Composition comprising l-aspartic acid as active ingredient for promoting differentiation of myocytes or osteoblasts

Abstract

The present invention relates to a composition comprising L-aspartic acid as an active ingredient for promoting differentiation into myocytes or osteoblasts. It has been confirmed that L-aspartic acid regulates the expression of muscle differentiation markers, inhibits muscle atrophy, and regulates the expression of differentiation markers of osteoblasts, and thus can be advantageously used for preventing, treating, and alleviating muscle diseases, osteogenesis, or diseases requiring promotion of osteogenesis.

Description

Composition for promoting differentiation of myocytes or osteoblasts containing L-aspartic acid as an active ingredient

[0001] The present invention relates to a composition for promoting differentiation of myocytes or osteoblasts, comprising L-aspartic acid as an active ingredient.

[0002] Our body's muscles attach to bones, protecting them and maintaining proper body shape, among other functions. Muscles also promote calcium uptake, increasing bone density. However, as the body ages, changes in composition lead to a redistribution of body fat and protein. Around age 50, protein synthesis within muscle cells slows down compared to its breakdown, leading to rapid muscle degeneration and exposure to sarcopenic diseases.

[0003] Sarcopenia, a type of muscle-losing disease, refers to a condition in which approximately 13-24% of the usual body mass is reduced. If you have sarcopenia, your activity level decreases significantly, which not only harms your mental health but also lowers your satisfaction with life, and you can easily get injured in everyday life, which can lead to serious injuries.

[0004] Sarcopenia is caused by the gradual decline in skeletal muscle mass and quality that occurs with aging, as well as weight loss, including fat and body fat components, due to inadequate dietary energy intake. Therefore, research aimed at preventing sarcopenia or muscle loss is urgently needed.

[0005] Meanwhile, bone is the hardest tissue that maintains the skeletal system of our body. It protects vital organs and plays a crucial role in the body's immune system, storing hematopoietic stem cells to supply blood cells. Bone undergoes a repetitive process of remodeling, involving the destruction and absorption of old bone and the formation of new bone. The destruction or absorption of old bone is accomplished by osteoclasts, cells derived from hematopoietic stem cells, while new bone is formed by osteoblasts, cells derived from bone cells.

[0006] Osteoporosis is a disease characterized by low bone density due to decreased expression of bone formation-related local factors in osteoblasts and a relative increase in bone resorption by osteoclasts. Normally, bone has a dense, mesh-like structure within its interior. However, in osteoporosis, the gaps between structures widen and the microstructure thins, weakening the bone and making it prone to fracture even with minor impacts.

[0007] The incidence of osteoporosis increases in both men and women due to increased osteoclast activity during aging. Women, in particular, experience a significantly higher incidence of osteoporosis after menopause due to decreased estrogen secretion, leading to a more severe decline in bone density. Therefore, hormone replacement therapy has been the primary treatment for postmenopausal osteoporosis. However, numerous reports have suggested increased risk of breast cancer and cardiovascular disease, which are side effects of hormone replacement therapy, leading to considerable hesitation in its use.

[0008] Aspartic acid, or aspartic acid (Asp, D), is an α-amino acid used in protein biosynthesis. Aspartic acid exists in two forms, or two enantiomers. The most representative function of one of the enantiomers, L-aspartic acid (L-Asp), is known to convert amino acids into energy. In addition, L-aspartic acid is used as a precursor to create arginine in the urea cycle, the main metabolism of arginine. This cycle is an important mechanism for removing ammonia, a protein metabolite and toxin, and it detoxifies ammonia into urea and excretes it through the kidneys, playing a role in purifying proteins. D-aspartic acid is a representative of the few D-amino acids present in the body and is present in the testes and kidneys, and it is known that the intake of D-aspartic acid can affect hormone production and secretion. As a prior art, Korean Patent Publication No. 10-2018-0137605 discloses a use for treating male infertility by confirming that D-aspartic acid and L-aspartic acid increase sperm count and motility. Although both forms of aspartic acid, L- and D-aspartic acid perform different functions in the body.

[0009] Accordingly, the inventors of the present invention have made extensive efforts to find a method for increasing the differentiation and formation of muscle cells or osteoblasts, and as a result, have confirmed that L-aspartic acid promotes the differentiation of muscle cells and osteoblasts, thereby preventing, improving, or treating sarcopenia and osteoporosis, thereby completing the present invention.

[0010] The purpose of the present invention is to provide a composition for promoting differentiation of myocytes or osteoblasts.

[0011] Another object of the present invention is to provide a pharmaceutical composition for treating muscle diseases, diseases requiring bone regeneration or bone formation promotion.

[0012] Another object of the present invention is to provide a health functional food composition for preventing or improving muscle diseases, diseases requiring bone regeneration or bone formation promotion.

[0013] To achieve the above purpose, the present invention provides a composition for promoting differentiation of myocytes or osteoblasts, comprising L-aspartic acid.

[0014] In addition, the present invention provides a pharmaceutical composition for treating muscle diseases, diseases requiring bone regeneration or bone formation promotion, including L-aspartic acid.

[0015] In addition, the present invention provides a health functional food composition for preventing or improving muscle disease, bone regeneration, or diseases requiring promotion of bone formation, containing L-aspartic acid.

[0016] The present invention relates to a composition for promoting differentiation of myocytes or osteoblasts, comprising L-aspartic acid as an active ingredient. It has been confirmed that L-aspartic acid regulates the expression of muscle differentiation markers, suppresses muscle atrophy, and regulates the expression of osteoblast differentiation markers. Therefore, the composition can be usefully used for the prevention, treatment, and improvement of muscle diseases, diseases requiring bone regeneration or bone formation promotion.

[0017] Figure 1 is a diagram showing the morphological changes in cells over time after differentiation treatment with L-aspartic acid.

[0018] Figure 2 is a diagram showing the level of expression of muscle differentiation markers MyoD and MyoG proteins according to the treatment concentration of L-aspartic acid.

[0019] Figure 3 is a graph showing the quantitative expression level of MyoD in Figure 2.

[0020] Figure 4 is a diagram showing the MyoG expression level of Figure 2. Figure 1 is a diagram showing the morphological changes of cells over time after differentiation after L-aspartic acid treatment.

[0021] Figure 2 is a diagram showing the level of expression of muscle differentiation markers MyoD (MYF3) and MyoG proteins according to the treatment concentration of L-aspartic acid.

[0022] Figure 3 is a graph showing the quantitative expression level of MyoD (MYF3) in Figure 2.

[0023] Figure 4 is a graph showing the quantitative expression level of MyoG in Figure 2.

[0024] Figure 5 is a graph showing the MYF3 (MyoD) transcription level according to the treatment concentration of L-aspartic acid.

[0025] Figure 6 is a graph showing the MYF5 transcription level according to the treatment concentration of L-aspartic acid.

[0026] Figure 7 is a graph showing the MYF7 transcription level according to the treatment concentration of L-aspartic acid.

[0027] Figure 8 is a diagram showing the expression level of MyoG protein over time after L-aspartic acid treatment.

[0028] Figure 9 is a graph showing the quantitative expression level of MyoG in Figure 8.

[0029] Figure 10 is a graph showing the MYF3 (MyoD) transcription level over time after L-aspartic acid treatment.

[0030] Figure 11 is a graph showing the MYF5 transcription level over time after L-aspartic acid treatment.

[0031] Figure 12 is a graph showing the MYF7 transcription level over time after L-aspartic acid treatment.

[0032] Figure 13 is a diagram showing the level of MyoD (MYF3) protein expression according to treatment with L-aspartic acid, creatine, and / or vitamin D.

[0033] Figure 14 is a diagram showing the level of MyoG protein expression according to treatment with L-aspartic acid, creatine, and / or vitamin D.

[0034] Figure 15 is a diagram showing the level of MyHC (myosin heavy chain) protein expression according to treatment with L-aspartic acid alone or L-aspartic acid, creatine, and vitamin D.

[0035] Figure 16 is a diagram showing the level of MyHC (MF20) protein expression according to treatment with L-aspartic acid alone or L-aspartic acid, creatine, and vitamin D after H2O2 treatment.

[0036] Figure 17 is a diagram showing the level of MyoD and MYH protein expression according to L-aspartic acid, creatine, and / or vitamin D treatment after dexamethasone treatment.

[0037] Figure 18 is a diagram showing the level of MyHC (MF20) protein expression according to treatment with L-aspartic acid alone or L-aspartic acid, creatine, and vitamin D after dexamethasone treatment.

[0038] Figure 19 is a graph showing the results of measuring oxygen consumption according to treatment with L-aspartic acid, creatine, and / or vitamin D after treatment with H2O2.

[0039] Figure 20 is a graph showing the oxygen consumption over time according to L-aspartic acid, creatine, and / or vitamin D treatment after H2O2 treatment.

[0040] Figure 21 is a graph showing the results of measuring oxygen consumption according to L-aspartic acid, creatine, and / or vitamin D treatment after dexamethasone treatment.

[0041] Figure 22 is a graph showing oxygen consumption over time following dexamethasone treatment followed by L-aspartic acid, creatine, and / or vitamin D treatment.

[0042] Figure 23 is a graph showing changes in body weight following treatment with L-aspartic acid, creatine, and / or vitamin D in a velcro muscle atrophy animal model.

[0043] Figure 24 is a graph showing the difference in grip strength according to treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0044] Figure 25 is a graph showing the degree of improvement in grip strength following repeated exercise after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0045] Figure 26 is a graph showing the specific results of treadmill exercise force as a function of distance after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0046] Figure 27 is a graph showing the results of time-dependent treadmill exercise force after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0047] Figure 28 is a graph showing the results of measuring the weight of the gastrocnemius muscle after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0048] Figure 29 is a graph showing the results of measuring the weight of the tibialis anterior muscle after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0049] Figure 30 is a graph showing the results of measuring the weight of the tibialis anterior muscle after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0050] Figure 31 is a diagram showing muscle density observed after treatment with L-aspartic acid, creatine, and / or vitamin D in a Velcro muscle atrophy animal model.

[0051] Figure 32 is a diagram showing the results of staining with MHC Type I / IIa / IIb after treatment with L-aspartic acid, creatine, and / or vitamin D in a muscle atrophy animal model.

[0052] Figure 33 is a graph showing the results of measuring the transcription level of osteoblast differentiation markers in C3H10T1 / 2 cells.

[0053] Figure 34 is a graph showing the results of measuring the transcription level of osteoblast differentiation markers in MC3T3-e1 cells.

[0054] The present invention is described in detail below.

[0055] The present invention provides a composition for promoting osteoblast differentiation comprising L-aspartic acid.

[0056] The term "L-aspartic acid" of the present invention refers to one of the two enantiomers of aspartic acid. Unlike D-aspartic acid, only L-aspartic acid is known to be used in protein biosynthesis.

[0057] The term "osteoblast" of the present invention refers to a cell that has the ability to synthesize and secrete bone matrix and to calcify bone tissue by depositing inorganic salts such as calcium and magnesium ions in the matrix, and is characterized by being seen in areas where bone is newly formed by ossification, etc.

[0058] The term "differentiation" of the present invention refers to a phenomenon in which structures and functions become specialized while cells divide and proliferate and grow, and refers to the change in shape and function of cells and tissues of a living organism in order to perform their respective assigned tasks. In addition, "differentiation of osteoblasts" is a concept that includes the process of forming bone matrix among the osteogenesis process, which is a series of physiological reactions in which precursor cells that appear during the development of an animal differentiate to form bone matrix, and the formed bone matrix is ​​calcified to form bone, or the process of forming bone matrix by naturally or artificially inducing differentiation of animal stem cells.

[0059] The above composition may further comprise at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a composition for promoting osteoblast differentiation, comprising L-aspartic acid, creatine and vitamin D.

[0060] Creatine, a nitrogen-containing organic acid, is synthesized in vertebrates and serves as an energy source for skeletal muscles. Most creatine is stored in skeletal muscles, bound to adenosine triphosphate (ATP). During muscle contraction, ATP is broken down and used as an energy source, helping to improve muscle function and endurance.

[0061] Vitamin D, a fat-soluble vitamin, is known to regulate calcium metabolism, maintaining calcium homeostasis and bone health. It also plays a role in regulating cell proliferation and differentiation, immune function, and more. Vitamin D deficiency is known to increase the risk of rickets, osteomalacia, and osteoporosis.

[0062] In a specific embodiment of the present invention, it was confirmed that treatment of osteoblasts with L-aspartic acid or L-aspartic acid, creatine, and vitamin D increased the transcription levels of osteoblast differentiation markers ALP (alkaline phosphatase), OCN (osteocalcin), Cola1 (type I collagen), OPN (osteopontin), and RUNX2 (Runt-related transcription factor 2). Therefore, a composition containing L-aspartic acid can be used for promoting osteoblast differentiation.

[0063] In addition, the present invention provides a pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid.

[0064] The composition may further comprise at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine, and vitamin D.

[0065] The disease requiring the promotion of bone regeneration or bone formation may be at least one selected from the group consisting of osteoporosis, multiple myelopathy, osteoarthritis, osteoporotic fractures, diabetic fractures, nonunion fractures, bone defects, osteogenesis imperfecta, osteomalacia and fractures resulting therefrom, osteogenesis disorders, degenerative bone diseases, and malocclusion, but is not limited thereto.

[0066] Osteoporosis is a disease in which bone mass decreases due to various causes and the microstructural deterioration of bone tissue continuously increases the risk of fracture. It occurs when the minerals (especially calcium) and matrix that make up the bone decrease, and the balance of bone formation is broken, so that osteoclastic activity increases more than osteoblastic activity. Normally, the inside of the bone has a dense mesh-like structure, but in the case of osteoporosis, the gaps between the structures widen and the microstructure becomes thinner, weakening the bone, making it prone to fracture even with a small impact.

[0067] The above pharmaceutical compositions can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions, according to conventional methods. Specifically, when formulating, the compositions can be prepared using diluents or excipients such as fillers, weighting agents, binders, wetting agents, disintegrants, and surfactants that are commonly used.

[0068] Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, and capsules. These solid preparations may be prepared by mixing the active ingredient with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. Furthermore, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. In addition to liquids and liquid paraffin for oral administration, various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, may be added to prepare the preparation.

[0069] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrosol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0070] The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

[0071] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity, and the degree of bone loss of the patient, and can be appropriately selected by a person skilled in the art, and is specifically 0.001 mg / kg to 50 mg / kg, and can be administered once a day or in divided doses several times as needed.

[0072] The term "prevention" of the present invention means any act of inhibiting or delaying the onset of a disease requiring promotion of bone regeneration or bone formation by administering a pharmaceutical composition containing the composition of the present invention.

[0073] The term "treatment" of the present invention means any action that improves or beneficially changes the symptoms of a subject suspected of or suffering from a disease requiring promotion of bone regeneration or bone formation by administering the pharmaceutical composition.

[0074] In addition, the present invention provides a health functional food composition for preventing or improving diseases requiring promotion of bone regeneration or bone formation, including L-aspartic acid.

[0075] The above composition may further include at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a health functional food composition for preventing or improving diseases requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine, and vitamin D.

[0076] The disease requiring the promotion of bone regeneration or bone formation may be at least one selected from the group consisting of osteoporosis, multiple myelopathy, osteoarthritis, osteoporotic fractures, diabetic fractures, nonunion fractures, bone defects, osteogenesis imperfecta, osteomalacia and fractures resulting therefrom, osteogenesis disorders, degenerative bone diseases, and malocclusion.

[0077] The term "health functional food" in the present invention refers to a food manufactured using nutrients that are easily deficient in daily meals, raw materials or ingredients with functions useful to the human body, or functional raw materials, and means a food that maintains and improves health by maintaining the normal functions of the human body or activating physiological functions, but is not limited thereto. The "function" above refers to regulating nutrients for the structure and functions of the human body or obtaining a beneficial effect for health purposes, such as physiological actions.

[0078] The health functional food of the present invention can be manufactured in the form of powder, granules, tablets, capsules, or liquid.

[0079] The term "improvement" in the present invention means any action by which osteoporosis is improved or beneficially changed by administration of the composition.

[0080] In addition, the present invention provides a method for preventing or treating a disease requiring promotion of bone regeneration or bone formation, comprising the step of administering L L-aspartic acid to a subject.

[0081] The present invention also provides a method for preventing or treating a disease requiring promotion of bone regeneration or bone formation, comprising administering to a subject L-aspartic acid, creatine and vitamin D.

[0082] The present invention also provides the use of L-aspartic acid for use in the manufacture of a medicament for preventing, improving or treating a disease requiring promotion of bone regeneration or bone formation.

[0083] The present invention also provides the use of L-aspartic acid, creatine and vitamin D for use in the manufacture of a medicament for preventing, improving or treating a disease requiring promotion of bone regeneration or bone formation.

[0084] In addition, the present invention provides a composition for promoting myocyte differentiation comprising L-aspartic acid.

[0085] The term "myocyte" or muscle cell of the present invention refers to a contractile fibrous cell that constitutes muscle tissue. It includes skeletal muscle fibers, smooth muscle fibers, and cardiac muscle fibers. Myocytes are a type of cell found in certain types of muscle tissue (e.g., skeletal muscle, cardiac muscle, and visceral muscle). Myocytes develop from myoblasts and form muscle in a process known as myogenesis.

[0086] The term "myocyte differentiation" of the present invention means that myocytes differentiate to form muscle cells that have muscle characteristics, such as a change in shape to an elongated shape and containing muscle fibers and a large number of mitochondria, and that the formed muscle cells fuse to form multinucleated myotubes.

[0087] The above composition may further comprise at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a composition for promoting osteoblast differentiation, comprising L-aspartic acid, creatine and vitamin D.

[0088] Creatine, a nitrogen-containing organic acid, is synthesized in vertebrates and serves as an energy source for skeletal muscles. Most creatine is stored in skeletal muscles, bound to adenosine triphosphate (ATP). During muscle contraction, ATP is broken down and used as an energy source, helping to improve muscle function and endurance.

[0089] Vitamin D, a fat-soluble vitamin, is known to regulate calcium metabolism, maintaining calcium homeostasis and bone health. It also plays a role in regulating cell proliferation and differentiation, immune function, and more. Vitamin D deficiency is known to increase the risk of rickets, osteomalacia, and osteoporosis.

[0090] In a specific embodiment of the present invention, it was confirmed that the protein expression levels of muscle differentiation markers MyoD, MyoG, or MyHC (MF20) increased depending on the treatment concentration and elapsed time of L-aspartic acid or L-aspartic acid, creatine, and vitamin D, and it was confirmed that the mRNA transcription levels of MYF3, MYF5, and MYF7 increased. In addition, after pretreatment with H2O2 or dexamethasone to create a muscle atrophy cell environment, it was confirmed that the protein expression levels of muscle differentiation markers MyHC (MF20), MyoD, or MYH increased by treatment with L-aspartic acid or L-aspartic acid, creatine, and vitamin D, and it was confirmed that oxygen consumption increased. In addition, it was confirmed that treadmill exercise power increased and muscle density increased according to treatment with L-aspartic acid or L-aspartic acid, creatine, and vitamin D in a Velcro muscle atrophy animal model. Therefore, the composition containing L-aspartic acid of the present invention can be used for promoting myocyte differentiation.

[0091] In addition, the present invention provides a pharmaceutical composition for preventing or treating muscle disease comprising L-aspartic acid.

[0092] The composition may further comprise at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine, and vitamin D.

[0093] The above muscle disease may be any one or more selected from the group consisting of, but is not limited to, sarcopenia, muscle wasting and muscle atrophy.

[0094] The above pharmaceutical compositions can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions, according to conventional methods. Specifically, when formulating, the compositions can be prepared using diluents or excipients such as fillers, weighting agents, binders, wetting agents, disintegrants, and surfactants that are commonly used.

[0095] Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, and capsules. These solid preparations may be prepared by mixing the active ingredient with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. Furthermore, lubricants such as magnesium stearate and talc may also be used in addition to simple excipients. In addition to liquids and liquid paraffin for oral administration, various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, may be added to prepare the preparation.

[0096] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrosol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0097] The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

[0098] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity, and the degree of bone loss of the patient, and can be appropriately selected by a person skilled in the art, and is specifically 0.001 mg / kg to 50 mg / kg, and can be administered once a day or in divided doses several times as needed.

[0099] The term "prevention" of the present invention means any act of inhibiting or delaying the onset of a disease requiring promotion of bone regeneration or bone formation by administering a pharmaceutical composition containing the composition of the present invention.

[0100] The term "treatment" of the present invention means any action that improves or beneficially changes the symptoms of a subject suspected of or suffering from a disease requiring promotion of bone regeneration or bone formation by administering the pharmaceutical composition.

[0101] In addition, the present invention provides a health functional food composition for preventing or improving muscle disease, comprising L-aspartic acid.

[0102] The above composition may further include at least one selected from the group consisting of creatine and vitamin D. Accordingly, the present invention provides a health functional food composition for preventing or improving diseases requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine, and vitamin D.

[0103] The above muscle disease may be any one or more selected from the group consisting of, but is not limited to, sarcopenia, muscle wasting and muscle atrophy.

[0104] The term "health functional food" in the present invention refers to a food manufactured using nutrients that are easily deficient in daily meals, raw materials or ingredients with functions useful to the human body, or functional raw materials, and means a food that maintains and improves health by maintaining the normal functions of the human body or activating physiological functions, but is not limited thereto. The "function" above refers to regulating nutrients for the structure and functions of the human body or obtaining a beneficial effect for health purposes, such as physiological actions.

[0105] The health functional food of the present invention can be manufactured in the form of powder, granules, tablets, capsules, or liquid.

[0106] The term "improvement" in the present invention means any action by which osteoporosis is improved or beneficially changed by administration of the composition.

[0107] The present invention also provides a method for preventing or treating a muscle disease, comprising administering L-aspartic acid to a subject.

[0108] The present invention also provides a method for preventing or treating a muscle disease, comprising administering to a subject L-aspartic acid, creatine and vitamin D.

[0109] The present invention also provides the use of L-aspartic acid for use in the manufacture of a medicament for preventing, improving or treating muscle disorders.

[0110] The present invention also provides the use of L-aspartic acid, creatine and vitamin D for use in the manufacture of a medicament for preventing, improving or treating muscle disorders.

[0111] Hereinafter, the present invention will be described in more detail through examples.

[0112] These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

[0113] <Example 1> Cell morphological changes following L-aspartic acid treatment

[0114] An experiment was conducted to confirm cell morphological changes following L-aspartic acid treatment.

[0115] Specifically, the mouse normal myoblast C2C12 cell line was obtained from ATCC (Manassas, VA, USA). C2C12 cells were passaged every 2–3 days in 100 mm dishes containing DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 100 units / ml penicillin, and 100 μg / ml streptomycin (Life Technologies, Grand Island, NY, USA). The cells were cultured and grown under humidified conditions of 5% CO2 and 37°C. To examine the differences in morphological changes of the cells, C2C12 cells (5 × 10 5 ) were placed on a 6-well dish, cultured for 24 hours, and differentiated for 5 days with a culture medium containing Horse Serum every day (control). L-aspartic acid (225 uM) was treated under the same conditions to confirm the difference in cell morphological changes over differentiation time.

[0116] As a result, as shown in Fig. 1, it was confirmed that muscle cell differentiation was promoted by L-aspartic acid (225 uM).

[0117] <Example 2> Confirmation of muscle differentiation marker protein expression according to L-aspartic acid treatment concentration

[0118] To confirm the expression level of muscle differentiation markers according to the treatment concentration of L-aspartic acid, Western blot was performed to confirm the expression of muscle differentiation markers MyoD and Myogenin (MyoG).

[0119] Specifically, C2C12 cells (5 x 10 5 ) were placed on a 6-well dish, cultured for 24 hours, treated with L-aspartic acid (60, 112, 225 uM), and then the cells were harvested and subjected to Western blot.

[0120] For Western blot analysis, C2C12 cells were placed on ice, washed twice with cold PBS, and lysed in cell lysis buffer (50 mmol / L Tris-HCl, pH 7.5, 1% (v / v) Nonidet P-40, 250 mmol / L NaCl, 0.1 mmol / L phenyl methyl sulfonyl fluoride, 0.1 mmol / L sodium vanadate, 20 mmol / L β-glycerol phosphate, 2 mmol / L DTT, 1 mmol / L Leupeptin, and 10 mmol / L PNPP) at 4°C for 30 min. The cell lysate was then centrifuged at 16,000 × g for 20 min at 4°C, and the supernatant was collected to assess the protein content. The proteins were mixed with sample buffer containing β-mercamtoethanol and heated at 100°C for 2 min. Forty micrograms of each cell lysate was fractionated on a 10% polyacrylamide gel by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk in tri-buffered saline (TBS) containing 0.02% Tween 20 for 1 h at room temperature, and then incubated overnight at 4°C with primary antibodies [MyoD (Santa Cruz, sc-377460), Myogenin (Santa Cruz sc-12732)] diluted 1:1000. GAPDH (1:5000 dilution) was used as a loading control. After incubation with primary antibodies, the blots were washed four times in TBS / Tween-20 before incubation with goat anti-mouse or anti-rabbit horse radish peroxidase (HRP)-conjugated antibodies diluted 1:2000 in TBS / Tween-20 containing 5% skim milk for 1 h at room temperature. After washing in TBS / Tween-20, the blots were used for antigen detection using an enhanced chemiluminescence system. Proteins were visualized using an ECL-chemiluminescence kit (GE Healthcare, Life Sciences).

[0121] As a result, as shown in Figures 2 to 4, it was confirmed that the expression of MyoD and MyoG, markers involved in the early stage of muscle cell differentiation, increased by L-aspartic acid.

[0122] <Example 3> Confirmation of muscle differentiation marker mRNA expression according to L-aspartic acid concentration

[0123] To determine the expression level of muscle differentiation markers according to the treatment concentration of L-aspartic acid, Q-PCR was performed to confirm the expression of muscle differentiation markers Myogenic factor 3 (MYF3, MyoD), MYF5, and MYF7 mRNA.

[0124] Specifically, C2C12 cells (5 x 10 5 ) were placed on a 6-well dish, cultured for 24 hours, treated with L-aspartic acid (60, 112, 225 uM), and then the cells were harvested and Q-PCR was performed.

[0125] The primers used for Q-PCR are shown in Table 1 below.

[0126] Name Sequence (5'-3') MYF3-FCCACTCCGGGACATAGACTTG (SEQ ID NO: 1) MYF3-RAAAAGCGCAGGTCTGGTGAG (SEQ ID NO: 2) MYF5-FAAGGCTCCTGTATCCCCTCAC (SEQ ID NO: 3) MYF5-RTGACCTTCTTCAGGCGTCTAC (SEQ ID NO: 4) MYH7-FACTGTCAACACTAAGAGGGTCA (SEQ ID NO: 5) MYH7-RTTGGATGATTTGATCTTCCGCGG (SEQ ID NO: 6)

[0127] As a result, as shown in FIGS. 5 to 7, it was confirmed that the transcription levels of MyoD (MYF3), MYF5, and MYH7 increased as the concentration of L-aspartic acid increased.

[0128] <Example 4> Confirmation of muscle differentiation marker expression according to differentiation time after L-aspartic acid treatment

[0129] To confirm the degree of expression of muscle differentiation markers according to differentiation time after treatment with L-aspartic acid, Western blot was performed to confirm the expression of the muscle differentiation marker MyoG (Myogenin).

[0130] Specifically, C2C12 cells (5 x 10 5 ) were placed on a 6-well dish and cultured for 24 hours, and differentiated for 5 days with a culture medium containing Horse Serum every day (-: control). The expression level of muscle cell differentiation markers according to differentiation time (1 day, 3 days, 5 days) was confirmed by treating with L-aspartic acid (225 uM) under the same conditions. Western blot was performed in the same manner as in Example 2.

[0131] As a result, as shown in Figures 8 and 9, it was confirmed that the expression of the muscle differentiation marker MyoG increased over time in the group treated with L-aspartic acid compared to the control group.

[0132] <Example 5> Confirmation of muscle differentiation marker mRNA expression according to differentiation time after L-aspartic acid treatment

[0133] To confirm the expression level of muscle differentiation markers according to the treatment concentration of L-aspartic acid, Q-PCR was performed to confirm the expression of muscle differentiation markers MYF3 (MyoD), MYF5, and MYF7 mRNA.

[0134] Specifically, C2C12 cells (5 x 10 5 ) were placed on a 6-well dish, and after 24 hours of culture, the culture medium containing Horse Serum was replaced daily to induce differentiation. The control group was treated with L-aspartic acid (225 uM), and the cells were harvested on the 3rd and 5th days and Q-PCR was performed. The primers used for Q-PCR are the same as in Table 1.

[0135] As a result, as shown in Figures 10 to 12, it was confirmed that the transcription levels of differentiation markers MYF3 (MyoD), MYH7, and MYF5 increased with L-aspartic acid treatment.

[0136] <Example 6> Confirmation of muscle differentiation marker expression according to treatment with L-aspartic acid, vitamin D, and creatine.

[0137] To confirm the expression level of muscle differentiation markers by L-aspartic acid, vitamin D, and creatine, Western blot was performed to confirm the expression of muscle differentiation markers MyoD (MYF3) and MyoG (Myogenin).

[0138] Specifically, C2C12 cells (5 x 10 5 ) were placed on a 6-well dish, and after 24 hours of culture, L-aspartic acid, creatine, and / or vitamin D were treated, and the degree of muscle cell differentiation was confirmed through muscle differentiation markers (MyoD, MyoG).

[0139] As a result, as shown in Fig. 13, when myofibroblasts are treated with L-Asparic acid, the expression of MyoD increases, and it was confirmed that when all of these were treated, the expression of MyoD increased even more compared to when L-aspartic acid, vitamin D, and creatine were treated alone.

[0140] In addition, as shown in Figure 14, it was confirmed that the expression of MyoG increased as much as on the third day of differentiation when L-aspartic acid was treated in non-differentiated myofibroblasts.

[0141] <Example 7> Confirmation of expression of muscle differentiation markers

[0142] To confirm the degree of muscle differentiation by L-aspartic acid, immunofluorescence staining (IF) was performed to confirm the expression of the muscle differentiation marker MyHC (MF20).

[0143] Specifically, sterile coverslips were placed in 12-well plates, with 1 × 10 per well. 5 C2C12 cells were seeded and grown at 37°C. After 24 h, cells were differentiated in DMEM (2% HS) for up to 5 days, and on the 4th day of differentiation, each compound was treated at various concentrations. Next, cells were washed twice with PBS at 37°C and fixed on coverslips by incubation in 4% paraformaldehyde for 1 h. Cells were then washed twice with PBS. Before blocking, cells were incubated with Triton X-100 in PBS for 30 min. Coverslips were blocked in 1% BSA for 1 h at room temperature with shaking. Anti-Myosin (MyHC, MF20) antibody was added (1:200) in 1% BSA and incubated overnight at 4°C. Coverslips were then washed three times each with PBS. Afterwards, Alexa fluor 488 secondary antibody (1:1000) in 1% BSA was added and incubated for 1 hour at room temperature under light-protected conditions. The coverslips were washed three times with PBS and mounted on slides using mounting medium containing DAPI VECTASHIELD (St. Louis, USA). Photographs were taken using Zeiss.

[0144] As a result, as shown in Fig. 15, it was confirmed that MyHC (MF20) expression increased more when treated with L-aspartic acid compared to the control group, and MyHC expression increased more in the group treated with L-aspartic acid, creatine, and vitamin D compared to the group treated with L-aspartic acid alone.

[0145] <Example 8> Confirmation of the degree of muscle differentiation of a composition containing L-aspartic acid in a muscle atrophy environment

[0146] To determine the degree of muscle differentiation according to the composition containing L-aspartic acid in a muscular dystrophy environment, the expression of muscle differentiation markers was confirmed.

[0147] <8-1> According to H2O2 treatment Confirmation of MyHC (MF20) expression

[0148] To create a muscle atrophy cell environment, 250uM of H2O was treated for 48 hours, and each compound was treated at different concentrations on the 4th day of differentiation. The following conditions were performed in the same manner as in Example 7.

[0149] As a result, as shown in Fig. 16, despite 5 days of muscle differentiation, muscle differentiation ability was reduced by H2O2 treatment (control group), and muscle differentiation ability was improved by L-aspartic acid treatment. Furthermore, it was confirmed that muscle differentiation increased more significantly in the group treated with L-aspartic acid, creatine, and vitamin D compared to the group treated with L-aspartic acid alone.

[0150] <8-2> Dexamethasone Confirmation of muscle differentiation marker expression according to treatment

[0151] To create a muscle atrophy cell environment, dexamethasone was treated and the expression of muscle differentiation markers MyoD and MYH was confirmed.

[0152] Specifically, C2C12 cells (4.5 x 10 5 ) were placed on a 6-well dish and cultured for 24 hours, then treated with 100 uM Dexamethasone (100 uM) and cultured for 48 hours to create a muscle atrophy environment. Afterwards, L-aspartic acid, creatine, and / or vitamin D were treated and cultured for 24 hours to confirm the expression of muscle differentiation markers MyoD and MYH.

[0153] As a result of performing Western blot, as shown in Fig. 17, compared to the control group (0D), when L-aspartic acid was treated after muscle atrophy, the expression of MyoD and MYH increased further, and compared to the group treated with L-aspartic acid alone, the expression of MyoD increased further in the group treated with L-aspartic acid, creatine, and vitamin D.

[0154] As a result of performing immunofluorescence staining, as shown in Fig. 18, despite 5 days of muscle differentiation, muscle differentiation ability was reduced by dexamethasone treatment (ctrl), but it was observed that differentiation ability was improved by L-aspartic acid, and muscle differentiation was confirmed to increase more significantly in the group treated with L-aspartic acid, creatine, and vitamin D compared to the group treated with L-aspartic acid alone.

[0155] <Example 9> Confirmation of oxygen consumption of a composition containing L-aspartic acid in a muscle atrophy environment

[0156] A higher oxygen consumption value indicates increased mitochondrial activity and a rapid increase in cellular oxygen consumption. Therefore, to determine mitochondrial activity, oxygen consumption rate (OCR) was measured in a muscle-atrophic environment.

[0157] Specifically, 1.2×10 in a 96-well plate 5Cells were seeded in 80 μl of culture media (CO2, 37°C). After 24 h, the media was replaced and treated with L-aspartic acid, creatine, and / or vitamin D, and the cells were cultured for 24 h until 80-90% confluence (CO2, 37°C). 200 μl of calibrant solution was added to a 96-well sensor plate and hydrated overnight (non-CO2, 37°C). After preparing running media containing D-Glucose, Sodium pyruvate, and L-glutamine at the same concentrations as the media used for cell culture, and drug compounds (Oligo, FCCP, Rot.A / A), the drug compounds were carefully added to the hydrated 96-well sensor plate in the corresponding amounts (20 / 22 / 25 μl / port, respectively). The CO2-incubated 96-well plate was carefully washed twice with running media and filled with 175 μl / well of the same media. After non-CO2 incubation for approximately 30 minutes to 1 hour, oxygen consumption (OCR) was measured.

[0158] As a result, as shown in FIGS. 19 and 20, it was confirmed that the oxygen consumption value increased when cells in a muscle atrophy (H2O2) environment were treated with L-aspartic acid or a composition containing it.

[0159] In addition, as shown in FIGS. 21 and 22, it was confirmed that the oxygen consumption value increased when cells in a muscle atrophy (Dexamethasone) environment were treated with a composition containing creatine or L-aspartic acid.

[0160] The above results imply that L-aspartic acid and creatine can each play a role when muscle atrophy occurs due to different causes, and suggest that L-aspartic acid or a composition containing it induces the average recovery of mitochondrial activity in a muscle atrophy cell environment.

[0161] <Example 10> Establishment of a Velcro muscle atrophy animal model and confirmation of weight changes

[0162] To confirm the muscle atrophy inhibitory effect of L-aspartic acid, a Velcro muscle atrophy animal model was established.

[0163] Specifically, 7-week-old male C57BL / 6J mice weighing 20±3 g were obtained from Dooyeol Bio (Seoul, South Korea). The mice were housed under a constant room temperature and 12 h day / night cycle for 1 week prior to the experiment, and the mice were fed a standard rodent diet and had free access to water.

[0164] To establish a sarcopenia mouse model, a Velcro model was established as follows. First, mice were anesthetized with isoflurane and their entire legs were wrapped with sports tape, starting from the ankle. Then, Velcro was used to wrap the entire leg, and both ends of the Velcro were secured with superglue. The condition of the Velcro was checked daily. After 14 days, the Velcro was removed and subsequent experiments were conducted. Each group was randomly assigned to five groups, as shown below, and oral administration was administered once daily for 14 days.

[0165] G1: - Velcro (PBS)

[0166] G2: + Velcro (PBS)

[0167] G3: + Velcro (Creatin 30mg / kg)

[0168] G4: + Velcro (L-Aspartic acid 30mg / kg)

[0169] G5: + Velcro (L-Aspartic acid 30mg / kg + Viatmin D 1ug / kg + Creatin 30mg / kg)

[0170] To check the weight change of the constructed mice, the body weight was measured at 3-day intervals.

[0171] As a result, as shown in Figure 23, no difference in body weight was observed between each group.

[0172] <Example 11> Verification of the Velcro muscle atrophy animal model

[0173] To confirm whether the Velcro muscle atrophy model was well established, grip strength measurement experiments were performed in normal animals and Velcro muscle atrophy animal models.

[0174] Specifically, grip strength was measured before velcro damage (day 0), and grip strength was measured on the 7th and 14th days after orally administering the composition and fasting for 3 hours.

[0175] As a result, as shown in Fig. 24, it was confirmed that the grip strength was reduced by more than 30% in the groups G2 to G5 with Velcro wrapped compared to the G1 group that did not have Velcro wrapped, confirming that the Velcro muscle atrophy model was well established.

[0176] Additionally, we observed whether grip strength improved with repeated exercise.

[0177] As a result, as shown in Figure 25, the control group (G1) that did not induce muscle atrophy with Velcro showed improvement in grip strength with repeated exercise. Meanwhile, in the 7th day test, significant improvement in grip strength was also observed in the creatine only group (G3), the L-aspartic acid only group (G4), and the group treated with L-aspartic acid, creatine, and vitamin D together (G5), and in the 14th day test, the grip strength was improved compared to the 7th day, but it was not significant.

[0178] <Example 12> Measurement of treadmill exercise force according to L-aspartic acid treatment in a Velcro muscle atrophy animal model

[0179] An experiment was conducted to confirm the improvement of treadmill exercise capacity following L-aspartic acid treatment in a Velcro muscle atrophy animal model.

[0180] Specifically, treadmill exercise power was measured after fasting for 3 hours before velcro injury (day 0), and after velcro injury, the composition was orally administered once a day for 14 days, and after fasting for 3 hours, treadmill exercise power was measured in terms of distance and time on the 4th, 8th, 11th, and 14th days, respectively. Treadmill conditions are as shown in Table 2.

[0181] As a result of measuring treadmill exercise power by distance, as shown in Fig. 26, it was confirmed that the treadmill exercise power improved as the administration period of each composition increased, and compared to the creatine only group (G3), the L-aspartic acid only group (G4) and the group administered L-aspartic acid, creatine, and vitamin D all together (G5) showed a proportional increase in total running distance as the administration period increased.

[0182] As a result of measuring treadmill exercise power by time, as shown in Fig. 27, similar to the increase in exercise power for the total running distance, the increase was greater in the L-aspartic acid only administration group (G4) than in the creatine only administration group (G3). In particular, in the group administered all of L-aspartic acid, creatine, and vitamin D (G5), it was observed that the running time increased significantly compared to the only administration group as the administration period increased.

[0183] <Example 13> Measurement of muscle weight by type according to L-aspartic acid treatment in a Velcro muscle atrophy animal model

[0184] Muscle weights of different muscle types were measured in response to L-aspartic acid treatment in a Velcro muscle atrophy animal model.

[0185] Specifically, on the 14th day after oral administration of each substance, the mice were dissected and the weights of the tibialis anterior, gastrocnemius muscle, and quadriceps femoris muscle were determined.

[0186] As a result, as shown in Figures 28 to 30, there was a difference in muscle weight according to Velcro damage between the group without Velcro damage (G1) and the group with Velcro damage (G2 to G5), but no significant difference was observed between the groups with Velcro damage.

[0187] <Example 14> Confirmation of muscle density following L-aspartic acid treatment in a Velcro muscle atrophy animal model

[0188] H&E staining was performed to observe muscle density following L-aspartic acid treatment.

[0189] Specifically, paraffin blocks were dried overnight at 50℃ after 4㎛ sections per slide, and then immersed in xylene twice for 2 minutes each to remove paraffin and dissolve it so that no residue remains. The tissue was immersed in EtOH in a gradually decreasing concentration order of 100% EtOH → 95% EtOH → 90% EtOH → 80% EtOH → 70% EtOH for 2 minutes to replenish the moisture lost in the previous step, and then washed in gently running water for 1 minute. The washed tissue was immersed in hematoxylin for 3 minutes to stain the nuclei, and then washed in gently running water for 2 minutes. The staining was stopped by immersing in stop reagent (Acid Alcohol (HCl + EtOH)) for 5 seconds to remove the background, and then washed again in gently running water for 2 minutes. After immersing in bluing reagent (1% Ammonia Alcohol (Ammonium + EtOH)) for 10 seconds to change the nuclei stained purple by Hematoxylin to blue, the tissue was washed in gently running water for 2 minutes. For contrast, the tissue was immersed in Eosin for 30 seconds to stain it pink. The concentration of EtOH was gradually increased in the order of 70% EtOH (up & down 15 times) → 80% EtOH (up & down 15 times) → 90% EtOH (up & down 15 times) → 95% EtOH (up & down 15 times) → 100% EtOH (3 min) → 100% EtOH (3 min), and after 15 up & downs, the tissue was immersed in 100% EtOH twice for 1 minute each to remove the Eosin and moisture remaining in the tissue. The process of removing EtOH during the dehydration process and soaking the slide in Xylene for 2 minutes to remove water present in the slide was repeated twice, and then mounting was performed.

[0190] As a result, as shown in Fig. 31, when comparing the muscles of the group without velcro damage (G1) and the group with velcro damage (G2), it was confirmed that the muscle density was reduced due to velcro damage. Meanwhile, it was observed that the muscle spacing became denser due to L-aspartic acid administration, and it was observed that the muscle spacing became denser in the group administered L-aspartic acid, creatine, and vitamin D (G5) than in the group administered L-aspartic acid alone (G4).

[0191] <Example 15> Confirmation of muscle fiber changes following L-aspartic acid treatment in a Velcro muscle atrophy animal model.

[0192] To confirm changes in muscle fibers following L-aspartic acid administration, confocal microscopy was used.

[0193] Specifically, frozen block sections (sections, 10 μm) were stored at -80°C until staining. The sections were dried at room temperature for 30 minutes to ensure good attachment to the slide. Afterwards, a PAP pen was used to create a barrier around the fixed sections to allow reaction with the reagents. The attached tissues were fixed with 4% PFA for 10 minutes and washed three times with PBS for 5 minutes each. After treatment with a PBS solution containing 0.5% Triton-X100 for 15 minutes, the slides were washed three times with PBS, and then blocked with a 3% BSA solution for 1 hour. After the blocking process, the slides were incubated with primary antibodies diluted in a 3% BSA solution overnight at 4°C, followed by PBS washes, and secondary antibody incubation. After antibody binding, the slides were washed three times with PBS, covered with a cover glass along with a mounting solution, and then fixed with nail gel. The slides were photographed using a confocal microscope with a fixed cover glass.

[0194] As a result, as shown in Figure 32, when the total muscle ratio of the control group (G2: PBS) and the comparison group (G4: L-Asp, G5: L-Asp, Cre, Vit D) was considered 100%, it was confirmed that the ratio of MHC Type Ⅰ of G4 and G5 was significantly increased compared to G2.

[0195] <Example 16> Confirmation of osteoblast differentiation marker mRNA expression according to L-aspartic acid concentration

[0196] To determine the degree of osteoblast differentiation by the treatment concentration of L-aspartic acid, Q-PCR was performed to confirm the expression of osteoblast differentiation markers ALP (alkaline phosphatase), OCN (osteocalcin), Cola1 (type I collagen), OPN (osteopontin), and RUNX2 (Runt-related transcription factor 2) mRNA.

[0197] Specifically, 5 x 10 C3H10T1 / 2 or MC3T3-e1 cells, known as osteoblasts, were injected 5 The cells were spread on 6-well dishes and cultured for 24 hours, then treated with L-aspartic acid (225 μM) or L-aspartic acid (225 μM), creatine, and vitamin D. After 24 hours of treatment, the cells were harvested and Q-PCR was performed. The primers used for Q-PCR are shown in Table 2 below.

[0198] Name Sequence (5'-3') ALP-FCCAGCAGGTTTCTCTCTTGG (SEQ ID NO: 7) ALP-RGGAATGTTCCATGGAGGTTG (SEQ ID NO: 8) OCN-FGGTAGTGAACAGACTCCGGC (SEQ ID NO: 9) OCN-RGGGCAGCACAGGTCCTAAAT (SEQ ID NO: 10) Cola1-FAGCATGACCGATGGATTCCC (SEQ ID NO: 11) Cola1-RATTAGGCGCAGGAAGGTCAG (SEQ ID NO: 12) OPN-FTGGACTGAGGTCAAAGTCTAGGA (SEQ ID NO: 13) OPN-RACAGGGATGACATCGAGGGA (SEQ ID NO: 14) RUNX2-FTCTCAGTAAGAAGAGCCAGGCA (SEQ ID NO: 15) RUNX2-RTTCGTGGGTTGGAGAAGCG (SEQ ID NO: 16)

[0199] As a result, as shown in Figures 33 and 34, it was confirmed that the transcription level of osteoblast differentiation markers increased in the group treated with L-aspartic acid (+) and the group treated with L-aspartic acid (225 uM), creatine, and vitamin D (++) (++) compared to the control group. The above results suggest that L-aspartic acid or a composition containing it has an excellent ability to differentiate osteoblasts.

Claims

1. A composition for promoting osteoblast differentiation, comprising L-aspartic acid.

2. In paragraph 1, A composition for promoting osteoblast differentiation, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

3. A composition for promoting osteoblast differentiation, comprising L-aspartic acid, creatine and vitamin D.

4. In paragraph 1 or paragraph 3, A composition for promoting osteoblast differentiation, wherein the above L-aspartic acid increases the transcription levels of ALP (alkaline phosphatase), OCN (osteocalcin), Cola1 (type I collagen), OPN (osteopontin), and RUNX2 (Runt-related transcription factor 2).

5. A pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid.

6. In paragraph 5, A pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

7. A pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine and vitamin D.

8. In any one of paragraphs 5 to 7, A pharmaceutical composition for treating a disease requiring promotion of bone regeneration or bone formation, wherein the disease requiring promotion of bone regeneration or bone formation is at least one selected from the group consisting of osteoporosis, multiple myelopathy, osteoarthritis, osteoporotic fractures, diabetic fractures, nonunion fractures, bone defects, osteogenesis imperfecta, osteomalacia and fractures resulting therefrom, osteogenesis disorders, degenerative bone diseases, and malocclusion.

9. A health functional food composition containing L-aspartic acid for preventing or improving a disease requiring promotion of bone regeneration or bone formation.

10. In paragraph 9, A health functional food composition for preventing or improving a disease requiring promotion of bone regeneration or bone formation, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

11. A health functional food composition for preventing or improving diseases requiring promotion of bone regeneration or bone formation, comprising L-aspartic acid, creatine and vitamin D.

12. In any one of paragraphs 9 to 11, A health functional food composition for preventing or improving a disease requiring bone regeneration or bone formation promotion, wherein the disease requiring bone regeneration or bone formation promotion is at least one selected from the group consisting of osteoporosis, multiple myelopathy, osteoarthritis, osteoporotic fractures, diabetic fractures, nonunion fractures, bone defects, osteogenesis imperfecta, osteomalacia and fractures resulting therefrom, osteogenesis disorders, degenerative bone diseases, and malocclusion.

13. A composition for promoting myocyte differentiation, comprising L-aspartic acid.

14. In paragraph 13, A composition for promoting myocyte differentiation, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

15. A composition for promoting myocyte differentiation, comprising L-aspartic acid, creatine and vitamin D.

16. In paragraph 13 or 15, A composition for promoting osteoblast differentiation, wherein the above L-aspartic acid increases the transcription levels of MYF (Myogenic factor) 3, MYF5, and MYF7.

17. A pharmaceutical composition for preventing or treating muscle disease, comprising L-aspartic acid.

18. In paragraph 17, A pharmaceutical composition for preventing or treating muscle disease, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

19. A pharmaceutical composition for preventing or treating muscle disease, comprising L-aspartic acid, creatine and vitamin D.

20. In any one of paragraphs 17 to 19, A pharmaceutical composition for preventing or treating a muscle disease, wherein the muscle disease is at least one selected from the group consisting of sarcopenia, muscle loss and muscle degeneration.

21. A health functional food composition containing L-aspartic acid for preventing or improving muscle disease.

22. In paragraph 21, A health functional food composition for preventing or improving muscle disease, wherein the composition further comprises at least one selected from the group consisting of creatine and vitamin D.

23. A health functional food composition for preventing or improving muscle disease, comprising L-aspartic acid, creatine and vitamin D.

24. In any one of paragraphs 21 to 23, A health functional food composition for preventing or improving muscle disease, wherein the muscle disease is at least one selected from the group consisting of sarcopenia, muscle loss, and muscle degeneration.

25. A method for preventing or treating a disease requiring promotion of bone regeneration or bone formation, comprising the step of administering L-aspartic acid to a subject.

26. A method for preventing or treating a disease requiring promotion of bone regeneration or bone formation, comprising administering to a subject L-aspartic acid, creatine and vitamin D.

27. A method for preventing or treating a muscle disease, comprising administering L-aspartic acid to a subject.

28. A method for preventing or treating a muscle disease, comprising administering to a subject L-aspartic acid, creatine and vitamin D.

29. Use of L-aspartic acid for the manufacture of a medicament for the prevention, improvement or treatment of diseases requiring promotion of bone regeneration or bone formation.

30. Use of L-aspartic acid, creatine and vitamin D for the manufacture of a medicament for the prevention, improvement or treatment of diseases requiring promotion of bone regeneration or bone formation.

31. Use of L-aspartic acid for the manufacture of a medicament for the prevention, improvement or treatment of muscle diseases.

32. Use of L-aspartic acid, creatine and vitamin D for the manufacture of a medicament for the prevention, improvement or treatment of muscle diseases.

Images