Composite engineered bacteria and method for producing d-allulose

Abstract

The present application belongs to the technical field of bioengineering and relates to a composite engineered bacteria and a method for producing D-allulose. D-allulose 3-epimerase and glucose isomerase of a specific origin are each used for bacillus subtilis expression, then fermentation is carried out to obtain an enzyme combination comprising glucose isomerase and D-allulose 3-epimerase, said enzyme combination is used to catalyze a substrate glucose to undergo isomerization, and lastly D-allulose is prepared. The present method is able to clearly increase the conversion rate of D-allulose and greatly shortens the time needed to convert glucose into D-allulose; also, the present method uses inexpensive glucose as a raw material, thus greatly reducing the production costs of D-allulose; and glucose-fructose syrup can be synchronously produced, thus eliminating the investment on a glucose-fructose syrup production line, and greatly improving economic benefits.

Description

Composite engineered bacteria and method for producing D-psicose Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a composite engineering bacterium and a method for producing D-psicose. Background Art

[0002] D-allulose is a rare sugar with 70% of the sweetness of sucrose but very low in calories, making it a good substitute for sucrose. Furthermore, its absorption rate is lower than that of other sweeteners, which can reduce the body's absorption of fructose and glucose, lowering fat accumulation and thus lowering the risk of conditions such as type 2 diabetes and obesity. Studies have also shown that D-allulose can lower blood lipids and blood sugar. The U.S. Food and Drug Administration (FDA) has certified D-allulose as GRAS (Generally Recognized as Safe), allowing it to be used as a food additive. D-allulose has broad application prospects in food and health supplements. Technical issues

[0003] However, existing processes primarily use fructose as a raw material, resulting in high raw material costs. Although a few processes use glucose as a raw material, these processes have long production cycles, consume more manpower and material resources, and increase production costs, making them unsuitable for industrial production. In view of this, the present invention provides a composite engineered bacterium and a method for producing D-psicose. The present invention utilizes glucose isomerase and D-psicose 3-epimerase from a specific source to catalyze the isomerization reaction of glucose to produce D-psicose. This method can significantly increase the conversion rate of D-psicose, shorten the production time of D-psicose, and reduce production costs. Technical Solutions

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] A method for producing D-psicose, comprising:

[0006] 1) Genes encoding glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp. were transformed into Bacillus subtilis to obtain GI engineered bacteria and DPE engineered bacteria, respectively;

[0007] 2) mixing the GI engineered bacteria and the DPE engineered bacteria into a fermentation medium for fermentation, and breaking the bacteria to obtain a crude enzyme solution containing glucose isomerase and D-psicose 3-epimerase;

[0008] 3) using the crude enzyme solution as a catalyst to catalyze an isomerization reaction of glucose to obtain D-psicose.

[0009] In step 1) of the present invention, the amino acid sequence of the glucose isomerase is selected from any one of the following:

[0010] a) as shown in SEQ ID NO: 1;

[0011] b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 1 without changing the protein activity; or

[0012] c) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 1 and has the same or similar protein activity as the protein shown in SEQ ID NO: 1;

[0013] The amino acid sequence of the D-psicose 3-epimerase is selected from any one of the following:

[0014] A) as shown in SEQ ID NO: 2;

[0015] B) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 2 without changing the protein activity; or

[0016] C) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 2 and has the same or similar activity as the protein shown in SEQ ID NO: 2.

[0017] In step 1) of the present invention, the gene encoding glucose isomerase is optimized according to the codon preference of Bacillus subtilis, and the optimized nucleotide sequence is shown in SEQ ID NO: 3;

[0018] The gene encoding D-psicose 3-epimerase was optimized according to the codon preference of Bacillus subtilis, and the optimized nucleotide sequence is shown in SEQ ID NO: 4.

[0019] In the present invention, the glucose isomerase GI is derived from Thermus thermophilus, with accession number WP_244348257.1 and an amino acid sequence of SEQ ID NO: 1. The D-psicose 3-epimerase DPE is derived from Ruminococcus sp., with accession number MBS6425357.1 and an amino acid sequence of SEQ ID NO: 2.

[0020] After long-term research, the present invention found that enzyme combinations from different sources catalyze the conversion of the substrate glucose to psicose at different rates. Ultimately, an optimal combination was obtained, namely a combination of glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp., with a conversion rate significantly higher than other combinations. Specifically, the amino acid sequence of the glucose isomerase is SEQ ID NO: 1, and the amino acid sequence of the D-psicose 3-epimerase is SEQ ID NO: 2.

[0021] In step 2) of the present invention, the mixed fermentation is specifically cultured at 37° C. and 200 rpm for 48 hours.

[0022] In step 2) of the present invention, the fermentation medium is 10 g of peptone, 5 g of yeast powder, 2.5 g of potassium dihydrogen phosphate, 15 g of dipotassium hydrogen phosphate, 0.1 g of manganese chloride tetrahydrate, 0.1 g of magnesium sulfate heptahydrate, and 6 g of glucose, and water is added to make the volume to 1 L.

[0023] In step 2) of the present invention, the step of preparing the engineered bacteria into a seed solution before inoculating the engineered bacteria into a fermentation medium for mixed fermentation is further included: inoculating the engineered bacteria into an LB seed medium, culturing at 37° C. and 200 rpm overnight to obtain a seed solution.

[0024] In step 2) of the present invention, the disruption of the cells is performed by mixing lysozyme and fermentation broth at a mass-to-volume ratio of 0.1‰ (i.e., a final lysozyme concentration of 0.1 g / L), and reacting at 37°C and 200 rpm for 0.5-4 hours. In some specific embodiments, the disruption of the cells is performed at 37°C and 200 rpm for 1 hour.

[0025] In step 3) of the present invention, the temperature of the isomerization reaction is 60° C., and the time is 2 to 24 hours. In some specific embodiments, the temperature of the isomerization reaction is 60° C., and the time is 2 hours, 4 hours, 6 hours, 12 hours, or 24 hours.

[0026] After the isomerization reaction, the present invention further includes filtering, purifying, chromatographically separating, and concentrating the reaction products in sequence to obtain D-psicose and fructose, respectively. The filtration is performed sequentially using a ceramic membrane with a pore size of 8-10 nm and a nanofiltration membrane with a pore size of 100-300 Daltons. The purification includes first passing through a cationic resin and then through an anionic resin to remove cations and anions. In a specific embodiment, the cationic resin model is D001-FD and the anionic resin model is D354-FD.

[0027] The present invention also provides a composite engineered bacterium, comprising Bacillus subtilis expressing glucose isomerase from Thermus thermophilus and Bacillus subtilis expressing D-psicose 3-epimerase from Ruminococcus sp. In some specific embodiments, the Bacillus subtilis is Bacillus subtilis WB600.

[0028] The method for constructing the composite engineered bacteria of the present invention is as follows:

[0029] 1) The glucose isomerase protein sequence from Thermus thermophilus (GI, SEQ ID NO:1) and the D-psicose 3-epimerase protein sequence from Ruminococccus sp. (DPE, SEQ ID NO:2) were selected and their encoding genes were codon-optimized and fully synthesized by GenScript Biotech. The optimized GI gene sequence is SEQ ID NO:3, and the optimized DPE gene sequence is SEQ ID NO:4. These genes were then ligated into the pWB980 vector via homologous recombination to generate the recombinant plasmids pWB980 GI and pWB980 DPE. The SacB signal peptide gene fragment on the plasmids was removed during recombination, and the GI and DPE genes were constitutively expressed in cells under the control of the p43 promoter.

[0030] 2) The recombinant plasmids pWB980 GI and pWB980 DPE were transformed into Bacillus subtilis WB600 to obtain recombinant Bacillus subtilis WB600 / GI and WB600 / DPE, respectively.

[0031] The present invention also provides the use of the composite engineered bacteria in producing D-psicose, or in preparing blood sugar and lipid-lowering products.

[0032] In a specific embodiment of the present invention, the method for preparing D-psicose comprises:

[0033] (1) The two engineered bacteria (WB600 / GI and WB600 / DPE) were inoculated into LB seed medium respectively, and cultured overnight at 37°C and 200 rpm for enrichment to obtain seed liquid with an OD600 value of 3-6;

[0034] (2) The seed liquid of the two recombinant bacterial strains obtained in step (1) was added to the same fermentation medium at a ratio of 0.1% (v / v) for mixed fermentation at a temperature of 37°C and 200 rpm for 48 h to obtain a fermentation liquid.

[0035] (3) Add lysozyme at 0.1‰ (w / v) to the fermentation broth obtained in step (2) and react at 37°C and 200 rpm for 1 h to break the bacteria and release the intracellular enzyme to obtain a crude enzyme solution.

[0036] (4) Glucose was added to the crude enzyme solution obtained in step (3) at a final concentration of 600 g / L, and the mixture was reacted at 60°C for 24 h to obtain invert syrup.

[0037] (5) The invert sugar syrup obtained in step (4) was filtered through a ceramic membrane with a pore size of 8-10 nm to remove impurities at a flux of 50 L / ㎡ / h to obtain a permeate.

[0038] (6) The permeate obtained in step (5) was filtered through a nanofiltration membrane with a molecular weight cutoff of 100-300 Daltons to remove impurities and decolorize at a flux of 10 L / ㎡ / h to obtain a permeate.

[0039] (7) The permeate obtained in step (6) is first passed through a cationic resin and then through an anionic resin to remove cations and anions; the cationic resin model is D001-FD and the anionic resin model is D354-FD; and a desalted sugar solution is obtained.

[0040] (8) The desalted sugar solution from step (7) is then subjected to chromatographic separation to obtain solution AD, which is a psicose solution, and solution BD, which is a mixed sugar solution of glucose and fructose. During the chromatographic separation process, the sugar solution concentration is controlled at 15-25%, the temperature is 50-60°C, the pressure is 0.2-0.3 MPa, the water-to-material mass ratio is 1:2, and the processing capacity is 2.2 kg / kg / d.

[0041] (9) The AD solution and BD solution obtained in step (8) are concentrated to a solid content of 75% to obtain D-psicose syrup and fructose syrup. Beneficial effects

[0042] The present invention expresses glucose isomerase and D-psicose 3-epimerase from a specific source in Bacillus subtilis, obtains a combined enzyme comprising glucose isomerase and D-psicose 3-epimerase through fermentation, and utilizes the combined enzyme to catalyze the isomerization reaction of the substrate glucose to ultimately produce D-psicose. The method provided by the present invention can significantly increase the conversion rate of D-psicose and greatly shorten the time it takes to convert glucose into D-psicose. At the same time, the present invention uses cheap glucose as a raw material, greatly reducing the production cost of D-psicose. The present invention can simultaneously produce high fructose syrup, saving the investment in a set of high fructose syrup production lines and greatly improving economic benefits. Compared with the prior art, the present invention has the following beneficial effects:

[0043] (1) The present invention utilizes enzymes from specific sources to catalyze the conversion of glucose into D-psicose in a relatively short period of time, which significantly shortens the production time, greatly improves the economic benefits, and is conducive to industrial production.

[0044] (2) The present invention uses cheap raw material glucose as a substrate, which greatly reduces the production cost of D-psicose.

[0045] (3) The present invention can produce both D-psicose and fructose syrup simultaneously, thereby saving the investment in a set of fructose syrup production lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 is a map of recombinant plasmids pWB980 GI and pWB980 DPE;

[0047] Figure 2 is an SDS-PAGE electrophoresis image, in which lanes 1 to 4 represent: 1: WB600 / pWB980, 2: WB600 / pWB980-GI, 3: WB600 / pWB980-DPE, 4: WB600 / pWB980-GI + WB600 / pWB980-DPE;

[0048] Figures 3 to 5 are liquid phase detection spectra. Modes for Carrying Out the Invention

[0049] The present invention provides a composite engineered bacteria and a method for producing D-psicose. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately alter and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0050] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0051] The present invention will be further described below in conjunction with the embodiments:

[0052] Example 1 Construction and Functional Verification of Glucose Isomerase (GI) Engineering Bacteria of the Present Invention

[0053] 1) The glucose isomerase protein sequence from Thermus thermophilus (GI, SEQ ID NO: 1) was selected and its encoding gene was optimized using the Bacillus subtilis codon. The optimized GI gene sequence is SEQ ID NO: 3 and was fully synthesized by GenScript Biotech. The synthesized gene was ligated into the pUC57 vector, designated pUC57-GI.

[0054] 2) Using the synthesized recombinant plasmid pUC57-GI as a template and primers GI-F and GI-R, PCR amplification was performed and the GI fragment was obtained by gel recovery and purification.

[0055] 3) Using plasmid vector pWB980 as a template and primers pWB980-F1 and pWB980-R1, PCR amplification was performed, and the linearized gene fragment P1 with the SacB signal peptide removed was obtained by gel recovery and purification.

[0056] 4) Ligate the GI fragment and the linearized pWB980 gene fragment P1 according to the homologous recombination kit instructions. Electroporate the ligation product into Bacillus subtilis WB600 competent cells to obtain a recombinant Bacillus subtilis strain named WB600 / GI and a recombinant plasmid named pWB980-GI (plasmid map shown in Figure 1). Verify the correctness of the transformant by colony PCR and sequencing (primer sequences are shown in Table 1).

[0057] Table 1 Primer sequences of the present invention

[0058] Primer name Primer sequence 5'-3' GI-FATAAAAAAGGAGACATGAACGATGTATGAACCAAAACCCGAGI-RTCTTGGAATTGTGCTGAAGCTTTAACCACGCACCCCTAACAGATA pWB980-F1AGCTTCAGCACAATTCCAAGA pWB980-R1CGTTCATGTCTCCTTTTTTATGTACTGDPE-FATAAAAAAGGAGACATGAACGATGAAATATGGTATTTATTACGCTTATTGGGDPE -RTCTTGGAATTGTGCTGAAGCTTAGACTTTCAAATACATGTTTTACAAAGTGpWB980-F2AGCTTCAGCACAATTCCAAGApWB980-R2CGTTCATGTCTCCTTTTTTATGTAC TGGI-JD-FACAGCCATTGAACATACGGTGI-JD-RCCTTGGTAACCGCTAGACTDPE-JD-FACAGCCATTGAACATACGGTDPE-JD-RTTCCATGCCCATCATAATATCATATT

[0059] 5) Pick a positive transformant from the kanamycin-containing LB medium plate and inoculate it into 5 ml of LB liquid medium containing 50 mg / L kanamycin. Incubate overnight at 37°C, 200 rpm. Then, inoculate a 0.1% inoculum into at least 1 L of fermentation medium containing 50 mg / L kanamycin. Incubate at 37°C, 200 rpm, for 48 hours. Add lysozyme powder at a rate of 0.1‰ and continue the reaction at 37°C, 200 rpm, for 1 hour to obtain a crude GI enzyme solution (SDS-PAGE results are shown in Figure 2).

[0060] 6) Add glucose to the crude enzyme solution obtained above to a final concentration of 600 g / L and react at 60°C for 24 h. Take 0.02 ml of the reaction solution, dilute it 50-fold with pure water, incubate it in a 100°C water bath for 10 min to inactivate the enzyme, centrifuge it at 10,000 rpm for 10 min, filter it through a 0.22 μm microporous filter, and analyze the filtrate by HPLC.

[0061] Bacillus subtilis WB600 carrying the empty plasmid pWB980 was used as a blank control, and other operating conditions were the same.

[0062] High-performance liquid chromatography (HPLC) was performed using the following conditions: Agilent 1200 HPLC; Waters Sugar Pak I analytical column; mobile phase: pure water; flow rate: 0.3 ml / min; column temperature: 80°C; detector: differential refractive index detector. The samples were analyzed using pure glucose, fructose, and D-psicose produced by Sigma as standards, with an injection volume of 10 μl.

[0063] Liquid chromatography analysis results showed that the peak times of glucose, fructose and D-psicose were 14.1 min, 17.9 min and 26.9 min, respectively.

[0064] The liquid phase spectrum of the blank control (Bacillus subtilis WB600 / pWB980) contained only glucose; the liquid phase spectrum of the experimental group (Bacillus subtilis WB600 / pWB980-GI) showed both glucose and fructose (the liquid phase spectrum is shown in Figure 3). These results demonstrate that the crude GI enzyme solution prepared by the above method can convert glucose into fructose. Peak area calculations indicate that the converted sugar solution contains 330 g / L of glucose and 270 g / L of fructose, with a ratio of 55:45.

[0065] Example 2 Construction and Functional Verification of an Engineering Bacterium Expressing D-Psicose 3-Epimerase (DPE)

[0066] 1) D-psicose 3-epimerase (DPE, SEQ ID NO: 2) from Ruminococcus sp. was selected. The gene encoding it was codon-optimized using Bacillus subtilis. The optimized DPE gene sequence is SEQ ID NO: 4. The gene was fully synthesized by GenScript Biotech and ligated into the pUC57 vector, designated pUC57-DPE.

[0067] 2) The coding gene was codon-optimized and fully synthesized by GenScript Biotech. The synthesized gene was then ligated into the pUC57 vector and named pUC57-DPE.

[0068] 3) Using the synthesized recombinant plasmid pUC57-DPE as a template and primers DPE-F and DPE-R, PCR amplification was performed and the DPE fragment was obtained by gel recovery and purification.

[0069] 4) Using plasmid vector pWB980 as a template and primers pWB980-F2 and pWB980-R2, PCR amplification was performed. The linearized gene fragment P2 with the SacB signal peptide removed was obtained by gel purification.

[0070] 5) Ligate the DPE fragment and the linearized pWB980 gene fragment P2 according to the homologous recombination kit instructions. Electroporate the ligation product into Bacillus subtilis WB600 competent cells to obtain recombinant Bacillus subtilis, named WB600 / DPE, and the recombinant plasmid pWB980-DPE (plasmid map shown in Figure 1). Verify the correctness of the transformant by colony PCR and sequencing (primer sequences are shown in Table 1).

[0071] 6) Select positive transformants from the above colonies, confirming PCR and sequencing results, and inoculate them into 5 ml of LB liquid medium containing 50 mg / L kanamycin. Incubate at 37°C, 200 rpm, and culture overnight. A 0.1% inoculum volume should be added to at least 1 L of fermentation medium containing 50 mg / L kanamycin. Incubate at 37°C, 200 rpm, and culture for 48 hours. Add lysozyme at a rate of 0.1‰ and continue the reaction at 37°C, 200 rpm, for 1 hour to obtain a crude DPE enzyme solution (SDS-PAGE results are shown in Figure 2).

[0072] 7) Add fructose to the crude enzyme solution obtained above to a final concentration of 600 g / L and react at 60°C for 24 h. Take 0.02 ml of the reaction solution, dilute it 50-fold with pure water, incubate it in a 100°C water bath for 10 min to inactivate the enzyme, centrifuge it at 10,000 rpm for 10 min, filter it through a 0.22 μm microporous filter, and analyze the filtrate by HPLC.

[0073] Bacillus subtilis WB600 carrying the empty plasmid pWB980 was used as a blank control, and other operating conditions were the same.

[0074] High-performance liquid chromatography (HPLC) was performed using the following conditions: Agilent 1200 HPLC instrument; Waters Sugar Pak I analytical column; mobile phase: pure water; flow rate: 0.3 ml / min; column temperature: 80°C; detector: differential refractive index detector. The samples were analyzed using pure glucose, fructose, and D-psicose produced by Sigma as standards, with an injection volume of 10 μl.

[0075] Liquid chromatography analysis (see Figure 4) showed that the peak times of glucose, fructose, and D-psicose were 14.1 min, 17.9 min, and 26.9 min, respectively.

[0076] The liquid phase spectrum of the blank control (Bacillus subtilis WB600 / pWB980) showed only fructose; the liquid phase spectrum of the experimental group (Bacillus subtilis WB600 / pWB980-DPE) showed both fructose and D-psicose (the liquid phase spectrum is shown in Figure 5). These results demonstrate that the crude DPE enzyme solution prepared by the above method can convert fructose into D-psicose. Peak area calculations indicate that the converted sugar solution contains 426 g / L of fructose and 174 g / L of D-psicose, with a ratio of 71:29.

[0077] Example 3: Production of fructose syrup and D-psicose by mixed fermentation of GI engineered bacteria and DPE engineered bacteria

[0078] The specific steps are as follows:

[0079] (1) The two engineered bacteria described in Examples 1 and 2 were inoculated into LB seed culture medium, respectively, and cultured overnight at 37°C and 200 rpm for enrichment to obtain a seed solution with an OD600 value of 3-6;

[0080] (2) The seed liquid of the two recombinant bacterial strains obtained in step (1) was added to the same fermentation medium at a ratio of 0.1% (v / v) for mixed fermentation at a temperature of 37°C and 200 rpm for 48 h to obtain a fermentation liquid.

[0081] (3) Add lysozyme at 0.1‰ (w / v) to the fermentation broth obtained in step (2) and react at 37°C and 200 rpm for 1 h to break the bacteria and release the intracellular enzyme to obtain a crude enzyme solution.

[0082] (4) Glucose was added to the crude enzyme solution obtained in step (3) at a final concentration of 600 g / L, and the mixture was incubated at 60°C for 24 h to obtain invert syrup.

[0083] (5) The invert sugar syrup obtained in step (4) was filtered through a ceramic membrane with a pore size of 8-10 nm to remove impurities at a flux of 50 L / ㎡ / h to obtain a permeate.

[0084] (6) The permeate obtained in step (5) was filtered through a nanofiltration membrane with a molecular weight cutoff of 100-300 Daltons to remove impurities and decolorize at a flux of 10 L / ㎡ / h to obtain a permeate.

[0085] (7) The permeate obtained in step (6) is first passed through a cationic resin and then through an anionic resin to remove cations and anions; the cationic resin model is D001-FD and the anionic resin model is D354-FD; and a desalted sugar solution is obtained.

[0086] (8) The desalted sugar solution from step (7) is then subjected to chromatographic separation to obtain solution AD, which is a psicose solution, and solution BD, which is a mixed sugar solution of glucose and fructose. During the chromatographic separation process, the sugar solution concentration is controlled at 15-25%, the temperature is 50-60°C, the pressure is 0.2-0.3 MPa, the water-to-material mass ratio is 1:2, and the processing capacity is 2.2 kg / kg / d.

[0087] (9) The AD solution and BD solution obtained in step (8) are concentrated to a solid content of 75% to obtain D-psicose syrup and fructose syrup.

[0088] Comparative Example 1

[0089] Glucose isomerase (GI, nucleic acid sequence see SEQ ID NO: 1 in the record of CN113980880) and D-psicose 3-epimerase (DPE, nucleic acid sequence see SEQ ID NO: 3 in the record of CN113980880) were selected from the CN113980880 patent, and Bacillus subtilis engineered bacteria expressing glucose isomerase and Bacillus subtilis engineered bacteria expressing D-psicose 3-epimerase were constructed according to the methods of Examples 1 and 2 of the present invention, respectively. Then, invert syrup containing glucose, fructose and psicose was prepared according to the method of Example 3 of the present invention.

[0090] Comparative Example 2 (GI of different genus (56% homology with the GI of the present invention), same DPE)

[0091] Glucose isomerase (GI) from CN113980880 (nucleic acid sequence, see SEQ ID NO: 1 in CN113980880) was selected and an engineered Bacillus subtilis strain expressing GI was constructed according to the method of Example 1 of the present invention. Invert syrup containing glucose, fructose, and psicose was prepared using the method of Example 3 of the present invention using the constructed GI-expressing strain and the DPE-expressing strain constructed according to the present invention.

[0092] Comparative Example 3 (GI of different genus (97% homology to the GI of the present invention), same DPE)

[0093] Glucose isomerase (GI) from Thermus scotoductus (Accession No. WP_126200404.1) was selected and codon-optimized (GI nucleic acid sequence is SEQ ID NO: 5). An engineered Bacillus subtilis strain expressing GI was constructed according to the method of Example 1 of the present invention. The constructed GI-expressing strain and the DPE-expressing strain constructed according to the present invention were used to prepare an invert syrup containing glucose, fructose, and psicose according to the method of Example 3 of the present invention.

[0094] Comparative Example 4 (same GI, different DPE (40% homology with the DPE of the present invention))

[0095] D-psicose 3-epimerase (DPE, nucleic acid sequence see SEQ ID NO: 3 in CN113980880) was selected from patent CN113980880, and an engineered Bacillus subtilis strain expressing DPE was constructed according to the method of Example 2 of the present invention. Invert syrup containing glucose, fructose, and psicose was prepared using the constructed DPE-expressing strain and the GI-expressing strain constructed according to the present invention according to the method of Example 3 of the present invention.

[0096] Comparative Example 5 (same GI, different DPE (69% homology with the DPE of the present invention))

[0097] D-psicose 3-epimerase (DPE, WP_183684385.1) from Oribacterium sinus was selected and codon-optimized (nucleotide sequence: SEQ ID NO: 6). An engineered Bacillus subtilis strain expressing DPE was constructed according to the method of Example 2 of the present invention. The constructed DPE-expressing strain and the GI-expressing strain constructed according to the present invention were used to prepare an invert syrup containing glucose, fructose, and psicose according to the method of Example 3 of the present invention.

[0098] Test example

[0099] Invert syrup was prepared according to the methods of Example 3 and Comparative Examples 1-5. Samples were collected after 2, 4, 6, 12, and 24 hours of reaction time. The glucose, fructose, and psicose contents were determined by HPLC, and the psicose production rate was calculated. The results are shown in Table 2.

[0100] Table 2

[0101]

[0102] From the above results, it can be seen that although the efficiency of glucose production of psicose by the enzymes produced by comparative examples 1 to 5 and the engineered strain of the present invention is comparable, all between 15% and 18%, there are significant differences in the time required to reach equilibrium conversion rate, namely 6 hours, 6 hours, 12 hours, 4 hours, 12 hours, and 2 hours, respectively. Among them, the enzyme combination from the specific source of the present invention takes the shortest time, which is significantly lower than that of the other comparative examples; and the production rate of psicose is the highest, which is significantly higher than that of the other comparative examples. Therefore, it can be determined that the combination of glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp. provided by the present invention has the highest catalytic activity for glucose and is the optimal combination.

[0103] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for producing D-psicose, characterized in that: include: 1) Genes encoding glucose isomerase from Thermus thermophilus and D-psicose 3-epimerase from Ruminococcus sp. were respectively transferred into Bacillus subtilis to obtain GI engineered bacteria and DPE engineered bacteria; 2) mixing the GI engineered bacteria and the DPE engineered bacteria into a fermentation medium for fermentation, and breaking the bacteria to obtain a crude enzyme solution containing glucose isomerase and D-psicose 3-epimerase; 3) Using the crude enzyme solution as a catalyst to catalyze the isomerization reaction of glucose to obtain D-psicose.

2. The method according to claim 1, characterized in that In step 1), the amino acid sequence of the glucose isomerase is selected from any one of the following; a) as shown in SEQ ID NO:1; b) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 1 without changing the protein activity; or c) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 1 and has a protein activity that is the same or similar to the protein activity of the sequence shown in SEQ ID NO: 1; The amino acid sequence of the D-psicose 3-epimerase is selected from any one of the following: A) as shown in SEQ ID NO:2; B) an amino acid sequence obtained by replacing, deleting or adding one or more amino acids to the sequence shown in SEQ ID NO: 2 without changing the protein activity; or C) an amino acid sequence that is at least 90% homologous to the sequence shown in SEQ ID NO: 2 and has the same or similar protein activity as the sequence shown in SEQ ID NO:

2.

3. The method according to claim 2, characterized in that The gene encoding glucose isomerase is optimized according to the codon preference of Bacillus subtilis, and the optimized nucleotide sequence is shown in SEQ ID NO: 3; The gene encoding D-psicose 3-epimerase was optimized according to the codon preference of Bacillus subtilis, and the optimized nucleotide sequence is shown in SEQ ID NO:

4.

4. The method according to claim 1, characterized in that: The fermentation in step 2) is specifically cultured at 37° C. and 200 rpm for 48 hours.

5. The method according to claim 1, characterized in that In step 2), the fermentation medium includes water and the following components: 10 g / L peptone, 5 g / L yeast powder, 2.5 g / L potassium dihydrogen phosphate, 15 g / L dipotassium hydrogen phosphate, 0.1 g / L manganese chloride tetrahydrate, 0.1 g / L magnesium sulfate heptahydrate, and 6 g / L glucose.

6. The method according to claim 1, characterized in that In step 2), before the engineered bacteria are inoculated into the fermentation medium for mixed fermentation, the step of preparing the engineered bacteria into a seed solution is also included: the engineered bacteria are inoculated into the LB seed medium, cultured overnight at 37° C. and 200 rpm to obtain a seed solution.

7. The method according to claim 1, characterized in that In step 2), the breaking of the bacteria is specifically as follows: lysozyme and fermentation liquid are mixed at a mass volume ratio of 0.1‰, and reacted at 37°C and 200rpm for 1 hour.

8. The method according to claim 1, characterized in that In step 3), the temperature of the isomerization reaction is 60° C. and the time is 2 to 24 hours.

9. The method according to claim 1, characterized in that: In step 3), after the isomerization reaction, the reaction products are filtered, purified, chromatographed and concentrated in sequence to obtain D-psicose and fructose, respectively.

10. A composite engineering bacteria, characterized in that: These include Bacillus subtilis expressing glucose isomerase from Thermus thermophilus and Bacillus subtilis expressing D-psicose 3-epimerase from Ruminococcus sp.

11. Use of the composite engineered bacteria according to claim 10 in producing D-psicose, or in preparing blood sugar and lipid lowering products.

Images