Capsici fructus cace gene and protein and use thereof

Abstract

The present invention belongs to the technical field of Capsici fructus planting. Disclosed is a Capsici fructus CaCE gene, which has a nucleotide sequence as shown in SEQ ID NO: 1. Also provided is a CaCE protein encoded by the CaCE gene, which has an amino acid sequence as shown in SEQ ID NO: 2. In the present invention, by means of silencing / deleting the CaCE gene in a Capsici fructus plant, the stem strength of the obtained silenced plant is remarkably enhanced, the content of cellulose and hemicellulose in the silenced plant is increased, and the content of lignin has no obvious change, which indicate that the CaCE gene can control stem development by means of affecting the components of stem cell walls, and therefore a lodging-resistant variety of Capsici fructus having a high stem strength and a high cellulose and hemicellulose content can be further cultivated.

Description

A pepper CaCE gene and its protein and application Technical Field

[0001] The present invention belongs to the technical field of pepper planting, and in particular relates to a pepper CaCE gene, a protein and an application thereof. Background Art

[0002] Lignification of stem primary xylem vessels occurs during the early stages of vascular bundle differentiation. As the primary transporter of plant matter, stem vascular bundles play a crucial role in the transport and distribution of water, minerals, sugars, and amino acids during plant growth. Plant stems are crucial support and nutrient transport organs, as well as important traits for plant architecture. Stem strength is a key factor influencing lodging in various plant crop species. Stem diameter is positively correlated with stem strength, while studies have shown a highly significant negative correlation between stem diameter and lodging. Stem strength is a complex trait encompassing mechanical elasticity and stiffness, and is closely related to the stem's morphology and anatomy. The stem's anatomical structure includes the epidermis, sclerenchyma, vascular bundles, and parenchyma. Vascular bundles comprise xylem and phloem. Uniformly thickened and lignified sclerenchyma cells are particularly important for the mechanical support of the stem.

[0003] Studies have shown that the proportion of sclerenchyma in the stem, the thickness of the vascular bundle sheath, the thickness of the scleroderma cell cavities, the density of vascular bundles, and the area of ​​vascular bundles are significantly positively correlated with stem strength. Chuanren et al. demonstrated that rice stem strength is significantly correlated with stem diameter, wall thickness, and the number of vascular bundles. Xiao et al. found that the diameter of the basal internodes of wheat is positively correlated with stem strength from the latex stage to maturity. Numerous other studies on rice stem diameter have shown that increasing rice stem diameter not only improves lodging resistance but also increases rice yield. These results provide important support for increasing crop yields.

[0004] Studies have shown that biochemical components of plant stems, such as cellulose, hemicellulose, and lignin, are associated with stem strength and diameter. Wheat varieties with significantly reduced stem strength exhibited lower lignin and hemicellulose content. Rashid measured the cellulose, hemicellulose, and lignin content in 410 rice accessions and found that cellulose was significantly correlated with stem diameter and strength. By constructing tomato overexpression and RNA interference (RNAi) lines, he found that overexpression plants had significantly increased stem diameter compared to controls, with significant increases in cell size and cell layer number. RNAi plants exhibited significantly decreased stem diameter, with a decrease in the number of cell layers in the xylem and secondary phloem. These results suggest that SD1 in tomato positively regulates node diameter development. Using whole-genome sequencing and association analysis in cabbage, Li Hongge identified 18 and 17 QTLs significantly associated with stem diameter and stem strength, respectively, and identified 19 and 18 candidate genes within these QTL loci. Several QTLs associated with rice stem diameter have been reported, including the loci SCM2 and SCM3 that regulate stem thickness. Wang Xintao et al. mapped six QTLs associated with maize stem diameter using a population of recombinant inbred lines. Transcription factors coordinately regulate plant cell wall synthesis by participating in the synthesis of different cell wall components and the interactions between different macromolecules, thereby regulating stem development.

[0005] Pepper (Capsicum annuum L.) is an important vegetable crop in my country. However, with the rapid development of the pepper industry, pepper growth and development face many challenges. The diameter of internodes decreases during cultivation, seriously affecting yield and quality. However, little research has been conducted on internode diameter in pepper stems.

[0006] Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a pepper CaCE gene and its protein and their application in cultivating plant varieties with high stem strength, high cellulose and hemicellulose content.

[0008] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0009] A pepper CaCE gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0010] A pepper CaCE protein, whose amino acid sequence is shown in SEQ ID NO: 2.

[0011] A recombinant vector comprises the pepper CaCE gene.

[0012] A transformant comprises the recombinant vector.

[0013] Based on a general inventive concept, the present invention also provides an application of silencing / deleting pepper CaCE gene or CaCE protein in cultivating new plant varieties with high stem strength, high cellulose and / or hemicellulose content.

[0014] In the above application, preferably, the plant is pepper.

[0015] More preferably, the application method comprises the following steps:

[0016] (1) Vector construction: PCR amplification was performed using pepper cDNA as a template. The PCR product was recovered and the purified DNA fragment was constructed into a linearized vector. The vector was then transformed into competent Escherichia coli DH5α cells and plated on LB medium containing kanamycin antibiotics. Positive clones were picked for plasmid extraction to obtain a silencing vector containing the CaCE gene.

[0017] (2) Transformation of Agrobacterium: The silencing vector containing the CaCE gene was transferred into Agrobacterium competent cells GV3101, and cultured on LB plates containing kan and rif antibiotics to obtain Agrobacterium culture liquid;

[0018] (3) Infection: Cultivate pepper plants for seedlings. When the two cotyledons are fully expanded and the true leaves have not yet grown, inoculate the pepper cotyledons with Agrobacterium using a needle-free infiltration method. After inoculation, cultivate the pepper plants to obtain pepper plants with silenced / deficient pepper CaCE genes, that is, obtain a new pepper variety with high stem strength, high cellulose and high hemicellulose.

[0019] More preferably, in step (1), the nucleotide sequences of the specific primers VIGS-CaCE F and VIGS-CaCE R used in the PCR amplification are shown as SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention discovered the CaCE gene and its encoded protein in pepper for the first time. By silencing / deleting the CaCE gene in pepper plants, the present invention obtained silenced plants with significantly increased stem strength, increased cellulose and hemicellulose content, and no significant change in lignin content, indicating that the CaCE gene can control stem development by affecting the composition of the stem cell wall, and can further cultivate lodging-resistant pepper varieties with high stem strength, high cellulose and hemicellulose content. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 is a cloning electrophoresis diagram of the CaCE gene (lane 1 is DL2000Marker; lane 2 is the CaCE gene; lane 3 is CK);

[0024] FIG2 is the cDNA sequence of the CaCE gene and the amino acid sequence it encodes;

[0025] FIG3 is a multiple sequence alignment of CaCE protein with other plant CE proteins;

[0026] Figure 4 is a hydrophobicity analysis of CaCE protein;

[0027] Figure 5 is the prediction and analysis of the secondary structure of the CaCE protein;

[0028] Figure 6 is the prediction and analysis of the tertiary structure of the CaCE protein;

[0029] Figure 7 is the predicted transmembrane domain structure of the CaCE protein;

[0030] Figure 8 is the prediction of the CaCE protein signal peptide;

[0031] FIG9 is a phylogenetic tree of CaCE proteins;

[0032] Figure 10 shows the expression levels of the CaCE gene in different parts of the body;

[0033] FIG11 is a specific sequence of CaCE silencing (230 bp yellow font region);

[0034] Figure 12 shows the relative expression levels of the CaCE gene in VIGS plants;

[0035] Figure 13 is a diagram of the stem strength measurement;

[0036] Figure 14 is the VIGS plant stem component analysis. DETAILED DESCRIPTION

[0037] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0038] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0039] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0040] Example 1:

[0041] The present invention used EMS-induced mutagenesis of the pepper stem parent 6421 to obtain the creeping stem mutant sp1 (stemprostrate1). Transcriptome analysis of 6421 and the sp1 mutant revealed a significantly differentially expressed gene, "carbohydrate esterase At4g34215." Therefore, the present invention conducted bioinformatics analysis of this gene and utilized virus-induced gene silencing (VIGS) to investigate its role in pepper stems.

[0042] The present invention discloses a pepper CaCE gene, the nucleotide sequence of which is shown in SEQ ID NO: 1; the amino acid sequence of the CaCE protein encoded by the CaCE gene is shown in SEQ ID NO: 2. The present invention uses pepper wild-type "6421" as the experimental material. Total RNA was extracted from different tissues (roots, stems, leaves, flowers, fruits, and anthers) of the plant material, and the expression level of CaCE was measured using qRT-PCR after cDNA reversal for expression analysis.

[0043] 1. Test methods

[0044] 1.1 CaCE gene cloning

[0045] Using the CaCE sequence from the Zunla 2.0 genome as a reference, specific primers were designed using Premier 5, and gene amplification was performed using DNA polymerase from Acridine Biotechnology. Using reverse-transcribed cDNA as a template, the CaCE gene was cloned by PCR. The primers for gene cloning are (5′→3′):

[0046] F: ATGCTCCCTCACTTGTTGCTA (as shown in SEQ ID NO: 3);

[0047] R: CTAATTGCGAAGGAAGGCATC (as shown in SEQ ID NO: 4).

[0048] The PCR reaction program was as follows: 94°C for 1 min, 98°C for 10 s, 60°C for 15 s, 68°C for 1.5 min, 35 cycles, and 4°C for 5 min.

[0049] 1.2 Bioinformatics analysis of CaCE genes

[0050] The amino acid sequence was aligned and analyzed using the sequence analysis software DNAMAN and BioEdit. The physicochemical properties of the CaCE protein were analyzed using the online website Prot-Param (https: / / web.expasy.org / protparam / ). The signal peptide was predicted using SignalP (http: / / www.cbs.dtu.dk / services / SignalP / ). The conserved domain of the protein was predicted using NCBI's BlastP. The secondary structure of the protein was predicted using SOPM (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html). SWISS-MODEL (http: / / swissmodel.expasy.org / ) was used to predict the tertiary structure of the CaCE protein and the function of the protein encoded by the CaCE gene. WoLF-PSORT (https: / / www.genscript.com / wolf-psort.html) was used to predict the subcellular localization. ProtScale (https: / / web.expasy.org / protscale / ) was used for hydrophobicity analysis. TMpred (https: / / embnet.vital-it.ch / software / TMPRED_form.html) was used to predict the protein transmembrane domain. The Neighbor-Joining (NJ) method of MEGA 6 software was used to construct a phylogenetic tree, and the constructed phylogenetic tree was evaluated using the Bootstrap method (repeated 1000 times).

[0051] 1.3 CaCE gene expression analysis

[0052] Design quantitative PCR primers (5′→3′) online at NCBI (Primer designing tool (nih.gov)):

[0053] qCaCE-F: TCAGGAAAGCACAGCGAGAG (as shown in SEQ ID NO: 5);

[0054] qCaCE-R: TCAGCGAGCATCTGTCCAAG (shown in SEQ ID NO: 6).

[0055] RNA was extracted using the Steady Pure Plant RNA Extraction Kit (Akura Biosciences) and reverse transcribed into cDNA using the Prime Script RT Master Mix (cat. No. RR036A, TaKaRa). Quantitative PCR was performed using the Touch Fluorescent Quantitative PCR Detection System (Bio-Rad).

[0056] The PCR reaction system consisted of 10 μL of PCR product, 0.1 μL of template, 0.4 μL of forward and reverse primers, and 5 μL of 2×SYBR Green PCR Master Mix, supplemented to 10 μL with ddH₂O. The amplification protocol was as follows: total denaturation at 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. The pepper actin gene was used as the internal reference gene. The relative expression of the CaCE gene in different tissues was analyzed. The primer pairs corresponding to the internal reference genes are as follows:

[0057] Actin-F: CCACCTCTTCACTCTCTGCTCT (as shown in SEQ ID NO: 7);

[0058] Actin-R: ACTAGGAAAAACAGCCCTTGGT (shown as SEQ ID NO: 8).

[0059] 1.4 CaCE virus-induced gene silencing (VIGS)

[0060] (1) Vector construction

[0061] The VIGS vectors pTRV1, pTRV2, and pTRV2:PDS are all maintained in our laboratory. We used an online tool (vigs.solgenomics.net) to identify regions suitable for VIGS vector construction. We then designed primers based on the restriction sites within the pTRV2 vector's multiple cloning site. The specific primers amplified the sequences shown below:

[0062] VIGS-CaCE F: ctgtgagtaaggttaccgaattc GCAGAGCAACATTTCAGGCC (as shown in SEQ ID NO: 9);

[0063] VIGS-CaCE R: cgcgtgagctcggtaccggatccTCAGTAATACTGGTTCCTCCAAC (lower case letters represent homology arms of the pTRV2 vector) (as shown in SEQ ID NO: 10).

[0064] PCR was performed using the cDNA of wild-type "6421" pepper as a template. The PCR reaction system is shown in Table 1 below, and cDNA was used for amplification;

[0065] Table 1: PCR reaction system

[0066] The amplification program was as follows: 94°C for 1 min, 98°C for 10 s, 60°C for 15 s, 72°C for 2 s, 35 cycles, and 4°C for 5 min.

[0067] After amplification, a 230-bp PCR product was obtained. The PCR product was recovered using a DNA gel recovery kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., and the purified fragment was constructed into the linearized pTRV2 vector. The purified target fragment and the linearized vector were ligated using a single-step recombination kit (Vazyme) using homologous recombination. The constructed vectors were transformed into competent Escherichia coli DH5α cells and plated on LB culture medium containing kanamycin antibiotics. After 14 to 16 hours, 5-6 single clones were selected for PCR identification. After verification, the bacterial solution containing the target band was sequenced and aligned with the designed vector primer sequence for confirmation. Plasmid extraction was then performed to obtain the silencing vector (pTRV2-CaCE) containing the CaCE gene.

[0068] (2) Transformation of Agrobacterium

[0069] Remove 100 μL of GV3101 Agrobacterium competent cells from the -80°C freezer and place on ice. When the competent cells are in an ice-water mixture, add 10 μL of the pTRV2-CaCE plasmid extracted above. Mix well and place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Add 700 μL of LB liquid medium and culture at 28°C with shaking for 2 hours. Centrifuge at 4000 rpm for 5 minutes, remove 700 μL of supernatant, and resuspend the cells in 100 μL of liquid. Spread the bacterial solution on an LB plate containing kan and rif antibiotics and culture at 28°C for 32-48 hours. Pick out Agrobacterium that has grown a single colony for colony PCR detection. A positive result indicates that the expression vector has been successfully constructed.

[0070] (3) Infection

[0071] Use an artificial climate chamber to grow pepper seedlings. When the two cotyledons are fully expanded and the true leaves have not yet grown, they are used for inoculation. The specific steps are as follows:

[0072] ① The bacterial suspension containing pTRV1, pTRV2, pTRV2-PDS, and pTRV2-CaCE plasmids was cultured in LB medium containing three antibiotics (final concentrations of Kan 50 μg·mL-1, Rif 50 μg·mL-1, and Gen 50 μg·mL-1) at 28°C and 200 rpm shaking until OD600 = 1.0;

[0073] ② Dilute the culture medium into the induction medium at a ratio of 1:20 (final concentrations: Kan 50 μg·mL-1, Rif 50 μg·mL-1, Gen 50 μg·mL-1, 20 μM AS) at 28°C, 200 rpm until OD600 = 0.5-0.8;

[0074] ③ Take 20 mL of the culture product into a centrifuge tube and centrifuge at 5000g for 8 min. Discard the supernatant and add 10 mM MES solution (MES 1.066 g, MgCl2·6H2O 1.0165 g, ultrapure water to 500 mL, adjust the pH to 5.6) and a final concentration of 200 μM AS (NH4Cl2 g, MgSO4·7H2O 0.6 g, KCl 0.3 g, CaCl2 0.02 g, FeSO4·7H2O 0.005 g, ultrapure water 100 mL) to resuspend the cells and adjust the OD600 to 1.0;

[0075] ④ Prepare pTRV1, pTRV2, and pTRV2-PDS bacterial suspensions using the same method;

[0076] ⑤ Mix the pTRV1 strain with other strains at a ratio of 1:1, let it stand in the dark at 28°C for 4-6 hours, and then inoculate;

[0077] ⑥ The upright wild-type pepper strain was infected. The pepper cotyledons (dehydrated 2 days before inoculation) were inoculated by needle-free infiltration method. After inoculation, the cotyledons were cultured in an artificial climate box at 18℃ in the dark for 3 days, and then the temperature was adjusted to 22℃ / 18℃ during the day and night, and the light intensity was 375μmol·(m -2 ·s -1 )(16h / 8h), and cultured under the conditions of relative humidity of 60%.

[0078] (4) Phenotypic observation

[0079] After 4-5 weeks of silencing, phenotypes begin to appear and the plant phenotypes are observed.

[0080] (5) Analysis of CaCE expression levels in silenced plants

[0081] RNA was extracted from the silenced plants TRV2-CaCE and the control plants TRV2 and reverse transcribed into cDNA, and then qRT-PCR analysis was performed. The qRT-PCR reaction system is shown in Table 2, and the qRT-PCR primers are as follows:

[0082] Forward primer: GCGGAAAGATAAGGGCGTTG (as shown in SEQ ID NO: 11);

[0083] Reverse primer: TCTCTCGCTGTGCTTTCCTG (as shown in SEQ ID NO: 12);

[0084] Table 2: qRT-PCR reaction system

[0085] (6) Stem index determination

[0086] Using a hardness measuring instrument, the first internode of the stem was uniformly cut, and the cutting force when the stem was cut 70% was used as the hardness index of the stem. The cellulose, hemicellulose and lignin contents in the stem tissue were then measured.

[0087] 2. Results Analysis

[0088] 2.1 Bioinformatics analysis of CaCE genes

[0089] The CaCE gene was cloned by PCR amplification using cDNA from the wild-type pepper "6421" as a template, as shown in Figure 1. The gene is 810 bp long (nucleotide sequence shown in SEQ ID NO: 1) and encodes a protein sequence consisting of 269 amino acid residues (amino acid sequence shown in SEQ ID NO: 2), as shown in Figure 2.

[0090] To understand the similarity of the CaCE amino sequence with that of other species, DNAMAN 8.0 software was used to perform homology analysis between the CaCE protein and CaCE proteins from potato, eggplant, tomato, tobacco, tomato, Pinus sylvestris, tea, coffee, and Arabidopsis thaliana. As shown in Figure 3, the protein identity is 67.03%.

[0091] To understand the hydrophilicity / hydrophobicity of the CaCE protein, we used ProtScale online software to generate a hydrophilicity / hydrophobicity prediction plot for the amino acid sequence (Figure 4). The results showed that the average hydrophilicity coefficient of the CaCE protein was the lowest (-2.056) at position 171, indicating the highest hydrophilicity; the highest (2.578) at position 125, indicating the highest hydrophobicity. The presence of more hydrophilic amino acids (negative values) than hydrophobic amino acids (positive values) suggests that the protein encoded by the amino acid sequence of the CaCE gene is hydrophilic.

[0092] To understand its secondary structure, we used SOPM online software to predict and analyze the protein's secondary structure. The results showed that the CaCE protein's secondary structure is primarily composed of 25.65% alpha helix, 14.5% beta sheet, 27.51% extended strand, and 32.34% random coil (Figure 5).

[0093] To understand the protein's tertiary structure, the online software SWISS-MODEL was used to generate a predicted tertiary structure (Figure 6). The CaCE protein's polypeptide chain further coils or folds within various secondary structures to form a regular three-dimensional structure. The protein structure was constructed using a structure with PDB number A0A1U7YK00.1.A as a template. The sequence identity is 86.47%, and the GMQE (Global Model Quality Estimate) value is 0.92.

[0094] To determine whether the protein contains a transmembrane domain, we used the TMHMMServer v.2.0 online tool to predict the transmembrane domain of the CaCE protein by inputting the amino acid sequence. The results (Figure 7) show that the predicted transmembrane domain map lacks a peak, confirming that the CaCE protein lacks a transmembrane domain and is likely non-transmembrane, primarily located in the extramembrane region. In summary, based on the signal peptide and transmembrane domain analyses, we infer that the protein is neither a secreted protein nor a membrane protein.

[0095] To determine the presence of a signal peptide, we used the online software SignaIP-5.0 to predict the signal peptide of the protein encoded by the CaCE gene. The results are shown in Figure 8. The probability of a signal peptide is 99.56%, indicating that the CaCE protein contains a signal peptide region. The online software WoLF PSORT was used to predict the subcellular localization of CaCE, indicating that CaCE is most likely localized to the cell membrane.

[0096] To understand which species this protein is closely related to during evolution, a Blastp comparison search was performed on the NCBI website using the full-length CaCE protein sequence. A phylogenetic tree of CaCE and different plant protein sequences was constructed. The results showed that the CaCE protein had the highest homology with the CE proteins of eggplant, potato, and tomato, as shown in Figure 9.

[0097] RT-qPCR was used to detect the expression levels of the CaCE gene in different parts. The expression levels of the gene in different parts were significantly different. As shown in Figure 10, the expression level of the gene was the highest in the stem.

[0098] 3. CaCE gene silencing analysis

[0099] To verify the gene's function, the present inventors further utilized virus-induced gene silencing (VIGS). Based on the cDNA sequence of the CaCE gene, the CaCE-specific sequence was identified in NCBI (Figure 11). Primers were designed based on this sequence to amplify a 300-bp fragment of the cDNA. This sequence was then silenced in peppers. Wild-type upright pepper lines were infected, and phenotypes were analyzed after 4-5 weeks of silencing before the phenotype began to appear.

[0100] Further qRT-PCR analysis showed that the expression level of this gene was decreased in the wild type ( FIG12 ).

[0101] To further understand the effects of CaCE gene silencing on stem development, we measured stem strength in silenced plants (Figure 13). We also measured the lignin, cellulose, and hemicellulose contents of TRV2 and TRV2-CaCE, as well as stem puncture strength (Figure 14). The results showed that compared with the control, stem strength in silenced plants was significantly increased. Cellulose and hemicellulose contents increased in silenced plants, while lignin content remained unchanged. Cellulose and hemicellulose increased by 33.3% and 29.2%, respectively, relative to the control. This suggests that CaCE controls stem development by affecting stem cell wall composition.

[0102] The above results indicate that the CaCE gene can control stem development by affecting the composition of stem cell walls, and that lodging-resistant pepper varieties with high stem strength, high cellulose and hemicellulose content can be cultivated by silencing / deleting the CaCE gene in pepper plants.

Claims

1. A pepper CaCE gene, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. A pepper CaCE protein, characterized in that Its amino acid sequence is shown in SEQ ID NO:

2.

3. A recombinant vector, characterized in that: Comprising the pepper CaCE gene as described in claim 1.

4. A transformant, characterized in that Comprising the recombinant vector as described in claim 3.

5. Use of silencing / deleting the pepper CaCE gene as claimed in claim 1 or the pepper CaCE protein as claimed in claim 2 in cultivating new plant varieties with high stem strength, high cellulose and / or high hemicellulose.

6. The use according to claim 5, characterized in that: The plant is pepper.

7. The use according to claim 6, characterized in that: The application method comprises the following steps: (1) Vector construction: PCR amplification was performed using pepper cDNA as a template, and the PCR product was recovered. The purified DNA fragment was constructed into a linearized vector, which was then transferred into Escherichia coli competent cells DH5α and spread on LB culture containing kanamycin antibiotics. Positive clones were selected for plasmid extraction to obtain a silencing vector containing the CaCE gene; (2) Transforming Agrobacterium: The silencing vector containing the CaCE gene is transferred into Agrobacterium competent cells GV3101, and cultured on an LB plate containing kan and rif antibiotics to obtain an Agrobacterium bacterial liquid; (3) Infection: Cultivate pepper plants for seedling raising, and when the two cotyledons are fully expanded and the true leaves have not yet grown, inoculate the pepper cotyledons with Agrobacterium using a needle-free infiltration method, and then culture them to obtain pepper plants with silenced / deficient pepper CaCE gene, that is, obtain a new pepper variety with high stem strength, high cellulose and high hemicellulose.

8. The use according to claim 7, characterized in that: In step (1), the nucleotide sequences of the specific primers VIGS-CaCE F and VIGS-CaCE R used in the PCR amplification are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

Images