Composition for treating spinal cord injury diseases and use thereof

Abstract

The present application relates to a composition for treating spinal cord injury diseases and a method therefor.

Description

Composition for treating spinal cord injury and use thereof

[0001] The present application relates to a composition for treating spinal cord injury disease and a method for treating spinal cord injury disease using the same.

[0002] The spinal cord, the central nervous system within the spine, is difficult to recover from damage. In particular, damage to the spinal cord disrupts proper nerve transmission between the brain and body, leading to loss of motor and sensory functions.

[0003] The spinal cord contains various types of nerve cells and glial cells, including astrocytes, microglia, and motor neurons.

[0004] When motor neurons are destroyed, progressive degeneration of the motor neurons can occur, affecting upper motor neurons that originate from the brain and transmit impulses to the medulla oblongata or spinal cord, or lower motor neurons that transmit impulses from the spinal cord to the muscles. Furthermore, there are reports that astrocytes form a glial scar in the damaged area of ​​the spinal cord, blocking ascending and descending neuronal signaling.

[0005] Spinal cord injury is a central nervous system injury. Despite advances in medical and surgical treatment, a clear treatment plan has not yet been established. Until now, treatments for spinal cord injury have often involved steroid therapy, which carries significant side effects, and invasive surgical procedures.

[0006] Furthermore, stem cell-based cell therapy and compound therapy are being developed as treatments for spinal cord injury, but stem cell therapy carries the risk of developing teratoma or cancer, and compound therapy only shows a temporary improvement in motor function and does not restore the damaged spinal cord.

[0007] Therefore, there is a need to develop new treatments for spinal cord injury.

[0008] One object of the present application is to provide a composition for treating spinal cord injury. In particular, the composition comprises a differentiation factor for direct cross-differentiation of somatic cells into motor neurons. Specifically, the composition comprises the Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding it.

[0009] Another object of the present application is to provide another composition for treating spinal cord injury. In particular, the composition comprises: Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding the same; Hb9 (MNX1) protein or a nucleic acid sequence encoding the same; Lhx3 protein or a nucleic acid sequence encoding the same; for direct cross-differentiation of somatic cells into motor neurons.

[0010] Another object of the present application is to provide a method for producing the composition.

[0011] Another object of the present application is to provide a method for treating spinal cord injury.

[0012] Another object of the present application is to provide various uses for the composition.

[0013] In order to solve the problem of the present application described above, according to one aspect of the present invention, a pharmaceutical composition for treating spinal cord injury disease is provided.

[0014] A pharmaceutical composition for treating the above spinal cord injury disease,

[0015] Nucleic acid sequence encoding Gsta4 (Glutathione S-Transferase Alpha 4) protein;

[0016] A nucleic acid sequence encoding the Lhx3 (LIM homeobox 3) protein; and

[0017] Nucleic acid sequence encoding MNX1 (Motor neuron and pancreas homeobox 1) protein;

[0018] may include.

[0019] At this time, the spinal cord injury disease can be selected from among paraplegia, quadriplegia, Lou Gehrig's disease, primary lateral sclerosis, progressive pseudobulbar paralysis, progressive muscular atrophy, progressive bulbar paralysis, and post-polio syndrome.

[0020] The nucleic acid sequence encoding the Gsta4 protein, the nucleic acid sequence encoding the Lhx3 protein, and the nucleic acid sequence encoding the MNX1 protein may be contained in the vector independently or in combination of two or more nucleic acid sequences.

[0021] At this time, the vector may be an adeno-associated virus (AAV). The adeno-associated virus may be selected from among AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0022] The nucleic acid sequence encoding the Gsta4 protein may be SEQ ID NO: 12, the nucleic acid sequence encoding the Lhx3 protein may be SEQ ID NO: 16, and the nucleic acid sequence encoding the MNX1 protein may be SEQ ID NO: 14.

[0023] The above vector may further comprise a promoter, a 2A self-cleaving peptide, and an inverted terminal repeat (ITR). In this case, the promoter may be a CMV promoter, and the 2A self-cleaving peptide may be P2A or T2A. In addition, the CMV promoter may be a sequence represented by SEQ ID NO: 37, P2A may be a sequence represented by SEQ ID NO: 38, and T2A may be a sequence represented by SEQ ID NO: 39.

[0024] The above pharmaceutical composition can be formulated as an injection. In this case, the AAV contained in the pharmaceutical composition is 1x10 5 GC / kg to 1x10 15 It can be administered to the subject at a dose of GC / kg. In addition, the AAV can be administered at a dose of 1x10 6 GC / kg to 1x10 12 It can be administered to the subject at a dose of GC / kg.

[0025] The above pharmaceutical composition can be administered to a damaged spinal cord area of ​​a subject with spinal cord injury. At this time, the damaged spinal cord areas include L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7(thoracic 7), T8(thoracic 8), T9(thoracic 9), T10(thoracic 10), T11(thoracic 11), T12(thoracic 12), T13(thoracic 13), C1(cervical 1), C2(cervical 2), C3(cervical 3), C4(cervical 4), C5(cervical 5), C6(cervical 6), It can be selected from C7 (cervical 7), C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3), and S4 (sacrum 4). When the pharmaceutical composition is administered to a subject, 1 uL to 1 mL can be administered at a time.

[0026] In order to solve the problem of the present application described above, according to another aspect of the present invention, a pharmaceutical composition for treating spinal cord injury disease is provided, which comprises a nucleic acid sequence encoding Gsta4 (Glutathione S-Transferase Alpha 4) protein.

[0027] At this time, the nucleic acid sequence encoding the Gsta4 protein may be contained in the vector. The nucleic acid sequence encoding the Gsta4 protein may be SEQ ID NO: 12.

[0028] Additionally, the vector may further contain a promoter sequence. In this case, the promoter sequence may be a sequence represented by SEQ ID NO: 37.

[0029] According to this application, the following effects occur.

[0030] According to the present application, a composition for treating spinal cord injury can be provided. In particular, the composition comprises a Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid sequence encoding the same for direct cross-differentiation of somatic cells into motor neurons.

[0031] In one specific example, the composition comprises a Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding the same; an Hb9 protein or a nucleic acid sequence encoding the same; and an Lhx3 protein or a nucleic acid sequence encoding the same for direct cross-differentiation of somatic cells into motor neurons.

[0032] According to the present application, a method for treating spinal cord injury disease using the composition can be provided.

[0033] Figure 1 is a schematic diagram of the AAV vector used in this experimental example.

[0034] (a) Schematic diagram of an AAV vector comprising Gsta4; (b) Schematic diagram of an AAV vector comprising Ascl1, Isl1, Lhx3, and Ngn2 (also called Neurog2); (c) Schematic diagram of an AAV vector comprising Brn2, Hb9 (also called Mnx1 (Motor neuron and pancreas homeobox 1)), and NeuroD1; (d) Schematic diagram of an AAV vector comprising Gsta4 and Myt1l; (e) Schematic diagram of an AAV vector comprising Gsta4, Hb9, and Lhx3.

[0035] Figure 2 is a schematic diagram of the AAV vector used in this experimental example, which is a schematic diagram that embodies the AAV vector schematic diagram including Gsta4, Hb9, and Lhx3 of Figure 1(e).

[0036] Figure 3 shows the results of direct cross-differentiation into motor neurons by introducing the direct cross-differentiation factor Gsta4 into mouse-derived fibroblasts, as assessed by the expression of neuronal markers ChAT and Map2. Here, "control" refers to the untreated control group. Figure 3 (a) shows the results of immunofluorescence staining, and (b) quantifies the results of (a).

[0037] Figure 4 shows the results of introducing a composition containing a conventional direct cross-differentiation factor into fibroblasts to determine the degree of direct cross-differentiation into motor neurons, as confirmed by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). Figure 4 (a) shows the introduction into mouse-derived fibroblasts, and (b) shows the introduction into human-derived fibroblasts.

[0038] Figure 5 shows the results of confirming the expression of neural cell markers Tuj1 and Map2 by introducing direct cross-differentiation factors into mouse-derived primary astrocytes. The direct cross-differentiation factors used here were GSTA4 alone, MNX1 (also called Hb9) alone, LHX3 alone, a combination of GSTA4 and MNX1, and a combination of GSTA4 and LHX3.

[0039] Figure 6 is a graph that numerically represents the results of Figure 5.

[0040] Figure 7 shows the results of immunofluorescence staining to confirm the degree of direct cross-differentiation into motor neurons by introducing a composition containing differentiation factors into mouse-derived fibroblasts. The differentiation factors used here were a combination of Mnx1 and Lhx3; and a combination of Gsta4, Mnx1, and Lhx3. Figure 7 (a) shows the immunofluorescence staining results, and (b) and (c) are graphs that quantify the results of (a).

[0041] Figure 8 shows the results of confirming the degree of direct cross-differentiation into motor neurons by introducing a composition containing differentiation factors into mouse-derived fibroblasts, as measured by the expression of neuronal markers Synapsin, Map2, and Hb9. The differentiation factors used here were Gsta4 alone; a combination of Mnx1 and Lhx3; and a combination of Gsta4, Mnx1, and Lhx3.

[0042] Figure 9 shows the results of introducing a composition containing differentiation factors into mouse-derived primary astrocytes, and confirming the degree of differentiation into motor neurons by examining the expression of neural cell markers Tuj1 and Map2. Naive is the control group that was not treated with any substance, and Control is the non-typeable control group treated with AAV2 buffer. STUP-001 refers to a composition containing Gsta4, Hb9, and Lhx3.

[0043] Figure 10 shows the results of confirming changes in the expression of motor neuron markers ChAT and Map2 by administering a composition containing GSTA4 to the spinal cord injury site of a SCI (Spinal cord injury) mouse model, which is a model of lower body paralysis caused by spinal cord injury. Figure 10 (a) is the result of immunofluorescence staining, and (b) is a graph that quantifies the result of (a).

[0044] Figure 11 shows the results of evaluating the viability of mouse-derived primary stellate cells by treating them with a composition containing Gsta4, MNX1, and Lhx3 (hereinafter referred to as STUP-001) at various concentrations. Here, "Naive" refers to the control group that was not treated with any substance; "Control" refers to the non-transfected control group treated with AAV2 buffer.

[0045] Figures 12 to 15 show the results of analyzing the BBB score (Basso Beattie and Bresnahan score), action potential (AP) firing ratio, resting membrane potential (RMP), and efficacy-related protein quantity by treating an SCI mouse model with STUP-001 at various concentrations.

[0046] At this time, E0 is the control group of normal ICR mice; E1 is the control group treated with AA2 buffer in the SCI mouse model; E2 is the SCI mouse model treated with 2.0 X 10 STUP-001 8 Group treated with GC / head; E3 was treated with 2.0 X 10 STUP-001 in the SCI mouse model 7 Group treated with GC / head; E4 was treated with 2.0 X 10 STUP-001 in the SCI mouse model 6 Group treated with GC / head; E5 was treated with 2.0 X 10 STUP-001 in the SCI mouse model 5 Refers to the group processed with GC / head.

[0047] The contents of the application will be described in more detail with reference to the drawings attached to this application and the description below. The attached drawings include implementation examples of the application, but not all implementation examples. In addition, the contents of the application may be embodied in various forms and are not limited to the specific implementation examples described below. That is, the application may have various modifications and may have various experimental examples. Although the structure and features of the application have been described based on the experimental examples according to the application, the application is not limited thereto, and it will be apparent to those skilled in the art that various changes or modifications can be made within the spirit and scope of the application. Therefore, it is stated that such changes or modifications fall within the scope of the appended claims.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. Additionally, the materials, methods, and experimental examples are illustrative only and are not intended to be limiting.

[0049]

[0050] Definition of terms

[0051] Spinal cord injury (SCI)

[0052] In this application, the term "spinal cord injury (SCI)" refers to damage to the spinal cord, the central nervous system within the spine. Spinal cord injury is interpreted to encompass both damage to the spinal cord caused by disease or trauma and diseases caused by such damage. Specifically, spinal cord injury, as a representative example in this application, refers to damage to motor neurons, resulting in abnormalities in the motor nerves. The term "spinal cord injury" may be used interchangeably with "damaged spinal cord."

[0053]

[0054] neuron

[0055] In this application, the term "neuron" refers to a nerve cell that constitutes the nervous system. Unlike other cells, nerve cells can transmit signals electrically. Neurons are divided into sensory neurons, which constitute sensory nerves, association neurons, which constitute the central nervous system, and motor neurons, which constitute motor nerves. All nerve cells are electrically excitable. Before receiving a signal, nerve cells maintain a resting potential of approximately -70 mV. This application particularly relates to a technique for efficiently generating motor neurons (motor neurons).

[0056]

[0057] induced motor neuron (iMN)

[0058] The term "induced motor neuron" used in this application refers to a motor neuron induced (generated) through direct cross-differentiation. The induced motor neuron refers to a motor neuron artificially produced by direct cross-differentiation of somatic cells, etc. using the novel differentiation factor of the present application. The induced motor neuron has the same function as a motor neuron existing in the body (i.e., not an artificially produced motor neuron). For example, the induced motor neuron can transmit motor stimuli generated in the brain and spinal cord to muscles, but this is only one example and is not limited thereto. The term "induced motor neuron" can be used interchangeably with motor neurons and iMN.

[0059]

[0060] Direct Reprogramming / Direct Conversion / Transdifferentiation

[0061] The term "direct reprogramming / direct conversion / transdifferentiation" used in this application refers to the conversion of differentiated cells into desired cells by introducing specific factors. In particular, direct reprogramming induces conversion between mature cells of completely different cell types. In other words, it converts somatic cells into desired cells without going through the pluripotent state. The terms direct reprogramming, direct conversion, cell converting, and transdifferentiation can be used interchangeably.

[0062]

[0063] Direct conversion factor (converting factor)

[0064] The term "direct conversion factor" as used in this application refers to a factor involved in the aforementioned direct conversion differentiation. The differentiation factor may be a gene, compound, protein, nucleic acid, or the like. The term "direct conversion factor" may be used interchangeably with "converting factor."

[0065]

[0066] therapy

[0067] The term "treatment" as used in this application means alleviating or inhibiting the progression of a disease, illness, symptom, etc. The treatment refers to any action that improves or beneficially alters symptoms by the composition of the present invention, direct cross-differentiating factor, etc.

[0068]

[0069] About

[0070] The term "about" as used in this application means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% relative to a reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0071]

[0072] The invention disclosed in this application is described in detail below.

[0073]

[0074] 1. Composition for treating spinal cord injury disease

[0075] Overview of compositions for treating spinal cord injury

[0076] One aspect of the present application relates to a composition for treating spinal cord injury. In particular, the composition for treating spinal cord injury of the present application comprises a direct cross-linking factor.

[0077] Below, we will explain the mechanism of spinal cord injury, conventional spinal cord injury treatment, GSTA4, and the active ingredients of the composition.

[0078]

[0079] spinal cord injury

[0080] The invention disclosed in this application is intended to treat spinal cord injury disease.

[0081] The spinal cord is composed of neurons, oligodendrocytes, astrocytes, and microglia.

[0082] When the spinal cord is injured, the cells that make up the spinal cord face different fates. Neurons and oligodendrocytes undergo apoptosis, leading to their death. Conversely, astrocytes and microglia, while not dying, become activated, rapidly increasing in number and size. Furthermore, they secrete various substances that impede the recovery of the injured spinal cord.

[0083] In particular, the mechanisms of cell death of neurons and glial cells are closely related to the loss of neuronal function, and neuronal loss due to necrosis is known to occur at all stages of spinal cord injury (Cell death in models of spinal cord injury. Prog Brain Res. 2002;137:37-47.).

[0084] Therefore, to recover or treat spinal cord injury, it is important to regenerate dead nerve cells and restore their function. In particular, the invention of the present application recovers or treats spinal cord injury by effectively generating and regenerating motor neurons in the spinal cord injury area.

[0085]

[0086] Diseases due to spinal cord injury

[0087] In this application, spinal cord injury disease includes all diseases caused by damage to the spinal cord, which is the central nervous system located within the spine.

[0088] Spinal cord injury disorders can include, for example, traumatic spinal cord injury, Lou Gehrig's (Amyotrophic Lateral Sclerosis, ALS), Primary Lateral Sclerosis (PLS), Multifocal motor neuropathy (MMN), Werdnig-Hoffman disease, Spinal Muscular Atrophy (SMA), Kugelberg-Welander syndrome, stroke, Ataxia telangiectasia, Familial motor neuron disease, bulbar palsy, paraplegia, quadriplegia, hemiplegia, tetraplegia, diplegia, and cerebral palsy. Preferably, the spinal cord injury disease may be selected from traumatic spinal cord injury, Lou Gehrig's disease, paraplegia, quadriplegia, biplegia, and cerebral palsy.

[0089]

[0090] Problems with conventional spinal cord injury treatment

[0091] As previously explained, no effective treatment for spinal cord injury has been reported to date.

[0092] However, research is being conducted aimed at transplanting cells or regenerating axons to treat spinal cord injury.

[0093] Cell-based therapies are being studied to regenerate neural tissue lost due to spinal cord injury. Research is primarily focused on transplanting Schwann cells, neural progenitor cells, and stem cells. However, there have been reports of axonal growth restrictions following transplantation due to the inhibitory effect of glial scarring. Furthermore, stem cell use raises concerns about the risk of teratoma or cancer. Furthermore, there is insufficient evidence to determine whether transplanted cells differentiate into neural cells, and their survival is very low, significantly reducing the effectiveness of the treatment.

[0094] In addition to these cell therapies, antibodies and compounds are also being developed. Central nervous system regeneration is inhibited when damaged, and oligodendrocyte axons are known to be the primary inhibitors of axon growth in the central nervous system. Therefore, axon growth inhibitors are primarily being studied. These include Rho / ROCK pathway blockers and chondroitinase ABC (ChABC), an enzyme that degrades chondroitin sulfate proteoglycan (CSPG), which inhibits axon regeneration. However, these compounds are not only toxic but also regenerate the axons of neurons remaining around the injury site. Therefore, they only temporarily improve damaged spinal cord function and are not considered fundamental treatments.

[0095]

[0096] Composition for treating spinal cord injury of this hospital

[0097] The composition for treating spinal cord injury disease of this hospital contains a direct cross-linking factor as an effective substance.

[0098] In particular, the direct cross-differentiation factor of this invention has the function of directly cross-differentiating somatic cells into motor neurons. This direct cross-differentiation has the characteristic of converting somatic cells into motor neurons without the step of dedifferentiating them into induced pluripotent stem cells.

[0099] The composition for treating spinal cord injury of this hospital converts somatic cells in the body of a patient administered the composition, for example, in the spinal cord injury area, into motor neurons. This allows for the generation and regeneration of a large number of motor neurons in the spinal cord injury area. The somatic cells may be selected from among fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, and oligodendrocyte precursor cells.

[0100]

[0101] Specifically, the composition for treating spinal cord injury disease of the present invention essentially includes GSTA4 (glutathione S-transferase alpha 4) protein or a nucleic acid encoding the same.

[0102]

[0103] GSTA4 legacy functions

[0104] Gsta4 is an enzyme belonging to the glutathione S-transferase (GST) family. Eight GSTs are known to be produced in the mammalian cytoplasm: alpha, kappa, mu, omega, pi, sigma, theta, and zeta. Among them, alpha is located on chromosome 6 and includes GSTA1, GSTA2, GSTA3, GSTA4, and GSTA5.

[0105] Gsta4, also known as GTA4, is known to be involved in cellular defense mechanisms, toxin decomposition, and anticancer effects. It is also known to play a significant role in reducing cellular stress by reducing reactive oxygen species. Furthermore, the absence of Gsta4 is known to be negatively associated with diseases such as Parkinson's disease and Alzheimer's disease. However, its function as a direct differentiation factor between cells, particularly in the differentiation of motor neurons, has not been reported.

[0106]

[0107] New GSTA4 features in the present invention

[0108] The composition for treating spinal cord injury of the present application comprises GSTA4 as an essential active substance that enables direct cross-differentiation.

[0109] The present inventors, while studying GSTA4, discovered a new function as a direct cross-differentiation factor into motor neurons, which was not previously known.

[0110] Referring to the experimental examples of this study, it can be confirmed that somatic cells directly cross-differentiate into motor neurons due to GSTA4, and further, it can be confirmed that the damaged spinal cord of an animal model with spinal cord damage is restored.

[0111] Therefore, it is desirable to interpret the term GSTA4 described below as GSTA4 having the function of a direct cross-differentiation factor.

[0112]

[0113] Function of GSTA4 in spinal cord injury

[0114] As mentioned above, when the spinal cord is injured, neurons and oligodendrocytes die through apoptosis, while astrocytes and microglia become activated and increase in number. Specifically, the increase in astrocytes leads to the formation of glial scars, which inhibit the regeneration and regrowth of axons. Furthermore, this disruption of signal transmission between neurons also leads to disruption of neuronal function.

[0115] The GSTA4 in this application functions to directly cross-differentiate abnormally increased astrocytes into motor neurons. By acting in this way in the damaged spinal cord, GSTA4 not only facilitates signal transmission between blocked neurons, but also directly promotes regeneration or recovery of damaged motor neurons, thereby healing spinal cord injuries.

[0116] In particular, the composition for treating spinal cord injury of the present application contains GSTA4, which can directly cross-differentiate somatic cells, such as astrocytes, into motor neurons, and thus has the advantage of being applicable in vivo. This will overcome various problems, such as the inconvenience of requiring ex vivo procedures in most conventional cell-based spinal cord injury treatments.

[0117]

[0118] A composition for treating spinal cord injury disease of the present application contains GSTA4 alone as an active substance.

[0119] Another composition for treating spinal cord injury disease of the present invention comprises GSTA4 and one or more known direct cross-linking factors as active ingredients.

[0120]

[0121] Examples of direct cross-differentiation factors in the notice

[0122] Known direct cross-differentiation factors used for direct cross-differentiation include Ascl1 (Achaete-scute homolog 1), Nurr1 (Nuclear Receptor Subfamily 4 Group A Member 2), Lmx1a (LIM Homeobox Transcription Factor 1 Alpha), Foxa2 (Forkhead box protein A2), Brn2 (POU Class 3 Homeobox 2), Sox2 (sex determining region Y-box 2), Foxg1 (Forkhead Box G1), Lhx3 (LIM homeobox 3), HB9 (Homeobox HB9; also called Mnx1 (Motor neuron and pancreas homeobox 1)), IsL1 (ISL LIM homeobox 1), Ngn2 (neurogenin 2;Also called Neurog2), NeuroD1 (Neuronal Differentiation 1), Myt1l (Myelin Transcription Factor 1 Like), NeuroD2 (Neuronal Differentiation 2), miR-9 (microRNA-9), miR-124 (microRNA-124), Zic1 (Zic Family Member 1), Gata5 (GATA Binding Protein 5), Hnf4α (Hepatocyte nuclear factor 4) alpha), HNF1α (hepatocyte nuclear factor 1 alpha), Foxa1 (Forkhead Box A1), Foxa3 (Forkhead Box A3), Tbx5 (T-Box Transcription Factor 5), Mef2c (Myocyte Enhancer Factor 2C), Oct4 (Octamer-binding transcription factor 4), PRDM16 (PR / SET Domain 16), MyoD (myoblast determination protein 1), Klf4 (Kruppel-like factor 4) and c-Myc (cellular Myc) are known. (Mol Cell. 2012 Sep 28;47(6):827-838.);

[0123] In particular, the known direct differentiation factor used in the present application may be one or more factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0124] Below, specific examples of the composition of the effective ingredient included in the composition for treating spinal cord injury of the present application are described, but are not limited thereto.

[0125] For convenience, the composition examples below are described as GSTA4 alone, GSTA4 and one conventional differentiation factor; GSTA4 and two conventional differentiation factors; but the number of conventional direct cross-differentiation factors is not limited. In other words, GSTA4 may further include one to eight of the aforementioned 'differentiation factors used for direct cross-differentiation into motor neurons'.

[0126] In particular, the composition comprises the aforementioned GSTA4, which acts as an "essential active ingredient" for the treatment of spinal cord injury. Furthermore, conventional differentiation factors may also act as active ingredients in the composition of the present application.

[0127]

[0128] Composition example

[0129] Composition example (1): GSTA4 alone

[0130] The composition for treating spinal cord injury of the present application may include a Gsta4 protein or a nucleic acid sequence encoding the same.

[0131]

[0132] Composition example (2): Containing GSTA4 and one conventional direct cross-differentiation factor

[0133] The composition for treating spinal cord injury of the present application may further comprise a Gsta4 protein or a nucleic acid sequence encoding the same; and one conventional direct cross-linking differentiation factor.

[0134] For example, the conventional direct cross-differentiation factor may be one protein selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid sequence encoding the selected protein.

[0135] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding the same; and an Ascl1 protein or a nucleic acid sequence encoding the same.

[0136] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding the same; and a Brn2 protein or a nucleic acid sequence encoding the same.

[0137] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding the same; and a Hb9 protein or a nucleic acid sequence encoding the same.

[0138] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding the same; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0139]

[0140] Composition example (3): Containing GSTA4 and two conventional direct cross-differentiation factors

[0141] The composition for treating spinal cord injury of the present application may further comprise Gsta4 protein or a nucleic acid encoding the same; and two conventional direct cross-linking differentiation factors.

[0142] For example, the conventional direct cross-differentiation factor may be two proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid sequence encoding the selected proteins.

[0143] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding it; a Hb9 protein or a nucleic acid sequence encoding it; and a Ngn2 protein or a nucleic acid sequence encoding it.

[0144] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding the same; a Lhx3 protein or a nucleic acid sequence encoding the same; and a Ngn2 protein or a nucleic acid sequence encoding the same.

[0145] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding it; a Hb9 protein or a nucleic acid sequence encoding it; and an Isl1 protein or a nucleic acid sequence encoding it.

[0146] For example, a composition for treating a spinal cord injury disorder may comprise a Gsta4 protein or a nucleic acid sequence encoding it; a Ngn2 protein or a nucleic acid sequence encoding it; and an Isl1 protein or a nucleic acid sequence encoding it.

[0147] Preferably, the composition for treating spinal cord injury disease comprises Gsta4 protein or a nucleic acid sequence encoding it; Hb9 protein or a nucleic acid sequence encoding it; and Lhx3 protein or a nucleic acid sequence encoding it.

[0148]

[0149] Combination ratio of Gsta4 and conventional direct cross differentiation factors

[0150] As described above, the composition for treating spinal cord injury disease can be used by combining Gsta4 and conventional direct cross-linking factors in various ratios as needed by those skilled in the art.

[0151] At this time, Gsta4 and conventional direct cross differentiation factor(s) can be used in the same or different ratios.

[0152] For example, when using Gsta4 and one conventional direct cross differentiation factor, it can be used in a ratio of 1:1, 1:2, or 2:1.

[0153] As a specific example, when using Gsta4 and Hb9, they can be used in a ratio of 1:1, 2:1 or 1:2.

[0154] As a specific example, when using Gsta4 and Lhx3, they can be used in a ratio of 1:1, 2:1 or 1:2.

[0155] As another example, when Gsta4 and two conventional direct cross differentiation factors are used, they can be used in a ratio of 1:1:1, 2:1:1, 2:1:2, or 1:2:1.

[0156] As a specific example, when Gsta4, Hb9 and Lhx3 are used, they can be used in a ratio of 1:1:1, 2:1:1, 2:1:2 or 1:2:1.

[0157]

[0158] Form of direct cross-differentiation factor

[0159] The direct cross-linking factor included in the composition for treating spinal cord injury of the present application may be, but is not limited to, a protein, a nucleic acid, or a mixture of proteins and nucleic acids.

[0160]

[0161] Example of GSTA4 format

[0162] The above GSTA4 may be of mammalian origin. For example, the mammal may be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, chimpanzee, etc. Preferably, it is of human origin.

[0163]

[0164] The composition of the present application may comprise a GSTA4 protein.

[0165] The above GSTA4 protein may be composed of a wild-type amino acid sequence, or may be a mutant in which one or more amino acids in the wild-type amino acid sequence are deleted, substituted, or inserted.

[0166] The amino acid sequence of the wild-type GSTA4 protein can be obtained from a known database. The GSTA4 protein of the present application may have an amino acid sequence having at least 60% sequence identity with the wild-type amino acid sequence. In this case, the sequence identity may be a value in two numerical ranges arbitrarily selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. Preferably, the GSTA4 protein may have a sequence identity of about 90% to 100% with the wild-type amino acid sequence.

[0167] In any embodiment, the GSTA4 protein for direct cross-linking of the present application may be the amino acid sequence represented by SEQ ID NO: 1.

[0168] Sequence number 1: maarpklhyp ngrgrmesvr wvlaaagvef deefletkeq lyklqdgnhl lfqqvpmvei dgmklvqtrs ilhyiadkhn lfgknlkert lidmyvegtl dllellimhp flkpddqqke vvnmaqkaii ryfpvfekil rghgqsflvg nqlsladvil lqtilaleek ipnilsafpf lqeytvklsn iptikrflep gskkkpppde iyvrtvynif rp

[0169] In another embodiment, the GSTA4 protein may be a sequence having 70% to 100% sequence identity with the amino acid sequence represented by SEQ ID NO: 1.

[0170]

[0171] Additionally, the composition of the present application may comprise a nucleic acid encoding a GSTA4 protein. The nucleic acid may be DNA or RNA.

[0172] The nucleic acid encoding the above GSTA4 protein may have a wild-type nucleic acid sequence, or may have a sequence in which one or more nucleotides in the wild-type nucleic acid sequence are deleted, substituted, or inserted.

[0173] Wild-type GSTA4 nucleic acid, e.g., DNA sequence, can be obtained from known databases.

[0174] The GSTA4 nucleic acid sequence of the present application may be a sequence having a sequence identity of 60% or more with a wild-type nucleic acid sequence. In this case, the sequence identity may be a numerical value in two numerical ranges arbitrarily selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. Preferably, the nucleic acid encoding the GSTA4 protein may have a sequence identity of about 90% to 100% with the wild-type nucleic acid sequence.

[0175] The above nucleic acid sequence may be a full sequence of the GSTA4 gene including intron and exon sequences.

[0176] Alternatively, the nucleic acid sequence may be a sequence that includes only exons. For example, the nucleic acid sequence encoding the GSTA4 protein may include a CDS (Coding Sequence) sequence excluding introns.

[0177] For example, the nucleic acid sequence may be a DNA sequence encoding a GSTA4 protein and an mRNA sequence corresponding thereto (which is a transcription product).

[0178] As another example, the nucleic acid sequence may be an mRNA sequence (a transcription product) corresponding to an exon sequence of the GSTA4 gene.

[0179]

[0180] In one specific example, the nucleic acid encoding the GSTA4 protein may comprise SEQ ID NO: 2, which is the full DNA sequence of the GSTA4 gene.

[0181] 서열번호 2: gctttgtgcg gctccaggcc tccgagtgga ctccagaaag cctgaaaagc tatcatggca gcaaggccca agctccacta tcccaacgga agaggccgga tggagtccgt gagatgggtt ttagctgccg ccggagtcga gtttgatctga acattctacagac aagttgcagg atggtaacca cctgctgttc caacaagtgc ccatggttga aattgacggg atgaagttgg tacagacccg aagcattctc cactacatag cagacaagca caatctcttt ggcaagaacc tcaaggagag aaccctgatt gacatgtacg tggaggcg a ctggacatgc ttggatcgc tcctttctta aaaccagatg atcagcaaaa ggaagtggtt aacatggccc agaaggctat aattagatac tttcctgtgt ttgaaaagat tttaaggggt cacggacaaa gctttcttgt tggtaatcag ctgagccttg cagatgtgat tttactccaa accattttag ctcacctctctt gacatccttc tttcctccag gaatacacag tgaaactaag tatatccct acaattaaga gattccttga acctggcagc aagaagaagc ctccccctga tgaaatttat gtgagaaccg tctacaacat ctttaggcca taaaacaaca catccatgtg tgagtgacag tgtgttccta gagatggtat tgtcctat tgtcttagtc ctctgtcatg gtgctatcta tgtattaagt tgggtcctaa gttgggtctt ttgtgtcaac gagatcatct cttctagaaa tatcaacctt ttttgtccagtaaataattg ttaggggatc tttattggaa aacttttttg gagaggctgg tatttaagtt agatctgatt gggctactca tgtcctgtag ccagttcatc ctcataataa gaatgggcag gatctcttgt tctctcctga gtgtctttct actctcctga gcgtctttct gctctcctta tcctgttctc ttatccttat cccctccagt ctctgcctaa tttttagtgt ttaataacaa ccgaatgtct agtaaatgac tctcctctga gctgtaataa ataaaatggt agtaatgaat gcaatcagta ttagccaaaa taaagaattt atgagtcatt

[0182]

[0183] In another specific example, the nucleic acid encoding the GSTA4 protein can have the CDS sequence SEQ ID NO: 12.

[0184] SEQ ID NO: 12: Atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggttttagctgccgccggagtcgagtttgatgaagaatttctggaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcc catggttgaaattgacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctttct taaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccaaaccattttagctcta gaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa

[0185]

[0186] In another embodiment, the nucleic acid encoding the GSTA4 protein can comprise a sequence having 90% to 100% sequence identity to the DNA sequence represented by SEQ ID NO: 2.

[0187] In another embodiment, the nucleic acid encoding the Gsta4 protein can comprise a sequence having 90% to 100% sequence identity to the CDS sequence represented by SEQ ID NO: 12.

[0188]

[0189] The form of the conventional direct cross-differentiation factor

[0190] The above conventional direct cross-differentiation factor may be of mammalian origin. For example, the mammal may be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, chimpanzee, etc. Preferably, it is of human origin.

[0191] The composition of the present application may further comprise a conventional direct cross-differentiation factor in protein form in addition to the GSTA4 protein.

[0192] If the conventional direct cross-differentiation factor is in the form of a protein, it may be composed of a wild-type amino acid sequence, or may be a mutant in which one or more amino acids in the wild-type amino acid sequence are deleted, substituted, or inserted.

[0193] The wild-type amino acid sequence can be obtained from a known database. The direct cross-linking differentiation factor protein of the present application may have an amino acid sequence having a sequence identity of 60% or more with the wild-type amino acid sequence. In this case, the sequence identity may be a value in two numerical ranges arbitrarily selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. Preferably, the conventional direct cross-linking differentiation factor protein may have a sequence identity of about 90% to 100% with the wild-type amino acid.

[0194] In any embodiment, the conventional direct cross-linking differentiation factor protein for the direct cross-linking of the present application may be an amino acid sequence represented by a sequence number selected from the following:

[0195] In another embodiment, the conventional direct cross-linking factor protein may be a sequence having 70% to 100% sequence identity with an amino acid sequence represented by a sequence number selected from the following:

[0196] The amino acid sequence of the Ascl1 protein is SEQ ID NO: 17;

[0197] The amino acid sequence of the Brn2 protein is SEQ ID NO: 19;

[0198] The amino acid sequence of the Myt1L protein is SEQ ID NO: 21;

[0199] The amino acid sequence of the Hb9 (also called Mnx1) protein is SEQ ID NO: 13;

[0200] The amino acid sequence of the Isl1 protein is SEQ ID NO: 23;

[0201] The amino acid sequence of the Lhx3 protein is SEQ ID NO: 15;

[0202] The amino acid sequence of the Ngn2 (also called Neurog2) protein is SEQ ID NO: 25; and

[0203] The amino acid sequence of the NeuroD1 protein is SEQ ID NO: 27.

[0204]

[0205] Additionally, the composition of the present application may comprise a nucleic acid encoding a conventional direct cross-linking differentiation factor protein. The nucleic acid may be DNA or RNA.

[0206] The nucleic acid encoding the above conventional direct cross-linking differentiation factor protein may have a wild-type nucleic acid sequence, or may have a sequence in which one or more nucleotides in the wild-type nucleic acid sequence are deleted, substituted, or inserted.

[0207] The nucleic acid, e.g., DNA sequence, of the wild-type conventional direct cross differentiation factor can be obtained from a known database.

[0208] The nucleic acid sequence of the conventional direct crossover differentiation factor of the present application may be a sequence having a sequence identity of 60% or more with the wild-type nucleic acid sequence. In this case, the sequence identity may be a numerical value in two numerical ranges arbitrarily selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. Preferably, the nucleic acid sequence encoding the conventional direct crossover differentiation factor protein may have a sequence identity of about 90% to 100% with the wild-type nucleic acid sequence.

[0209] The above nucleic acid sequence may be a full sequence of a conventional direct crossover differentiation factor gene including intron and exon sequences.

[0210] Alternatively, the nucleic acid sequence may be a sequence containing only exons. For example, the nucleic acid sequence encoding the conventional direct cross-linking differentiation factor protein may contain a CDS (Coding Sequence) sequence excluding introns.

[0211] For example, the nucleic acid sequence may be a DNA sequence encoding a conventional direct cross-linking differentiation factor protein and a corresponding mRNA sequence (which is a transcription product).

[0212] As another example, the nucleic acid sequence may be an mRNA sequence (which is a transcription product) corresponding to the exon sequence of a conventional direct cross-linking differentiation factor gene.

[0213]

[0214] In one specific example, the nucleic acid encoding the conventional direct cross-linking differentiation factor protein may comprise a sequence number selected from the following:

[0215] In another specific example, a nucleic acid encoding a conventional direct cross-linking differentiation factor protein may comprise a sequence having 90% to 100% sequence identity with a sequence selected from the following sequence numbers:

[0216] The nucleic acid sequence encoding the Ascl1 protein is the sequence of SEQ ID NO: 18;

[0217] The nucleic acid encoding the Brn2 protein has the sequence of SEQ ID NO: 20;

[0218] The nucleic acid encoding the Myt1L protein has the sequence of SEQ ID NO: 22;

[0219] The nucleic acid encoding the Hb9 (also called Mnx1) protein has the sequence of SEQ ID NO: 14;

[0220] The nucleic acid encoding the Isl1 protein has the sequence of SEQ ID NO: 24;

[0221] The nucleic acid encoding the Lhx3 protein has the sequence of SEQ ID NO: 16;

[0222] The nucleic acid encoding the Ngn2 (also called Neurog2) protein has the sequence of SEQ ID NO: 26; and

[0223] The nucleic acid encoding the NeuroD1 protein has the sequence of SEQ ID NO: 28.

[0224]

[0225] Form of the active ingredient included in the composition of the present application

[0226] The active ingredient of the composition for treating spinal cord injury of the present application may be, but is not limited to, a protein, a nucleic acid sequence, a mixture of a protein and a nucleic acid sequence, etc. In this case, the nucleic acid may be DNA, RNA, or a mixture of DNA and RNA.

[0227] The active ingredient of the composition for treating spinal cord injury of the present application may be the GSTA4 protein or a nucleic acid sequence encoding the same. In one specific example, the active ingredient of the composition for treating spinal cord injury of the present application may be a nucleic acid sequence encoding the GSTA4 protein.

[0228] The active ingredient of the composition for treating spinal cord injury of the present application may be a GSTA4 protein or a nucleic acid sequence encoding the same; and one or more conventional direct cross-linking factor proteins or a nucleic acid sequence encoding one or more conventional direct cross-linking factors.

[0229] In one specific example, the active ingredient of the composition for treating spinal cord injury of the present application may be a nucleic acid sequence encoding a Gsta4 protein; a nucleic acid sequence encoding a Hb9 protein; and a nucleic acid sequence encoding a Lhx3 protein.

[0230] Below, the effective ingredients of the composition for treating the spinal cord injury disease are described in terms of nucleic acid sequences among various forms. For convenience of explanation, this is described as a composition containing a nucleic acid sequence, and is not limited thereto.

[0231] For example, if the active ingredient of a composition for treating spinal cord injury is in the form of a nucleic acid sequence, it may be included in a vector.

[0232]

[0233] Example of the form of the active ingredient: vector

[0234] In another aspect of the present application, a composition for treating spinal cord injury disease may include a vector comprising a nucleic acid sequence of a direct cross-linking factor capable of expressing the direct cross-linking factor as an active ingredient in the body.

[0235]

[0236] essential factors

[0237] The vector of the present application essentially comprises a nucleic acid sequence encoding the GSTA4 protein.

[0238] The nucleic acid sequence encoding the above GSTA4 protein may be the full-length sequence or a partial sequence of the GSTA4 gene.

[0239] For example, a portion of the sequence of the GSTA4 gene may be an exon sequence of GSTA4. In this case, the exon sequence may be a CDS (Coding Sequence) sequence of the GSTA4 gene excluding introns.

[0240] As an example, the vector may comprise a sequence of SEQ ID NO: 2 or SEQ ID NO: 12. As another example, the vector may comprise a sequence that is 70% to 100% homologous to a sequence of SEQ ID NO: 2 or SEQ ID NO: 12.

[0241]

[0242] Optional arguments

[0243] The vector of the present application may further comprise a nucleic acid sequence encoding one or more conventional direct cross-differentiation factors in addition to a nucleic acid sequence encoding a GSTA4 protein.

[0244] The nucleic acid sequence encoding the conventional direct crossover differentiation factor may be the full-length sequence or a portion of the conventional direct crossover differentiation factor. For example, the portion of the conventional direct crossover differentiation factor may be an exon sequence of the conventional direct crossover differentiation factor.

[0245] For example, the vector may optionally further comprise a nucleic acid sequence encoding one or more factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0246] When a vector further includes the optional factors, the vector may be composed of one or more vectors. The vector may include the essential factors and optional factors in one vector, or may include them in two or more vectors. That is, independent vectors may be used for each number of differentiation factors, or two or more differentiation factors may be combined and included in a single vector.

[0247]

[0248] Vector implementation example

[0249] A vector must include the above-described essential factors, and optional factors may be combined in various ways as follows, but are not limited to the description below.

[0250]

[0251] Implementation Example (1): A vector containing only essential parameters

[0252] The vector may comprise a nucleic acid sequence encoding a GSTA4 protein.

[0253] For example, the vector may comprise the sequence of SEQ ID NO: 2 or SEQ ID NO: 12.

[0254] As another example, the vector may comprise a sequence that is 90% to 100% homologous to the sequence of SEQ ID NO: 2 or SEQ ID NO: 12.

[0255]

[0256] Implementation Example (2): A vector containing one required argument and one optional argument

[0257] The vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence of one conventional direct cross differentiation factor.

[0258] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding an Ascl1 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2 and 18. In another embodiment, the vector may comprise SEQ ID NOs: 12 and 18.

[0259] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Brn2 protein. In one specific example, the vector may comprise SEQ ID NOs: 2 and 20. In another specific example, the vector may comprise SEQ ID NOs: 12 and 20.

[0260] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Hb9 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2 and 14. In another embodiment, the vector may comprise SEQ ID NOs: 12 and 14.

[0261] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2 and 16. In another embodiment, the vector may comprise SEQ ID NOs: 12 and 16.

[0262]

[0263] Implementation Example (3): A vector containing two required and two optional arguments.

[0264] The vector may include a nucleic acid sequence encoding the GSTA4 protein; and two nucleic acid sequences of conventional direct cross-differentiation factors.

[0265] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 protein; and a nucleic acid sequence encoding a Ngn2 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2, 14, and 26. In another embodiment, the vector may comprise SEQ ID NOs: 12, 14, and 26.

[0266] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Lhx3 protein; and a nucleic acid sequence encoding a Ngn2 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2, 16, and 26. In another embodiment, the vector may comprise SEQ ID NOs: 12, 16, and 26.

[0267] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 protein; and a nucleic acid sequence encoding an Isl1 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2, 14, and 24. In another embodiment, the vector may comprise SEQ ID NOs: 12, 14, and 24.

[0268] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Ngn2 protein; and a nucleic acid sequence encoding an Isl1 protein. In one specific embodiment, the vector may comprise SEQ ID NOs: 2, 26, and 24. In another specific embodiment, the vector may comprise SEQ ID NOs: 12, 26, and 24.

[0269] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 protein; and a nucleic acid sequence encoding a Lhx3 protein. In one embodiment, the vector may comprise SEQ ID NOs: 2, 14, and 16. In another embodiment, the vector may comprise SEQ ID NOs: 12, 14, and 16.

[0270]

[0271] Expression element of vector

[0272] In addition to the essential and optional components described above, the vector may further include expression elements necessary for the expression of the target protein.

[0273] For example, the expression element may include a "regulatory element" that regulates the expression of a differentiation factor. Furthermore, the expression element may optionally further include a "selection element" that aids in the selection of a differentiation factor.

[0274] Below, the vector's control elements, selection elements, etc. are described as examples, but any element known in the art for effectively expressing the target protein in the vector may be further included.

[0275]

[0276] regulation element

[0277] The above regulatory elements may be a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), 2A self-cleaving peptides, etc.

[0278] For example, the promoter may be an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, a CAG promoter, etc.

[0279] For example, the 2A self-cleaving peptide may be T2A, P2A, E2A, F2A, etc. The vector for expressing the differentiation factor may contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptides produce multiple proteins from the same transcript. Therefore, the 2A self-cleaving peptide may be positioned between two or more different proteins to be expressed within the vector.

[0280]

[0281] selection element

[0282] The above selection elements may be fluorescent protein genes, tags, reporter genes, antibiotic resistance genes, etc.

[0283] For example, the fluorescent protein gene may be a GFP gene, a YFP gene, an RFP gene, or an mCherry gene.

[0284] For example, the tag may be a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, and a thioredoxin (Trx) tag.

[0285] For example, the reporter gene may be glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, etc.

[0286] For example, the antibiotic resistance gene may be an ampicillin resistant gene, a hygromycin resistant gene, a neomycin resistant gene, a kanamycin resistant gene, a blasticidin resistant gene, a zeocin resistant gene, or the like.

[0287]

[0288] Specific examples of vectors

[0289] Below, examples including essential components, optional components, and expression elements of the aforementioned vectors will be described, but are not limited to the description below.

[0290] The configuration examples described below are only examples, and those skilled in the art can modify the design to express the target protein.

[0291]

[0292] Example (1): Vector containing GSTA4 alone

[0293] As an example of the present application, the vector may include a promoter and a nucleic acid sequence encoding the GSTA4 protein. In this case, the nucleic acid sequence encoding the GSTA4 protein may be of human origin. Preferably, the nucleic acid sequence encoding the GSTA4 protein may be SEQ ID NO: 2 or 12. In this case, the promoter may be a CBA promoter, a PGK promoter, a CMV promoter, a CAG promoter, etc. Preferably, the promoter may be a CMV promoter. In one specific example, the sequence of the promoter may be a sequence represented by SEQ ID NO: 37.

[0294] In one embodiment, the vector of the present application may comprise SEQ ID NO: 37 and SEQ ID NO: 2.

[0295] In another embodiment, the vector of the present application may comprise SEQ ID NO: 37 and SEQ ID NO: 12.

[0296]

[0297] Example (2): A vector containing GSTA4 and one conventional direct cross differentiation factor

[0298] In another example of the present application, the vector may comprise a promoter, a nucleic acid sequence encoding a GSTA4 protein, and a nucleic acid sequence encoding a conventional direct cross-differentiation factor.

[0299] For example,

[0300] The above vector may include a promoter, a nucleic acid sequence encoding a GSTA4 protein, and a nucleic acid sequence encoding an Ascl1 protein.

[0301] The above vector may include a promoter, a nucleic acid sequence encoding a GSTA4 protein, and a nucleic acid sequence encoding a Brn2 protein.

[0302] The above vector may include a promoter, a nucleic acid sequence encoding a GSTA4 protein, and a nucleic acid sequence encoding a MNX1 (Motor neuron and pancreas homeobox 1; also called Hb9) protein.

[0303] The above vector may include a promoter, a nucleic acid sequence encoding a GSTA4 protein, and a nucleic acid sequence encoding a Lhx3 protein.

[0304] At this time, the nucleic acid sequence encoding the GSTA4 protein; the nucleic acid sequence encoding the Ascl1 protein; the nucleic acid sequence encoding the Brn2 protein; the nucleic acid sequence encoding the Hb9 protein; and the nucleic acid sequence encoding the Lhx3 protein may be of human origin.

[0305] In one specific example,

[0306] For example, the nucleic acid sequence encoding the GSTA4 protein may be SEQ ID NO: 2 or 12.

[0307] For example, the nucleic acid sequence encoding the Ascl1 protein may be SEQ ID NO: 18.

[0308] For example, the nucleic acid sequence encoding the Brn2 protein may be SEQ ID NO: 20.

[0309] For example, the nucleic acid sequence encoding the Hb9 (MNX1) protein may be SEQ ID NO: 14.

[0310] For example, the nucleic acid sequence encoding the Lhx3 protein may be SEQ ID NO: 16.

[0311]

[0312] At this time, the promoter contained in the vector of Example (2) may be selected from a CBA promoter, a PGK promoter, a CMV promoter, a CAG promoter, etc. Preferably, the promoter may be a CMV promoter. In one specific example, the CMV promoter sequence may be a sequence represented by SEQ ID NO: 37.

[0313] At this time, the vector of Example (2) may optionally further include a 2A self-cleaving peptide. In particular, when the vector of the present application further includes a 2A self-cleaving peptide, it may be when the vector includes a nucleic acid sequence encoding two or more different proteins to be expressed. In this case, the 2A self-cleaving peptide may be located between two or more different proteins.

[0314] The above 2A self-cleaving peptide may be selected from T2A, P2A, E2A, F2A, etc. In one specific example, the 2A self-cleaving peptide may be T2A or P2A. For example, P2A may be the sequence of SEQ ID NO: 38, and T2A may be the sequence of SEQ ID NO: 39.

[0315] For example,

[0316] The above vector may include a promoter; a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding a Lhx3 protein.

[0317] The above vector may include a promoter; a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding a Lhx3 protein.

[0318] The above vector may include a promoter; a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding a Hb9 protein.

[0319] The above vector may include a promoter; a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding a Hb9 protein.

[0320] As specific examples of embodiment (2), the vector may include the following sequence:

[0321] Specific examples of vectors containing (promoter, Gsta4, MNX1):

[0322] SEQ ID NO: 37, SEQ ID NO: 12 and SEQ ID NO: 14;

[0323] SEQ ID NO: 37, SEQ ID NO: 2 and SEQ ID NO: 14;

[0324]

[0325] Specific examples of vectors containing (promoter, Gsta4, 2A, MNX1):

[0326] SEQ ID NO: 37, SEQ ID NO: 12, SEQ ID NO: 38 and SEQ ID NO: 14;

[0327] SEQ ID NO: 37, SEQ ID NO: 12, SEQ ID NO: 39 and SEQ ID NO: 14;

[0328] SEQ ID NO: 37, SEQ ID NO: 2, SEQ ID NO: 38 and SEQ ID NO: 14;

[0329] SEQ ID NO: 37, SEQ ID NO: 2, SEQ ID NO: 39 and SEQ ID NO: 14;

[0330]

[0331] Specific examples of vectors containing (promoter, Gsta4, Lhx3):

[0332] SEQ ID NO: 37, SEQ ID NO: 12 and SEQ ID NO: 16;

[0333] Sequence number 37, Sequence number 2 and Sequence number 16;

[0334]

[0335] Specific examples of vectors containing (promoter, Gsta4, 2A, Lhx3):

[0336] SEQ ID NO: 37, SEQ ID NO: 12, SEQ ID NO: 38 and SEQ ID NO: 16;

[0337] SEQ ID NO: 37, SEQ ID NO: 12, SEQ ID NO: 39 and SEQ ID NO: 16;

[0338] SEQ ID NO: 37, SEQ ID NO: 2, SEQ ID NO: 38 and SEQ ID NO: 16;

[0339] Sequence number 37, Sequence number 2, Sequence number 39 and Sequence number 16.

[0340]

[0341] Example (3): A vector containing GSTA4 and two conventional direct cross differentiation factors

[0342] As another example of the present application, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; and two nucleic acid sequences encoding a conventional direct cross-differentiation factor.

[0343] For example, the vector may comprise a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 protein; and a nucleic acid sequence encoding a Lhx3 protein.

[0344] At this time, the nucleic acid sequence encoding the GSTA4 protein; the nucleic acid sequence encoding the Hb9 protein; and the nucleic acid sequence encoding the Lhx3 protein may be of human origin.

[0345] For example, the nucleic acid sequence encoding the GSTA4 protein may be SEQ ID NO: 2 or 12.

[0346] For example, the nucleic acid sequence encoding the Hb9 protein may be SEQ ID NO: 14.

[0347] For example, the nucleic acid sequence encoding the Lhx3 protein may be SEQ ID NO: 16.

[0348]

[0349] At this time, the promoter contained in the vector of Example (3) may be selected from a CBA promoter, a PGK promoter, a CMV promoter, a CAG promoter, etc. Preferably, the promoter may be a CMV promoter. In one specific example, the CMV promoter sequence may be a sequence represented by SEQ ID NO: 37.

[0350] The vector may optionally further comprise a 2A self-cleaving peptide. Preferably, the 2A self-cleaving peptide may be T2A, P2A, E2A, F2A, etc. Most preferably, the 2A self-cleaving peptide may be T2A or P2A. Specifically, P2A may be SEQ ID NO: 38, and T2A may be SEQ ID NO: 39. The 2A self-cleaving peptide may be located between three or more different proteins. Furthermore, at this time, the 2A self-cleaving peptide may be one or two. In particular, when there are two 2A self-cleaving peptides, they may be identical or different from each other.

[0351] For example,

[0352] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding Lhx3 protein; and a nucleic acid sequence encoding GSTA4 protein.

[0353] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding Lhx3 protein; and a nucleic acid sequence encoding GSTA4 protein.

[0354] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding GSTA4 protein.

[0355] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding GSTA4 protein.

[0356] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding GSTA4 protein.

[0357] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding GSTA4 protein.

[0358] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding GSTA4 protein.

[0359] The above vector may include a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding GSTA4 protein.

[0360]

[0361] As specific examples of embodiment (3), the vector may include the following sequence:

[0362] Specific examples of vectors containing (promoter, Gsta4, MNX1, Lhx3):

[0363] SEQ ID NO: 37, SEQ ID NO: 12, SEQ ID NO: 14 and SEQ ID NO: 16;

[0364] SEQ ID NO: 37, SEQ ID NO: 2, SEQ ID NO: 14 and SEQ ID NO: 16;

[0365]

[0366] Specific examples of vectors containing (promoter, MNX1, 2A, Lhx3, Gsta4):

[0367] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 38, SEQ ID NO: 16 and SEQ ID NO: 2;

[0368] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 39, SEQ ID NO: 16 and SEQ ID NO: 2;

[0369] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 38, SEQ ID NO: 16 and SEQ ID NO: 12;

[0370] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 39, SEQ ID NO: 16 and SEQ ID NO: 12;

[0371]

[0372] Specific examples of vectors containing (promoter, MNX1, Lhx3, 2A, Gsta4):

[0373] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 38 and SEQ ID NO: 2;

[0374] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 39 and SEQ ID NO: 2;

[0375] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 38 and SEQ ID NO: 12;

[0376] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 39 and SEQ ID NO: 12;

[0377]

[0378] Specific examples of vectors containing (promoter, MNX1, 2A, Lhx3, 2A, Gsta4):

[0379] SEQ ID NO: 37, SEQ ID NO: 14, SEQ ID NO: 38, SEQ ID NO: 16, SEQ ID NO: 39 and SEQ ID NO: 2;

[0380] SEQ ID NO: 37; SEQ ID NO: 14, SEQ ID NO: 38, SEQ ID NO: 16, SEQ ID NO: 39 and SEQ ID NO: 12;

[0381] SEQ ID NO: 37; SEQ ID NO: 14, SEQ ID NO: 39, SEQ ID NO: 16, SEQ ID NO: 38 and SEQ ID NO: 2;

[0382] SEQ ID NO: 37; SEQ ID NO: 14, SEQ ID NO: 39, SEQ ID NO: 16, SEQ ID NO: 38 and SEQ ID NO: 12;

[0383] SEQ ID NO: 37; SEQ ID NO: 14, SEQ ID NO: 38, SEQ ID NO: 16, SEQ ID NO: 39 and SEQ ID NO: 12;

[0384] SEQ ID NO: 37; SEQ ID NO: 14, SEQ ID NO: 39, SEQ ID NO: 16, SEQ ID NO: 38 and SEQ ID NO: 12.

[0385]

[0386] Types of vectors

[0387] The above vector may be a viral vector.

[0388] For example, the virus may be a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus (AAV), a vaccinia virus, a poxvirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukosis virus (ASLV), a spleen necrosis virus (SNV), a rou sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a herpes simplex virus, an epizomal virus, or a herpes simplex virus. Preferably, the virus may be an adeno-associated virus.

[0389] As another example, the vector may be a non-viral vector.

[0390] For example, the non-viral vector may be a plasmid, a phage, naked DNA, a DNA-lipid complex, a DNA-polymer complex, mRNA, etc.

[0391]

[0392] Function of vector: carrier

[0393] The vector described above is used to deliver a direct differentiation factor to cells for treating spinal cord injury disease of the present application.

[0394] In particular, in the case of viral vectors, a nucleic acid sequence encoding a direct cross-differentiation factor is loaded onto the viral capsid and delivered to cells.

[0395] The most commonly used viral vectors today are lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors.

[0396] Lentiviral vectors are primarily used in ex vivo therapies, where cells taken from a patient are modified in the laboratory before being reimplanted.

[0397] Adenovirus vectors can carry a large amount of genes, but have limitations in transient expression.

[0398] Adeno-associated virus (AAV) vectors are the most widely used therapeutics because they can overcome the problems of lentiviral and adenoviral vectors. Because AAV vectors can infect cells regardless of cell division, they are widely used in the development of in vivo therapeutics. Therefore, AAV vectors are currently recognized as the safest and most effective viral vectors used to deliver genes into cells compared to other viral vectors, and are the only therapeutic developed using viral vectors to have received US FDA approval. In this application, the terms "AAV vector" and "AAV particle" are sometimes used interchangeably.

[0399]

[0400] The composition for treating spinal cord injury of the present invention can be delivered to the damaged spinal cord region by incorporating a direct cross-linking differentiation factor into the AAV vector. That is, by administering the AAV vector to the damaged spinal cord region and expressing the direct cross-linking differentiation factor, a therapeutic effect can be achieved through the overproduction of motor neurons.

[0401] Below, a composition comprising an AAV vector is described in more detail.

[0402]

[0403] Composition comprising an AAV vector

[0404] Another aspect of the present application relates to a composition for treating spinal cord injury disease comprising an AAV vector.

[0405] The composition for treating spinal cord injury disease of the present application comprises an AAV vector.

[0406] In one example, the AAV vector comprises a nucleic acid sequence encoding the GSTA4 protein.

[0407] In another example, the AAV vector comprises a nucleic acid sequence encoding a GSTA4 protein and each nucleic acid sequence encoding one or more conventional direct cross-linking differentiation factor proteins.

[0408] Below, the AAV structure and characteristics, AAV vectors containing GSTA4, AAV vectors containing GSTA4 and conventional direct cross differentiation factors, etc. are described.

[0409]

[0410] Structure and characteristics of adeno-associated virus (AAV)

[0411] AAV, used as a gene delivery vehicle, is composed of an icosahedral capsid with a diameter of 18 to 25 nm and a single-stranded DNA of 4.7 to 6 kb in length inside it.

[0412] At both ends of the AAV genome are hairpin structures called inverted terminal repeats (ITRs). ITRs are involved in AAV genome replication and AAV particle packaging.

[0413] Additionally, the AAV genome contains two open reading frames (ORFs): the replication (Rep) region and the capsid (Cap) region. These ORFs encode the replication and capsid gene products, respectively. The replication and capsid gene products are involved in replication, assembly, and packaging of complete AAV viral particles. The AAV replication region expresses four viral proteins: Rep 78, Rep 68, Rep 52, and Rep 40. The AAV capsid region also encodes at least three proteins: VP1, VP2, and VP3.

[0414]

[0415] Hereinafter, the term AAV vector (AAV particle or AAV) is interpreted to include at least a capsid, ITR and the active ingredient of the present application.

[0416] ITR serves as a replication and packaging signal for vector production, and the capsid protein forms a capsid to accommodate the cross-differentiation factor DNA inside, as well as determines tissue tropism to deliver the cross-differentiation factor DNA to target cells and tissues.

[0417]

[0418] AAV serotype

[0419] AAV has more than 20 serotypes and more than 100 variants, so those skilled in the art can select and use them appropriately as needed.

[0420] AAVs that can be used in the present application can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, etc.

[0421] For example, the AAV may be AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9, or AAV10. In one specific embodiment, the AAV may be AAV1, AAV2, AAV4, AAV9, or AAV10. In one embodiment, the AAV of the present application may be AAV2.

[0422] In a preferred embodiment, the composition for treating spinal cord injury of the present application may utilize an AAV2 vector. That is, the composition for treating spinal cord injury of the present application may include an AAV2 vector comprising a nucleic acid sequence encoding a direct cross-linking factor. In one embodiment of the present application, the AAV2 vector comprises an ITR, a replication site, a capsid site, and a nucleic acid sequence encoding a direct cross-linking factor.

[0423]

[0424] Advantages of AAV vectors

[0425] In the present application, when an AAV vector is used as a delivery vehicle for an effective substance, the following advantages can be obtained.

[0426] Advantage (1): Since the AAV genome is not inserted into the host cell genome, safety issues such as genotoxicity are very low.

[0427] Advantage (2): AAV vectors exist in a stable episomal state within target cells, allowing gene expression to continue for a long period of time.

[0428] Advantage (3): AAV vectors target both dividing and non-dividing cells. Therefore, they can target areas where transfection is difficult, such as the central nervous system, muscles, and eyes. In other words, they can be effectively applied to cells in the spinal cord injury area (central nervous system), the target of treatment in this application.

[0429] Advantage (4): Since AAV vectors do not contain viral structural genes, they do not induce an immune response.

[0430] Advantage (5): AAV vectors can be produced at high titers.

[0431]

[0432] Below are specific examples of the composition for treating spinal cord injury disease of the present application.

[0433] An AAV vector containing a nucleic acid sequence encoding the GSTA4 protein,

[0434] An AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein and a nucleic acid sequence encoding a conventional differentiation factor is described.

[0435] This is only for convenience and is not intended to be limiting.

[0436]

[0437] Example of a composition containing an AAV vector

[0438] For example, a composition for treating a spinal cord injury disorder may comprise an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein.

[0439] As another example, a composition for treating a spinal cord injury disorder may comprise an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a conventional direct differentiation factor. The conventional direct differentiation factor may be selected from Ascl1, Brn2, Myt1L, Mnx1 (also called Motor neuron and pancreas homeobox 1; Hb9), Isl1, Lhx3, Ngn2, and NeuroD1. Preferably, the composition for treating a spinal cord injury disorder may comprise an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Mnx1 protein; and a nucleic acid sequence encoding a Lhx3 protein.

[0440] The above AAV vector can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, etc.

[0441] For example, the AAV vector can be AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9, or AAV10. In one specific embodiment, the AAV can be AAV1, AAV2, AAV4, AAV9, or AAV10. In one embodiment, the AAV vector can be AAV2.

[0442]

[0443] Method for preparing a composition for treating spinal cord injury disease

[0444] In another aspect of the present application, a method for preparing a composition for treating the spinal cord injury disease is provided.

[0445] As previously described, the composition for treating spinal cord injury may take various forms, including proteins, nucleic acids, and mixtures of proteins and nucleic acids. Methods for producing these various forms can be employed using methods known in the art.

[0446] However, the following describes, by way of example, a method for preparing a composition for treating spinal cord injury disease including an AAV vector, but is not limited to the description thereof.

[0447]

[0448] Method for producing AAV vectors

[0449] The method for producing the AAV vector of the present application can use a method known in the art.

[0450] The method for producing an AAV vector can typically be performed using three or more plasmids.

[0451] As an example, a method for manufacturing an AAV vector includes:

[0452] A first plasmid containing at least ITR, promoter, and direct cross-differentiation factor;

[0453] A second plasmid comprising a nucleic acid sequence encoding at least a replication protein and / or a capsid protein;

[0454] A third plasmid comprising at least a sequence encoding a helper gene;

[0455] introduces into the host cell;

[0456] Extracting AAV particles from the host cell may be included.

[0457] At this time, the AAV particle may be an AAV2 particle.

[0458] The above AAV particle refers to one that includes at least a capsid, ITR, and a direct cross-differentiation factor. That is, it includes at least an ITR and a direct cross-differentiation factor inside the capsid.

[0459] At this time, the method for producing the above AAV vector can be introduced into a host cell excluding the above third plasmid.

[0460] In one specific example, the first plasmid may comprise at least an ITR, a promoter, and a nucleic acid sequence encoding a GSTA4 protein. In this case, the AAV particle may be an AAV 2 particle.

[0461] In another specific example, the first plasmid may include at least an ITR, a promoter, a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Mnx1 protein; and a nucleic acid sequence encoding a Lhx3 protein.

[0462] In another specific example, the first plasmid may comprise at least an ITR, a promoter, a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Mnx1 protein.

[0463] In another specific example, the first plasmid may include at least an ITR, a promoter, a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein.

[0464] The host cell may be a cell infected with an AAV vector. For example, the host cell may be HEK293, HEK293T, Huh-7, HeLa, HepG2, Hep1A, SV40, CHO, COS, MeWo, NIH3T3, A549, PERC6, HT1180, monocytes, dendritic cells, etc., but is not limited thereto. Preferably, the host cell may be a HEK293T cell.

[0465] The above replication protein may be Rep78, Rep68, Rep52, Rep40, etc.

[0466] The above capsid protein may be VP1, VP2, VP3, etc.

[0467] The above helper genes may be E2A, E4, VA, etc.

[0468] The above promoter may be a CBA promoter, a PGK promoter, a CMV promoter, a CAG promoter, etc.

[0469] The method for producing the above AAV vector may further include culturing a host cell into which the first plasmid to the third plasmid have been introduced.

[0470] At this time, the culture can be continued until the first to third plasmids are introduced into the host cell and the direct cross-differentiation factor is expressed. This can be set by the experimenter according to the type of direct cross-differentiation factor, the type of host cell, etc.

[0471] A method known in the art for introducing the above plasmid into a host cell can be appropriately selected and performed.

[0472] Examples of methods that can be used include, but are not limited to, electroporation, gene gun, sonoporation, magnetofection, microinjection, transient cell compression or squeezing, cationic liposome, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection.

[0473] At this time, the order in which the plasmid is introduced into the host cell is not particularly restricted.

[0474] The above AAV particles may be prepared in the form of exosomes or microparticles, but are not limited thereto. The method for extracting AAV particles may be performed using a method known in the art.

[0475] For example, methods for extracting AAV particles can include centrifugation, precipitation, immunoprecipitation, affinity chromatography, filtration, magnetic beads coated with specific antibodies or actamers, freeze / thaw, sonication, and commercial kits.

[0476] AAV particles can optionally be concentrated using methods known in the art. For example, the concentration can be achieved using, but is not limited to, immunomagnetic capture, organic flocculation, and polyethylene glycol (PEG) precipitation.

[0477] Additionally, AAV particles may optionally undergo further quality testing. For example, the quality testing may include, but is not limited to, titer measurement, sterility testing for bacteria and fungi, and mycoplasma detection testing.

[0478]

[0479] A nucleic acid sequence encoding a replication protein or / and a nucleic acid sequence encoding a capsid protein contained in a plasmid introduced into a host cell forms an AAV capsid,

[0480] The nucleic acid sequence encoding the ITR, promoter, and direct cross-linking factor is introduced into the AAV capsid. In this way, the AAV particle extracted from the host cell into which the plasmid has been introduced penetrates into the nucleus of the cell through receptors on the surface of the target cell, etc., and when the nucleic acid sequence encoding the direct cross-linking factor inside the capsid is administered to the target, the nucleic acid sequence encoding the direct cross-linking factor is expressed in the body.

[0481] In a preferred embodiment, the AAV particle of the present application may be an AAV2 particle comprising sequence number 2 or 12.

[0482] In another preferred embodiment, the AAV particle of the present application may be an AAV2 particle comprising sequence numbers 2, 14 and 16.

[0483] In another preferred embodiment, the AAV particle of the present application may be an AAV2 particle comprising sequence numbers 12, 14 and 16.

[0484]

[0485] Various uses of compositions for treating spinal cord injuries

[0486] Another aspect of the present application relates to various uses of the composition for treating spinal cord injuries.

[0487] The composition for treating the above spinal cord injury can be used for pharmaceutical purposes, kits, etc.

[0488] Below we will explain the pharmaceutical uses and kit.

[0489] Use (1): Pharmaceutical use

[0490] The composition of the present application can be used to treat a subject in need of treatment. For example, the composition for treating spinal cord injury can be used for pharmaceutical purposes.

[0491]

[0492] pharmaceutical composition

[0493] In another aspect of the present application, a composition for treating spinal cord injury is disclosed as a pharmaceutical composition.

[0494] The above pharmaceutical composition may contain the above-described effective ingredient as an effective ingredient of the pharmaceutical composition.

[0495] The above effective ingredient may be (1) or (2) below.

[0496] (1) GSTA4 protein or nucleic acid sequence encoding it

[0497] (2) GSTA4 protein or a nucleic acid sequence encoding the same; and a conventional direct cross-differentiation factor protein or a nucleic acid sequence encoding the same.

[0498] At this time, the conventional direct cross-differentiation factors may be 1 to 8 selected from Ascl1, Brn2, Myt1L, Hb9 (MNX1), Isl1, Lhx3, Ngn2, and NeuroD1.

[0499] Preferably, the conventional direct cross-differentiation factor may be a nucleic acid sequence encoding the Hb9 (MNX1) protein; or a nucleic acid sequence encoding the Lhx3 protein. Most preferably, the conventional direct cross-differentiation factor may be a nucleic acid sequence encoding the Hb9 (MNX1) protein; or a nucleic acid sequence encoding the Lhx3 protein.

[0500] In addition, the indications of the pharmaceutical composition, delivery of the active ingredient, etc. are the same as those described in the composition for treating spinal cord injury.

[0501] For example, the pharmaceutical composition of the present application may be an AAV vector comprising an active ingredient.

[0502] As an example, the pharmaceutical composition of the present application may comprise an AAV vector comprising a nucleic acid sequence encoding GSTA4. In this case, the AAV vector may be an AAV 2 vector or an AAV 4 vector. Preferably, the AAV vector may be an AAV2 vector.

[0503] As another example, the pharmaceutical composition of the present application may comprise an AAV vector comprising a nucleic acid sequence encoding GSTA4; a nucleic acid sequence encoding Hb9 protein; and a nucleic acid sequence encoding Lhx3 protein. In this case, the AAV vector may be an AAV 2 vector or an AAV 4 vector. Preferably, the AAV vector may be an AAV2 vector.

[0504] As another example, the pharmaceutical composition of the present application may be an AAV particle comprising an active ingredient.

[0505] As an example, the pharmaceutical composition of the present application may comprise an AAV particle comprising a nucleic acid sequence encoding GSTA4. In this case, the AAV particle may be an AAV 2 particle or an AAV 4 particle. Preferably, the AAV particle may be an AAV2 particle.

[0506] As another example, the pharmaceutical composition of the present application may comprise an AAV particle comprising a nucleic acid sequence encoding GSTA4; a nucleic acid sequence encoding Hb9 protein; and a nucleic acid sequence encoding Lhx3 protein. In this case, the AAV particle may be an AAV 2 particle or an AAV 4 particle. Preferably, the AAV particle may be an AAV2 particle.

[0507]

[0508] Additional components of pharmaceutical compositions

[0509] In addition to the active ingredient, the pharmaceutical composition may optionally further comprise a pharmaceutically acceptable additional component.

[0510] The term "pharmaceutically acceptable" is used herein to refer to materials, compositions and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0511] The pharmaceutically acceptable additional component may be physiologically acceptable, contributing to the stabilization, dissolution, absorption, and introduction efficiency of the active ingredient of the present application. For example, the pharmaceutically acceptable additional component may be, but is not limited to, a carrier, excipient, diluent, or preservative.

[0512] For example, the carrier, excipient and diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, distilled water, saline solution, glycerol, ethanol, HSA (Human serum albumin), etc.

[0513] For example, the preservative may be benzoic acid, sodium benzoate, sorbic acid, paraoxybenzoic acid, chlorobutanol, etc.

[0514] When formulating the above pharmaceutical composition, fillers, bulking agents, binders, wetting agents, etc. may be further included.

[0515]

[0516] Formulation of pharmaceutical compositions

[0517] The above pharmaceutical composition may be formulated for oral or parenteral use.

[0518] For example, when formulated for oral use, it can be manufactured in the form of solids, liquids, suspensions, granules, capsules, semi-solids, etc.

[0519] For example, when formulated for parenteral use, it can be manufactured as an injection, an aerosol, etc. Preferably, it can be formulated as an injection.

[0520] For injectable formulations, additional methods known in the art can be employed to delay drug absorption and prolong the drug's effect, if necessary. For example, injectable depot forms can be manufactured by encapsulating the active ingredient using a biodegradable polymer. Alternatively, injectable depot forms can be manufactured by entrapping the active ingredient in liposomes or microemulsions.

[0521]

[0522] Specific composition examples of pharmaceutical compositions

[0523] Below, examples of the composition of the pharmaceutical composition are described, but are not limited to the description below.

[0524]

[0525] Composition example (1): Pharmaceutical composition comprising GSTA4 protein or a nucleic acid sequence encoding the same

[0526] As an example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0527] It may include a GSTA4 protein or a nucleic acid sequence encoding the same.

[0528] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0529] Promoter; and

[0530] It may include a GSTA4 protein or a nucleic acid sequence encoding the same.

[0531] At this time, the promoter may be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter may be a CMV promoter. In one specific example, the sequence of the promoter may be a sequence represented by SEQ ID NO: 37.

[0532] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0533] promoter;

[0534] GSTA4 protein or a nucleic acid sequence encoding the same; and

[0535] It may include one or more pharmaceutically acceptable carriers, excipients, diluents, and preservatives.

[0536] At this time, the promoter, pharmaceutically acceptable carrier, excipient, diluent, preservative, etc. are the same as described above.

[0537] As a specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0538] Sequence number 37;

[0539] Sequence number 2 or 12; and

[0540] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0541] At this time, the pharmaceutical composition can be formulated into an injection.

[0542]

[0543] Composition example (2): A pharmaceutical composition comprising a GSTA4 protein or a nucleic acid sequence encoding the same; and a MNX1 (Hb9) protein or a nucleic acid sequence encoding the same.

[0544] As an example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0545] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; and a MNX1 (Hb9) protein or a nucleic acid sequence encoding the same.

[0546] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0547] promoter;

[0548] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; and a MNX1 (Hb9) protein or a nucleic acid sequence encoding the same.

[0549] At this time, the promoter may be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter may be a CMV promoter. In one specific example, the sequence of the promoter may be a sequence represented by SEQ ID NO: 37.

[0550] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0551] promoter;

[0552] GSTA4 protein or a nucleic acid sequence encoding the same;

[0553] MNX1 (Hb9) protein or a nucleic acid sequence encoding the same; and

[0554] It may include one or more pharmaceutically acceptable carriers, excipients, diluents, and preservatives.

[0555] At this time, the promoter, pharmaceutically acceptable carrier, excipient, diluent, preservative, etc. are the same as described above.

[0556] As a specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0557] Sequence number 37;

[0558] Sequence number 2;

[0559] Sequence number 14; and

[0560] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0561] In another specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0562] Sequence number 37;

[0563] Sequence number 12;

[0564] Sequence number 14; and

[0565] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0566] At this time, the pharmaceutical composition can be formulated into an injection.

[0567]

[0568] Composition example (3): A pharmaceutical composition comprising a GSTA4 protein or a nucleic acid sequence encoding the same; and a Lhx3 protein or a nucleic acid sequence encoding the same;

[0569] As an example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0570] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0571] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0572] promoter;

[0573] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0574] At this time, the promoter may be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter may be a CMV promoter. In one specific example, the sequence of the promoter may be a sequence represented by SEQ ID NO: 37.

[0575] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0576] promoter;

[0577] GSTA4 protein or a nucleic acid sequence encoding the same;

[0578] Lhx3 protein or a nucleic acid sequence encoding the same; and

[0579] It may include one or more pharmaceutically acceptable carriers, excipients, diluents, and preservatives.

[0580] At this time, the promoter, pharmaceutically acceptable carrier, excipient, diluent, preservative, etc. are the same as described above.

[0581] As a specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0582] Sequence number 37;

[0583] Sequence number 2;

[0584] Sequence number 16; and

[0585] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0586] As a specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0587] Sequence number 37;

[0588] Sequence number 12;

[0589] Sequence number 16; and

[0590] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0591] At this time, the pharmaceutical composition can be formulated into an injection.

[0592]

[0593] Composition example (4): A pharmaceutical composition comprising a GSTA4 protein or a nucleic acid sequence encoding the same; a MNX1 (Hb9) protein or a nucleic acid sequence encoding the same; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0594] As an example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0595] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; a nucleic acid sequence encoding the MNX1 (Hb9) protein; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0596] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0597] promoter;

[0598] It may include a GSTA4 protein or a nucleic acid sequence encoding the same; a nucleic acid sequence encoding the MNX1 (Hb9) protein; and a Lhx3 protein or a nucleic acid sequence encoding the same.

[0599] At this time, the promoter may be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter may be a CMV promoter. In one specific example, the sequence of the promoter may be a sequence represented by SEQ ID NO: 37.

[0600] As another example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0601] promoter;

[0602] GSTA4 protein or a nucleic acid sequence encoding the same;

[0603] Lhx3 protein or a nucleic acid sequence encoding the same;

[0604] A nucleic acid sequence encoding the MNX1 (Hb9) protein; and

[0605] It may include one or more pharmaceutically acceptable carriers, excipients, diluents, and preservatives.

[0606] At this time, the promoter, pharmaceutically acceptable carrier, excipient, diluent, preservative, etc. are the same as described above.

[0607] As a specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0608] Sequence number 37;

[0609] Sequence number 2;

[0610] Sequence number 14;

[0611] Sequence number 16; and

[0612] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0613] In another specific example, the pharmaceutical composition for treating spinal cord injury of the present application comprises:

[0614] Sequence number 37;

[0615] Sequence number 12;

[0616] Sequence number 14;

[0617] Sequence number 16; and

[0618] A buffer comprising one or more of sodium chloride, potassium chloride, potassium dihydrogen phosphate, dibasic sodium phosphate, and poloxamer 188 may be included.

[0619] At this time, the pharmaceutical composition can be formulated into an injection.

[0620]

[0621] Purpose (2): Kit

[0622] Another aspect of the present application discloses a kit comprising a composition for treating spinal cord injury.

[0623] The kit may include one or more containers containing instructions for use according to methods known in the art. Typically, the instructions for use include instructions for administering the pharmaceutical composition for treating, diagnosing, or preventing a disease.

[0624] The above instructions for use include information on dosage, dosing schedule and route of administration for the intended treatment.

[0625] For example, the instructions for use may include information on dosage, administration schedule, administration route, etc. for treating spinal cord injury using the composition for treating spinal cord injury of the present application.

[0626] The kit may further include one or more containers. For example, the containers may be vials, bottles, etc.

[0627] The above container contains a composition for treating spinal cord injury of the present application, and the container may be determined according to the form of the composition for treating spinal cord injury.

[0628]

[0629] 2. How to treat spinal cord injury

[0630] Overview of How to Treat Spinal Cord Injury Disorders

[0631] Another aspect of the present application relates to a method for treating spinal cord injury disorders.

[0632] The spinal cord injury disease is the same as described above.

[0633] The method for treating the above spinal cord injury disease utilizes the pharmaceutical composition described above.

[0634] As described above, the pharmaceutical composition for treating spinal cord injury disease of the present application comprises a direct cross-linking factor.

[0635] In particular, the method for treating spinal cord injury of the present application has the advantage of being able to be administered directly to the damaged spinal cord. This ability to act as an in vivo therapeutic agent is possible because the pharmaceutical composition for treating spinal cord injury of the present application possesses the following characteristics:

[0636] Feature (1): A direct cross-differentiation factor included in a pharmaceutical composition for treating spinal cord injury disease can directly cross-differentiate somatic cells into motor neurons.

[0637] Feature (2): The nucleic acid sequence encoding the above direct cross-differentiation factor can be delivered to a target cell using an AAV vector.

[0638] Therefore, the method of treating spinal cord injury disease of the present application can be used as an alternative that can overcome the limitations of conventional methods of treating spinal cord disease.

[0639] Below, we will explain the methods, dosage, etc. for treating spinal cord injury.

[0640]

[0641] Treatment methods

[0642] The method for treating spinal cord injury disease of the present application is as follows:

[0643] It includes administering to a subject a pharmaceutical composition (therapeutic agent) for treating spinal cord injury disease.

[0644] The pharmaceutical composition may be in the form of a vector, a cell comprising a vector, a protein, or a cell comprising a protein, but is not limited thereto. Preferably, the pharmaceutical composition may be in the form of a vector. More preferably, the pharmaceutical composition may be in the form of an AAV vector (AAV particle).

[0645] For example, a method of treating a spinal cord injury disorder may comprise administering to a subject a pharmaceutical composition comprising an AAV vector comprising a nucleic acid sequence encoding a direct cross-linking factor.

[0646] In one specific example, a method for treating a spinal cord injury disorder may comprise administering to a subject a pharmaceutical composition comprising an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein. Preferably, the AAV vector may be an AAV2 vector.

[0647] In another specific example, a method for treating a spinal cord injury disorder may comprise administering to a subject a pharmaceutical composition comprising an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein. Preferably, the AAV vector may be an AAV2 vector.

[0648] In another specific example, a method for treating a spinal cord injury disorder may comprise administering to a subject a pharmaceutical composition comprising an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding an Hb9 (MNX1) protein. Preferably, the AAV vector may be an AAV2 vector.

[0649] In another specific example, a method for treating a spinal cord injury disorder may comprise administering to a subject a pharmaceutical composition comprising an AAV vector comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 (MNX1) protein; and a nucleic acid sequence encoding a Lhx3 protein. Preferably, the AAV vector may be an AAV2 vector.

[0650]

[0651] Administration target

[0652] The subject (patient) to whom the above spinal cord injury disease treatment method is applied may be a subject with spinal cord damage, a subject with decreased motor neuron function, or a subject with a reduced number of motor neurons, but is not limited thereto.

[0653] The subject may be a mammal requiring treatment or prevention of spinal cord injury. For example, the mammal may be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, chimpanzee, etc. Preferably, the subject is a human.

[0654]

[0655] Method of administration

[0656] The spinal cord injury disease treatment agent of the present application can be administered to a subject through various routes according to clinical needs.

[0657] Administration may be oral or parenteral. In this case, parenteral administration may be injection.

[0658] When administering the above injection, the site of administration may be the damaged spinal cord, muscle, intradermal, subcutaneous, intravenous, abdominal, arterial, mucosal, spinal cord, bone marrow, intrathecal, transdermal, etc. Preferably, it is administered directly to the damaged spinal cord site.

[0659] For example, if the injection site is a damaged spinal cord, L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), T8 (thoracic 8), T9 (thoracic 9), T10 (thoracic 10), T11 (thoracic 11), T12 (thoracic 12), T13 (thoracic 13), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 (cervical 4), C5 (cervical 5), C6 (cervical 6), C7 (cervical 7), C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3), S4 (sacrum 4), etc.

[0660] It may include administering to the L4 of the spinal cord an AAV vector (AAV particle) comprising a nucleic acid sequence encoding a GSTA4 protein or a pharmaceutical composition comprising the same.

[0661] It may include administering to the L5 of the spinal cord an AAV vector (AAV particle) comprising a nucleic acid sequence encoding a GSTA4 protein or a pharmaceutical composition comprising the same.

[0662] It may include administering an AAV vector (AAV particle) containing a nucleic acid sequence encoding a GSTA4 protein or a pharmaceutical composition containing the same to a subject with spinal cord damage between L4 and L5, between the L4 and L5 areas of the spinal cord.

[0663] As a specific example, a method for treating spinal cord injury disease is provided.

[0664] A method for treating spinal cord damage between L4 and L5 may include administering an AAV vector (AAV particle) comprising a nucleic acid sequence encoding a GSTA4 protein to a subject having spinal cord damage between L4 and L5, or a pharmaceutical composition comprising the same, between L4 and L5 of the spinal cord.

[0665] In another specific example, a method for treating spinal cord injury disease is provided.

[0666] It may include administering to L4 to L5 of the spinal cord a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding an Lhx3 protein; an AAV vector (AAV particle) or a pharmaceutical composition comprising the same, to L4 to L5 of the spinal cord.

[0667] In another specific example, a method for treating spinal cord injury disease is provided.

[0668] It may include administering to L4 to L5 of the spinal cord a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a MNX1 (Hb9) protein; an AAV vector (AAV particle) or a pharmaceutical composition comprising the same, to L4 to L5 of the spinal cord.

[0669] In another specific example, a method for treating spinal cord injury disease is provided.

[0670] It may include administering to L4 to L5 of the spinal cord an AAV vector (AAV particle) comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a MNX1 (Hb9) protein; or a nucleic acid sequence encoding a Lhx3 protein, or a pharmaceutical composition comprising the same, to L4 to L5 of the spinal cord.

[0671]

[0672] Administration dose

[0673] The dosage of the pharmaceutical composition of the present application may be determined by considering the type of disease of the subject, the site of administration, body weight, age, degree of disease progression, etc., but is not limited thereto.

[0674] In addition, the above dosage may be determined within a range where the pharmaceutical composition does not cause excessive toxicity, irritation, allergic reactions, or other problems, corresponding to a reasonable benefit / risk ratio within the scope of medical judgment.

[0675] As an example, when purified into an AAV vector (AAV particle) comprising the pharmaceutical composition of the present application, the following dosage forms may be included.

[0676] For example, if the subject is a human,

[0677] 1x10 5 GC(genome copy) / kg, 1x10 6 GC / kg, 1x10 7 GC / kg, 1x10 8 GC / kg, 1x10 9 GC / kg, 1x10 10 GC / kg, 1x10 11 GC / kg, 1x10 12 GC / kg, 1x10 13 GC / kg, 1x10 14 GC / kg, 1x10 15 GC / kg, 1x10 16 GC / kg, 1x10 17 GC / kg, 1x10 18 GC / kg, 1x10 19 GC / kg, 1x10 20 AAV particles can be administered at doses within two numerical ranges selected from GC / kg.

[0678] The above pharmaceutical composition can be appropriately determined by a person skilled in the art in terms of the AAV content that can be included in the entire composition, taking into account the AAV administration dose.

[0679] In one specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein. 5 GC / kg to 1x10 15GC / kg can be administered to the subject. Preferably, the AAV particles are 1x10 6 GC / kg to 1x10 12 GC / kg. Most preferably, the AAV particles are 6x10 8 GC / kg to 5x10 11 GC / kg. More preferably, the AAV particles are administered at a dose of 6.7x10 8 GC / kg to 3.3x10 11 GC / kg. In one embodiment, the AAV particles are administered at a dose of 2.5x10 9 GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7x10 8 It can be administered at a dose of GC / kg.

[0680] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein. 5 GC / kg to 1x10 15 GC / kg can be administered to the subject. Preferably, the AAV particles are 1x10 6 GC / kg to 1x10 12 The dose may be GC / kg. Most preferably, the AAV particles are 6x10 8 GC / kg to 5x10 11 GC / kg. More preferably, the AAV particles are administered at a dose of 6.7x10 8 GC / kg to 3.3x10 11 GC / kg. In one embodiment, the AAV particles are administered at a dose of 2.5x10 9 GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7x10 8 It can be administered at a dose of GC / kg.

[0681] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Hb9 (MNX1) protein; 5 GC / kg to 1x10 15 GC / kg can be administered to the subject. Preferably, the AAV particles are 1x10 6 GC / kg to 1x10 12 The dose may be GC / kg. Most preferably, the AAV particles are 6x10 8 GC / kg to 5x10 11 GC / kg. More preferably, the AAV particles are administered at a dose of 6.7x10 8 GC / kg to 3.3x10 11 GC / kg. In one embodiment, the AAV particles are administered at a dose of 2.5x10 9 GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7x10 8 It can be administered at a dose of GC / kg.

[0682] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 (MNX1) protein; and a nucleic acid sequence encoding a Lhx3 protein. 5 GC / kg to 1x10 15 GC / kg can be administered to the subject. Preferably, the AAV particles are 1x10 6 GC / kg to 1x10 12 The dose may be GC / kg. Most preferably, the AAV particles are 6x10 8 GC / kg to 5x10 11 GC / kg. More preferably, the AAV particles are administered at a dose of 6.7x10 8 GC / kg to 3.3x10 11GC / kg. In one embodiment, the AAV particles are administered at a dose of 2.5x10 9 GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7x10 8 It can be administered at a dose of GC / kg.

[0683] For another example, if the subject is a non-human animal,

[0684] 1x10 5 GC(genome copy) / head, 1x10 6 GC / head, 1x10 7 GC / head, 1x10 8 GC / head, 1x10 9 GC / head, 1x10 10 GC / head, 1x10 11 GC / head, 1x10 12 GC / head, 1x10 13 GC / head, 1x10 14 GC / head, 1x10 15 GC / head, 1x10 16 GC / head, 1x10 17 GC / head, 1x10 18 GC / head, 1x10 19 GC / head, 1x10 20 AAV particles may be included in doses within two numerical ranges selected from GC / head, where GC / head refers to the dose of genome copies (GC) administered per mouse.

[0685] In one specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein. 5 GC / head to 1x10 15 It can be administered to the subject in a dose of GC / head. Preferably, the AAV particles are 1x10 6 GC / head to 1x10 12The capacity may be GC / head. Most preferably, the AAV particles are 2x10 7 GC / head to 1x10 10 It could be the capacity of GC / head.

[0686] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein; 5 GC / head to 1x10 15 It can be administered to the subject in a dose of GC / head. Preferably, the AAV particles are 1x10 6 GC / head to 1x10 12 A dose of GC / head may be administered. Most preferably, the AAV particles are 2x10 7 GC / head to 1x10 10 A dose of GC / head may be administered.

[0687] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Hb9 (MNX1) protein; 5 GC / head to 1x10 15 It can be administered to the subject in a dose of GC / head. Preferably, the AAV particles are 1x10 6 GC / head to 1x10 12 A dose of GC / head may be administered. Most preferably, the AAV particles are 2x10 7 GC / head to 1x10 10 A dose of GC / head may be administered.

[0688] In another specific example, the method of treating spinal cord injury disease of the present application comprises administering 1x10 AAV particles comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 (MNX1) protein; and a nucleic acid sequence encoding a Lhx3 protein.5 GC / head to 1x10 15 It can be administered to the subject in a dose of GC / head. Preferably, the AAV particles are 1x10 6 GC / head to 1x10 12 A dose of GC / head may be administered. Most preferably, the AAV particles are 2x10 7 GC / head to 1x10 10 A dose of GC / head may be administered.

[0689] The above dosage can be determined based on data obtained from cell culture and / or animal studies and / or human clinical trials. At this time, the dosage range for humans can be determined based on the dosage obtained from animal studies or preclinical trials using methods known in the art.

[0690] For example, to formulate a dosage range for humans, one can refer to the following formula:

[0691] HED(Human Equivalent Dose) = animal NOAEL x(W animal / W human ) (1-b)

[0692] The above NOAEL (No Observed Adverse Effect Level) refers to the non-toxic dose.

[0693] For another example, formulating a dosage range for humans may involve selecting a value below the MRSD (Maximum Recommended Starting Dose). In this case, the MRSD value can be calculated by referring to the following formula:

[0694] MRSD = HED / SF

[0695]

[0696] At this time, 1x10 per 1uL of the pharmaceutical composition 5 GC(genome copy), 1x106 GC, 1x10 7 GC, 1x10 8 GC, 1x10 9 GC, 1x10 10 GC, 1x10 11 GC, 1x10 12 GC, 1x10 13 GC, 1x10 14 GC, 1x10 15 GC, 1x10 16 GC, 1x10 17 GC, 1x10 18 AAVs of capacities within two numerical ranges selected from GC may be included.

[0697] For example, 1x10 per 1uL of the pharmaceutical composition of the present application 5 GC to 1x10 16 AAV of GC may be included. Preferably 1x10 per 1uL of the pharmaceutical composition. 5 GC to 1x10 14 AAV of GC may be included. Most preferably, 2x10 per 1uL of the pharmaceutical composition. 5 GC to 3.0x10 13 AAV of GC may be included.

[0698] In one specific example, 1x10 AAVs comprising a nucleic acid sequence encoding a GSTA4 protein are present per 1 uL of the pharmaceutical composition of the present application. 5 GC to 1x10 16 GC may be included. Preferably, the AAV is 1x10 5 GC to 1x10 14 It can be GC. Most preferably, the AAV is 2x10 5 GC to 3.0x10 13 It could be GC.

[0699] In another specific example, 1 uL of the pharmaceutical composition of the present application comprises 1x10 AAVs comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Lhx3 protein. 5 GC to 1x1016 GC may be included. Preferably, the AAV is 1x10 5 GC to 1x10 14 It can be GC. Most preferably, the AAV is 2x10 5 GC to 3.0x10 13 It could be GC.

[0700] In another specific example, 1 uL of the pharmaceutical composition of the present application comprises an AAV comprising a nucleic acid sequence encoding a GSTA4 protein; and a nucleic acid sequence encoding a Hb9 (Mnx1) protein; at a concentration of 1x10 5 GC to 1x10 16 GC may be included. Preferably, the AAV is 1x10 5 GC to 1x10 14 It can be GC. Most preferably, the AAV is 2x10 5 GC to 3.0x10 13 It could be GC.

[0701] In another specific example, 1x10 AAVs comprising a nucleic acid sequence encoding a GSTA4 protein; a nucleic acid sequence encoding a Hb9 (Mnx1) protein; and a nucleic acid sequence encoding a Lhx3 protein are present per 1 uL of the pharmaceutical composition of the present application. 5 GC to 1x10 16 GC may be included. Preferably, the AAV is 1x10 5 GC to 1x10 14 It can be GC. Most preferably, the AAV is 2x10 5 GC to 3.0x10 13 It could be GC.

[0702]

[0703] The administration volume of the above pharmaceutical composition can be selected as an appropriate dosage considering the administration method, target, etc.

[0704] For example, the administration volume may be 1 uL to 20 mL at a time, but is not limited thereto.

[0705] For example, if the subject is a human, when the pharmaceutical composition of the present application is directly administered to a damaged spinal cord of the human, 1uL, 2uL, 3uL, 4uL, 5uL, 6uL, 7uL, 8uL, 9uL, 10uL, 11uL, 12uL, 13uL, 14uL, 15uL, 16uL, 17uL, 18uL, 19uL, 20uL, 21uL, 22uL, 23uL, 24uL, 25uL, 26uL, 27uL, 28uL, 29uL, 30uL, 31uL, 32uL, 33uL, 34uL, 35uL, 36uL, 37uL, 38uL, 39uL, 40uL, 41uL, 42uL, 43uL, 44uL, 45uL, 46uL, 47uL, 48uL, 49uL, 50uL, 51uL, 52uL, 53uL, 54uL, 55uL, 56uL, 57uL, 58uL, 59uL, 60uL, 61uL, 62uL, 63uL, 64uL, 65uL, 66uL, 67uL, 68uL, 69uL, 70uL, 71uL, 72uL, 73uL, 74uL, 75uL, 76uL, 77uL, 78uL, 79uL, 80uL, 81uL, 82uL, 83uL, 84uL, 85uL, 86uL, 87uL, 88uL, 89uL, 90uL, 91uL, 92uL, 93uL, 94uL, 95uL, 96uL, 97uL, 98uL, 99uL, 100uL, 110uL, 120uL, 130uL, 140uL, 150uL, 200uL, 250uL, 300uL, 350uL, 400uL, 450uL, 200uL, 250uL, 300uL, 350uL, 400uL, It can be administered in a volume within two numerical ranges selected from 450uL, 500uL, 600uL, 700uL, 800uL, 900uL, 950uL, 1mL, 2mL, 3mL, 4mL, 5mL, 6mL, 7mL, 8mL, 9mL, and 10mL.

[0706] In one specific example, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 10 uL to 200 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 10 uL to 100 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 10 uL to 90 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 20 uL to 80 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 20 uL to 70 uL at a time. In another specific embodiment, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 20 uL to 60 uL at a time. In another specific embodiment, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 30 uL to 60 uL at a time. In any embodiment, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 40 uL to 60 uL at a time. Most preferably, the pharmaceutical composition may be administered directly to a damaged human spinal cord in a volume of 50 uL at a time.

[0707] For another example, when the subject is a non-human animal, the pharmaceutical composition of the present application is directly administered to a damaged spinal cord of a human at a dose of 1uL, 2uL, 3uL, 4uL, 5uL, 6uL, 7uL, 8uL, 9uL, 10uL, 11uL, 12uL, 13uL, 14uL, 15uL, 16uL, 17uL, 18uL, 19uL, 20uL, 21uL, 22uL, 23uL, 24uL, 25uL, 26uL, 27uL, 28uL, 29uL, 30uL, 31uL, 32uL, 33uL, 34uL, 35uL, 36uL, 37uL, 38uL, 39uL, 40uL, 41uL, 42uL, 43uL, 44uL, 45uL, 46uL, 47uL, 48uL, 49uL, 50uL, 51uL, 52uL, 53uL, 54uL, 55uL, 56uL, 57uL, 58uL, 59uL, 60uL, 61uL, 62uL, 63uL, 64uL, 65uL, 66uL, 67uL, 68uL, 69uL, 70uL, 71uL, 72uL, 73uL, 74uL, 75uL, 76uL, 77uL, 78uL, 79uL, 80uL, 81uL, 82uL, 83uL, 84uL, 85uL, 86uL, 87uL, 88uL, 89uL, 90uL, 91uL, 92uL, 93uL, 94uL, 95uL, 96uL, 97uL, 98uL, 99uL, 100uL, 110uL, 120uL, 130uL, 140uL, 150uL, 200uL, 250uL, 300uL, 350uL, 400uL, 450uL, 200uL, 250uL, 300uL, 350uL, 400uL, It can be administered in a volume within two numerical ranges selected from among 450uL, 500uL, 600uL, 700uL, 800uL, 900uL, 950uL, 1mL, 2mL, 3mL, 4mL, 5mL, 6mL, 7mL, 8mL, 9mL, and 10mL. At this time, the non-human animal may be, but is not limited to, a mouse, rat, chimpanzee, monkey, dog, pig, etc.

[0708] In one specific example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 100 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 80 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 70 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 60 uL at a time. In another specific example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 50 uL at a time. In another specific embodiment, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 30 uL at a time. In another specific embodiment, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 20 uL at a time. In another specific embodiment, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 10 uL at a time. In any example, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 1 uL to 5 uL at a time. Most preferably, the pharmaceutical composition may be administered directly to the injured spinal cord of a non-human animal in a volume of 2 uL at a time.

[0709]

[0710] Dosage cycle

[0711] The cycle of administering the above pharmaceutical composition to a subject may be administered depending on the subject's disease, severity of onset, etc.

[0712] The dosage may be administered once or several times daily, or multiple times over a long period of time. Administration may also be spaced out over a period of time.

[0713] The above administration interval may be 1 to 30 days, etc. At this time, continuous or discontinuous administration may be used.

[0714]

[0715] Confirmation of treatment effect

[0716] After applying the treatment method for the above spinal cord injury disease to the subject, the effect of alleviating, improving, or curing the spinal cord injury disease can be confirmed in various ways.

[0717] For example, it can be confirmed through scar reduction, changes in neuronal marker expression, BBB score, action potential, and spontaneous response.

[0718] For example, using the method for treating the spinal cord injury disease described above, scarring can be reduced by about 2 to 50 times.

[0719] As another example, the method for treating the spinal cord injury disorder may increase the expression of neuronal markers by about 2-fold to 50-fold.

[0720] As another example, the method for treating the spinal cord injury disease described above can increase the BBB score by about 2-fold to 50-fold.

[0721] As another example, by using the method of treating the spinal cord injury disease, action potentials or spontaneous responses may appear in a similar manner to that of a normal person.

[0722]

[0723] The administration concentration, administration dose, administration cycle, etc. used in the method for treating the spinal cord injury disease described above can be easily determined and prescribed by doctors, veterinarians, etc. in the art to be therapeutically effective.

[0724] For example, a physician or veterinarian may gradually increase or decrease the dosage until the desired therapeutic effect is achieved. Furthermore, the physician or veterinarian may determine the therapeutically effective dose, administration period, etc., based on the subject's condition.

[0725] Additionally, the method of treating spinal cord injury of the present application may be combined with adjuvant treatments to facilitate rapid recovery and / or treatment of spinal cord injury. Such adjuvant treatments may include physical therapy, rehabilitation therapy, anticonvulsant medications, and / or antidepressant medications.

[0726]

[0727] Meaning of treatment or recovery of damaged spinal cord

[0728] In the present application, treatment or recovery of a damaged spinal cord means treatment of a spinal cord injury disease. In particular, the composition for treating a spinal cord injury disease of the present application includes GSTA4, a direct cross-linking differentiation factor, and thus means "treatment of a spinal cord injury disease by the generation of motor neurons."

[0729] Specifically, the generation of motor neurons due to GSTA4 can be expected in three ways, and the treatment of damaged spinal cord in the present application is not limited to the three ways below, but can include all hypotheses that can be expected by those skilled in the art.

[0730] Generation of motor neurons by GSTA4 (1): Direct cross-differentiation of abnormally increased astrocytes into motor neurons.

[0731] A composition containing GSTA4 can generate motor neurons by directly cross-differentiating somatic cells within a damaged spinal cord into motor neurons. For example, abnormally increased astrocytes in a damaged spinal cord increase while motor neurons are lost. In this case, a composition containing GSTA4 can act on astrocytes to directly cross-differentiate into motor neurons, resulting in the generation of motor neurons, thereby treating or recovering the damaged spinal cord.

[0732] Generation of motor neurons by GSTA4 (2): Recovering dead motor neurons.

[0733] When the spinal cord is damaged, motor neurons within the spinal cord can die. A composition containing GSTA4 can act on the damaged spinal cord, directly cross-differentiating the dead motor neurons to generate new motor neurons. For example, motor neurons within the damaged spinal cord may have died due to apoptotic programs but may still exist without degrading. In this case, a composition containing GSTA4 can act on the dead motor neurons to directly cross-differentiate them into normal motor neurons, thereby treating or recovering the damaged spinal cord.

[0734] Generation of motor neurons by GSTA4 (3): Restores the function of motor neurons that have not died but have had their function reduced (or degenerated).

[0735] Spinal cord damage can lead to a decline in the function of motor neurons within the spinal cord. In other words, when motor neurons are impaired, the muscles they innervate deteriorate and may not function normally. For example, when a composition containing GSTA4 is applied to the damaged spinal cord, it can directly cross-differentiate the impaired motor neurons into motor neurons with normal function. These newly generated, functional motor neurons can then be used to treat or restore the damaged spinal cord.

[0736] Hereinafter, the present invention will be described in more detail through experimental examples.

[0737] These experimental examples are only intended to explain the present invention more specifically, and it will be apparent to a person skilled in the art to which the present invention pertains that the scope of the present invention is not limited by these examples.

[0738]

[0739] Experimental materials

[0740] ● Vector design

[0741] The vector used in the experiment below was an AAV vector (Cell Biolabs, INC., VPK-402), and a schematic diagram of the AAV vector for introducing differentiation factors is shown in Figure 1.

[0742] The DNA sequences as specific examples of each vector used, corresponding to the vector schematic diagram illustrated in Figure 1, are as follows:

[0743] Figure 1(a) consists of the sequence of SEQ ID NO: 36; Figure 1(b) consists of the sequence of SEQ ID NO: 3; Figure 1(c) consists of the sequence of SEQ ID NO: 4; Figure 1(d) consists of the sequence of SEQ ID NO: 5; and Figure 1(e) consists of the sequence of SEQ ID NO: 29.

[0744] Figure 1(a) includes a nucleic acid sequence encoding human-derived GSTA4.

[0745] Figure 1(b) includes a nucleic acid sequence encoding human ASCL1; a nucleic acid sequence encoding human NEUROG2; a nucleic acid sequence encoding human ISL1; and a nucleic acid sequence encoding human LHX3;

[0746] Figure 1(c) includes a nucleic acid sequence encoding human BRN2; a nucleic acid sequence encoding human MNX1 (Motor neuron and pancreas homeobox 1; also called Hb9); and a nucleic acid sequence encoding human NeuroD1.

[0747] Figure 1(d) includes a nucleic acid sequence encoding human-derived GSTA4; and a nucleic acid sequence encoding human-derived MYTL1;

[0748] Figure 1(e) includes a nucleic acid sequence encoding human GSTA4; a nucleic acid sequence encoding human MNX1; and a nucleic acid sequence encoding human LHX3.

[0749]

[0750] ● AAV production

[0751] The 293T cell line was used to produce AAV. 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Thermal Fisher, #12430112) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimyotic (Thermal Fisher, #15240096) at 37°C and 5% CO2. 293T cells were transfected with the AAV vector, pHelper, and pRepCap of Figure 1 and cultured for 48 hours. Subsequently, AAV virus particles containing differentiation factors were extracted through an AAV virus particle extraction process. The produced AAV virus particles may also be referred to as 'AAV' or 'AAV particles' hereinafter.

[0752]

[0753] ● Cell culture and intracellular AAV introduction

[0754] Introduction of AAV containing fibroblast culture and differentiation factors

[0755] Human dermal fibroblasts (Sigma, 106-05A) were cultured in fibroblast growth medium (Sigma, 116-500) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimyotic (Thermal Fisher, #15240096) at 37°C and 5% CO2.

[0756] Human dermal fibroblasts were seeded at 0.025 x 10 in 24 wells. 6The cells were seeded and prepared. 24 hours after cell seeding, AAV containing differentiation factors was treated (hereinafter, for convenience, ‘AAV containing differentiation factors’ is sometimes abbreviated as ‘differentiation factors’).

[0757] Twenty-four hours after the differentiation factor treatment, the medium was replaced with fibroblast growth medium. Another 24 hours later, it was replaced with neural induction medium. The medium was replaced every other day. On days 14-17, cells were fixed and subjected to immunofluorescence staining.

[0758] Mouse embryonic fibroblasts were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% Penicillin / Streptomycin (Gibco) at 37°C and 5% CO2.

[0759] Mouse embryonic fibroblasts 0.025 x 10 in 24 wells 6 Cells were seeded and prepared. 24 hours after seeding, differentiation factors were applied. Twenty-four hours after differentiation factor treatment, the medium was replaced with DMEM. Twenty-four hours later, the medium was replaced with neural induction medium. The medium was replaced every other day. On days 14–17, cells were fixed and immunofluorescence stained.

[0760]

[0761] Culture of mouse-derived primary astrocytes and introduction of AAV containing differentiation factors

[0762] The meninges of ICR mouse P1 pups were stripped and minced with sterilized scissors or a razor blade. The tissue was transferred to a 50 ml conical tube, and 3 ml TrypLE™ Express Enzyme (Gibco) and 20 μl 0.5 M ascorbic acid (Sigma) were added. The 50 ml conical tube was tapped to mix well, and the mixture was incubated at 37°C for 20 minutes. The medium was then diluted with 10 ml glial medium (DMEM + 1% L-glu (Gibco) + 1% P / S). The medium was replaced with fresh glial medium every other day. On day 9, when the T75 flask was full of glial cells, the flask was shaken at 60 rpm for 30 minutes on an orbital shaker in a 37°C incubator. Equilibration was performed in a 37℃ incubator for 4 hours. The T75 flask was shaken at 245 rpm on an orbital shaker in a 37℃ incubator for 18–20 hours. The cells were subcultured and dispensed in the amount needed for use.

[0763] Mouse-derived primary astrocytes were seeded at 0.2–0.6 x 10 in 24 wells. 6 Cells were seeded and prepared. 24 hours after seeding, differentiation factors were applied. Twenty-four hours after differentiation factor treatment, the medium was replaced with DMEM. Twenty-four hours later, the medium was replaced with neural induction medium. The medium was replaced every other day. On days 14–17, cells were fixed and immunofluorescence stained.

[0764]

[0765] ● Immunofluorescence staining

[0766] For cell fixation, cells were washed twice with PBS (Gibco) for 5 minutes each. Then, 4% paraformaldehyde (ThermoFisher) was added and incubated at room temperature for 10 minutes.

[0767] For permeabilization, PBS + 0.1% Triton-X was added and incubated at room temperature for 10 minutes. Cells were washed three times with PBS for 5 minutes each.

[0768] For blocking and immunostaining, 1% BSA + PBST (PBS + 0.1% Tween 20) was added and incubated at room temperature for 30 minutes. Primary antibodies used were antibodies against ChAT (Invitrogen, 1:1000), Map2 (Millipore, 1:200), and Tuj1 (Beta III Tubulin) (Abcam, 1:1000). The primary antibodies were added to 1% BSA + PBST and incubated at 4℃ overnight. After washing three times with PBS for 5 minutes each, the secondary antibodies Alexa FluorTM 488 / 594 (ThermoFisher, 1:1000) were added to 1% BSA + PBST and incubated in the dark at room temperature for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0769]

[0770] ● RNA extraction and cDNA synthesis

[0771] Approximately 14 to 17 days after AAV treatment containing differentiation factors on cultured cells after seeding, 2 x 10 cells 6After removing the supernatant with trypsin (ThemoFisher), centrifugation was performed at 13,000 rpm for 10 seconds. After removing the supernatant, 1 ml of easy-BlueTM (iNtRON) was added, vortexed for 10 seconds, 200 μl of chloroform was added, and vortexed again. After centrifugation at 13,000 rpm for 10 minutes, 400 μl of the upper fluid was transferred to a new 1.5 ml tube. 400 μl of 2-propanol (Sigma) was added, inverted 2-3 times, and left at RT for 10 minutes. After centrifugation at 13,000 rpm for 5 minutes, the upper layer was removed. 1 ml of 75% EtOH (Sigma) was added, and inverted 2-3 times. After centrifugation at 10,000 rpm, 4°C, and 5 min, the upper layer was removed. After drying at RT for 5 min, 20 μl of distilled water was added to dissolve the RNA. The final RNA was stored at -70°C.

[0772] cDNA was synthesized using AccuPower® CycleScript RT PreMix & Master Mix (Bioneer).

[0773]

[0774] ● Real-time quantitative reverse transcription PCR (qRT-PCR)

[0775] To determine whether fibroblasts or astrocytes differentiated into motor neurons, qPCR (SYBRGreen Realtime PCR Master Mix, TOYOBO) was used. To confirm whether direct cross-differentiation occurred from fibroblasts or astrocytes to motor neurons, the expression of Synapsin, Map2, and Hb9 in the cells was determined by qRT-PCR. High levels of Synapsin, Map2, and Hb9 were observed in cells induced to differentiate into motor neurons from fibroblasts or astrocytes.

[0776] The primers used at this time are as shown in the table below.

[0777] Name Sequence Sequence Number hSYN1_FGTG GCA CTG ACC AAG ACG TA Sequence Number 6 hSYN1_RCTG ACG TCC TCA TGT AGG CC Sequence Number 7 hMAP2_FTCC TCC ATT CTC CCT CCT CG Sequence Number 8 hMAP2_RCGA ATT GGC TCT GAC CTG GT Sequence Number 9 hHb9_FGAG CTT GAA CTG GTG CTC CA Sequence Number 10 hHb9_RTCT CAA CAG TAG GTG CCT GC Sequence Number 11 mMap2-FACC TTC CTC CAT CCT CCC TC Sequence Number 30 mMap2-RTCC TGC TCT GCG AAT TGG TT Sequence Number 31 mHb9-FTCC AGA ACC GCC GAA TGA AA Sequence Number 32 mHb9-RCCA TCA GCT CCT CTT CCG TC sequence number 33 mSynapsin-FTCC TCC TGC TCA ACA ACG AC sequence number 34 mSynapsin-RCGG TCC AAG GCC AGA AAG AT sequence number 35

[0778] ● Cell Viability Test

[0779] Mouse-derived primary astrocytes were seeded at 0.2 x 10 in a 96-well plate. 5 / well. After treatment with the test substance, the cells were incubated at 37°C for 20 hours. MTS reagent (Promega, G3582) was added to the cells prepared in a 96-well plate and incubated at 37°C for 30 minutes. After brief shaking, the absorbance was measured using a microplate reader (Allsheng, AMR-100) with the OD set to 490 nm.

[0780]

[0781] ● Spinal cord injury disease mouse - Creation of SCI mouse model

[0782] To create a mouse model of spinal cord injury (SCI), a paraplegia model caused by spinal cord injury, ICR mice were anesthetized with an intraperitoneal injection of avertin (125-250 mg / kg). Once anesthetized, the animals were secured to the operating table. The surgical site (dorsum) was disinfected with povidone-alpha (POV) and 70% ethanol and thoroughly dried. After confirming anesthesia, the spinal cord was disinfected with a povidone-alpha (POV) solution and incised. After removing the T13 vertebra, the spinal cord nerve bundle was injured at a thickness of 0.35 mm for 30 seconds using forceps fitted with digital calipers (Cixi Duxan). After spinal cord injury, the surgical site was closed with surgical sutures. After surgery, the animals were placed on a heating pad preheated to 37°C and observed until they regained consciousness. After regaining consciousness, an analgesic (Ketoprofen 1 mg / kg) was administered subcutaneously to relieve pain and relieve pain. After regaining consciousness, the mice were housed in a mouse cage and observed for up to three weeks. After surgery, an infrared irradiator was used to maintain a warm environment for a certain period of time to prevent the animals from losing body temperature. The SCI mouse model was used in the experiment 5 weeks after damage to the Lumbar 4-5 region of the spinal cord (hereinafter referred to as L4-5; corresponding to T13-L1).

[0783]

[0784] ● Administration of test substances to SCI mouse models

[0785] Surgical procedures were performed on all test groups, and sterilized / disinfected instruments were used to prevent contamination during the surgical procedure. Prior to administration, anesthesia was administered via intraperitoneal injection of avertin (125-250 mg / kg). Once anesthetized, the animals were secured to the operating table. The surgical site (back) was disinfected with povidone-iodine and 70% ethanol and thoroughly dried. To expose the spine, a vertical incision was made in the muscles adjacent to the injection site using a scalpel blade. Care was taken to avoid damaging nerves and blood vessels. After confirming the injection site under a stereomicroscope, the needle of a Hamilton syringe (needle gauge 33) was tilted approximately 20-30° toward the lumbar spine and inserted into the injured area between L4 and L5 of the SCI mouse model. Then, 2 μl of the prepared test substance was microinjected at a rate of approximately 1 μl / min using an infusion pump. After approximately two minutes of infusion, the needle was slowly withdrawn from the spinal cord. After administration, the incised muscle and skin were sutured.

[0786]

[0787] ● Behavioral tests

[0788] Among the behavioral tests, the Basso, Beattie, and Bresnahan (hereinafter referred to as "BBB) score test" was performed to measure movement. The BBB score test was performed according to the standard operating procedure EXP-SOP-012 (Basso, Beattie, and Bresnahan (BBB) ​​score test).

[0789] BBB scores were measured weekly from 1 week after administration to 8 weeks after administration of the manufactured AAV. The manufactured AAV was a composition containing Gsta4, Mnx1, and Lhx3 (hereinafter referred to as STUP-001).

[0790] A statistically significant increase in score compared to the control group was considered to indicate the effective efficacy of the treated substance (denoted as STUP-001 in this experimental example). The analysis rules are as follows. The BBB scores for all animals are indicated as measured values ​​in the table below, and the figure uses the corrected BBB scores. The following formula was applied to evaluate the results for inter-individual correction, and the reference point was the average BBB score for each animal 1 to 4 weeks after surgery.

[0791] Adjusted BBB score = BBB score (week) - BBB score (baseline)

[0792]

[0793] ● Physiological examination

[0794] Patch clamp recordings of motor neuron electrical responses in ex vivo spinal cord slices were performed using the method of Shim HS et al. (2019). The lumbar region of the biopsied spinal cord was sectioned transversely at 350 μm thickness in cold (4°C) mixed gas (95% oxygen, 5% carbon dioxide)-saturated NMDG (N-methyl-D-glucamine) solution (in mM: 93 NMDG, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 glucose, 5 sodium ascorbate, 2 thiourea, 3 sodium pyruvate, 10 MgSO4, and 0.5 CaCl2, pH 7.4). Whole-cell electrical recordings of motor neurons in the ventral horn of the spinal cord were recorded in artificial cerebrospinal fluid (aCSF in mM: 124 NaCl, 2.5 KCl, 1.2 NaH2PO4, 24 NaHCO3, 5 HEPES, 12.5 glucose, 2 MgSO4, and 2 CaCl2, pH 7.4). Electrical responses were acquired using a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA), DigiDATA (Molecular Devices, Sunnyvale, CA), and pClamp software (version 10.6. Molecular Device). Patch pipettes with a resistance of 4–8 MΩ were used and filled with internal aqueous solution (in mM: 120 K-gluconate, 10 KCl, 2 Mg-ATP, 0.5 Na-GTP, 0.5 EGTA, 20 HEPES, and 10 phosphocreatine, pH 7.3). Action potentials of motor neurons were measured using current steps (20 pA / step from 0 pA to 140 pA).

[0795]

[0796] ● Protein quantitative test

[0797] Quantitative protein assays were performed at the injection site using an ELISA kit. The levels of MAP2 and CHAT, neuronal markers, at the injection site for each test animal were examined and presented in a table. Information about the ELISA kit used is provided in the table below (Table 2).

[0798] ELISA kitCompany Catalog NumberMouse choline acetyltransterase (CHAT)ELISA KitCUSABIOCSB-E17524mMouse Microtubule-associated protein 2(MAP2) ELISA KitAbcamab253229

[0799] ● Weight measurement

[0800] Body weights of mouse models were measured before administration of test substances, once a week thereafter, and on the day of autopsy. Fasting body weights were measured on the day of autopsy.

[0801]

[0802] ● Functional observation test

[0803] All surviving animals were evaluated during the last week of observation (approximately 13 weeks after administration), and the following items were assessed. Stimulus reactivity tests included auditory response, righting reflex, pain response, pinpoint response, and threat reflex. Grip strength was tested to assess neurological and muscular status. Locomotor activity was tested to assess mobility outside the cage.

[0804]

[0805] Experimental Example 1: Confirmation of the direct cross-differentiation effect of Gsta4 into motor neurons within cells.

[0806] Experimental Example 1-1: Introduction of GSTA4 into Mouse-Derived Fibroblasts

[0807] AAV containing GSTA4 (Fig. 1(a)) was introduced into mouse-derived fibroblasts. Approximately 14 to 17 days after AAV introduction, direct differentiation of fibroblasts into neurons induced by Gsta4 was confirmed by immunofluorescence and qPCR (Fig. 3).

[0808] In differentiated cells, high expression of ChAT, a marker of motor neurons, and Map2, a marker of mature neurons, was confirmed using immunofluorescence staining. Furthermore, qPCR was used to observe changes in the expression of Synapsin, a marker of synaptic formation, Map2, a marker of mature neurons, and Hb9, a marker of mature neurons, confirming the direct cross-differentiation effect of fibroblasts into neurons.

[0809] As a result, when only Gsta4 was treated, the expression level of synapsin was confirmed to increase by about 4 times compared to the control group (indicated as control), Map2 was confirmed to increase by about 5 times compared to the control group (indicated as control), and Hb9 was confirmed to increase by about 2 times compared to the control group (indicated as control).

[0810] This suggests that the Gsta4 factor has the function of directly inducing differentiation from fibroblasts into neurons.

[0811]

[0812] Experimental Example 1-2: Introduction of GSTA4 into Mouse-Derived Primary Astrocytes

[0813] AAV containing GSTA4, as used in 1-1 above, was introduced into mouse-derived primary astrocytes. Gsta4-induced differentiation of astrocytes into neurons was confirmed by immunofluorescence staining (Figs. 5 and 6).

[0814] Immunofluorescence staining confirmed high expression of Tuj1, a neuronal marker, and Map2, a mature neuronal marker, in differentiated cells.

[0815] In the control group (indicated as control), neither Tuj1 nor Map2 were expressed, but when Gsta4 was treated alone, the number of cells immunostained with neuronal markers for both Tuj1 and Map2 increased by approximately 40-50 times and 20-30 times, respectively, compared to the control group.

[0816] This suggests that the Gsta4 factor has the function of directly transdifferentiating mouse-derived primary astrocytes into neurons.

[0817]

[0818] The results of Experimental Example 1 above show that Gsta4 has the ability to effectively convert somatic cells into motor neurons (direct cross-differentiation) on its own.

[0819]

[0820] Experimental Example 2: Confirmation of direct cross-differentiation into motor neurons by a known differentiation factor within the cell.

[0821] In Example 1, it was confirmed that Gsta4 alone could induce direct cross-differentiation from somatic cells into motor neurons. Furthermore, the direct cross-differentiation efficiency of Gsta4 was compared with the direct cross-differentiation efficiency of previously known methods. To this end, known direct cross-differentiation factors were introduced into cells and the degree of direct cross-differentiation into motor neurons was confirmed.

[0822]

[0823] Experimental Example 2-1: Comparison of Effects with Known Direct Cross Differentiation Factors

[0824] The degree of differentiation into motor neurons was confirmed by introducing conventional differentiation factors into mouse-derived fibroblasts and using qPCR to determine the expression of neuronal markers Synapsin and Map2 (Fig. 4 (a)).

[0825] When representative conventional differentiation factors, Ascl1 and Brn2, were treated alone, the expression level of synapsin increased by approximately 1.5 to 2 times compared to the control group (indicated as control), and Map2 was confirmed to be almost similar to the control group (indicated as control) and showed almost no increase.

[0826] This was compared with the case where Gsta4 of the present application was treated alone (Experimental Example 1). As previously examined, Gsta4 of the present application showed an approximately 4-fold increase in synapsin expression compared to the control group (indicated as control), and an approximately 5-fold increase in Map2 expression compared to the control group (indicated as control). In other words, when comparing its effect with that of a previously known differentiation factor, it was found that Gsta4 of the present application had a significantly higher direct cross-differentiation efficiency into motor neurons.

[0827] In addition, the conventional differentiation factors MNX1 and Lhx3 were introduced into mouse-derived primary astrocytes, respectively, and the expression of Tuj1, a neuronal marker, and Map2, a mature neuronal marker, was confirmed through immunofluorescence staining, and compared with Gsta4 of the present application.

[0828] As can be seen in Figures 5 and 6, when the conventional differentiation factors MNX1 and Lhx3 were treated alone, the expression of Tuj1 and Map2 was almost similar to the control group. In contrast, when GSTA4 was treated alone, the expression of Tuj1 and Map2 was about 10 to 15 times higher in the number of cells immunostained with neural cell markers compared to when MNX1 and Lhx3 were treated alone.

[0829] Through these experimental results, it can be seen that the direct cross-differentiation ability of the present invention's GSTA4 into motor neurons is significantly higher than the direct cross-differentiation ability of previously known differentiation factors (Ascl1, Brn2, MNX1, Lhx3) into motor neurons.

[0830] This suggests that the GSTA4 of the present invention may be very useful for the regeneration and generation of motor neurons.

[0831]

[0832] Experimental Example 2-2: Conventional direct cross-differentiation factor combination

[0833] Although it was confirmed through the above Experimental Example 2-1 that GSTA4 alone exhibits an excellent direct cross-differentiation effect into motor neurons, the inventors of the present invention additionally sought to compare the differentiation effect with that of a combination of two or more known differentiation factors.

[0834] To this end, human-derived fibroblasts were treated with various combinations of conventional differentiation factors, and the degree of differentiation into motor neurons was confirmed using qPCR. At this time, the expression of neuronal markers Synapsin, Map2, and Hb9 was confirmed (Fig. 4 (b)).

[0835] Combination 1: Ascl1, Brn2, Myt1l combination (denoted as ABM);

[0836] Second combination: Hb9, Isl1, Lhx3 combination (denoted as HIL);

[0837] Each cell was treated with human-derived fibroblasts.

[0838] At this time, both the first and second combinations showed an increase in the expression level of synapsin of approximately 1.5 to 3 times compared to the control group (indicated as control), Map2 showed an increase in expression of approximately 1 to 4 times compared to the control group, and Hb9 showed an increase in expression of approximately 1 to 1.5 times compared to the control group.

[0839] In Example 1, when Gsta4 was treated alone, compared to each control group, synapsin showed an approximately 4-fold increase in expression, and Map2 showed an approximately 5-fold increase in expression. Therefore, even when three conventional differentiation factors were combined for treatment, it was found that the direct cross-differentiation efficiency into motor neurons was lower than when Gsta4 of the present invention was treated alone. These results imply that Gsta4 of the present invention can have a superior direct cross-differentiation effect compared to when some conventional differentiation factors are used in combination.

[0840]

[0841] The results of Experimental Example 2 showed that Gsta4 is a novel "direct cross-differentiation factor into motor neurons" with a very high direct cross-differentiation efficiency compared to previously known factors.

[0842]

[0843] Experimental Example 3: Confirmation of improved direct cross-differentiation effects through the combined use of Gsta4.

[0844] The present inventors sought to further confirm the effect of combining Gsta4 with known direct cross-differentiation factors.

[0845]

[0846] Experimental Example 3-1: Comparison of MNX1 vs. Gsta4+ MNX1

[0847] The direct cross-differentiation effect was compared between cases where only MNX1 was introduced into mouse-derived primary astrocytes via AAV and cases where Gsta4 and MNX1 were introduced.

[0848] The degree of differentiation was confirmed by immunofluorescence staining, with expression of Tuj1, a neuronal marker, and Map2, a mature neuronal marker (Figs. 5 and 6).

[0849] As a result, the number of cells expressing Tuj1 was slightly increased compared to the control group (indicated as control) when treated alone with the conventional differentiation factor MNX1, but was confirmed to increase by approximately 8 to 20 times when treated with a combination of Gsta4 and MNX1 (indicated as Gsta4+MNX1).

[0850] The number of cells expressing Map2 was almost non-existent when the conventional differentiation factor MNX1 was treated alone, but it was confirmed that it increased by about 50 times or more when the combination of Gsta4 and MNX1 (indicated as Gsta4+MNX1) was treated.

[0851] Through these results, it was confirmed that when GSTA4, which has a high direct cross-differentiation efficiency from somatic cells to motor neurons of the present application, is used together with MNX1, a conventional differentiation factor, the direct cross-differentiation efficiency increases.

[0852] That is, when Gsta4+ MNX1 was treated, an unexpectedly significant direct cross-differentiation effect was observed.

[0853]

[0854] Experimental Example 3-2: Comparison of Lhx3 vs. Gsta4+ Lhx3

[0855] The direct cross-differentiation effect was compared between cases where only Lhx3 was introduced into mouse-derived primary astrocytes via AAV and cases where Gsta4 and Lhx3 were introduced.

[0856] The degree of differentiation was confirmed by immunofluorescence staining, with expression of Tuj1, a neuronal marker, and Map2, a mature neuronal marker (Figs. 5 and 6).

[0857] As a result, the number of cells expressing Tuj1 was slightly increased compared to the control group (indicated as control) when treated with the conventional differentiation factor Lhx3 alone, but was confirmed to increase by approximately 8 to 20 times when treated with a combination of Gsta4 and Lhx3 (indicated as Gsta4+Lhx3).

[0858] The number of cells expressing Map2 was almost non-existent when the conventional differentiation factor Lhx3 was treated alone, but it was confirmed to increase by about 20 times or more when the combination of Gsta4 and Lhx3 (indicated as Gsta4+Lhx3) was treated.

[0859] Through these results, it was confirmed that when GSTA4, which has a high direct cross-differentiation efficiency from somatic cells to motor neurons of the present application, is used together with Lhx3, a conventional differentiation factor, the direct cross-differentiation efficiency increases.

[0860] That is, when Gsta4+ Lhx3 was treated, an unexpectedly significant direct cross-differentiation effect was observed.

[0861]

[0862] Experimental Example 3-3: Comparison of Mnx1+Lhx3 vs. Gsta4+Mnx1+Lhx3

[0863] 3-3-1. Direct cross-differentiation of mouse-derived fibroblasts

[0864] The direct cross-differentiation effect was compared between cases where Mnx1+Lhx3 was introduced into mouse-derived fibroblasts via AAV and cases where Gsta4+Mnx1+Lhx3 was introduced.

[0865] To confirm and compare the degree of differentiation, the expression levels of neuronal markers were determined using immunofluorescence and qPCR (Figs. 7 and 8). For reference, cases in which Gsta4 was administered alone (denoted as Gsta4) are also shown in the graph.

[0866] First, as a result of analyzing the immunofluorescent cells, it was confirmed that the number of cells immunostained with neuronal markers increased by about 40 times or more when Gsta4 and Mnx1, Lhx3 were combined (indicated as Gsta4+Mnx1+Lhx3) compared to when the cells were treated with a combination of conventional differentiation factors Mnx1, Lhx3 (indicated as Mnx1+Lhx3) (Fig. 7).

[0867] Additionally, the expression level of neuronal markers (Synapsin, Map2) was confirmed using qPCR (Fig. 8).

[0868] It was confirmed that when Gsta4 and Mnx1, Lhx3 were combined (expressed as Gsta4+Mnx1+Lhx3), the mRNA expression of neural cell markers increased by approximately 2-4 times or more compared to when the differentiation factors Mnx1 and Lhx3 were combined (expressed as Mnx1+Lhx3).

[0869] Specifically, in the case of Gsta4+Mnx1+Lhx3, compared to the control group, Synapsin was expressed about 8 times higher, Map2 about 7 times higher, and Hb9 about 4 times higher. In addition, compared to the case of Mnx1+Lhx3, Synapsin was expressed about 4 times higher, Map2 about 4 times higher, and Hb9 about 2.5 times higher.

[0870] That is, compared to the combination of only the conventional differentiation factors Mnx1+Lhx3, it was confirmed that when Gsta4 was added and “Gsta4+Mnx1+Lhx3” was processed, a more remarkable direct cross-differentiation effect was observed.

[0871] As observed in the previous experiment, even when Gsta4 was administered alone (denoted as Gsta4), it showed a superior direct cross-differentiation effect than when the conventional factor combination (Mnx1+Lhx3) was used. However, when Gsta4 was added to this conventional factor combination, it was found that very remarkable direct cross-differentiation into motor neurons occurred.

[0872]

[0873] 3-3-2. Direct cross-differentiation of mouse-derived primary astrocytes

[0874] Additionally, the inventors of the present invention treated mouse-derived primary astrocytes with the STUP-001 composition containing Gsta4, Mnx1, and Lhx3 at various concentrations with the "Gsta4+Mnx1+Lhx3" combination, and confirmed the degree of differentiation into motor neurons by immunofluorescence staining and the expression of neuronal cell markers (Tuj1, Map2) (Fig. 9).

[0875] At this time, the concentration of Gsta4+Mnx1+Lhx3 (denoted as STUP-001) was 1x10 10 GC / well was treated. Naive is a control group that was not treated with any substance; control is a control group treated with AAV2 buffer (a buffer containing sodium chloride (13.84 g / L), potassium chloride (0.2 g / L), potassium dihydrogen phosphate (0.24 g / L), dibasic sodium phosphate (1.44 g / L), and Poloxamer 188 (0.01 g / L)).

[0876] As can be seen in Figure 9, in the group treated with Gsta4+Mnx1+Lhx3 (designated as STUP-001) in mouse-derived astrocytes, the intensity of expression of neuronal markers was confirmed to increase by approximately 3 to 5 times.

[0877] Through the experimental results of Experimental Examples 1 to 3, it was found that Gsta4 of the present application is a differentiation factor that has the function of converting somatic cells such as fibroblasts and astrocytes into induced motor neurons through direct cross-differentiation. In addition, it was found that Gsta4 has a higher differentiation efficiency than conventional direct cross-differentiation factors, and further, when Gsta4 is used together with conventional differentiation factors, it significantly increases the differentiation efficiency of conventional differentiation factors with low differentiation efficiency.

[0878]

[0879] Furthermore, the inventors of the present invention sought to confirm the 'direct cross-differentiation effect of somatic cells into motor neurons' and the 'therapeutic effect on spinal cord injury' resulting from the use of Gsta4 or Gsta4+Mnx1+Lhx3 of the present invention through in vivo animal experiments.

[0880]

[0881] Experimental Example 4: Mouse Experiment to Confirm the Effect of Gsta4 on Spinal Cord Injury Treatment

[0882] A composition containing GSTA4 was administered to the SCI mouse model prepared using the method described above. The administration site and dosage were as described in the "Experimental Materials" section.

[0883] In the group administered only GSTA4 as a differentiation factor, immunofluorescence staining was performed to observe changes in the expression of motor neuron markers in the spinal cord injury area (between L4 and L5) (Fig. 10).

[0884] Looking at Figure 10, the intensity of ChAT and Map2 was approximately 4 times higher in the group treated with GSTA4 alone (indicated as SCI+GSTA4) compared to the SCI spinal cord injury model group (indicated as SCI).

[0885] These results indicate that when GSTA4 was administered alone to a SCI mouse model, cells within the spinal cord injury site directly differentiated into motor neurons, increasing the number of motor neurons in the spinal cord injury site. In other words, this indirectly confirms that GSTA4 administration alone can have a therapeutic effect on spinal cord injury in a SCI mouse model.

[0886]

[0887] Experimental Example 5: Mouse experiment to confirm the therapeutic effect of Gsta4+Mnx1+Lhx3 on spinal cord injury.

[0888] In order to confirm the therapeutic effect of a composition containing Gsta4, Mnx1, and Lhx3 (hereinafter referred to as STUP-001) on spinal cord injury disease, various analyses were performed after cytotoxicity evaluation and administration of the composition to mice.

[0889]

[0890] Experimental Example 5-1: Cell Viability

[0891] In Experimental Example 4, it was found that a composition (STUP-001) containing a combination of Gsta4, Mnx1, and Lhx3 induced direct differentiation of fibroblasts or astrocytes into motor neurons (Figs. 7 and 9). Furthermore, cell viability was additionally measured for the toxicity test of STUP-001 (Fig. 11).

[0892] After treating mouse-derived primary astrocytes with STUP-001 at various concentrations, the survival rate of cells that directly differentiated into motor neurons was measured.

[0893] At this time, the concentration of STUP-001 is 1 x 10 6 GC / well, 1 x 10 7 GC / well, 1 x 10 8 GC / well, 1 x 10 9 GC / well, 1 x 10 10 GC / well, 1 x 10 11 GC / well was treated. Naive is the control group that was not treated with any substance; control is the parent control group treated with AAV2 buffer.

[0894] As a result, as can be seen in Fig. 11, it was confirmed that even when the concentration of STUP-001 treated on mouse-derived primary stellate cells increased, the cell viability showed a similar pattern to the control group and the control group, which means that STUP-001 has almost no cytotoxicity.

[0895]

[0896] After confirming the toxicity of STUP-001 in vitro, the inventors treated SCI mice, an animal model of spinal cord injury, with STUP-001 at various concentrations and then performed behavioral tests, electrophysiological tests, and protein tests.

[0897] At this time, the E0~E5 groups were composed of 3 females and 3 males per group, and measurements were taken for 8 weeks after administration.

[0898] E0 to E5 refer to:

[0899] E0 is the control group, which is a normal ICR mouse;

[0900] E1 is a control group treated with AA2 buffer in the SCI mouse model;

[0901] E2 administered STUP-001 to the SCI mouse model at a dose of 2.0 X 10 8 Group treated with GC / head;

[0902] E3 treated STUP-001 in a SCI mouse model at 2.0 X 10 7 Group treated with GC / head;

[0903] E4 treated the SCI mouse model with STUP-001 at 2.0 X 10 6 Group treated with GC / head;

[0904] E5 STUP-001 2.0 X 10 in SCI mouse model 5 Group processed with GC / head.

[0905]

[0906] Experimental Example 5-2: Confirming the Effectiveness of Spinal Cord Injury Treatment through Behavioral Analysis

[0907] The SCI mouse model was treated with STUP-001 at various concentrations, and the BBB score was measured to conduct a behavioral analysis (Fig. 12, Tables 3-7).

[0908] The BBB scores in Tables 3 to 7 are graphically depicted in Figure 12.

[0909] Table 3 shows the BBB score of group E1, Table 4 shows the BBB score of group E2, Table 5 shows the BBB score of group E3, Table 6 shows the BBB score of group E4, and Table 7 shows the BBB score of group E5.

[0910]

[0911]

[0912]

[0913]

[0914]

[0915] As shown in Figure 12, at 0 weeks prior to administration, the values ​​for groups E0 to E5 were identical, with a maximum of 21 points. In group E2, a spinal cord injury disease model, the BBB score was significantly reduced due to damage between spinal cord L4 and L5, resulting in a low score of approximately 4 points or less during the BBB score measurement period. This indicates spinal cord damage.

[0916] Meanwhile, in the E2 to E5 groups administered with STUP-001 of the present invention, a tendency to increase scores overall was observed compared to the control group after administration.

[0917] The E2 group showed a statistically significant increase in scores compared to the control group (designated E1) from approximately weeks 3 to 8. In particular, the E2 group's BBB score was measured to be approximately 5 or higher from approximately week 6 onward.

[0918] The E3 group showed a significant increase in scores compared to the control group at approximately weeks 4 to 8. Furthermore, a significant increase in scores was observed in the E3 group compared to the E4 and E5 groups at approximately week 8.

[0919] A trend toward an increase in BBB scores was also observed in groups E4 and E5.

[0920] These results can be interpreted as indicating that administration of STUP-001 of the present invention increases BBB scores as spinal cord damage in mice recovers. In particular, it was confirmed that the BBB scores tended to be higher in groups E2 and E3 compared to the control group (E1). Group E2 tended to have the highest BBB score.

[0921]

[0922] Experimental Example 5-3: Confirming the Effectiveness of Spinal Cord Injury Treatment Through Electrophysiological Analysis

[0923] Electrophysiological analysis was performed by measuring the action potential (AP) firing ratio and resting membrane potential (RMP) by treating the SCI mouse model with STUP-001 at various concentrations (Figs. 13 and 14).

[0924] Figure 13 shows the results of measuring the action potential firing rate. As a result, the observed frequency of AP firing was significantly reduced in the control group E1 compared to the normal group E0. The E2 and E3 groups of the present invention showed a very significant increase in the action potential firing rate at currents of 40, 60, and 100 pA compared to the E1 group. In addition, a tendency for the action potential firing rate to slightly increase in the E4 and E5 groups was also observed. In other words, it was confirmed that the administration of STUP-001 of the present invention showed a tendency to improve the AP firing ratio overall.

[0925] Figure 14 shows the results of measuring the resting membrane potential.

[0926] As a result of the measurement, the average value in the normal group E0 was approximately -59.442 ± 4.948 mV, and the average value in the control group E1 was approximately -13.672 ± 9.995 mV, showing that the E1 group was statistically significantly higher than the E0 group. This means that the resting membrane potential, which is a sign of spinal cord injury, is somewhat higher.

[0927] When STUP-001 of the present invention was administered to the SCI mouse model, both groups E2 to E5 showed a significantly recovered resting membrane potential compared to the control group E1. In particular, the E2 group was measured to have an average of approximately -54.690 ± 9.147 mV, and the E3 group was measured to have an average of approximately -57.89 ± 7.382 mV, which were found to be recovered to a similar level as the normal group E0.

[0928]

[0929] Experimental Example 5-4: Measurement of protein expression levels related to differentiation efficacy

[0930] In groups E0 to E5, the expression levels of MAP2 and ChAT expressed in the spinal cord tissue at the site of STUP-001 administration in sacrificed mice were measured using ELISA, and the results are shown in Fig. 15.

[0931] MAP2 protein is a marker expressed by mature neurons, and CHAT protein is a marker expressed by motor neurons.

[0932] As confirmed in the previous experimental examples (Experimental Examples 3 and 4), since STUP-001 of the present invention directly cross-differentiates astrocytes or fibroblasts into motor neurons, in the E2 to E5 groups in which STUP-001 of the present invention was administered to the SCI mouse model, the amount of motor neurons increased at the site of administration (spinal cord injury site). Accordingly, the expression levels of MAP2 and ChAT also increased at the site.

[0933] It was confirmed that the expression of MAP2 and CHAT proteins in the control group E1 was statistically significantly reduced compared to the normal group E0. In other words, when the spinal cord is damaged, the expression of MAP2 and ChAT decreases.

[0934] In contrast, it was confirmed that the expression of MAP2 protein and CHAT protein in the E2 to E5 groups administered with STUP-001 of the present invention was statistically significantly increased compared to the E1 group (Fig. 15).

[0935]

[0936] Thus, through Example 5, when STUP-001 was administered to a SCI mouse model, it was confirmed that the BBB score, action potential firing rate, resting membrane potential, and efficacy-related protein measurements were close to those of the normal group. This suggests that STUP-001 of the present invention can significantly increase the amount of motor neurons in the spinal cord injury area (regeneration and generation of motor neurons) by effectively directly cross-differentiating somatic cells in the spinal cord injury area into motor neurons, thereby treating spinal cord injury.

[0937] In particular, STUP-001 2.0 X 10 8 E2 group treated with GC / head concentration, STUP-001 2.0 X 10 7 The E3 group treated with GC / head concentration showed an excellent therapeutic effect.

[0938]

[0939] Experimental Example 6: Toxicity Investigation as a Treatment for Spinal Cord Injury from Various Perspectives

[0940] Afterwards, in order to investigate the toxicity of STUP-001, a spinal cord injury treatment, from a more diverse perspective, an experiment was designed and conducted as shown in Table 8 below.

[0941] Hereinafter, groups G1 to G4 refer to:

[0942] G1 is the control group treated with AA2 buffer in ICR mice;

[0943] G2 is 2.5 X 10 STUP-001 in ICR mouse 9 Group treated with GC / head;

[0944] G3 is 5.0 X 10 STUP-001 on ICR mouse 9 Group treated with GC / head;

[0945] G4 is 1.0 X 10 STUP-001 on ICR mouse 10 Group processed with GC / head.

[0946]

[0947] Experimental Example 6-1: Weight Measurement

[0948] Tables 9 and 10 show the results of body weight measurements for groups G1 to G4.

[0949] Table 9 shows the body weight of male mice, and Table 10 shows the body weight of female mice.

[0950]

[0951]

[0952]

[0953]

[0954] Looking at the measurement results, it can be seen that the males and females of groups G2 to G4 do not differ in body weight from the males and females of group G1. In other words, STUP-001 of the present invention is expected to not cause any toxicologically harmful changes, such as weight loss, during follow-up observation after administration.

[0955]

[0956] Experimental Example 6-2: Functional Observation Test

[0957] Table 11 (Functional Observation Evaluation of Males) and Table 12 (Functional Observation Evaluation of Females) show the results of functional observation tests for groups G1 to G4. This experiment was conducted to confirm safety pharmacological testing in the central nervous system. Functional observation tests included stimulus reactivity tests (auditory response, righting reflex, pain response, pinpoint response, and threat reflex), and grip strength tests to assess nerve and muscle condition. Locomotor activity was tested to confirm mobility outside the cage.

[0958] The measurement results show that males and females in groups G2 to G4 do not differ from males and females in group G1 in terms of functional observation items. In other words, STUP-001 of the present invention is expected to have no adverse effects on the central nervous system, such as damage or weakening of various biological functions in patients.

[0959]

[0960]

[0961] Experimental Example 6-3: General Toxicity Evaluation

[0962] A general toxicity assessment was conducted to determine the maximum no-toxicity dose (NOAAD) and target organs by examining the toxicity observed after administering STUP-001 to healthy mice for 13 weeks. The general toxicity assessment was confirmed through autopsy results.

[0963] Table 13 shows the results of an autopsy performed for toxicity assessment. The autopsy revealed findings in various body parts, and no evidence of toxicity was found. Therefore, STUP-001 of the present invention exhibits no toxicity to various tissues of the patient, and is expected to be a highly safe therapeutic agent.

[0964]

[0965] Through Experimental Example 6, STUP-001 of the present invention was 1.0 X 10 10Even in the G4 group treated with a very high dose of GC / head, there was no change in body weight and no toxicity was observed.

[0966] These results demonstrate that STUP-001 of the present invention is highly suitable as a treatment for spinal cord injury.

[0967]

[0968] Meanwhile, through the aforementioned experimental examples, it was revealed that Gsta4, a novel differentiation factor discovered by the inventors of the present application, is an important factor in direct cross-differentiation of somatic cells into motor neurons. Furthermore, Gsta4 has a higher differentiation efficiency than conventional differentiation factors, and furthermore, when Gsta4 is used together with conventional differentiation factors, the differentiation efficiency can be further increased compared to when conventional differentiation factors are used alone.

[0969] Furthermore, the inventors of the present invention clearly confirmed the therapeutic effect in a SCI mouse model, a model of lower body paralysis caused by spinal cord damage.

[0970] In particular, when directly administered to the injured spinal cord of SCI mice in the form of AAV containing Gsta4, the therapeutic effect on the injured spinal cord was confirmed. Furthermore, when administered to SCI mice in the form of AAV containing Gsta4, Mnx1, and Lhx3, the therapeutic effect on the injured spinal cord was confirmed along with safety and toxicity, confirming its suitability as a therapeutic agent.

[0971] Therefore, the technology of the present application is expected to have industrial applicability not only as a treatment for spinal cord injury, but also as a treatment for various nervous system diseases.

[0972] The present application may provide a composition for treating spinal cord injury and a use thereof.

[0973] It relates to Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid sequence encoding the same.

Claims

1. A pharmaceutical composition for treating spinal cord injury disease, Nucleic acid sequence encoding Gsta4 (Glutathione S-Transferase Alpha 4) protein; A nucleic acid sequence encoding the Lhx3 (LIM homeobox 3) protein; and Nucleic acid sequence encoding MNX1 (Motor neuron and pancreas homeobox 1) protein; A pharmaceutical composition comprising:

2. In paragraph 1, A pharmaceutical composition characterized in that the spinal cord injury disease is selected from among paraplegia, quadriplegia, Lou Gehrig's disease, primary lateral sclerosis, progressive pseudobulbar paralysis, progressive muscular atrophy, progressive bulbar paralysis, and post-polio syndrome.

3. In paragraph 1, The nucleic acid sequence encoding the Gsta4 protein, the nucleic acid sequence encoding the Lhx3 protein, and the nucleic acid sequence encoding the MNX1 protein are Independently or in combination of two or more nucleic acid sequences A pharmaceutical composition characterized by being contained in a vector.

4. In paragraph 3, A pharmaceutical composition wherein the above vector is an adeno-associated virus (AAV).

5. In paragraph 4, A pharmaceutical composition wherein the adeno-associated virus is a type selected from among AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB and AAV-PHP.S.

6. In paragraph 5, A pharmaceutical composition characterized in that the adeno-associated virus is AAV2.

7. In paragraph 1, A pharmaceutical composition characterized in that the nucleic acid sequence encoding the Gsta4 protein is SEQ ID NO:

12.

8. In paragraph 1, A pharmaceutical composition characterized in that the nucleic acid sequence encoding the Lhx3 protein is SEQ ID NO:

16.

9. In paragraph 1, A pharmaceutical composition characterized in that the nucleic acid sequence encoding the above MNX1 protein is SEQ ID NO:

14.

10. In paragraph 3, A pharmaceutical composition characterized in that the vector further comprises at least one selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), and 2A self-cleaving peptides.

11. In paragraph 3, A pharmaceutical composition characterized in that the above vector further comprises a promoter, a 2A self-cleaving peptide, and an inverted terminal repeat (ITR).

12. In paragraph 11, The above promoter is a CMV promoter, A pharmaceutical composition characterized in that the above 2A self-cleaving peptide is P2A or T2A.

13. In paragraph 1, A pharmaceutical composition characterized in that the above pharmaceutical composition is formulated as an injection.

14. In paragraph 4, AAV contained in the above pharmaceutical composition is 1x10 5 GC / kg to 1x10 15 A pharmaceutical composition characterized in that it can be administered to a subject at a dose of GC / kg.

15. In paragraph 14, The above AAV is 1x10 6 GC / kg to 1x10 12 A pharmaceutical composition characterized in that it can be administered to a subject at a dose of GC / kg.

16. In paragraph 1, The above pharmaceutical composition is administered to the damaged spinal cord area of ​​a subject with spinal cord injury, wherein the damaged spinal cord area is L1(lumbar 1), L2(lumbar 2), L3(lumbar 3), L4(lumbar 4), L5(lumbar 5), T1(thoracic 1), T2(thoracic 2), T3(thoracic 3), T4(thoracic 4), T5(thoracic 5), T6(thoracic 6), T7(thoracic 7), T8(thoracic 8), T9(thoracic 9), T10(thoracic 10), T11(thoracic 11), T12(thoracic 12), T13(thoracic 13), C1(cervical 1), C2(cervical 2), C3(cervical 3), C4(cervical 4), C5(cervical 5), C6(cervical 6), C7(cervical 7), A pharmaceutical composition characterized by being selected from C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3), and S4 (sacrum 4).

17. In paragraph 1, A pharmaceutical composition characterized in that the pharmaceutical composition can be administered to a subject in a volume of 10uL to 100uL at a time.

18. A pharmaceutical composition for treating spinal cord injury disease, Nucleic acid sequence encoding Gsta4 (Glutathione S-Transferase Alpha 4) protein; A pharmaceutical composition comprising:

19. In paragraph 18, A pharmaceutical composition characterized in that the spinal cord injury disease is selected from among paraplegia, quadriplegia, Lou Gehrig's disease, primary lateral sclerosis, progressive pseudobulbar paralysis, progressive muscular atrophy, progressive bulbar paralysis, and post-polio syndrome.

20. In paragraph 18, A pharmaceutical composition characterized in that the nucleic acid sequence encoding the above Gsta4 protein is contained in a vector.

21. In paragraph 20, A pharmaceutical composition wherein the vector is an adeno-associated virus (AAV).

22. In paragraph 21, A pharmaceutical composition characterized in that the adeno-associated virus is AAV2.

23. In paragraph 20, A pharmaceutical composition characterized in that the nucleic acid sequence encoding the Gsta4 protein is SEQ ID NO:

12.

24. In paragraph 20, A pharmaceutical composition characterized in that the above vector additionally contains a promoter sequence.

25. In paragraph 24, A pharmaceutical composition characterized in that the promoter sequence is a sequence represented by SEQ ID NO: 37.

Images