantly outperformed the currently known dominant sequence, SN-252704. This demonstrates that the modified sequences of the present invention significantly outperform existing dominant sequences, and these advantages are independent of the choice of targeting vector.

[0199] In addition, coupling the siRNA of the above-mentioned advantageous group with Tri-GalNAc (its specific structure is shown in the aforementioned formula I, and the sequences involved are shown in Table 7) can further enhance the liver targeting of the siRNA drug.

[0200] Table 7

[0201] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0202] When the efficacy of the siRNA drugs shown in Table 7 was verified in human HSD17B13 transgenic mice, they still had significant efficacy advantages. The siRNA drugs of the present invention can achieve better efficacy at a lower dose.

[0203] In addition, by comparing the silencing effect of unmodified siRNA on HSD17B13 gene expression in cells, it can be confirmed that the siRNA of the present invention has obvious effect advantages at the naked sequence level, and is significantly better than existing advantageous sequences in silencing the HSD17B13 gene.

[0204] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A nucleic acid comprising a sense strand and an antisense strand, characterized in that: The sense strand contains a sequence having more than 80% sequence identity with a sequence shown in any one of SEQ ID NOs: 1-80, and the antisense strand contains a sequence having more than 80% sequence identity with a sequence shown in any one of SEQ ID NOs: 81-160.

2. The nucleic acid according to claim 1, wherein The antisense strand contains at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sequence shown in any one of SEQ ID NOs: 81 to 160, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sequence shown in any one of SEQ ID NOs: 1 to 80.

3. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 89, 100, 106, 109, 135, 136, 149, 150, 152, 153, 154, 156, 157, 158, 159, and 160 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 9, 20, 26, 29, 55, 56, 69, 70, 72, 73, 74, 76, 77, 78, 79, and 80 by 0, 1 or 2 nucleotides.

4. The nucleic acid according to claim 3, wherein The antisense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 109, 135, 136, 149, 150, 152, 153, 154, 156, 157, 158, and 159 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 29, 55, 56, 69, 70, 72, 73, 74, 76, 77, 78, and 79 by 0, 1 or 2 nucleotides.

5. The nucleic acid according to claim 4, wherein The antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 109 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 29 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 135 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 55 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 136 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 56 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 149 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 69 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 150 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 70 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 152 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 72 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 153 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 73 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 154 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 74 by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 156 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 76 by 0, 1 or 2 nucleotides; Or, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 157 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 77 by 1, 2 or 3 nucleotides. Nucleotide sequences differing by 0, 1 or 2 nucleotides; or, the antisense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 158 by 0, 1 or 2 nucleotides, and the sense strand comprises a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 78 by 0, 1 or 2 nucleotides; Alternatively, the antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 159 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 79 by 0, 1 or 2 nucleotides.

6. The nucleic acid according to claim 1, wherein At least one nucleotide in the nucleic acid is a modified nucleotide or includes a modified internucleotide; The modified nucleotide is preferably selected from one or more of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-open ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, reverse nucleotides, reverse 2'-O-methyl nucleotides, reverse 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, nucleotides containing vinyl phosphonate, nucleotides containing cyclopropyl phosphonate and 3'-O-methyl nucleotides; the modified nucleotide is further preferably selected from one or more of 2'-O-methyl nucleotides and 2'-fluoro nucleotides; The modified internucleotide bond is preferably selected from one or more of phosphorothioate internucleotide bonds and methylphosphonate internucleotide bonds; the modified internucleotide bond is further preferably selected from one or more of phosphorothioate monoester internucleotide bonds and phosphorothioate diester internucleotide bonds.

7. The nucleic acid according to claim 6, wherein The antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and the 3' end, respectively, and contains 4 to 6 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides; the 5' end of the sense strand contains two phosphorothioate internucleotide bonds and contains 2 to 4 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides; preferably, the 2nd, 4th, 6th, 14th and 16th nucleotides of the antisense strand counting from the 5' end are 2'-fluoro nucleotides, and the 7th, 9th and 11th nucleotides of the sense strand counting from the 5' end are 2'-fluoro nucleotides.

8. The nucleic acid according to claim 1, wherein The antisense strand has at least 15 consecutive nucleotides with a difference of no more than 3 nucleotides from the antisense strand sequence shown in any one of Table 2, and the sense strand has at least 15 consecutive nucleotides with a difference of no more than 3 nucleotides from the sense strand sequence shown in any one of Table 2; preferably, the sense strand and the antisense strand form a siRNA shown in any one of Table 3.

9. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs from the following nucleotide sequence by 0, 1 or 2 nucleotides from the 5' end to the 3' end: SN-5553: asUfsaGfaUfcucuucuCfuGfuugcusgsc; SN-5564: asUfsaCfaGfgccauaaUfcUfugugcsusu; SN-5573: usAfsaGfuAfuuccaucUfaUfcagacsusu; SN-5577: csAfsuAfuCfauuaucaUfgCfauacasusc; SN-5606: usUfsaUfaCfagaagacAfgAfaucaasgsu; SN-5607: asGfsuUfaUfacagaagAfcAfgaaucsusu; SN-52389: asCfsuAfuUfcauaucaUfuAfucaugscsa; SN-52391: usCfsaUfaAfuguaucuUfaUfaagacsusa; SN-52393: asCfsaAfaGfaaaaaggUfuAfucaugsusu; SN-52394: asUfsuAfcAfaagaaaaAfgGfuuaucsusu; SN-52395: asUfsaUfaUfgaaagcaUfaAfauuacsusu; SN-52397: asCfsaAfgAfuuagucuUfgAfugaugsusg; SN-52398: asAfsaAfcAfagauuagUfcUfugaugsusa; SN-52399: asCfsaCfaCfaaaacaaGfaUfuagucsusu; SN-52400: usAfsuAfaUfacaugugAfaAfaacacsasc; SN-52401: usCfsuAfuAfauacaugUfgAfaaaacsasc; The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; Preferably, the sense strand contains a nucleotide sequence from the 5' end to the 3' end that differs by 0, 1 or 2 nucleotides from any of the following nucleotide sequences: SN-2553: asgscaacAfgAfgAfagagaucuau; SN-2564:gscsacaaGfaUfuAfuggccuguau; SN-2573:gsuscugaUfaGfaUfggaauacuua; SN-2577:usgsuaugCfaUfgAfuaaugauaug; SN-2606:ususgauuCfuGfuCfuucuguuaa; SN-2607: gsasuucuGfuCfuUfcuguauaacu; SN-22389:csasugauAfaUfgAfuaugaauagu; SN-22391: gsuscuuaUfaAfgAfuacauuauga; SN-22393: csasugauAfaCfcUfuuuucuuugu; SN-22394:gsasuaacCfuUfuUfucuuuguaau; SN-22395:gsusaauuUfaUfgCfuuucauauau; SN-22397:csusacauCfaAfgAfcuaaucuugu; SN-22398: csasucaaGfaCfuAfaucuuguuuu; SN-22399:gsascuaaUfcUfuGfuuuugugu; SN-22400:gsusguuuUfuCfaCfauguauuaua; SN-22401: gsusuuuuCfaCfaUfguauuauaga; In each sequence, a nucleotide represented by a lowercase letter indicates that the nucleotide is a 2'-O-methyl nucleotide; f indicates that the nucleotide adjacent to the left is a 2'-fluoro nucleotide; and s indicates that the two adjacent nucleotides on the left and right are connected by a phosphorothioate diester bond.

10. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs from the following nucleotide sequence by 0, 1 or 2 nucleotides from the 5' end to the 3' end: SN-5577: csAfsuAfuCfauuaucaUfgCfauacasusc; SN-5606: usUfsaUfaCfagaagacAfgAfaucaasgsu; SN-5607: asGfsuUfaUfacagaagAfcAfgaaucsusu; SN-52389: asCfsuAfuUfcauaucaUfuAfucaugscsa; SN-52391: usCfsaUfaAfuguaucuUfaUfaagacsusa; SN-52393: asCfsaAfaGfaaaaaggUfuAfucaugsusu; SN-52394: asUfsuAfcAfaagaaaaAfgGfuuaucsusu; SN-52395: asUfsaUfaUfgaaagcaUfaAfauuacsusu; SN-52397: asCfsaAfgAfuuagucuUfgAfugaugsusg; SN-52398: asAfsaAfcAfagauuagUfcUfugaugsusa; SN-52399: asCfsaCfaCfaaaacaaGfaUfuagucsusu; SN-52400: usAfsuAfaUfacaugugAfaAfaacacsasc; The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; Preferably, the sense strand contains a nucleotide sequence from the 5' end to the 3' end that differs by 0, 1 or 2 nucleotides from any of the following nucleotide sequences: SN-2577:usgsuaugCfaUfgAfuaaugauaug; SN-2606:ususgauuCfuGfuCfuucuguuaa; SN-2607: gsasuucuGfuCfuUfcuguauaacu; SN-22389:csasugauAfaUfgAfuaugaauagu; SN-22391: gsuscuuaUfaAfgAfuacauuauga; SN-22393: csasugauAfaCfcUfuuuucuuugu; SN-22394:gsasuaacCfuUfuUfucuuuguaau; SN-22395:gsusaauuUfaUfgCfuuucauauau; SN-22397:csusacauCfaAfgAfcuaaucuugu; SN-22398: csasucaaGfaCfuAfaucuuguuuu; SN-22399:gsascuaaUfcUfuGfuuuugugu; SN-22400:gsusguuuUfuCfaCfauguauuaua; In each sequence, a nucleotide represented by a lowercase letter indicates that the nucleotide is a 2'-O-methyl nucleotide; f indicates that the nucleotide adjacent to the left is a 2'-fluoro nucleotide; and s indicates that the two adjacent nucleotides on the left and right are connected by a phosphorothioate diester bond.

11. A targeted drug delivery system, characterized in that: The targeted drug delivery system comprises a targeting group, a linking group, and the nucleic acid according to any one of claims 1 to 10 connected to the targeting group via the linking group.

12. The targeted drug delivery system according to claim 11, wherein: The linking group is connected to the 3' end or 5' end of the sense strand or antisense strand of the nucleic acid.

13. The targeted drug delivery system according to claim 11 or 12, wherein: The targeted drug delivery system comprises a ligand and the nucleic acid connected to the ligand; preferably, the ligand is a GalNAc derivative; more preferably, the ligand is one or more GalNAc derivatives connected by single-stranded, double-stranded or triple-stranded branched linkers.

14. The targeted drug delivery system according to claim 11, wherein: The structure of the targeted drug delivery system is shown below: In the formula, Nu represents the nucleic acid.

15. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the nucleic acid according to any one of claims 1 to 10 or the targeted drug delivery system according to any one of claims 11 to 14 and a pharmaceutically acceptable carrier.

16. A method for inhibiting the expression of 17-β-hydroxysteroid dehydrogenase 13 gene in a cell, the method comprising: The cell is contacted with the nucleic acid according to any one of claims 1 to 10, the targeted drug delivery system according to any one of claims 11 to 14, or the pharmaceutical composition according to claim 15 to inhibit the expression of the 17-β-hydroxysteroid dehydrogenase 13 gene in the cell.

17. Use of the nucleic acid according to any one of claims 1 to 10, the targeted drug delivery system according to any one of claims 11 to 14, or the pharmaceutical composition according to claim 15 in any of the following aspects: 1) Treating and / or preventing diseases related to 17-β-hydroxysteroid dehydrogenase 13; 2) Preparation of drugs for treating and / or preventing diseases associated with 17-β-hydroxysteroid dehydrogenase 13.

18. The use according to claim 17, wherein The diseases are: (i) a disease associated with increased or elevated levels of 17-β-hydroxysteroid dehydrogenase 13; or (ii) Diseases that would benefit from reduced expression of 17-β-hydroxysteroid dehydrogenase 13.

19. The use according to claim 17, wherein The disease is selected from one or more of the following: non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, liver fibrosis, alcoholic steatohepatitis, alcoholic fatty liver disease, cirrhosis, hepatitis, hepatitis C virus-related cirrhosis, drug-induced liver damage, and hepatocellular necrosis.

20. The use according to claim 17, wherein The nucleic acid, the targeted drug delivery system or the pharmaceutical composition is administered to a subject by subcutaneous administration, intravenous administration and / or intramuscular administration.

Images