Nucleic acid targeting angiotensinogen and use thereof

Abstract

A nucleic acid targeting angiotensinogen and a use thereof. The nucleic acid can effectively inhibit the expression of AGT, and can effectively reduce the activation degree of RAAS, so that the nucleic acid can be used for treating and / or preventing diseases related to AGT, such as hypertension.

Description

Nucleic acid targeting angiotensinogen and its use

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This invention claims priority to Chinese patent application No. 202310718430.6 filed on June 16, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of biotechnology, and in particular relates to a nucleic acid targeting angiotensinogen and uses thereof. Background Art

[0004] The renin-angiotensin-aldosterone system (RAAS) is a complex regulatory network composed of multiple proteases and short peptides. It is a key regulator of cardiovascular and renal function. Overactivation of this system is a central link in many common pathological conditions, including hypertension, heart failure, and kidney disease (Lu H et al. Hypertension Res. 39:492-500, 2016). The RAAS pathway begins with renin breaking down its substrate angiotensinogen to produce the inactive peptide angiotensin I (Ang I). Angiotensin-converting enzyme (ACE) in endothelial cells then converts Ang I to angiotensin II (Ang II). ACE activation of Ang II is most extensive in the lungs. Ang II mediates vasoconstriction and the release of aldosterone from the adrenal glands, leading to sodium retention and increased blood pressure.

[0005] RAAS inhibitors include ACE inhibitors, angiotensin II receptor blockers (ARBs), aldosterone antagonists and direct renin inhibitors. RAAS inhibitors are currently important drugs for the treatment of hypertension, prevention and treatment of heart failure, and are widely used clinically (Schmieder RE et al. Lancet. 369(9568):1208-1219; Antonaccio MJ. J Pharmcol. 14:29-45, 1983; Ruiz-Ortega M et al. Trends Cardiovasc Med. 17(1):19-25, 2007; Matsubara H. Cric Res. 83(12):1182-1191, 1998). ACE inhibitors and Ang II receptor antagonists can activate compensatory pathways, leading to reactivation of angiotensin and aldosterone clearance, causing blood Ang II and aldosterone concentrations to return to pre-treatment levels or even higher (Nobakht N et al. Nat Rev Nephrol. 7:356-359, 2011; Bomback AS and Klemmer PJ. Nat Clin Pract Nephrol. 3:486-492, 2007). This may be an important factor in the poor response of patients with resistant hypertension and heart failure to RAAS inhibitory drugs (Narayan H and Webb DJ. Curr Hypertens Rep. 18:34, 2016, Roig E et al. Eur Heart J. 21:53-57, 2000). Therefore, a more effective treatment strategy should be to target the upstream of RAAS enzymes and receptors to avoid compensatory mechanisms and intracellular secretory pathways that limit the therapeutic effect (Mullick AE et al. Hypertension. 70(3):566-576, 2017).

[0006] Angiotensinogen (AGT, also known as SERPINA8, ANHU, hFLT1) is the common precursor of all angiotensin (Wu C et al. Am J Med Sci. 4:183-190, 2011; Lu H et al. Hypertens Res 39:492-500, 2016), and the liver is the main source of blood AGT (Yiannilouris G et al. Hypertension. 66:836-842, 2015; Matsusaka T et al. J Am Soc Nephrol. 23:1181-1189, 2012). Multiple studies have confirmed that increased blood AGT concentration is significantly positively correlated with hypertension (Fasola AF et al. J Appl Physiol. 21: 1709-1712, 1966), lowering blood AGT concentration can inhibit the activity of the RAAS pathway and lead to a decrease in blood pressure (Olearczyk J et al. Hypertension Res. 37: 405-412, 2014), intravenous infusion of AGT into rats can increase blood pressure, which can be reversed by treatment with anti-AGT antibodies (Menard J et al. Hypertension. 18: 705-707, 1991), AGT-knockout mice have reduced blood pressure, while AGT-overexpression leads to increased blood pressure (Kim HS et al. Proc Natl Acad Sci USA 92: 2735-2739, 1995; Kimura S et al. Embo J. 11: 821-827, 1982). Treating hypertension by regulating AGT levels is a promising research and development target. However, targeting AGT using traditional methods encounters many difficulties (Morgan L et al. Int J Biochem Cell Biol. 28: 1211-1222, 1996).

[0007] RNA interference (RNAi) refers to a highly conserved phenomenon in evolution where double-stranded small interfering RNA (siRNA) induces efficient and specific degradation of homologous mRNA. Therefore, the research and development of siRNA targeting AGT is of great significance.

[0008] Summary of the Invention

[0009] The purpose of the present invention is to overcome the problems existing in the prior art and provide a new nucleic acid targeting AGT and its use.

[0010] The first aspect of the present invention provides a nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand contains a sequence having more than 80% sequence identity with the sequence shown in any one of SEQ ID NOs: 1-26, and the antisense strand contains a sequence having more than 80% sequence identity with the sequence shown in any one of SEQ ID NOs: 27-52.

[0011] A second aspect of the present invention provides a targeted drug delivery system, which comprises a targeting group, a linking group, and the nucleic acid as described above connected to the targeting group via the linking group.

[0012] The third aspect of the present invention provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system as described above and a pharmaceutically acceptable carrier.

[0013] A fourth aspect of the present invention provides a method for inhibiting the expression of angiotensin gene in a cell, the method comprising: contacting the cell with the nucleic acid, targeted drug delivery system or pharmaceutical composition as described above to inhibit the expression of angiotensin gene in the cell.

[0014] The fifth aspect of the present invention provides the use of the nucleic acid, targeted drug delivery system or pharmaceutical composition as described above in any of the following aspects: 1) treating and / or preventing diseases related to angiotensin; 2) preparing drugs for treating and / or preventing diseases related to angiotensin.

[0015] The inventors of the present invention have discovered that AGT is a highly suitable target for RNAi within the renin-angiotensin-aldosterone system. Therefore, the present invention provides novel AGT-targeting nucleic acids and their uses. These nucleic acids can effectively inhibit AGT expression and reduce RAAS activation, thus enabling the treatment and / or prevention of AGT-related diseases such as hypertension. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] FIG1 shows the efficacy of SN-682160, SN-682172, SN-682173, SN-682175, and SN-682176 in human AGT transgenic mice according to the examples of the present invention.

[0018] FIG2 shows the efficacy of SN-682726 and SN-682728 in human AGT transgenic mice according to an embodiment of the present invention.

[0019] FIG3 shows the efficacy of SN-682726 and SN-2073 in human AGT transgenic mice according to an embodiment of the present invention. DETAILED DESCRIPTION

[0020] The following describes specific embodiments of the present invention in detail. It should be understood that the specific embodiments described herein are intended only to illustrate and explain the present invention and are not intended to limit the present invention. Those skilled in the art may make various modifications and variations to the present invention without departing from the scope or spirit of the present invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.

[0021] Explanation of terms

[0022] Unless otherwise indicated, all terms (including technical and scientific terms) used to disclose the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. For further guidance, the following definitions are provided to better understand the teachings of the present invention. The terms used in this specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention.

[0023] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0024] As used herein, the terms "comprising," "including," and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0025] The recitation of numerical ranges herein by endpoints includes all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0026] Concentration values ​​used in this invention include fluctuations within a certain range. For example, fluctuations within a certain precision range are permitted. For example, for 2%, fluctuations within ±0.1% are permitted. For larger values ​​or values ​​that do not require overly precise control, greater fluctuations are permitted. For example, for 100 mM, fluctuations within ±1%, ±2%, ±5%, etc. are permitted. Regarding molecular weight, fluctuations within ±10% are permitted.

[0027] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0028] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0029] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0030] In the present invention, the terms "optionally," "optional," "optionally," "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If multiple "optional" or "optional" terms appear in a technical solution, unless otherwise specified and there are no contradictions or constraints, each "optional" or "optional" term is independent of the others.

[0031] In the present invention, the term "nucleic acid" refers to a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can degrade or inhibit (e.g., degrade or inhibit under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. The nucleic acid can act through an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism of mammalian cells (RNA-induced silencing complex or RISC)), or through any alternative mechanism or pathway. The scope of the nucleic acids disclosed herein, including sense and antisense strands, includes, but is not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates.

[0032] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown" when referring to the expression of a given gene mean that the expression of the gene is reduced when the cell, cell population, tissue, organ, or subject is treated with a nucleic acid described herein, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, compared to a second cell, cell population, tissue, organ, or subject that has not been so treated.

[0033] As used herein, "fully complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, all (100%) bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0034] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0035] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in the contiguous sequence of the first oligonucleotide hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first nucleotide sequence or the second nucleotide sequence.

[0036] In the present invention, when referring to "at least partially complementary", it means that the first oligonucleotide and the second oligonucleotide are partially complementary, substantially complementary or completely complementary in the hybridization pair of nucleobase or nucleotide sequence molecules.

[0037] As used herein, the term "treating" refers to methods or steps taken to provide relief or alleviation of the number, severity, and / or frequency of one or more disease symptoms in a subject. Such treatment may include prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject.

[0038] In the present invention, the term "linked" means that two compounds or molecules are joined by a covalent bond. Unless otherwise specified, as used herein, the term "linked" may refer to a connection between a first compound and a second compound with or without any intermediate atoms or groups of atoms.

[0039] Nucleic Acids

[0040] The present invention provides a (modified or unmodified) nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) or more sequence identity to the sequence of any one of SEQ ID NOs: 1 to 26, and the antisense strand comprises a sequence having 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) or more sequence identity to the sequence of any one of SEQ ID NOs: 27 to 52.

[0041] In some embodiments, the antisense strand has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0042] In some embodiments, the sense strand has 15 to 30 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides (bases).

[0043] In specific implementations, those skilled in the art can combine the sequences provided in the present invention in consideration of the complementarity of the sense strand and the antisense strand, thereby obtaining a combined nucleic acid (siRNA).

[0044] In a preferred embodiment of the present invention, as shown in Table 1, the nucleic acid is selected from at least one of siRNA-1 having a sense chain sequence of SEQ ID NO: 1 and an antisense chain sequence of SEQ ID NO: 27, siRNA-2 having a sense chain sequence of SEQ ID NO: 2 and an antisense chain sequence of SEQ ID NO: 28, siRNA-3 having a sense chain sequence of SEQ ID NO: 3 and an antisense chain sequence of SEQ ID NO: 29, siRNA-4 having a sense chain sequence of SEQ ID NO: 4 and an antisense chain sequence of SEQ ID NO: 30, siRNA-5 having a sense chain sequence of SEQ ID NO: 5 and an antisense chain sequence of SEQ ID NO: 31..., siRNA-24, siRNA-25, and siRNA-26.

[0045] In some preferred embodiments, the antisense strand contains at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides that differ from the sequence shown in any one of SEQ ID NOs: 27 to 52 by no more than 0, 1, 2 or 3 nucleotides, and the positive strand contains a nucleotide sequence that is at least partially complementary (e.g., partially complementary, substantially complementary or fully complementary) to the antisense strand.

[0046] In some preferred embodiments, the sense strand contains at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides that differ from the sequence of any one of SEQ ID NOs: 1 to 26 by no more than 0, 1, 2 or 3 nucleotides.

[0047] In the present invention, the sense strand and the antisense strand may have the same length or different lengths.

[0048] All nucleotide groups in the above nucleic acid may be chemically unmodified, or may contain at least one modified nucleotide group, and the modification may be on the nucleotide at any position.

[0049] In some embodiments, the sense and antisense strands can be partially complementary, substantially complementary, or fully complementary to each other.

[0050] In some preferred embodiments, the antisense strand comprises a nucleotide sequence that differs by 0, 1, or 2 nucleotides from the sequence of any one of SEQ ID NOs: 29, 32, 38, 40, 41, 42, 43, and 44, and the sense strand comprises a nucleotide sequence that is at least partially complementary (e.g., partially complementary, substantially complementary, or completely complementary) to the antisense strand. When the antisense strand has the above sequence, the double-stranded RNA has a significantly better inhibitory effect on AGT.

[0051] In some preferred embodiments, the sense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 3, 6, 12, 14, 15, 16, 17, and 18 by 0, 1, or 2 nucleotides.

[0052] In some more preferred embodiments, the antisense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 29, 40, 41, 43, and 44 by 0, 1, or 2 nucleotides, and the positive strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0053] In some preferred embodiments, the sense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 3, 14, 15, 17, and 18 by 0, 1, or 2 nucleotides.

[0054] In some further preferred embodiments, the antisense strand comprises a nucleotide sequence that differs from the sequence of SEQ ID NO: 40 by 0, 1, or 2 nucleotides, and the sense strand comprises a nucleotide sequence that is at least partially complementary (e.g., partially complementary, substantially complementary, or completely complementary) to the antisense strand. When the antisense strand comprises this sequence, double-stranded RNAs with various modifications all exhibit superior inhibitory effects on AGT.

[0055] In some preferred embodiments, the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 14 by 0, 1 or 2 nucleotides.

[0056] In some preferred embodiments, the GC content of the nucleic acid is 20-45%, more preferably 20-35%.

[0057] In some embodiments, even if the sequence identity of the sense or antisense strand of the nucleic acid to the corresponding sequence mentioned herein is less than 100% or differs by more than one nucleotide, the nucleic acid still exhibits an inhibitory effect on AGT similar to or comparable to the corresponding sequence. For example, the UU residue at the 3' end of the antisense strand of the nucleic acid is replaced with AA, CC, GG, or UG, or a combination of any two nucleic acids. Such nucleic acid sequences also fall within the scope of protection of the present invention.

[0058] The above-mentioned technical solutions for naked sequences (i.e., unmodified sequences) mentioned in the present invention have advantages that are independent of the modification method or the choice of targeting vector. The following describes applicable modification solutions and further preferred modification solutions:

[0059] According to the nucleic acid of the present invention, the nucleic acid contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group and a base. Preferably, the nucleic acid contains at least one modified nucleotide group. The modified nucleic acid has an inhibition efficiency of AGT of not less than 50% (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%).

[0060] According to the nucleic acid of the present invention, wherein the modified nucleotide group is a nucleotide group in which a phosphate group and / or a ribose group is modified. The modified site can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of the sense strand and / or the antisense strand.

[0061] For example, phosphate group modification involves the modification of the oxygen in the phosphate group, including phosphorothioate and boranophosphate modifications. As shown in the formulas below, the oxygen in the phosphate group is replaced with sulfur, borane, amine, alkyl, or alkoxy groups. These modifications stabilize the structure of nucleic acids and maintain high base pairing specificity and affinity.

[0062] In the above structural formula, BASE represents the base A, U, C, G, or T. X can be oxygen (O) or sulfur (S). R in the above structure can be the same or different, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, amino, cyanoethyl, acetyl, etc. R' and R" can each independently be hydrogen (H), methyl (CH3), ethyl (CH2CH3), propyl (CH2CH2CH3), isopropyl (CH(CH3)2), allyl, propargyl, acyloxybenzyl, or acyloxyethyl.

[0063] Ribose modification refers to modifications to the 2'-hydroxyl group (2'-OH) of the ribose group. The introduction of certain substituents, such as methoxy or fluorine, at the 2'-hydroxyl position of the ribose group makes the nucleic acid less susceptible to cleavage by ribonucleases, thereby increasing its stability and making it more resistant to nuclease hydrolysis. Modifications of the 2'-hydroxyl group in nucleotide pentoses include 2'-fluoro modification (such as 2'-arabino-fluoro modification), 2'-methoxy modification (2'-OME), 2'-methoxyethyl modification (2'-MOE), 2'-2,4-dinitrophenol modification (2'-DNP modification), 2',4'-constrained ethyl modification, 2'-amino modification, 2'-deoxy modification, BNA, acyclic nucleic acid modification, staggered nucleic acid modification, and L-type nucleic acid modification. BNA (internal ring bridged nucleotide) refers to a constrained or inaccessible nucleotide. BNA can contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C 3'-endo sugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose ring to provide a 2', 4'-BNA nucleotide, such as a locked ethyl modification (LNA), a ring locked ethyl modification (ENA) and an ethyl locked nucleic acid modification (cET BNA). Acyclic nucleic acids are nucleotides formed by opening the sugar ring of the nucleotide, such as unlocked nucleic acid (UNA) nucleotides and glycerol nucleic acid (GNA) nucleotides. Misplaced nucleic acid modification refers to the replacement of a 3', 5'-phosphate bond link by a 2', 5'-phosphate bond chain. L-type nucleic acid modification refers to the replacement of a naturally occurring D-type nucleic acid with its mirror image stereo equivalent, an L-type nucleic acid.

[0064] Wherein, BASE represents the base A, U, C, G or T. R in the above structure can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, acetyl, etc.

[0065] According to the nucleic acid of the present invention, preferably, the nucleotide group in which the ribose group is modified is a nucleotide group in which the 2'-OH of the ribose group is substituted by a methoxy group or a fluorine group.

[0066] According to a particularly preferred embodiment of the present invention, the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is a nucleotide group in which the ribose group is modified, that is, the 2'-OH of the ribose group in the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is replaced by a methoxy group or a fluorine. More preferably, the 3' end of the sense strand and the antisense strand of the nucleic acid can be connected with dTdT; or, the 3' end of the antisense strand of the nucleic acid can be connected with AA or UU or a combination of any two nucleic acids (which can be but is not limited to CC, GG or UG), so that the sequence has a specific inducement to mRNA degradation. The nucleic acid with the above modifications shows a more excellent inhibitory effect in vivo, and the above modifications can further reduce the immunogenicity of the nucleic acid of the present invention in vivo.

[0067] The nucleic acids of the present invention may also include modifications that include a nucleoside monophosphate attached to the 5' end of the antisense strand. The 5'-monophosphate at the terminal end of the siRNA guide strand is important for RISC recognition. Phosphorylation of the 5'-hydroxyl group plays a role in the effective loading of siRNA onto Ago2 within cells. The monophosphate at the 5' end of the siRNA guide strand interacts with Argonaute-2 (Ago2) through H-bonding, thereby ensuring accurate targeting and precise cleavage of the mRNA target. Commonly used 5'-monophosphate nucleoside derivatives include the following. These phosphate nucleoside derivatives have been shown to exhibit a certain degree of stability in biological metabolic media and to be effective in promoting the loading of siRNA guide strands onto Ago2 within cells (Nucleic Acids Research, 2015, 43, 2993–3011). In the nucleic acids of the present invention, trans-vinyl phosphate (VP) is preferably used as the primary moiety, but monophosphate nucleoside derivatives other than those mentioned above may also be included.

[0068] In the above structures, BASE represents the base A, U, C, G, or T. R in the above structures can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, amino, acetyl, etc.

[0069] In some embodiments, at least one nucleotide in the nucleic acid is a modified nucleotide or includes a modified linkage.

[0070] In some preferred embodiments, the modified nucleotides are selected from one or more of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-open ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides and 3'-O-methyl nucleotides; the modified nucleotides are further preferably selected from one or more of 2'-O-methyl nucleotides and 2'-fluoro nucleotides.

[0071] In some preferred embodiments, the modified internucleotide bond is preferably selected from one or more of a thiophosphate internucleotide bond and a methylphosphonate internucleotide bond; the modified internucleotide bond is further preferably selected from one or more of a thiophosphate monoester internucleotide bond and a thiophosphate diester internucleotide bond.

[0072] In some embodiments, the 5th and 6th nucleotides of the antisense strand, counted from the 5' end, are 2'-O-methyl nucleotides, and the 7th nucleotide is a 2'-fluoro nucleotide. Based on any of the sequences mentioned in the present invention, by performing the above modifications on the antisense strand, the inhibitory effect of siRNA on AGT can be further significantly improved.

[0073] In some preferred embodiments, the antisense strand contains two phosphorothioate internucleotide bonds at the 5' and 3' ends respectively, and the 1st, 2nd, 7th, 9th, 14th and 16th nucleotides counted from the 5' end are 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

[0074] In some embodiments, the second nucleotide from the 5' end of the sense strand is a 2'-O-methyl nucleotide or a 2'-fluoro nucleotide, preferably a 2'-O-methyl nucleotide. By modifying the sense strand as above, the inhibitory effect of siRNA on AGT can be further improved.

[0075] In some preferred embodiments, the 5' end of the sense strand contains two phosphorothioate internucleotide bonds, and the 4th, 7th, 9th, 10th and 11th nucleotides counted from the 5' end are 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

[0076] In some embodiments, the antisense strand has at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides that differ from the antisense strand sequence as shown in any one of Tables 3 or 8 by no more than 0, 1, 2, or 3 nucleotides, and the sense strand has at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the sense strand sequence as shown in any one of Tables 3 or 8 by no more than 0, 1, 2, or 3 nucleotides.

[0077] In some embodiments, the sense strand and the antisense strand form an siRNA having any one of the sequences shown in Table 4 or Table 8.

[0078] In some embodiments, the antisense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs from the following nucleotide sequence by 0, 1, or 2 nucleotides:

[0079] AfsCfsacuuUfuUfuguuUfcAfcaaacsasa;

[0080] The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand.

[0081] In some embodiments, the sense strand comprises a nucleotide sequence from the 5' end to the 3' end that differs by 0, 1, or 2 nucleotides from any of the following nucleotide sequences:

[0082] gsusuUfguGfaAfAfCfaaaaaagugu;

[0083] gsUfsuUfguGfaAfAfCfaaaaaagugu;

[0084] In each sequence of the present invention, a nucleotide represented by a lowercase letter represents a 2'-O-methyl nucleotide; f represents that the nucleotide adjacent to the left is a 2'-fluoro-modified nucleotide; s represents that the two adjacent nucleotides on the left and right are connected by a phosphorothioate diester bond.

[0085] The nucleic acids according to the present invention can be obtained by conventional methods in the art, such as solid phase synthesis and liquid phase synthesis. Solid phase synthesis is commercially available on a custom basis and can therefore be purchased commercially. The modified nucleotide groups can be introduced by nucleotide monomers having corresponding modifications.

[0086] Based on the nucleic acid (siRNA) synthesized above, the present invention can further construct an shRNA expression plasmid having the same or similar function as the above siRNA. The method for constructing the expression plasmid is well known to those skilled in the art and will not be described in detail here.

[0087] The present invention also provides a targeted gene site of the nucleic acid as described above. In some embodiments, the targeted gene site is as marked in any one of the first columns of Table 1.

[0088] Table 1

[0089] Note: The first column indicates the position of the first base of the targeted gene in the AGT gene sequence, and so on; the numbers in the second and fourth columns indicate the sequence numbers, for example, "1" indicates SEQ ID NO: 1.

[0090] Coding sequence of human AGT (NM_001382817.3, SEQ ID NO: 53):

[0091] Targeted drug delivery system

[0092] The present invention also provides a targeted drug delivery system, characterized in that the targeted drug delivery system comprises a targeting group, a linking group and the nucleic acid as described above connected to the targeting group via the linking group.

[0093] Wherein, the targeting group can further improve the targeting of small nucleic acids and can be provided by monosaccharides (such as glucose, mannose, allose, altrose, galactose, galactosamine, N-acetylgalactosamine, talose, fructose, idose, etc.) and / or polypeptides (such as proteins, monoclonal antibodies, nanobodies). The linking group can be selected from -O-[CH2CH2O]n-, -[CH2]m-CONH-[CH2]nO-, -O-[CH2CH2O]m-CONH-[CH2]nO-, -O-[CH2]m-CONH-[CH2H2O]nO-. Wherein, m and n can each independently be an integer from 1 to 10.

[0094] In conjunction with common sense in the art, nucleic acid (siRNA) of the present invention, when applied to different targeted drug delivery systems, all has preferably inhibitory effect. In other words, the naked sequence and modified sequence that want to be protected in the present invention, its effect does not depend on the selection of targeting vector. In order to further improve the bioavailability and therapeutic effect of siRNA, the present invention has also been optimized to the targeted drug delivery system, and has obtained the following technical scheme.

[0095] In some embodiments, the linker is linked to the 3' end or the 5' end of the sense strand or the antisense strand of the nucleic acid.

[0096] In some specific embodiments, the linker is attached to the 3' end of the sense strand of the nucleic acid.

[0097] In some embodiments, the targeted drug delivery system comprises a ligand and the nucleic acid linked to the ligand.

[0098] In some embodiments, the ligand is a GalNAc derivative.

[0099] In some embodiments, the ligand is one or more GalNAc derivatives connected by a single-stranded, double-stranded, or triple-stranded branched linker.

[0100] In some preferred embodiments, the structure of the targeted drug delivery system is shown in Formula I below:

[0101] In Formula I, Nu represents the nucleic acid (siRNA). In some embodiments, the compound portion of the system can be connected to the 5' end or 3' end of the sense strand of the siRNA via a phosphodiester bond, or can be connected to the 5' end or 3' end of the antisense strand of the siRNA via a phosphodiester bond. This targeted drug delivery system utilizes the structural characteristics on its left side to improve the cell penetration ability of the nucleic acid drug (Nu), enhance its intracellular stability, and has a simple preparation process and strong practicality.

[0102] Pharmaceutical composition

[0103] The present invention also provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system as described above and a pharmaceutically acceptable carrier.

[0104] The pharmaceutical composition can be prepared from the nucleic acid and the pharmaceutically acceptable carrier by conventional methods. For example, the pharmaceutical composition can be an injection. The injection can be used for subcutaneous, intramuscular, or intravenous injection.

[0105] According to the pharmaceutical composition of the present invention, there are no special requirements for the amount of the nucleic acid or targeted drug delivery system and the pharmaceutically acceptable carrier. Generally, relative to 1 part by weight of the nucleic acid (or 1 part by weight of the targeted drug delivery system calculated as nucleic acid), the content of the pharmaceutically acceptable carrier can be 1-100,000 parts by weight (such as 1 part by weight, 5 parts by weight, 10 parts by weight, 50 parts by weight, 100 parts by weight, 500 parts by weight, 1,000 parts by weight, 5,000 parts by weight, 10,000 parts by weight, 50,000 parts by weight, 100,000 parts by weight or any value between any two of the above values).

[0106] According to the pharmaceutical composition of the present invention, wherein the pharmaceutically acceptable carrier can be various carriers conventionally used in the art, for example, can include at least one of a pH buffer, a protective agent and an osmotic pressure regulator. The pH buffer can be a tris hydroxymethylaminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. The protective agent can be at least one of inositol, sorbitol and sucrose. Based on the gross weight of the pharmaceutical composition, the content of the protective agent can be 0.01-30 weight % (such as 0.01 weight %, 0.05 weight %, 0.1 weight %, 0.5 weight %, 1 weight %, 5 weight %, 10 weight %, 15 weight %, 20 weight %, 25 weight %, 30 weight % or any value between any two of the above values). The osmotic pressure regulator can be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition be 200-700 mOsmole / kg. According to the desired osmotic pressure, those skilled in the art can determine the content of the osmotic pressure regulator.

[0107] According to a preferred embodiment of the present invention, the pharmaceutically acceptable carrier is a liposome. The liposome can be any liposome capable of encapsulating nucleic acid, and its diameter can be 25-1000 nm, and can include but not limited to cholesterol and its analogs or derivatives.

[0108] The dosage of the pharmaceutical composition of the present invention can be a conventional dosage in the art, and can be determined based on various parameters, particularly the age, weight, and sex of the subject. For example, for female mice aged 3-4 months and weighing 25-30 g, the dosage of the pharmaceutical composition can be 0.01-100 mg / kg body weight, preferably 1-10 mg / kg body weight, based on the amount of the nucleic acid in the pharmaceutical composition.

[0109] Methods and uses

[0110] The present invention also provides a method for inhibiting the expression of angiotensin gene in a cell, the method comprising: contacting the cell with the nucleic acid, the targeted drug delivery system or the pharmaceutical composition as described above, to inhibit the expression of angiotensin gene in the cell.

[0111] In some embodiments, the cell is in a subject, eg, a human subject, eg, a subject suffering from an angiotensinogen (AGT)-related disease.

[0112] In some embodiments, the cells are located in vitro. The methods are for research purposes or for constructing animal models.

[0113] In some embodiments, contacting the cell with the nucleic acid inhibits expression of AGT by at least 50%, 60%, 70%, 80%, 90%, 95% (e.g., compared to the level of AGT expression before the cell is first contacted with the nucleic acid; e.g., before the first dose of the nucleic acid is administered to the subject). In certain embodiments, inhibiting expression of AGT reduces the level of AGT protein in a serum sample of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%, e.g., compared to the level of AGT expression before the cell is first contacted with the nucleic acid.

[0114] The present invention also provides uses of the nucleic acid, targeted drug delivery system or pharmaceutical composition described above in any of the following aspects: 1) treating and / or preventing diseases associated with angiotensin; 2) preparing drugs for treating and / or preventing diseases associated with angiotensin.

[0115] In some embodiments, the disease is: (i) a disease associated with increased or elevated levels of angiotensin activity; or (ii) a disease that would benefit from decreased angiotensinogen expression.

[0116] In some embodiments, the disease is a disease associated with overactivation of the renin-angiotensin-aldosterone system (RAAS). In some specific embodiments, "diseases associated with overactivation of the RAAS system" can include hypertension, heart failure, kidney disease, Alzheimer's disease, ophthalmological diseases, etc.

[0117] In some embodiments, the disease is selected from the group consisting of hypertension, hypertension, critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension), hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; one or more of hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus), and metabolic syndrome.

[0118] In the present invention, the subject can be a mammal, including primates (such as humans, non-human primates, such as monkeys and chimpanzees), non-primates (such as cattle, pigs, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats or mice) or birds. In some embodiments, the subject is preferably a primate, more preferably a human. Administration can be carried out in a variety of ways, depending on whether local treatment or systemic treatment is required. The mode of administration can be, but is not limited to, intravenous administration, intra-arterial administration, subcutaneous administration, intraperitoneal administration, transdermal administration (such as by implantation of a device) and administration into soft tissue. The dosage can be referred to above and will not be repeated here.

[0119] In some embodiments, the nucleic acid, the targeted drug delivery system, or the pharmaceutical composition is administered to the subject by subcutaneous administration, intravenous administration, and / or intramuscular administration.

[0120] Example

[0121] The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. For experimental methods in the following examples where specific conditions are not specified, reference is made to the guidance provided in the present invention, and may also be made to experimental manuals or conventional conditions in the art, other experimental methods known in the art, or conditions recommended by the manufacturer.

[0122] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0123] Example 1 siRNA sequence screening

[0124] Double-stranded siRNA can enter cells and be incorporated into the RISC complex. In the RISC complex, the double-stranded siRNA is unwound by the endonuclease Ago2, leaving only the antisense strand for recognizing the target mRNA. It is generally believed that a GC content of 35-55% is the best choice for siRNA. The GC content is also related to the melting temperature of the siRNA. However, siRNA with a lower GC content may be able to unwound the double-stranded siRNA faster or more efficiently due to its thermal stability. The siRNA sequences designed by the present invention (as shown in Table 2) include those with a lower GC content to better select siRNA.

[0125] Table 2

[0126] Among them, the preferred sequence is GUUUGUGAAACAAAAAAGUGU, which has a GC content of 28.6%.

[0127] The sense and antisense strand sequences corresponding to the above sequences are shown in Table 1.

[0128] In this example, each sense strand and antisense strand was further modified, and the modified sequences are shown in Table 3.

[0129] Table 3

[0130] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0131] The sense strand and antisense strand in Table 2 were synthesized into the modified double-stranded siRNA in Table 4 by solid phase synthesis.

[0132] Table 4

[0133] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0134] Add 0.5 ml of cell culture medium (DMEM, 10% calf serum, 1% penicillin + streptomycin solution) containing 10 4Hep3B (Procell, Cat# CL-0102) cells were cultured overnight at 37°C, 5% CO2 in a cell culture incubator. RNAiMAX (1.5 μL / well) and the small interfering RNAs (siRNAs) listed in Table 3 were added to Opti-MEM medium to a final concentration of 1 nM or 10 nM per well. The cells were incubated for 48 hours at 37°C, 5% CO2. To extract RNA, the cell culture supernatant was aspirated, washed with PBS, and then 50 μL of the prepared lysis buffer (as recommended in the Cells-to-CT Kit (ThermoFisher Scientific, Cat# 4391851c)) was added and mixed. After 10 minutes of lysis, 2.5 μL of Stop solution was added for 2 minutes. RT-PCR was performed according to the High Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific, Cat# 4368814), with 10 ml of lysis buffer per reaction. Gene expression was quantified by real-time fluorescence PCR using the TaqMan probe for human AGT, Hs00174854_m1, and the probe for the internal reference gene (human HPRT1), Hs02800695_m1 (Thermo Fisher Scientific, Waltham, MA, USA). PCR conditions were 1 cycle at 95°C for 20 seconds, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds. The real-time fluorescence PCR instrument was a QuantStudio TM 6 Pro Real-Time PCR System (Thermo Fisher). AGT gene expression was calculated using 2-ΔΔCt, with human HPRT1 gene expression serving as an internal reference. AGT gene expression is expressed relative to the control group treated with RNAiMAX alone. Results are shown in Table 5.

[0135] Table 5

[0136] To further determine the activity of siRNA, the siRNA with better effects in Table 5 was conjugated with Tri-GalNAc (its specific structure is shown in the aforementioned Formula I, and the sequence after conjugation is shown in Table 6). A dose-response experiment was then conducted in human primary hepatocytes. The siRNA-GalNAc samples were dissolved in 100 μL of enzyme-free sterile water to form a 100 μM solution. 30 μL of the 100 μM test solution was added to 70 μL of inVitroGRO Plating Medium and diluted to a 30 μM solution as a working solution for the 30 nM final concentration group. The 30 μM test solution was then diluted three-fold with inVitroGRO Plating Medium at eight concentration points, resulting in final working solution concentrations of 4.6, 13.7, 41.2, 123.4, 370.4, 1111.1, 3333.3, and 10000 nM. Primary human hepatocytes were removed from liquid nitrogen, thawed and revived at 37°C, washed and counted in serum-containing inVitroGRO Plating Medium, and centrifuged. The supernatant was removed, and the cells were diluted to 300k / mL in fresh serum-containing inVitroGRO Plating Medium. 90μL of this diluted cell suspension was plated onto a 96-well cell culture plate, with 30k cells per well. Prepared sample working solution was added to the cell suspension to final concentrations of 0.46, 1.37, 4.12, 12.34, 37.04, 111.11, 333.33, and 1000nM. The cells were then incubated at 37°C in a 5% CO2 incubator for 48 hours. After 48 hours, all medium was aspirated from the 96-well plate, and the plate was washed with 1× PBS buffer. 50μL of prepared Cells to CT lysis buffer (as recommended by the manufacturer) was added, mixed, and allowed to stand for 10 minutes. Then, 2.5μL of stop solution was added for 2 minutes. RT-PCR was performed according to the High Capacity cDNA Reverse Transcription Kits (Thermo Fisher, Catalog No. 4368814). Each reaction contained 10 ml of lysate. Gene expression was quantified using real-time fluorescence PCR. The TaqMan probe for human AGT was Hs00174854_m1, and the probe for the internal reference gene (human HPRT1) was Hs02800695_m1 (Thermo Fisher Scientific, Waltham, MA, USA). PCR conditions were 1 cycle at 95°C for 20 seconds, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds. The real-time PCR instrument was a QuantStudio TM6 Pro Real-Time PCR System (Thermo Fisher). AGT gene expression was calculated using 2-ΔΔCt, with human HPRT1 gene expression serving as an internal reference. AGT gene expression was expressed as a percentage of the control group containing cells cultured only, and IC50 values ​​were calculated (see Table 7).

[0137] Table 6

[0138] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0139] Table 7

[0140] To further validate the efficacy of siRNA, SN-682160, SN-682172, SN-682173, SN-682175, and SN-682176 were subcutaneously injected into human AGT transgenic mice at a dose of 10 mg / kg. Blood samples were collected on day 10 to measure the level of residual AGT protein in plasma. The results are shown in Figure 1. As can be seen from Figure 1, SN-682172 knocked down AGT protein levels to below 90% on day 10.

[0141] Example 2 Optimization of siRNA modification methods

[0142] In order to further increase the activity of siRNA, siRNA was further modified according to Table 8.

[0143] Table 8

[0144] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; s = phosphorothioate diester bond.

[0145] To further confirm the activity of the siRNAs, a dose-response experiment was performed in human primary hepatocytes using the same method as above. The absolute IC50 values ​​for reducing AGT expression are shown in Table 9.

[0146] Table 9

[0147] Example 3 Verification of the in vitro effect of siRNA

[0148] To further validate the efficacy, the preferred siRNA drug was compared with SN-2073 in primary human hepatocytes. The siRNAs involved are shown in Table 10. SN-2073, used for comparison, was prepared according to the disclosure of US11015201B2. The experimental procedures in primary human hepatocytes were similar to those used in the previous experiments. AGT gene expression, expressed as a percentage of the vehicle-only control, is shown in Table 11.

[0149] Table 10

[0150] In the table, a / c / g / u = 2'-OMe nucleotides; Af / Cf / Gf / Uf = 2'-F nucleotides; Tgn = thymidine glycol; s = phosphorothioate diester bond. SN-682726 and SN-682728 use the structure shown in Formula I, and the Tri-galNac used in SN-2073 is Alnylam Tri-GalNAc (L96). Both the structure shown in Formula I and L96 are classified as triantennary N-acetylgalactosamine. Therefore, the following efficacy data confirms the advantages of the modified sequences of the present invention.

[0151] Table 11

[0152] From the free uptake experiment in human primary hepatocytes, it was found that SN-682726 and SN-682728 of the present invention have better activity than SN-2073.

[0153] Example 4 Verification of the in vivo effect of siRNA

[0154] To further verify the activity of siRNA, human AGT transgenic mice were subcutaneously injected with 1, 3, or 10 mg / kg of SN-682726 or SN-682728 on day 0, respectively. PBS was used as a blank control group. The human AGT protein in the blood was then tracked and observed. The results are shown in Figure 2.

[0155] As shown in Figure 2, both SN-682726 and SN-682728 can significantly reduce AGT protein levels and have a relatively long-lasting efficacy. Among them, SN-682726 has a better efficacy.

[0156] To further verify the effect of modification on drug efficacy, SN-682726 was compared with SN-2073 as a control in human AGT transgenic mice. Mice were subcutaneously injected with 1, 3, or 10 mg / kg of SN-682726 or SN-2073 on day 0, respectively, with PBS as a blank control group. The human AGT protein in the blood was then tracked and observed. The results are shown in Figure 3.

[0157] As can be seen from Figure 3, SN-682726 maintained its efficacy longer than its counterpart SN-2073 compound in all dose groups, with a 40% knockdown effect still observed 130 days after injection. In contrast, the AGT protein level in the SN-2073 group had returned to baseline 110 days after injection, demonstrating the superior efficacy of SN-682726.

[0158] Furthermore, it should be noted that the efficacy advantages of the siRNA drugs of the present invention are not dependent on the choice of targeting vector. When TriGalNAc is replaced with other available vectors (such as the aforementioned L96), the resulting siRNA drugs still exhibit the aforementioned significant efficacy advantages compared to SN-2073 in both in vitro cell assays and in vivo experiments. For example, replacing the TriGalNAc of SN-682726 with L96 still achieved a superior AGT expression silencing effect compared to SN-2073 in primary monkey hepatocytes, as shown in Table 12.

[0159] Table 12

[0160] The modified version of SN-682726 was also applied to SN-2073, such as SN-683015 in Table 13. It was found that SN-683015 had better efficacy than SN-2073 in primary monkey hepatocytes. The results are shown in Table 14.

[0161] Table 13

[0162] Table 14

[0163] In addition, the unmodified sequence of SN-682726 (SN-122726) and the unmodified sequence of SN-2073 (SN-122073, Table 15) were also compared in Hep3B cells at three concentrations (0.1, 1, and 10 nM). The results are shown in Table 16. It can be seen that the unmodified SN-122726 of the present invention is more effective in reducing AGT expression levels.

[0164] Table 15

[0165] Table 16

[0166] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A nucleic acid comprising a sense strand and an antisense strand, characterized in that: The sense strand contains a sequence having more than 80% sequence identity with a sequence shown in any one of SEQ ID NOs: 1 to 26, and the antisense strand contains a sequence having more than 80% sequence identity with a sequence shown in any one of SEQ ID NOs: 27 to 52.

2. The nucleic acid according to claim 1, wherein The antisense strand contains at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sequence shown in any one of SEQ ID NOs: 27 to 52, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the sequence shown in any one of SEQ ID NOs: 1 to 26.

3. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs by 0, 1 or 2 nucleotides from the sequence shown in any one of SEQ ID NOs: 29, 32, 38, 40, 41, 42, 43, and 44, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains a nucleotide sequence that differs by 0, 1 or 2 nucleotides from the sequence shown in any one of SEQ ID NOs: 3, 6, 12, 14, 15, 16, 17, and 18.

4. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 29, 40, 41, 43, and 44 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains a nucleotide sequence that differs from the sequence shown in any one of SEQ ID NOs: 3, 14, 15, 17, and 18 by 0, 1 or 2 nucleotides.

5. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 40 by 0, 1 or 2 nucleotides, and the sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; optionally, the sense strand contains a nucleotide sequence that differs from the sequence shown in SEQ ID NO: 14 by 0, 1 or 2 nucleotides.

6. The nucleic acid according to claim 1, wherein The GC content of the nucleic acid is 20 to 45%, more preferably 20 to 35%.

7. The nucleic acid according to claim 1, wherein At least one nucleotide in the nucleic acid is a modified nucleotide or includes a modified internucleotide; The modified nucleotide is preferably selected from one or more of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-open ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, reverse nucleotides, reverse 2'-O-methyl nucleotides, reverse 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, nucleotides containing vinyl phosphonate, nucleotides containing cyclopropyl phosphonate and 3'-O-methyl nucleotides; the modified nucleotide is further preferably selected from one or more of 2'-O-methyl nucleotides and 2'-fluoro nucleotides; The modified internucleotide bond is preferably selected from one or more of phosphorothioate internucleotide bonds and methylphosphonate internucleotide bonds; the modified internucleotide bond is further preferably selected from one or more of phosphorothioate monoester internucleotide bonds and phosphorothioate diester internucleotide bonds.

8. The nucleic acid according to claim 7, wherein The 5th and 6th nucleotides of the antisense strand counted from the 5' end are 2'-O-methyl nucleotides, and the 7th nucleotide is a 2'-fluoro nucleotide; Preferably, the antisense strand contains two phosphorothioate internucleotide bonds at the 5' end and the 3' end respectively, and the nucleotides at the 1st, 2nd, 7th, 9th, 14th and 16th positions counting from the 5' end are 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

9. The nucleic acid according to claim 7 or 8, wherein The second nucleotide of the sense strand counted from the 5' end is a 2'-O-methyl nucleotide or a 2'-fluoro nucleotide, preferably a 2'-O-methyl nucleotide; Preferably, the 5' end of the sense strand contains two phosphorothioate internucleotide bonds, and the 4th, 7th, 9th, 10th and 11th nucleotides counted from the 5' end are 2'-fluoro nucleotides, and the remaining nucleotides are 2'-O-methyl nucleotides.

10. The nucleic acid according to claim 1, wherein The antisense strand has at least 15 consecutive nucleotides with a difference of no more than 3 nucleotides in the antisense strand sequence as shown in any one of Tables 3 or 8, and the sense strand has at least 15 consecutive nucleotides with a difference of no more than 3 nucleotides in the sense strand sequence as shown in any one of Tables 3 or 8; preferably, the sense strand and the antisense strand form a siRNA as shown in any one of Tables 4 or 8.

11. The nucleic acid according to claim 1, wherein The antisense strand contains a nucleotide sequence from the 5' end to the 3' end that differs from the following nucleotide sequence by 0, 1 or 2 nucleotides: AfsCfsacuuUfuUfuguuUfcAfcaaacsasa; The sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand; Preferably, the sense strand contains a nucleotide sequence from the 5' end to the 3' end that differs by 0, 1 or 2 nucleotides from any of the following nucleotide sequences: gsusuUfguGfaAfAfCfaaaaaagugu; gsUfsuUfguGfaAfAfCfaaaaaagugu; In each sequence, a nucleotide represented by a lowercase letter indicates that the nucleotide is a 2'-O-methyl nucleotide; f indicates that the nucleotide adjacent to its left is a 2'-fluorine-modified nucleotide; s indicates that the two adjacent nucleotides on the left and right are connected by a phosphorothioate diester bond.

12. A targeted drug delivery system, characterized in that: The targeted drug delivery system comprises a targeting group, a linking group, and the nucleic acid according to any one of claims 1 to 11 connected to the targeting group via the linking group.

13. The targeted drug delivery system according to claim 12, wherein: The targeted drug delivery system comprises a ligand and the nucleic acid connected to the ligand; preferably, the ligand is a GalNAc derivative; more preferably, the ligand is one or more GalNAc derivatives connected by single-stranded, double-stranded or triple-stranded branched linkers; further preferably, the structure of the targeted drug delivery system is shown in the following formula: In the formula, Nu represents the nucleic acid.

14. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the nucleic acid according to any one of claims 1 to 11 or the targeted drug delivery system according to any one of claims 12 to 13 and a pharmaceutically acceptable carrier.

15. A method for inhibiting the expression of angiotensin gene in a cell, the method comprising: The cell is contacted with the nucleic acid according to any one of claims 1 to 11, the targeted drug delivery system according to any one of claims 12 to 13, or the pharmaceutical composition according to claim 14 to inhibit the expression of angiotensin gene in the cell.

16. Use of the nucleic acid according to any one of claims 1 to 11, the targeted drug delivery system according to any one of claims 12 to 13, or the pharmaceutical composition according to claim 14 in any of the following aspects: 1) Treating and / or preventing diseases related to angiotensin; 2) Preparation of drugs for treating and / or preventing diseases associated with angiotensin.

17. The use according to claim 16, wherein The diseases are: (i) a disease associated with increased or elevated levels of angiotensin activity; or (ii) Diseases that would benefit from reduced angiotensinogen expression.

18. The use according to claim 16, wherein The disease is a disease associated with overactivation of the renin-angiotensin-aldosterone system.

19. The use according to claim 16, wherein The disease is selected from hypertension, hypertension, critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertension One or more of the following: congenital heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction, fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, glucose intolerance, type 2 diabetes mellitus and metabolic syndrome.

20. The use according to claim 16, wherein The nucleic acid, the targeted drug delivery system or the pharmaceutical composition is administered to a subject by subcutaneous administration, intravenous administration and / or intramuscular administration.

Images