Method for treatment of tumor by using recombinant oncolytic virus in combination with small-molecule anticancer drug

Abstract

The present application relates to the technical field of biomedicine, and in particular to a method for treatment of a tumor by using a recombinant oncolytic virus in combination with a small-molecule anticancer drug. Specifically, the method comprises the following steps: treating a tumor by using a recombinant oncolytic virus in combination with a small-molecule anticancer drug, wherein the small-molecule anticancer drug includes a small-molecule anticancer drug targeting ALK, a small-molecule anticancer drug targeting BTK, a small-molecule anticancer drug targeting EGFR, a small-molecule anticancer drug targeting FGFR, a small-molecule anticancer drug targeting HER2, a small-molecule anticancer drug targeting Parp, a small-molecule anticancer drug targeting PI3K, a small-molecule anticancer drug targeting VEGFR, a small-molecule anticancer drug targeting CDK4 / 6, and a small-molecule anticancer drug targeting KRAS; and the recombinant oncolytic virus comprises an M protein, a G protein, an N protein, a P protein, and an L protein after site-directed mutagenesis. According to the present application, the recombinant oncolytic virus and the small-molecule anticancer drug are used in combination to attack and kill tumor cells, thereby achieving the synergistic efficacy.

Description

Method for treating tumors by combining recombinant oncolytic virus and small molecule anticancer drug Technical Field

[0001] The present application relates to the technical field of biomedicine, and specifically to a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug. Background Art

[0002] Oncolytic viruses are a class of replication-competent, tumor-killing viruses that are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example by exploiting the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells. After infecting tumor cells, oncolytic viruses replicate massively within them and ultimately destroy them, killing them. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary for the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells.

[0003] Although oncolytic viruses have good application prospects in tumor immunotherapy, wild-type oncolytic viruses often cause damage and dysfunction of body tissues and organs. There is also a high risk of pathogenicity when using wild-type viruses to infect tumor cells. Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses. The attenuated oncolytic viruses can be used in clinical applications to reduce the pathogenicity risk of oncolytic viruses and improve their safety.

[0004] However, in the process of modifying oncolytic viruses, if only the wild-type oncolytic virus is randomly genetically modified, although its toxicity can be reduced, the modified oncolytic virus may have a poor cure rate, or even be unable to be packaged, which is not conducive to promoting the clinical application of oncolytic viruses.

[0005] With the development of modern molecular biology and the application of advanced technologies such as computer-aided drug design, structural biology, and combinatorial chemistry, small-molecule anticancer drugs have entered a period of rapid development. To date, the FDA (United States Food and Drug Administration) and the NMPA (National Medical Products Administration) have approved 89 small-molecule anticancer drugs for the treatment of various cancers. Thousands of targeted drugs are undergoing clinical trials for cancer treatment. Among them, a large number of promising drugs have entered Phase III trials. It is predicted that the global anticancer drug market will reach US$200 billion in 2021, with targeted drugs as the main force. Despite significant progress, small-molecule anticancer drugs still face several challenges.

[0006] The first major challenge is drug resistance. Almost all targeted anticancer drugs will encounter the problem of drug resistance after a period of clinical use. Drug resistance is related to many mechanisms, including gene mutation, amplification, cancer stem cells, efflux transporters, apoptosis dysregulation and autophagy. Gene mutation is the main cause of anti-tumor drug resistance. Low efficiency is another major challenge for targeted anticancer drugs. Targeted anticancer drugs are only effective in a limited number of patients. For example, less than 20% of patients with non-small cell lung cancer are sensitive to EGFR inhibitors such as gefitinib and erlotinib.

[0007] Summary of the Invention

[0008] In order to further improve the therapeutic effect of tumor cells, the present application provides a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug.

[0009] Oncolytic viruses are a type of tumor-killing virus with replication ability, and are currently accepted by the public as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by taking advantage of the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells; after infecting tumor cells, oncolytic viruses will replicate in large quantities within the tumor cells and eventually destroy the tumor cells, thereby killing the tumor cells. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and turn "cold tumors" into "hot tumors."

[0010] At the same time, although small molecule anticancer drugs have entered a rapid development stage, and thousands of targeted drugs are undergoing clinical trials for cancer treatment, despite significant progress, small molecule anticancer drugs still face challenges such as drug resistance and low efficiency. The treatment method of this application utilizes a recombinant oncolytic virus and a small molecule anticancer drug to attack and kill tumor cells, thereby achieving a 1+1 greater than 2 efficacy.

[0011] Furthermore, to enhance therapeutic efficacy, cytokines can be inserted and expressed in oncolytic viruses. The synergistic action of oncolytic viruses, cytokines, and small molecule anticancer drugs in these three anti-tumor mechanisms results in a more potent anti-tumor effect.

[0012] The present application provides a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug, which adopts the following technical solution

[0013] A method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug, wherein a small molecule anticancer drug and a recombinant oncolytic virus are used to treat tumors;

[0014] The small molecule anticancer drugs include small molecule anticancer drugs targeting ALK, small molecule anticancer drugs targeting BTK, small molecule anticancer drugs targeting EGFR, small molecule anticancer drugs targeting FGFR, small molecule anticancer drugs targeting HER2, small molecule anticancer drugs targeting Parp, small molecule anticancer drugs targeting PI3K, small molecule anticancer drugs targeting VEGFR, small molecule anticancer drugs targeting CDK4 / 6, and small molecule anticancer drugs targeting KRAS.

[0015] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0016] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, deletion of the 111th leucine coding base, V221F, V225I, and S226R. 25I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54 Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0017] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0018] Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.

[0019] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0020] Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

[0021] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype M protein comprises the amino acid sequence shown in SEQ ID NO 1.

[0022] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.

[0023] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 3.

[0024] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 4.

[0025] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 5.

[0026] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 6.

[0027] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 7.

[0028] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 8.

[0029] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 9.

[0030] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 10.

[0031] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 11.

[0032] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype G protein comprises the amino acid sequence shown in SEQ ID NO 12.

[0033] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 13.

[0034] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype N protein comprises the amino acid sequence shown in SEQ ID NO 14.

[0035] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 15.

[0036] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype P protein comprises the amino acid sequence shown in SEQ ID NO 16.

[0037] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 17.

[0038] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype L protein comprises the amino acid sequence shown in SEQ ID NO 18.

[0039] In a specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 19.

[0040] Preferably, the recombinant oncolytic virus comprises any one or more of rhabdovirus, poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus.

[0041] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on a rod-shaped virus.

[0042] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on Vesicular Stomatitis Virus (VSV).

[0043] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on the VSV Indiana Mudd Summer subtype.

[0044] Furthermore, the recombinant oncolytic virus also includes an antigen encoded by an exogenous gene.

[0045] Furthermore, the antigen is selected from solid tumor antigens or hematological tumor antigens.

[0046] Furthermore, the solid tumor antigens include but are not limited to 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, HER2, HER3, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), T RAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, ErbB3 (HER3), folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, MET (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (Myostatin) (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN),DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1 (NRP-1), glypican 2 / 3 (GPC2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, TPBG, CEA, EpCAM.

[0047] Furthermore, the blood tumor antigens include but are not limited to BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), CD70, CD117, CD123 (IL3RA), CD138 (SDC1), CD174, CLL-1, ROR1, NKG2DL1 / 2(ULBP1 / 2), IL1R3(IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1 , FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3(CD229), SLAMF7(CD319), TCRB-chain, ITGB7, k-1gG, TACI, TRBCI, LeY.

[0048] Furthermore, the antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, and MAGE-A10.

[0049] In a specific embodiment, the antigen CD19 comprises the amino acid sequence shown in SEQ ID NO 20.

[0050] In a specific embodiment, the antigen CD22 comprises the amino acid sequence shown in SEQ ID NO 21.

[0051] In a specific embodiment, the antigen NY-ESO-1 comprises the amino acid sequence shown in SEQ ID NO 22.

[0052] In a specific embodiment, the antigen MAGE A4 comprises the amino acid sequence shown in SEQ ID NO 23.

[0053] In a specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown in SEQ ID NO 24.

[0054] In a specific embodiment, the antigen EGFR comprises the amino acid sequence shown in SEQ ID NO 25.

[0055] In a specific embodiment, the antigen HER2 comprises the amino acid sequence shown in SEQ ID NO 26.

[0056] Furthermore, the small molecule anticancer drug is selected from any one or more of the following:

[0057] Small molecule anticancer drugs targeting ALK, including but not limited to Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, and Ensartinib.

[0058] Small molecule anticancer drugs targeting BTK, including but not limited to Acalabrutinib, Ibrutinib, Zanubrutinib, and Orelabrutinib.

[0059] Small molecule anticancer drugs targeting EGFR, including but not limited to Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Lapatinib, Mobocertinib, Osimertinib, Rybrevant, Befortinib, Razortinib, Dasatinib, Brigatinib, Vandetanib, Almonetinib, and Furmonertinib.

[0060] Small molecule anticancer drugs targeting FGFR, including but not limited to Erdafitinib, Infigratinib, Pemazyre, Pemigatinib, Lenvatinib, Pazopanib, Anlotinib, and Ponatinib.

[0061] Small molecule anticancer drugs targeting HER2, including but not limited to Neratinib, Pyrotinib, Tucatinib, and Mobocertinib.

[0062] Small molecule anticancer drugs targeting Parp, including but not limited to Avapritinib, Fluzoparib, Niraparib, Olaparib, and Rucaparib.

[0063] Small molecule anticancer drugs targeting PI3K, including but not limited to duvelisib and linperlisib.

[0064] Small molecule anticancer drugs targeting VEGFR, including but not limited to Apatinib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Donafenib, Surufatinib, and Fruquintinib.

[0065] Small molecule anticancer drugs targeting CDK4 / 6, including but not limited to Abemaciclib, Dalpiciclib, Palbociclib, and Ribociclib.

[0066] Small molecule anticancer drugs targeting KRAS, including but not limited to small molecule anticancer drugs targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H;

[0067] Small molecule anticancer drugs targeting KRAS G12C, including but not limited to Sotorasib and Adagrasib.

[0068] Small molecule anticancer drugs for the treatment of melanoma, including but not limited to Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib.

[0069] Small molecule anticancer drugs indicated for cell tumors or sarcomas, including but not limited to Pexidartinib, Tazemetostat, Pazopanib, and Anlotinib.

[0070] Small molecule anticancer drugs for the treatment of leukemia, including but not limited to Imatinib, Bosutinib, Nilotinib, Gilteritinib, and Ivosidenib.

[0071] Small molecule anticancer drugs indicated for NSCLC include but are not limited to Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befortinib.

[0072] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: tivazanib, everolimus, sirolimus, temsirolimus, midostaurin, ripretinib, selumetinib, larotrectinib, lurbinectedin, and olverembatinib.

[0073] Furthermore, the small molecule anticancer drug is selected from any one or more of the following:

[0074] dànbǎdiǎndexiǎofēnzǐkàngáiyào.bāokuòdànbùxiànyú:Lorlatinib、Acalabrutinib、Ibrutinib、Zanubrutinib、Erlotinib、Gefitinib、Icotinib、Osimertinib、Rybrevant、bèifútìnì、ruìzétìnì、Erdafitinib、Infigratin ib、Pemazyre、Pemigatinib、Pyrotinib、Tucatinib、Avapritinib、Fluzoparib、Niraparib、Olaparib、Rucaparib、linperlisib、Apatinib、Abemaciclib、Dalpiciclib、Palbociclib ib, Ribociclib, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, Cobimetinib, Pexidartinib, tazemetostat, Gilteritinib, Ivosidenib, Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin.

[0075] Multi-targeted small molecule anticancer drugs, including but not limited to: Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, tivazanib.

[0076] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.

[0077] Furthermore, the recombinant oncolytic virus also includes cytokines encoded by exogenous genes.

[0078] Furthermore, the cytokine is selected from the family of interleukins, interferons, tumor necrosis factors, colony stimulating factors, transforming growth factor β, and chemokines.

[0079] Furthermore, the cytokine is selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β and TNF-α.

[0080] Furthermore, the cytokine is selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0081] In a specific embodiment, the cytokine IL-12A comprises the amino acid sequence shown in SEQ ID NO 27.

[0082] In a specific embodiment, the cytokine IL-12B comprises the amino acid sequence shown in SEQ ID NO 28.

[0083] In a specific embodiment, the cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO 29.

[0084] In some specific embodiments, the recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with a site mutation, a nucleic acid sequence encoding the G protein with a site mutation, a nucleic acid sequence encoding the N protein with a site mutation, a nucleic acid sequence encoding the P protein with a site mutation, and a nucleic acid sequence encoding the L protein with a site mutation.

[0085] In a specific embodiment, the ALK comprises the amino acid sequence shown in SEQ ID NO 30.

[0086] In a specific embodiment, the BTK comprises the amino acid sequence shown in SEQ ID NO 31.

[0087] In a specific embodiment, the FGFR1 comprises the amino acid sequence shown in SEQ ID NO 32.

[0088] In a specific embodiment, the VEGFR comprises the amino acid sequence shown in SEQ ID NO 33.

[0089] In a specific embodiment, the CDK4 comprises the amino acid sequence shown in SEQ ID NO 34.

[0090] In a specific embodiment, the CDK6 comprises the amino acid sequence shown in SEQ ID NO 35.

[0091] In a specific embodiment, the BRAF comprises the amino acid sequence shown in SEQ ID NO 36.

[0092] In a specific embodiment, the MET comprises the amino acid sequence shown in SEQ ID NO 37.

[0093] In a specific embodiment, the KRAS G12C comprises the amino acid sequence shown in SEQ ID NO 38.

[0094] In a specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding a cytokine.

[0095] In a specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding an antigen.

[0096] In a specific embodiment, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.

[0097] In a specific embodiment, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.

[0098] The antigen sequence inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence. Similarly, the target sequence inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence. Similarly, the cytokine inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence.

[0099] In some specific embodiments, the method of treating tumors by combining the recombinant oncolytic virus and a small molecule anticancer drug is used to continuously kill abnormally proliferative cells.

[0100] In some specific embodiments, the abnormally proliferative cells are selected from tumor cells or cells associated with tumor tissue.

[0101] In some specific embodiments, the tumor comprises a solid tumor or a hematological tumor.

[0102] In some specific embodiments, the tumor includes but is not limited to acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, Gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.

[0103] The present application also provides a composition comprising the above-mentioned oncolytic virus vaccine and a small molecule anticancer drug.

[0104] In summary, this application has the following beneficial effects:

[0105] The method for treating tumors with a recombinant oncolytic virus combined with a small molecule anticancer drug provided in the present application has a significant inhibitory effect on tumor growth. Moreover, the experimental results of the combined treatment of tumors with a recombinant oncolytic virus directly combined with a small molecule anticancer drug are better than the experimental results of treating tumors with a recombinant oncolytic virus alone or with a small molecule anticancer drug alone; the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed antigen fragments and then combined with a small molecule anticancer drug are better than the experimental results of treating tumors with a recombinant oncolytic virus directly combined with a small molecule anticancer drug or the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed antigen fragments directly. Therefore, the method for treating tumors with a recombinant oncolytic virus and a small molecule anticancer drug provided in the present application further effectively improves the therapeutic effect on tumor cells.

[0106] The method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in this application has a good ability to inhibit the growth of tumor cells. It can be judged that the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in this application also has a good ability to inhibit other cancer cells and has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Mobocertinib to treat tumors.

[0108] Figure 2 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Ceritinib to treat tumors.

[0109] Figure 3 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Ibrutinib to treat tumors.

[0110] Figure 4 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Afatinib to treat tumors.

[0111] Figure 5 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Dacomitinib to treat tumors.

[0112] Figure 6 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Icotinib to treat tumors.

[0113] Figure 7 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Lenvatinib to treat tumors.

[0114] Figure 8 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Pazopanib to treat tumors.

[0115] Figure 9 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Anlotinib to treat tumors.

[0116] Figure 10 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Pyrotinib to treat tumors.

[0117] Figure 11 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Niraparib to treat tumors.

[0118] Figure 12 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Olaparib to treat tumors.

[0119] Figure 13 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Regorafenib to treat tumors.

[0120] Figure 14 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Palbociclib to treat tumors.

[0121] Figure 15 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Vemurafenib to treat tumors.

[0122] Figure 16 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Savolitinib to treat tumors.

[0123] Figure 17 shows the results of animal experiments using a recombinant oncolytic virus and the small molecule anticancer drug Sotorasib to treat tumors.

[0124] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. DETAILED DESCRIPTION

[0125] The following describes the implementation of the present invention through specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0126] Definition of terms

[0127] In this application, the term "oncolytic virus" (oncolytic virus) generally refers to a virus that can replicate in tumor cells and kill tumor cells. Oncolytic viruses include but are not limited to: Vesicular Stomatitis Virus (Vesicular Stomatitis Virus, referred to as "VSV virus"), poxvirus, herpes simplex virus (HSV), measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), Echovirus, Coxsackie virus, Newcastle disease virus (NDV) and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve the selectivity to tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity.

[0128] In some embodiments, the VSV virus is a mutant of the Indiana Mudd Summer subtype of the VSV virus, which can be used to treat tumors. This virus does not interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.

[0129] VSV virus can express a variety of cell surface molecules, including low-density lipoprotein receptor, phosphatidylserine, sialolipid and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic virus platforms currently under development, VSV virus has the following advantages: (1) small genome, short replication time, and fast transsynaptic speed; (2)

[0130] The exogenous gene expression is extremely high, so it can have a high titer, allowing large-scale production; (3) It has an independent cell cycle and no risk of transformation in the host cell cytoplasm. This oncolytic virus does not integrate into DNA, and after being attenuated, it can avoid the nervous system inflammation caused by wild-type viruses. Given the above characteristics, VSV has great potential in tumor immunotherapy.

[0131] In some embodiments, site-directed gene mutations can be performed on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.

[0132] In certain embodiments, the recombinant oncolytic virus described herein can be an oncolytic virus that has been genetically modified, such as by modification of one or more genes to improve its tumor selectivity and / or preferentially replicate in dividing cells. The genetic modification can be a modification of genes involved in DNA / RNA replication, nucleic acid metabolism, host tropism, surface attachment, virulence, lysis and diffusion processes, or it can be a modification of integrated exogenous genes. The exogenous genes may include exogenous immunomodulatory genes, exogenous screening genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an oncolytic virus that has been modified at the amino acid level, such as insertion, deletion, or substitution of one or more amino acids.

[0133] In this application, the term "M protein" generally refers to the VSV viral matrix protein. M protein is an important virulence factor of the VSV virus and is also a protein in the VSV virus that is known to interfere with the natural immune response of mice. The term "M protein" also includes homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype M protein may comprise the amino acid sequence shown in SEQ ID NO 1. In this application, the M protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 2-11.

[0134] In this application, the term "G protein" generally refers to the glycoprotein of the VSV virus, also known as the envelope protein. The term "G protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype G protein may comprise the amino acid sequence shown in SEQ ID NO 12. In this application, the G protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 13.

[0135] In this application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype N protein may comprise the amino acid sequence shown in SEQ ID NO 14. In this application, the N protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 15.

[0136] In this application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype P protein may comprise the amino acid sequence shown in SEQ ID NO 16. In this application, the P protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 17.

[0137] In this application, the term "L protein" generally refers to the VSV viral RNA polymerase protein. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype L protein may comprise the amino acid sequence shown in SEQ ID NO 18. In this application, the L protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 19.

[0138] In this application, protein mutation sites are generally described as "amino acid + amino acid position + mutated amino acid." In this application, mutations may include, but are not limited to, amino acid additions, substitutions, deletions, and / or deletions. For example, the term "M51R" generally refers to a mutation from methionine (M) at position 51 to arginine (R).

[0139] In this application, the term "amino acid substitution" generally refers to the replacement of an amino acid residue present in a parent sequence with another amino acid residue. The amino acid in the parent sequence can be replaced, for example, via chemical synthesis or by recombinant methods known in the art. Thus, "substitution at position xx" generally refers to the replacement of the amino acid present at position xx with an alternative amino acid residue. In this application, the amino acid substitution may include an amino acid mutation.

[0140] In this application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes can include substitution, deletion, absence, insertion, addition, truncation, or protein processing or cleavage of amino acids.

[0141] In the present application, the recombinant oncolytic virus is a virus that integrates exogenous genes while performing site-directed gene mutations on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus. The exogenous genes are specifically genes encoding antigens and / or cytokines.

[0142] In this application, the term "small molecule anticancer drug" refers to chemical substances or peptides, typically signal transduction inhibitors, so-called because of their small molecular weight. Small molecule anticancer drugs are typically formulated as oral dosage forms that rapidly dissolve in the intestine. Once absorbed, they bind to the active conformation of certain kinases, inhibiting their activity and preventing cancer cell growth. Alternatively, they block signaling within tumor cells, inhibiting the activity of abnormal proteins and preventing cancer cell growth and spread.

[0143] ALK is a receptor tyrosine kinase. Activated ALK can activate the downstream ALK / PLCV, JAK / STAT, MEK / ERK, and PI3K / AKT pathways, thereby promoting cell cycle progression, proliferation, and angiogenesis, leading to tumorigenesis. Small molecule anticancer drugs targeting ALK can inhibit ALK phosphorylation and ALK-mediated activation of downstream signaling proteins STAT3 and AKT, thereby suppressing ALK fusion and amplification and reducing tumor cell viability.

[0144] BTK is a tyrosine kinase found in B cells and plays a central role in transmitting B cell growth signals. Studies have shown that BTK is a key protein in the rapid proliferation of malignant B cells. Small molecule anticancer drugs targeting BTK can inactivate BTK, inhibiting B cell growth signaling and relatively accurately suppressing the growth of malignant B cells, thereby controlling their number.

[0145] EGFR is a glycoprotein and a tyrosine kinase receptor. It is a transmembrane receptor on cells that penetrates the cell membrane. Upon activation by ligand binding, it converts from a monomer to a dimer, activating downstream pathways within the cell and inducing cell proliferation. Studies have shown that EGFR is overexpressed or aberrantly expressed in solid tumors. Activating mutations in EGFR lead to constitutive activation of the tyrosine kinase, phosphorylation of downstream pathways, and ultimately uncontrolled cell proliferation. Small molecule anticancer drugs targeting EGFR can inhibit EGFR activity, thereby blocking the activation of related pathways.

[0146] Alterations in FGFR molecules can lead to aberrant FGF / FGFR signaling, promoting cell proliferation, angiogenesis, invasion, metastasis, and anti-apoptosis, which are associated with a wide range of human malignancies. Common FGFR mutations include gene amplification / fusion / deletion mutations. The FGFR family primarily comprises four subtypes: FGFR1, FGFR2, FGFR3, and FGFR4, as well as several isoforms. Each subtype shares structural characteristics: a ligand-binding extracellular domain, a transmembrane region, and a phosphorylated intracellular domain. They are part of the tyrosine kinase signaling pathway responsible for cell proliferation and differentiation. They form ternary complexes with 18 different fibroblast growth factors (FGFs), initiating a series of signaling pathways involved in regulating physiological processes in vivo, such as embryonic and fetal development, wound healing, and angiogenesis. Small molecule anticancer drugs targeting FGFRs can inhibit FGFR activity, thereby blocking the associated signaling pathways.

[0147] HER2 encodes a transmembrane tyrosine kinase receptor protein composed of three parts: an extracellular ligand-binding domain, a single-stranded transmembrane domain, and an intracellular protein tyrosine kinase active domain. The extracellular domain forms homodimers (HER2-HER2) or heterodimers (HER2-EGFR), mediating phosphorylation of the intracellular tyrosine kinase active domain, thereby activating downstream signaling pathways and promoting cell proliferation and angiogenesis. The HER2 protein, the product of the HER2-encoded gene, is typically expressed only during the fetal period and at low levels in only a few tissues in adulthood. The number of HER2 receptors on the surface of HER2-positive cells is 10-100 times higher than that of normal cells. Studies have shown that HER2 gene amplification / overexpression is found in more than 30% of human tumors, such as breast, ovarian, endometrial, fallopian tube, gastric, and prostate cancers. Small molecule anticancer drugs targeting HER2 are oral non-peptide anilinoquinazolone compounds that are homologous to ATP. This similarity enables them to compete for the ATP-binding domain of protein kinases, thereby preventing phosphorylation and subsequent activation of signal transduction pathways, further leading to cell apoptosis and reduced cell proliferation.

[0148] Parp is a DNA damage repair enzyme that plays a key role in the single-strand DNA repair pathway. Specifically, the process is as follows: Parp is activated when DNA is damaged and breaks. It recognizes and binds to the DNA break site, activating and catalyzing the poly(ADP-ribosylation) of the receptor protein, participating in the DNA repair process. Small molecule anticancer drugs targeting Parp can hinder this repair process, preventing the damaged DNA from being repaired and causing cell death. When single-strand repair is hindered in normal cells, another repair pathway, homologous recombination repair, is activated. Therefore, small molecule anticancer drugs targeting Parp are not very toxic to normal cells. However, for certain tumor cells, if homologous recombination repair also fails, small molecule anticancer drugs targeting Parp can selectively kill tumor cells with BRCA1 / 2 gene deletions, a phenomenon known as "synthetic lethality."

[0149] The PI3K / Akt / mTOR signaling pathway is involved in regulating the proliferation, survival, transcription, translation, and metabolism of malignant tumor cells. Small molecule anticancer drugs targeting PI3K can act on lymphoma cells, inhibiting PI3K expression and reducing AKT protein phosphorylation, thereby inducing apoptosis and inhibiting the proliferation of malignant B lymphocytes.

[0150] VEGFR is a receptor for VEGF, expressed in lymphatic and vascular endothelium. VEGFR1 / 2 / 3 regulates endothelial cell proliferation and migration and is highly expressed in many tumors, playing a crucial role in tumor angiogenesis. VEGFR inhibition has become an effective treatment for many cancers. Small molecule anticancer drugs targeting VEGFR can block the VEGF signaling pathway by binding to VEGF or interfering with different VEGFR domains, thereby inhibiting endothelial cell proliferation and migration.

[0151] CDK4 / 6 are a group of protein kinases discovered for their role in cell cycle regulation and are also believed to be involved in transcriptional regulation, mRNA processing, and neuronal differentiation. CDK4 and CDK6, two cyclin-dependent kinases, can form a complex with cyclin D, thereby phosphorylating the retinoblastoma protein (RB), which in turn promotes cell proliferation by releasing the transcription factor E2F1. Small molecule anticancer drugs targeting CDK4 / 6 can effectively reduce the phosphorylation of the RB protein and downregulate E2F expression, resulting in cell cycle arrest and inhibition of cell proliferation.

[0152] Over 90% of chronic myeloid leukemia (CML) cases are caused by the formation of the Philadelphia chromosome, a chromosomal abnormality. The Philadelphia chromosome is formed by a translocation between chromosomes 9 and 22. This chromosomal translocation results in the abl proto-oncogene, originally located on chromosome 9, being linked to the bcr gene on chromosome 22, forming the bcr-abl fusion gene. The protein originally expressed by the abl gene is a tyrosine kinase located in the cell. The translocated bcr gene affects the regulation of the abl gene. The bcr-abl fusion protein binds to GRB2 and SRC proteins, thereby initiating the Ras-Raf pathway, leading to growth factor-independent cell proliferation, activating the PI3K pathway to inhibit programmed cell death, and activating the CRKL-FAK-PYK2 pathway to reduce cell surface adhesion, thereby enhancing the cancer cell's metastatic ability. Furthermore, it participates in the JAK-STAT pathway, a signal transduction and transcriptional activation pathway. Ultimately, cancer cells harboring the bcr-abl abnormality continue to proliferate and metastasize, ultimately manifesting as leukemia. In addition to inhibiting abl kinase, small molecule anticancer drugs for leukemia can also inhibit related signaling pathways such as Kit and growth factor PDGFR.

[0153] JAK is a non-receptor tyrosine protein kinase with four subtypes: JAK1, JAK2, JAK3, and TYK2. JAK1, JAK2, and TYK2 are widely present in various tissues and cells in the body, while JAK3 is restricted to the bone marrow and lymphatic system. The JAK-STAT signaling pathway is essential for both immune and hematopoietic function. A variety of inflammatory factors activate this intracellular signaling pathway, triggering inflammatory responses. It has become a novel target in the fields of immuno-inflammation and cancer. Small molecule anticancer drugs targeting JAKs inhibit this JAK-STAT signaling pathway.

[0154] The GTP hydrolysis activity of the KRAS protein enables it to function as a binary switch downstream of cell surface receptors during signal transduction. Simply put, the nucleotide binding state of KRAS determines its activation state. In the absence of mitogenic signals, the KRAS protein primarily binds to GDP and remains in an inactive conformation. This inactive state is maintained by intrinsic GTP hydrolysis activity and interaction with GTPase-activating proteins (GAPs), which accelerate the conversion of GTP to GDP. When cell surface receptors are activated by mitogenic signals, they recruit guanine nucleotide exchange factors (GEFs) that bind to inactive KRAS and catalyze the expulsion of GDP from the active site, thereby passively loading GTP. GTP binding to KRAS shifts the active site from an open to a closed conformation, which facilitates subsequent interactions between KRAS and various effector proteins. KRAS is one of the most common oncogenes in solid tumors, with KRAS mutations found in approximately 30% of tumors, including 90% of pancreatic cancers, 30%-40% of colon cancers, and 15%-20% of lung cancers. Among the KRAS gene mutations, 97% occur at amino acid residues 12 or 13, including G12C, G12D, G13D, etc., with G12C mutation being the most common. KRAS G12C mutation occurs in approximately 14% of lung adenocarcinomas (the most common subtype of NSCLC), 4% of colorectal cancers, and 2% of pancreatic cancers. Patients with this mutation have a poor prognosis and are prone to resistance to standard therapies. Once chemotherapy or immunotherapy fails, treatment options are very limited. As the "most difficult target to conquer," the currently approved inhibitors for the KRAS G12C mutation are Lumakras (sotorasib) and Krazati (adagrasib).

[0155] Adagrasib is a specific inhibitor of the KRAS G12C mutant and has shown good efficacy in the treatment of non-small cell lung cancer, colorectal cancer and other solid tumors.

[0156] In some specific embodiments, the small molecule anticancer drug may include but is not limited to:

[0157] 1. Small molecule anticancer drugs targeting ALK (anaplastic lymphoma kinase):

[0158] Alectinib (Roche) targets ALK and RET, and its indications may be ALK-positive NSCLC (non-small cell lung cancer).

[0159] Brigatinib (Ariad Pharmaceuticals) targets ALK, ROS1, IGF-1R, FLT3, and EGFR, and its indications may be ALK-positive NSCLC.

[0160] Ceritinib (Novartis) targets ALK, IGF-1R, InsR, and ROS1, and its indications may be ALK-positive NSCLC.

[0161] Crizobtinib (Pfizer) targets ALK, c-Met, HGFR, ROS1, and MST1R, and its indications may be ALK- and ROS1-positive NSCLC.

[0162] Entrectinib (Roche) targets TRKA / B / C, ROS1, and ALK, and its indications may be ROS1-positive NSCLC and solid tumors expressing NTRK protein fusion.

[0163] Lorlatinib (Pfizer) targets ALK and its indication may be ALK-positive NSCLC.

[0164] Ensartinib targets ALK.

[0165] 2. Small molecule anticancer drugs targeting BTK (tyrosine kinase)

[0166] Acalabrutinib (AstraZeneca) targets BTK and its indications may be mantle cell lymphoma, CLL (chronic lymphocytic leukemia), and SLL (small lymphocytic lymphoma).

[0167] Ibrutinib (Pharmacyclics) targets BTK and may be used for the treatment of mantle cell lymphoma, CLL, and Waldenstrom's macroglobulinemia.

[0168] Zanubrutinib (BeiGene) targets BTK and may be indicated for mantle cell lymphoma.

[0169] Orelabrutinib targets BTK.

[0170] 3. Small molecule anticancer drugs targeting EGFR (epidermal growth factor receptor)

[0171] Afatinib (Boehringer Ingelheim) targets EGFR, ERBB2, and ERBB4, and its indications may be NSCLC2013 and squamous NSCLC2016.

[0172] Dacomitinib (Pfizer) targets EGFR, ERBB, and ERBB4, and its indications may be NSCLC with EGFR mutations.

[0173] Erlotinib (OSI Pharmaceuticals) targets EGFR and is indicated for NSCLC and pancreatic cancer.

[0174] Gefitinib (AstraZeneca) targets EGFR and may be indicated for NSCLC.

[0175] Icotinib (Betta Pharmaceuticals) targets EGFR and may be indicated for NSCLC.

[0176] Lapatinib (SmithKline Beecham) targets EGFR and ErbB2 and may be indicated for breast cancer.

[0177] Mobocertinib (Takeda Pharmaceuticals, Inc.) targets EGFR and HER2 and is indicated for locally advanced or metastatic NSCLC with EGFR exon 20 insertion mutations.

[0178] Osimertinib (AstraZeneca) targets EGFR T970M and is indicated for NSCLC with EGFR-sensitive mutations.

[0179] Rybrevant (Janssen) targets EGFR and is indicated for NSCLC with EGFR exon 20 insertion mutations.

[0180] Beifortinib (Beida Pharmaceuticals) targets EGFR and its indication may be EGFR-resistant T790M mutation NSCLC.

[0181] Rizetinib (Beta) targets EGFR and its indication may be NSCLC.

[0182] Dasatinib (Bristol-Myers Squibb) targets bcr-abl, EGFR, Src, Lck, Yes, Fyn, Kit, EphA2, and PDGFRβ, and its indications may be chronic myeloid leukemia.

[0183] Almonetinib (Ametinib, Hausen Pharmaceuticals) targets EGFR.

[0184] Furmonertinib (Ailis Pharmaceuticals) targets EGFR.

[0185] 4. Small molecule anticancer drugs targeting FGFR (fibroblast growth factor receptor)

[0186] Erdafitinib (Janssen Biotech) targets FGFR1 / 2 / 3 / 4 and may be indicated for urothelial bladder cancer.

[0187] Infigratinib (QED Therapeutics, Inc.) targets FGFR2 and is indicated for the treatment of advanced or metastatic FGFR2 fusion cholangiocarcinoma.

[0188] Pemazyre (Incyte) targets FGFR1 / 2 / 3 and may be indicated for advanced cholangiocarcinoma.

[0189] Pemigatinib (Incyte) targets FGFR1 / 2 / 3 and is indicated for locally advanced or metastatic cholangiocarcinoma with FGFR2 fusion or rearrangement.

[0190] 5. Small molecule anticancer drugs targeting HER2 (human epidermal growth factor receptor)

[0191] Neratinib (Puma Pharmaceuticals) targets ERBB2 and HER2, and its indications may be HER2-positive breast cancer.

[0192] Pyrotinib (Hengrui) targets HER2 and may be indicated for solid tumors.

[0193] Tucatinib (Seattle Genetics) targets HER2 and is indicated for surgically unresectable or metastatic, previously treated, advanced HER2-positive breast cancer.

[0194] 6. Small molecule anticancer drugs targeting Parp (poly(ADP-ribose) polymerase)

[0195] Avapritinib (Blueprint Medicines Corp) targets Parp and may be indicated for the treatment of gastrointestinal stromal tumors with mutations in exon 18 of the PDGFR gene.

[0196] Fluzoparib (Hengrui) targets Parp and its indications include platinum-sensitive recurrent ovarian cancer, fallopian tube cancer or primary peritoneal cancer with germline BRCA mutations that have undergone second-line or higher chemotherapy, and platinum-sensitive recurrent epithelial ovarian cancer and fallopian tube cancer.

[0197] Niraparib (ZEJULA Tesaro, Inc.) targets Parp and is indicated for maintenance treatment of epithelial ovarian, fallopian tube, and primary peritoneal cancer that has a complete / partial response to first-line platinum-based chemotherapy.

[0198] Olaparib (Olaparib, AstraZeneca) targets Parp and is indicated for HRD-positive advanced ovarian cancer, fallopian tube cancer, and primary peritoneal cancer.

[0199] Rucaparib (fluzoparib, Rubraca clovis oncology, Inc.) targets Parp and is indicated for prostate cancer after androgen receptor and taxane chemotherapy.

[0200] 7. Small molecule anticancer drugs targeting PI3K (phosphatidylinositol 3-hydroxykinase)

[0201] Duvelisib (Duensib, Shijiao) is a dual inhibitor targeting PI3K-δ and PI3K-γ, and its indications may be relapsed / refractory follicular lymphoma.

[0202] Linperlisib (Linpulisi, Yingli) is a highly selective inhibitor targeting PI3K-δ, and its indications may be relapsed / refractory follicular lymphoma.

[0203] 8. Small molecule anticancer drugs targeting VEGFR (vascular endothelial growth factor receptor)

[0204] Apatinib (Hengrui) targets VEGFR2 and may be indicated for gastric cancer in 2014 and liver cancer in 2020.

[0205] Axitinib (Pfizer) targets VEGFR1 / 2 / 3 and PDGFRβ, and its indication may be RCC (renal cell carcinoma).

[0206] Lenvatinib (Alche Pharmaceuticals) targets VEGFR, FGFR, PDGFR, KIT, and RET, and its indication may be DTC (differentiated thyroid cancer).

[0207] Pazopanib (GlaxoSmithKline) targets VEGFR1 / 2 / 3, PDGFRα / β, FGFR1 / 3, Kit, LCk, Fms, and Itk, and its indications may be renal cancer and soft tissue sarcoma.

[0208] Regorafenib (Bayer Group) targets VEGFRl / 2 / 3, bcr-abl, B-Raf, B-RafyV600E, and Kit, and its indications may be CRC (colorectal cancer) and GIST (gastrointestinal stromal tumor).

[0209] Anlotinib (Zhengda Tianqing) is a multi-target tyrosine kinase inhibitor that effectively targets VEGFR, PDGFR, FGFR, c-Kit, and other targets. It has dual effects of inhibiting tumor angiogenesis and inhibiting tumor growth. It is indicated for NSCLC, soft tissue sarcoma, and small cell lung cancer. In addition, it may be approved soon for the treatment of medullary thyroid tumor.

[0210] Cabozantinib (Exelixis Biopharmaceuticals) targets RET, Met, VEGFR1 / 2 / 3, Kit, TrkB, Flt3, Axl, Tie2, and ROS1, and its indications may be metastatic medullary thyroid cancer, advanced renal cancer, and liver cancer.

[0211] Sunitinib (Pfizer) targets PDGFRa, VEGFR1 / 2 / 3, Kit, Flt3, CSF-1R, and RET, and its indications may be RCC, GIST, and PNET (primitive neuroectodermal tumor).

[0212] Vandetanib (IPR PHARMS Inc.) targets EGFRs, VEGFRs, RET, Brk, Tie2, EphRs, and Srcfamily kinases, and its indication may be medullary thyroid cancer.

[0213] Ponatinib (ARIAD Pharmaceuticals) targets bcr-abl, bcr-abl T315I, VEGFR, PDGFR, FGFR, EphR, Src, Kit, RET, Tie2, and Flt3, and its indications may be chronic myeloid leukemia.

[0214] Sorafenib (Bayer Pharmaceuticals) targets B / C-Raf, B-RafV600E, Kit, Flt3, RET, VEGFR1 / 2 / 3, and PDGFRβ, and its indications may be hepatocellular carcinoma, RCC, and DTC.

[0215] Donafenib targets VEGFR and PDGFR.

[0216] Surufatinib targets VEGFR1 / 2 / 3, FGFR, and CSF-IR.

[0217] Fruquintinib targets VEGFR1 / 2 / 3.

[0218] 9. Small molecule anticancer drugs targeting CDK4 / 6 (cyclin-dependent kinase 4 / 6)

[0219] Abemaciclib (Pomacillin, Eli Lilly) targets CDK4 / 6 and can be used for the treatment of HR+ and HER- breast cancer.

[0220] Dalpiciclib (Hengrui) targets CDK4 / 6 and can be used in combination with fulvestrant for the treatment of hormone receptor-positive (HR+), HER2-positive recurrent or metastatic breast cancer that has progressed after previous endocrine therapy.

[0221] Palbociclib (Pfizer) targets CDK4 / 6 and can be used for the treatment of ER+ and HER- breast cancer.

[0222] Ribociclib (Novartis Pharmaceuticals) targets CDK4 / 6 and can be used for the treatment of HR+ and EGFR- breast cancer.

[0223] 10. Small molecule anticancer drugs for melanoma

[0224] Vemurafenib (Hoffman) targets BRAF and is indicated for melanoma with B-RafV600E mutation.

[0225] Dabrafenib (GlaxoSmithKline) targets B-Raf and is indicated for melanoma, NSCLC, and anaplastic thyroid carcinoma with BRAF mutations.

[0226] Encorafenib (Array Biopharmaceuticals) targets B-Raf-V600E / K and is indicated for the treatment of melanoma with B-Raf-V600E / K mutations.

[0227] Trametinib (GlaxoSmithKline) targets MEK1 / 2 and is indicated for melanoma and BRAF-mutated NSCLC.

[0228] Binimetmib (Array Biopharmaceuticals) targets MEK1 / 2 and is indicated for the treatment of melanoma with B-RafV600E / K mutations.

[0229] Cobimetinib (coblmetinib, Genentech) targets MEK1 / 2 and may be indicated for melanoma with BRAF-V600E / K mutations.

[0230] 11. Small molecule anticancer drugs for cell tumors or sarcomas

[0231] Pexidartinib (Daiichi Sankyo) targets CSFR1 / Kit and may be indicated for the treatment of giant cell tumor of the tendon sheath.

[0232] Tazemetostat (Epizyme) targets EZH2 mutations and may be indicated for epithelioid sarcoma / follicular lymphoma.

[0233] 12. Small molecule anticancer drugs for leukemia

[0234] Imatinib (Novartis Pharmaceuticals) targets A / B / C-Raf, B-RafV600E, SRMS, ACK1, MAP4K5, and FGR. Its indications may be chronic myeloid leukemia, aggressive systemic mastocytosis, CEL (chronic eosinophilic leukemia), GIST, and MDS (myelodysplastic syndrome).

[0235] Bosutinib (Wyeth) targets bcr-abl, Src, Lyn, and Hck, and its indication may be chronic myeloid leukemia.

[0236] Nilotinib (Novartis Pharmaceuticals) targets bcr-abl / PDGFR and DDR1, and its indications may be chronic myeloid leukemia.

[0237] Gilteritinib (Astellas) targets FLT3 and is indicated for the treatment of AML (acute myeloid leukemia) with FLT3 mutations.

[0238] Ivosidenib (Centerstone) targets mutant isocitrate dehydrogenase and is indicated for relapsed or refractory IDH1 acute myeloid leukemia.

[0239] 13. Small molecule anticancer drugs for NSCLC

[0240] Sotorasib (Amgen) targets KRAS G12C and is indicated for the treatment of KRAS G12C-mutated NSCLC.

[0241] Capmatinib (Novartis) targets MET and is indicated for metastatic NSCLC with MET14 exon skipping.

[0242] Tepotinib (Merck) targets MET and is indicated for metastatic NSCLC, gastric cancer, and esophageal cancer with MET exon 14 skipping.

[0243] Savolitinib (Savolitinib, Hutchison Whampoa) targets MET and is indicated for advanced NSCLC with MET exon 14 skipping.

[0244] Pralsetinib (Blueprint / Keystone) targets RET and is indicated for RET fusion-positive metastatic non-NSCLC.

[0245] Selpercatinib (Loxo Oncology) targets RET and is indicated for patients with RET fusion-positive NSCLC and medullary thyroid cancer.

[0246] 14. Other small molecule anticancer drugs

[0247] Tivazanib (AVEO) is a multi-enzyme inhibitor and its indication may be RCC.

[0248] Everolimus (Novartis Pharmaceuticals) targets FKBP12 / mTOR and may be indicated for HER2-breast cancer, PNET, RCC, and RAML (renal angiomyolipoma).

[0249] Sirolimus (Wyeth) targets FKBP12 / mTOR and may be indicated for renal transplant lymphangioleiomyomatosis.

[0250] Temsirolimus (Wyeth) targets FKBP12 / mTOR and may be indicated for advanced renal cancer.

[0251] Midostaurin (Novartis Pharmaceuticals) targets FLT3 and may be indicated for the treatment of AML with FLT3 mutations.

[0252] Ripretinib (Deciphera) targets KIT / PDGFRα and may be indicated for GIST.

[0253] Selumetinib (AstraZeneca) targets MEK1 / 2 and is indicated for the treatment of neurofibromatosis type 1 and symptomatic, inoperable plexiform neurofibromas.

[0254] Larotrectinib (Eli Lilly) targets NTRK and its indications may be solid tumors with NTRK protein fusions.

[0255] Lurbinectedin (GlaxoSmithKline) is a targeted alkylating agent indicated for the treatment of adult patients with metastatic small cell lung cancer whose disease has progressed during or after platinum-based chemotherapy.

[0256] Olverembatinib (Ascentage Pharmaceuticals) is a small molecule protein tyrosine kinase inhibitor that effectively inhibits the activity of wild-type and multiple mutant Bcr-Abl tyrosine kinase. It inhibits the phosphorylation of Bcr-Abl tyrosine kinase and downstream proteins STAT5 and Crk1, blocking downstream pathway activation and inducing cell cycle arrest and apoptosis in Bcr-Abl-positive and Bcr-Abl T315I mutant cell lines. It is indicated for Bcr-Abl, KIT leukemia, and gastrointestinal stromal tumors.

[0257] 15. Small molecule anticancer drugs targeting KRAS

[0258] Sotorasib targets KRAS G12C.

[0259] Adagrasib targets KRAS G12C.

[0260] In this application, the term "antigen" refers to a substance that can cause the production of antibodies or immune cells, and is any substance that can induce an immune response in the body. That is, it can be specifically recognized and bound by the antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activating T / B cells, causing them to proliferate and differentiate, produce immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products in vivo and in vitro. Therefore, antigenic substances have two important characteristics: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body and produce antibodies and / or sensitized lymphocytes; immunoreactivity refers to the ability to undergo a specific binding reaction with the corresponding immune effector substances (antibodies or sensitized lymphocytes) in vivo and in vitro.

[0261] In some specific embodiments, the antigen is exogenous, meaning that the antigen is from a different species.

[0262] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is an antigen normally expressed on tumor cells.

[0263] In a specific implementation method, the antigen is a tumor associated antigen (Tumor Associated Antigen: TAA) or a tumor specific antigen (Tumor Specific Antigen: TSA).

[0264] In a specific embodiment, TAA or TSA encompasses a molecule or a portion thereof that is presented on the cell surface (antigens recognized by CAR) or within the cell membrane (antigens recognized by TCR) or present in the tumor environment (e.g., in the tumor microenvironment).

[0265] In some specific embodiments, the cell is a tumor cell.

[0266] In some specific embodiments, the TAA or TSA comprises a tumor-associated antigen or a tumor-specific antigen on the cell surface or in the cell membrane.

[0267] In some specific embodiments, the cells are non-tumor cells present in a tumor environment, such as, but not limited to, cells present in vasculature tissue associated with a tumor or cancer.

[0268] In some specific embodiments, the TAA or TSA is an angiogenesis antigen in the tumor microenvironment.

[0269] In some specific embodiments, the TAA or TSA is an antigen on a blood vessel in the tumor microenvironment.

[0270] In some specific embodiments, the cells are stromal cells present in a tumor environment.

[0271] In some specific embodiments, the TAA or TSA is a stromal cell antigen in the tumor microenvironment.

[0272] In some specific embodiments, TAA or TSA includes extracellular epitopes of tumor cell surface antigens, tetramers inside and outside the tumor cell membrane, or other structures that can be recognized by antibodies or immune cells.

[0273] In some specific embodiments, the TAA or TSA comprises an extracellular matrix antigen.

[0274] In some specific embodiments, the TAA or TSA comprises an antigen present in the tumor microenvironment (TME).

[0275] In some specific embodiments, the TAA or TSA comprises a molecule secreted by a tumor cell into the TME.

[0276] In some specific embodiments, the TAA or TSA comprises an effector molecule that is secreted by tumor cells into the TME.

[0277] In some specific embodiments, the TAA or TSA comprises an effector molecule that is secreted by tumor cells into the TME to downregulate or inhibit the activity of cytotoxic natural killer (NK) cells or T cells.

[0278] In some specific embodiments, the TAA or TSA comprises a soluble activating receptor ligand that is secreted by tumor cells into the TME to block recognition of tumor cells by NK cells or T cells.

[0279] In some specific embodiments, examples of TAAs or TSAs include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), toll-like receptor (TLR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (HER2 / neu;Erb2), ErbB3 (Her3), folate receptor, ephrin receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, MET (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE -A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC 1, MUC2, P-cadherin, myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / IN T2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, mesothelin, DR5, PD-1, PD-L1, HER2, HER3, IGF-1R, CXCR4, neuropilin 1, glypican, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2 or VEGF-R2, CEA, EpCAM.

[0280] In this application, the term "cytokines" (cytokines) is a biologically active substance that is synthesized and secreted by immune cells (lymphocytes, mononuclear macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) to regulate the functions of other immune cells or target cells. It is a small molecule polypeptide or glycoprotein. Cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. According to their main functions, cytokines are divided into: interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), transforming growth factor-β family (TGF-βfamily), growth factor (GF), chemokine family (chemokine family).

[0281] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, and IL-18.

[0282] Specifically, interleukin 1 (IL-1): IL-1 is a pleiotropic cytokine involved in cortical inflammatory responses, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, and IL-18. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 can stimulate the proliferation of CD4+ T cells in vitro, induce the production of IL-2, co-stimulate the activation of CD8+ / IL1R+ T cells, and stimulate the proliferation of mature B cells and the secretion of immunoglobulins.

[0283] Specifically, interleukin 2 (IL-2): IL-2, also known as T cell growth factor, is produced by T cells in response to antigens or mitotic stimulation and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 can stimulate NK cell proliferation, increase cytotoxicity, and stimulate NK cells to secrete a variety of cytokines. However, further studies have found that IL-2 can cause excessive differentiation of T cells and induce apoptosis of activated T cells. It can also activate CD4+FoxP3 Treg regulatory cells, thereby inhibiting T cell activation and tumor killing activity. Therefore, IL-2 is considered to be a T cell regulatory factor rather than just an activating factor. Therefore, some studies have now used IL-7, IL-15, and IL-21 to replace IL-2.

[0284] Specifically, interleukin-7 (IL-7): IL-7 is a hematopoietic growth factor secreted by stromal cells in the bone marrow and thymus, and shares the γc receptor subunit with IL-2 to stimulate the proliferation of lymphocyte progenitor cells. IL-7 provides sustained stimulatory signals to T cells and memory T cells. As mentioned above, IL-7 activates CD8+ T cells without activating CD4+FoxP3+ Treg cells. Clinically, IL-7 can also be used to restore T cell numbers after chemotherapy or hematopoietic stem cell transplantation. IL-7 also plays an important role in certain stages of B cell maturation, influencing their proliferation. IL-7 also acts as a regulatory factor for intestinal mucosal lymphocytes.

[0285] Specifically, interleukin 15 (IL-15): IL-15 has a similar structure to IL-2, shares a γc receptor subunit, and belongs to a family with four α-helix helical bundles (others include IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 mainly kills virus-infected cells in the innate immune system. At the same time, IL-15 can activate NKT cells and γδT cells. In immune cell therapy, IL-15 does not cause apoptosis of activated T cells, but activates CD8+ effector T cells. IL-15 maintains the survival of memory T cells, thereby playing an important role in long-term anti-tumor activity.

[0286] Specifically, interleukin 21 (IL-21): IL-21 also belongs to the IL-2 family, shares the γc receptor subunit, has a strong regulatory effect on cells of the immune system, and can induce cell division and proliferation in its target cells. In cellular immunotherapy, IL-21 can promote the proliferation of CD4+ and CD8+ T cells, enhance the cytotoxicity of CD8+ T cells and NK cells, and will not cause cell apoptosis due to activation. IL-21 will preferentially expand "young" CD27+CD28+ CD8+ T cells, which have stronger cytotoxicity. Of course, IL-21 will not cause the expansion of Treg, so the application of IL-21 in cellular immunotherapy is becoming more and more extensive.

[0287] Specifically, interleukin-4 (IL-4): IL-4 activates the proliferation of activated B and T cells and regulates Fc receptor expression on lymphocytes and monocytes. IL-4 induces the transformation of Th1 cells into Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. IL-4 inhibits macrophage growth, thereby directing monocyte differentiation into DCs. Without IL-4 in the culture system, monocytes will differentiate into macrophages. IL-4 plays a key role in regulating humoral and adaptive immunity, inducing B cell antibody class switching to IgE and upregulating the production of MHC class II molecules. The combined action of IL-4 and GM-CSF can direct monocyte differentiation into immature DCs, which have strong antigen uptake and processing capabilities but weak antigen presentation. The sequential administration of IL-4 and TNF-α can promote DC maturation.

[0288] Specifically, interleukin-12 (IL-12): IL-12 acts on activated T and NK cells and has a wide range of biological activities, mediated by the activator of the transcriptional protein STAT4 to exert its effects on lymphocytes. IL-12 is required for the T-cell-independent induction of IFN-γ and plays a crucial role in the differentiation of Th1 and Th2 cells. IL12B binds to IL23A to form IL-23 interleukin, which has both innate and adaptive immune functions. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances the activity of CD8+ CTLs. The therapeutic effect of IL-12 is related to its dose, duration of action, and other interacting cytokines, promoting the tumor-killing activity of immune cells through multiple mechanisms. In a mouse anti-melanoma model, high-dose IL-12 exerts its tumor-killing effect through NK cells, while low-dose IL-12 exerts its tumor-killing effect through NKT cells.

[0289] Specifically, interleukin 18 (IL-18): IL-18, also known as interferon-γ inducing factor, is a proinflammatory cytokine produced by macrophages and other cells. IL-18 can stimulate NK cells and CD8+T cells to secrete IFN-γ, enhancing the cytotoxic effect of NK cells and CD8+T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+T cells, and promote the expression of FasL in lymphocytes and other functions. IL-18 may provide a potential therapeutic target for allergic diseases. In addition, the synergistic effect of IL-18, IL-12, and IL-15 can maintain Th1 responses and monokine production in autoimmune diseases.

[0290] Gamma interferon, a type II interferon, is primarily produced by NK and NKT cells and exhibits antiviral, antitumor, and immunomodulatory effects. Interferon-γ, including IFN-γ and IFN-β, has antiproliferative effects on transformed cells and can enhance the antiviral and antitumor effects of type I interferons. IFN-γ activates macrophages, inducing the expression of MHC I, MHC II, and coactivator molecules on antigen-presenting cells (APCs). Furthermore, IFN-γ can induce changes in proteasome expression, thereby enhancing antigen presentation. IFN-γ can also promote the differentiation of CD4+ T cells into Th1 cells and inhibit IL-4-dependent B cell subtype switching. IFN-γ phosphorylates JAK1 and JAK2 proteins, thereby activating the JAK-STAT cellular pathway. In cellular immunotherapy, IFN-γ acts on host immune cells, exerting effects on macrophages, T cells, B cells, and NK cells. IFN-γ enhances antigen presentation by promoting the expression of MHC class II molecules on macrophages or by causing certain cells that normally do not express MHC class II molecules (such as vascular endothelial cells, certain epithelial cells, and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells, but not their proliferation. IFN-γ can enhance the activity and immune function of TH1 cells. IFN-γ enhances the phagocytic capacity of neutrophils and activates NK cells, thereby enhancing their cytotoxic effects. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.

[0291] Tumor necrosis factor (TNF), a member of the TNF superfamily of cytokines, is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α is involved in anti-tumor activities. In cellular immunotherapy, TNF-α induces the differentiation of immature DCs into mature DCs. This process occurs by downregulating macropinocytosis and surface Fc receptor expression in immature DCs, while upregulating cell surface expression of MHC class I and II molecules and B7 family molecules (CD80, CD86, etc.). Mature DCs significantly weaken their antigen uptake and processing capacity, but significantly enhance their antigen presentation capacity, resulting in strong T cell activation. TNF-α also influences the production of other cytokines, such as stimulating IL-1 secretion from monocytes and macrophages, enhancing IL-2-dependent thymocyte and T cell proliferation, promoting the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhancing B cell proliferation and Ig secretion in response to mitogens or foreign antigens.

[0292] Granulocyte macrophage colony-stimulating factor (GM-CSF) plays a key role in embryonic transplantation and development. GM-CSF is one of the earliest cytokines discovered to have an effect on DCs. In DC culture, GM-CSF promotes the differentiation of monocytes into large macrophage-like cells and enhances the expression of MHC class II molecules on the cell surface, thereby enhancing the cells' antigen presentation function. GM-CSF also promotes DC survival. In cellular immunotherapy, GM-CSF can stimulate immune responses and produce anti-tumor activity by activating macrophages and DCs. Regarding antigen presentation, GM-CSF promotes DC maturation, upregulating co-stimulatory molecules, and CD1d receptor expression. Recent studies have shown that GM-CSF stimulates the differentiation of hematopoietic progenitor cells into monocytes and neutrophils, thereby reducing the risk of febrile neutropenia in cancer patients. Other studies have demonstrated that GM-CSF can induce the differentiation of bone marrow DCs, promote a Th1 cell-biased immune response, promote angiogenesis, and influence the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is clinically used to treat malignant tumors.

[0293] In this application, the term "nucleic acid molecule" generally refers to nucleotides of any length. In this application, the term "nucleic acid molecule" can encode the protein contained in the oncolytic virus. In this application, the nucleic acid molecule can include DNA and / or RNA. In some cases, the RNA can include single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA can include sense RNA, antisense RNA (anti-sense RNA), or ambisense RNA.

[0294] In this application, the term "prevention" generally refers to preventing the generation and onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment generally refers to administering one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In certain embodiments, "treatment" can be administering the drug combination and / or pharmaceutical product in the presence or absence of other drugs after the onset of symptoms of a particular disease. For example, the use of the drug combination and / or pharmaceutical product described herein prevents the generation, development, recurrence, and / or metastasis of a tumor.

[0295] In this application, the term "tumor" generally refers to any new pathological tissue growth. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematologic tumor. For research purposes, these tissues can be isolated from readily available sources using methods well known to those skilled in the art.

[0296] In some specific embodiments, the tumor includes but is not limited to acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensorineuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, Gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.

[0297] Detailed Description of the Invention

[0298] A wild-type VSV virus, specifically the Indiana strain of VSV virus, or the Indiana Mudd Summer subtype of VSV virus. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 12; the amino acid sequence of its N protein is shown in SEQ ID NO 14; the amino acid sequence of its P protein is shown in SEQ ID NO 16; and the amino acid sequence of its L protein is shown in SEQ ID NO 18. In the present application, the M protein, G protein, N protein, P protein, and L protein can all be modified.

[0299] A recombinant oncolytic virus is obtained by mutating sites on the amino acid sequences of the wild-type VSV virus, including its M protein, G protein, N protein, P protein, and L protein.

[0300] The present application provides a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug, specifically comprising: using a small molecule anticancer drug and a recombinant oncolytic virus to treat tumors.

[0301] Small molecule anticancer drugs include small molecule anticancer drugs targeting ALK, small molecule anticancer drugs targeting BTK, small molecule anticancer drugs targeting EGFR, small molecule anticancer drugs targeting FGFR, small molecule anticancer drugs targeting HER2, small molecule anticancer drugs targeting Parp, small molecule anticancer drugs targeting PI3K, small molecule anticancer drugs targeting VEGFR, small molecule anticancer drugs targeting CDK4 / 6, and small molecule anticancer drugs targeting KRAS.

[0302] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0303] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, deletion of the 111th leucine coding base, V221F, V225I, and S226R. 25I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54 Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0304] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0305] Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.

[0306] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0307] Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

[0308] Furthermore, the recombinant oncolytic virus is obtained by introducing an exogenous gene encoding an antigen into the above-mentioned recombinant oncolytic virus.

[0309] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.

[0310] Furthermore, the recombinant oncolytic virus also includes an antigen encoded by an exogenous gene.

[0311] Furthermore, the antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, and MAGE-A10.

[0312] Furthermore, the recombinant oncolytic virus also includes cytokines encoded by exogenous genes.

[0313] Furthermore, the cytokine is selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0314] In the present application, the recombinant oncolytic virus described in the present application can be obtained through a virus packaging process and a virus rescue process. The specific process can include inoculating BSR-T7 cells with a poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids cloned with VSVN, VSV P, and VSVL genes, respectively, to obtain the target oncolytic virus.

[0315] The present application provides a composition comprising the above-mentioned recombinant oncolytic virus and a small molecule anticancer drug.

[0316] In certain embodiments, the composition may include one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. The acceptable ingredients of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The composition of the present application includes but is not limited to liquid, frozen and lyophilized compositions.

[0317] In certain embodiments, the pharmaceutically acceptable carrier can include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delaying agents that are compatible with pharmaceutical administration and are generally safe and non-toxic.

[0318] In certain embodiments, the composition can include parenteral, subcutaneous, intracavitary, intra-arterial, intravenous, intrathecal and / or intranasal administration or direct injection into tissue.For example, the composition can be administered to a patient or subject by infusion or injection. In certain embodiments, the administration of the composition can be carried out in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intra-tissue administration. In certain embodiments, the composition can be administered uninterruptedly. The uninterrupted (or continuous) administration can be achieved by a small pump system worn by the patient, to measure the therapeutic agent flowing into the patient, as described in WO2015 / 036583.

[0319] The present application also provides use of the above composition in preparing a medicament for preventing and / or treating a disease and / or condition.

[0320] The method for treating tumors with a recombinant oncolytic virus combined with a small molecule anticancer drug provided in the present application has a significant inhibitory effect on tumor growth. Moreover, the experimental results of the combined treatment of tumors with a recombinant oncolytic virus directly combined with a small molecule anticancer drug are better than the experimental results of treating tumors with a recombinant oncolytic virus alone or with a small molecule anticancer drug alone; the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed as an antigen fragment and then combined with a small molecule anticancer drug are better than the experimental results of treating tumors with a recombinant oncolytic virus directly combined with a small molecule anticancer drug or the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed as an antigen fragment. Therefore, the method of treating tumors with a recombinant oncolytic virus and a small molecule anticancer drug provided in the present application further effectively improves the therapeutic effect on tumor cells.

[0321] The method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in this application has a good ability to inhibit the growth of tumor cells. It can be judged that the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in this application also has a good ability to inhibit other cancer cells and has broad clinical application prospects.

[0322] The present application is further described in detail below in conjunction with Preparation Examples 1-116 and Examples.

[0323] Preparation Example

[0324] Preparation Example 1-10

[0325] Preparation Examples 1-10 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug.

[0326] This method uses a combination of recombinant oncolytic viruses and small molecule anticancer drugs to treat tumors.

[0327] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein. Among them, M protein, G protein, N protein, P protein and L protein are all obtained by point mutation based on the wild-type VSV virus Indiana Mudd Summer subtype.

[0328] The differences between the preparation examples are: the mutation sites of the M protein are different. The mutation sites of the M protein are as shown in the amino acid sequences of SEQ ID NO 2 to SEQ ID NO 11, respectively. The G protein comprises the amino acid sequence shown in SEQ ID NO 13, the N protein comprises the amino acid sequence shown in SEQ ID NO 15, the P protein comprises the amino acid sequence shown in SEQ ID NO 17, and the L protein comprises the amino acid sequence shown in SEQ ID NO 19.

[0329] The mutation sites of each protein and the types of small molecule anticancer drugs are shown in Table 1.

[0330] The construction methods of the recombinant oncolytic viruses provided in the above preparation examples are as follows:

[0331] (1) Construction of vector

[0332] Using the pRV-core plasmid (BioVector NTCC Plasmid Vector Culture Cell Gene Collection Center) as a template, PCR technology was used to introduce the M protein mutation site, G protein mutation site, N protein mutation site, P protein mutation site, and L protein mutation site shown in Table 1.

[0333] Gene fragments containing the above-mentioned protein mutation sites, each containing XbaI and MluI restriction sites, were synthesized and used as templates for PCR amplification. The PCR products were then subjected to 1% agarose gel electrophoresis, double-digested with XbaI and MluI, and recovered using a gel recovery kit to obtain gene fragments containing the M protein mutation site, the G protein mutation site, the N protein mutation site, the P protein mutation site, and the L protein mutation site, respectively. The RV-core plasmid was double-digested with XbaI and MluI, and recovered using a gel recovery kit to obtain the pRV-core restriction-digested backbone fragment.

[0334] The above-mentioned gene fragments with M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites were respectively connected with the backbone fragments recovered by enzyme digestion of pRV-core and transformed into plates. Single clones were selected for PCR verification to obtain the constructed plasmid pRV-core Mut, which was sent to a sequencing company for sequencing.

[0335] Table 1 Recombinant oncolytic viruses and small molecule anticancer drugs in Preparation Examples 1-10

[0336] (2) Virus rescue

[0337] The constructed plasmid pRV-core Mut was transfected into BSR-T7 cells (purchased from ATCC, American Type Culture Collection, also known as the American Type Culture Collection) by cell transfection technology using a calcium phosphate transfection kit (Thermo Fisher Scientific).

[0338] The four plasmids pRV-core Mut, pP, pN, and pL were mixed in a mass ratio of 10:5:4:1, resulting in a total of 5 μg of plasmid. The plasmids were diluted in 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of Transfection Reagent Plus Reagent (Life Technologies) were added to obtain a transfection plasmid premix. Among them, pP (a plasmid carrying the baculovirus phosphoprotein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), and pL (a plasmid carrying the baculovirus polymerase protein gene) were all derived from the pCAGGS vector (purchased from ATCC).

[0339] 10 μl of lipofectamine LTX (Thermo Fisher Scientific) was diluted with 200 μl of opti-MEM medium to obtain an LTX mixture;

[0340] Plasmid transfection was performed according to the instructions of lipofectamine LTX. After 6 h, BSR-T7 cells were washed twice with PBS and further inoculated in DMEM medium containing 10% fetal bovine serum (Thermo Fisher Scientific) and cultured for 3 days;

[0341] The cell supernatant obtained from culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured at 37°C for 3 days. The green fluorescence in the cells was observed under a fluorescence microscope to determine the virus rescue. The rescued mutant rod-shaped virus library was further passaged through Vero cells, and monoclonal virus strains were selected using an established plaque screening system.

[0342] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit, and reverse transcription was performed using random primers. PCR was performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, primers designed for the G protein gene sequence, primers designed for the N protein gene sequence, primers designed for the P protein gene sequence, primers designed for the L protein gene sequence, and primers designed for the antigen-encoding gene sequence;

[0343] The primer sequences designed for the M protein gene sequence are:

[0344] PF:ATGAGTTCCTTAAAGAA;

[0345] PR:TCATTTGAAGTGG.

[0346] The primer sequences designed for the G protein gene sequence are:

[0347] PF:ATGAAGTGCCTTTTGTACTTAG;

[0348] PR:TTACTTTCCAAGTCGGTTCATCT.

[0349] The primer sequences designed for the N protein gene sequence are:

[0350] PF:ATGTCTGTTACAGTCAAGAG;

[0351] PR:TCATTTGTCAAATTCTGACTT.

[0352] The primer sequences designed for the P protein gene sequence are:

[0353] PF:ATGGATAATCTCACAAAAGTTCG;

[0354] PR:CTACAGAGAATATTTGACTCTCG.

[0355] The primer sequences designed for the L protein gene sequence are:

[0356] PF:ATGGAAGTCCACGATTTTGAGA;

[0357] PR:TTAATCTCTCCAAGAGTTTTCCT.

[0358] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0359] Preparation Example 11-49

[0360] Preparation Examples 11-49 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug.

[0361] This method uses a combination of recombinant oncolytic viruses and small molecule anticancer drugs to treat tumors.

[0362] The recombinant oncolytic virus comprises M protein, G protein, N protein, P protein, L protein and antigen. The mutation sites of M protein, G protein, N protein, P protein and L protein are the same as the corresponding mutation sites in Preparation Example 2.

[0363] The differences lie in the types of antigens and small molecule anticancer drugs. The mutation sites, antigen types, and small molecule anticancer drug types of each protein are shown in Table 2.

[0364] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 2. The specific differences in the construction method are:

[0365] Between step (1) constructing the vector and step (2) rescuing the virus, the following steps are also included: inserting the exogenous gene encoding the antigen. Specifically, the plasmid pRV-core Mut obtained in step (1) is treated with Xho I and Mlu I for double enzyme digestion to recover the long fragment. The exogenous gene encoding the antigen is synthesized by a gene synthesis company and amplified with corresponding primers, and double enzyme digestion is performed with Xho I and Nhe I to recover the target gene fragment. The pRV-core Mut treated with double enzyme digestion and the exogenous gene fragment are connected and transformed, and a single clone is selected. After PCR or enzyme digestion identification, it is sent to a sequencing company for sequencing to obtain the plasmid pRV-core Mut carrying the exogenous gene. In step (2) virus rescue, the plasmid pRV-core Mut carrying the exogenous gene is used to transfect BSR-T7 cells.

[0366] Step (3) involves sequencing each type of antigen. Viral genomic RNA is extracted using a Trizol kit, reverse transcribed using random primers, and the reverse transcribed cDNA is subjected to PCR using primers designed for the antigen-encoding gene sequence.

[0367] The primer sequences designed for the antigen gene sequence are:

[0368] 1) CD19 F: ACGCTCGAGATGCCACCTCCTCGCCTCC;

[0369] CD19 R:TCTGGCTAGCTCATCTTTTCCTCCTCAGG.

[0370] 2) CD22 F:ATGCATCTCCTCGGCCCCT;

[0371] CD22 R:TCAGAGCCCACAGATTGCCAGG.

[0372] 3)NY-ESO-1F: ACGCTCGAGATGCAGGCAGAAGGAAG;

[0373] NY-ESO-1R:TCTGGCTAGCTCATCTTCTCTGTCCGCTA.

[0374] 4)MAGE A4 F: ACGCTCGAGACAGAGGAGCACCAAGGAG;

[0375] MAGE A4 R:TCTGGCTAGCATAGACTGAGGCATAAGGC.

[0376] 5)Claude 18.2F:ACGCTCGAGATGGACCAGTGGAGCACCC;

[0377] Claude 18.2R:TCTGGCTAGCTTAGGCGATGCACATCATC。

[0378] 6)EGFR F:ACGCTCGAGATGCGACCCTCCGGGACGG;

[0379] EGFR R:TCTGGCTAGCTTACATGAAGAGGCCGAT。

[0380] 7)HER2 F:ATGGAGCTGGCGGCCTTGTGCC;

[0381] HER2 R:TTAGATGAGGATCCCAAAGACCA。

[0382] 8)ALK F:AAGCGGGGGCGGCAGCGGT;

[0383] ALK R:TTTTAGTCATTACAAATAAC。

[0384] 9)BTK F:ATGGCCGCAGTGATTCTGG;

[0385] BTK R:GGATTCTTCATCCATGACA。

[0386] 10)FGFR1 F:ATGTGGAGCTGGAAGTGCC;

[0387] FGFR1 R:TCAGCGGCGTTTGAGTCCG。

[0388] 11)VEGFR F:ACGCTCGAGATGCAGAGCAAGGTGCTG;

[0389] VEGFR R:TCTGGCTAGCTCAGATGATGACAAGAAGT。

[0390] 12)CDK4 F:ATGGCTACCTCTCGATATG;

[0391] CDK4 R:TCACTCCGGATTACCTTCA。

[0392] 13)CDK6 F:ATGGAGAAGGACGGCCTGT;

[0393] CDK6 R: TCAGGCTGTATTCAGCTCC.

[0394] 14)BRAF F:ATGGCGGCGCTGAGCGGTG;

[0395] BRAF R:TCAGTGGACAGGAAACGCA.

[0396] 15)MET F: ACGCTCGAGATGGAGTGCAAGGAGGCC;

[0397] MET R:TCTGGCTAGCTTACAGCCACAGGAAGAAG.

[0398] 16)KRAS G12C F:ATGACTGAATATAAACTTG;

[0399] KRAS G12C R:TTACATTATAATGCATTTT.

[0400] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0401] Table 2 Recombinant oncolytic viruses and small molecule anticancer drugs in Preparation Examples 11-49

[0402] Preparation Examples 50-83

[0403] Preparation Examples 50-83 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug.

[0404] This method uses a combination of recombinant oncolytic viruses and small molecule anticancer drugs to treat tumors.

[0405] The difference between the above preparation example and preparation example 11 is that the recombinant oncolytic virus includes not only M protein, G protein, N protein, P protein, L protein and antigen, but also cytokines. The mutation sites of M protein, G protein, N protein, P protein and L protein are the same as the corresponding mutation sites in preparation example 2.

[0406] The differences are: the type of cytokine and the type of small molecule anticancer drug. The mutation site, antigen type, cytokine type, and small molecule anticancer drug type of each protein are shown in Table 3.

[0407] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 2. The specific differences in the construction method are:

[0408] Between step (1) constructing the vector and step (2) rescuing the virus, the following steps are also included: inserting an exogenous gene encoding a cytokine, with specific reference to the step of inserting an exogenous gene encoding an antigen. The antigen and cytokine are inserted between the G protein and the L protein. The order of insertion of the two can be to insert the cytokine first and then the antigen; or to insert the antigen first and then the cytokine. In this application, the cytokine is inserted first and then the antigen.

[0409] Step (3) also includes sequencing of cytokines. Viral genomic RNA is extracted using a Trizol kit, reverse transcribed using random primers, and the reverse transcribed cDNA is subjected to PCR using primers designed for the cytokine gene sequence.

[0410] The primer sequences designed for the cytokine gene sequences are:

[0411] IL12 F:CCCTCGAGATGTGGCCCCCTGGGT,

[0412] IL12 R: CGGCTAGCTTAACTGCAGGGCACAGATG.

[0413] IL-18F:CCCTCGAGATGGCTCCTGAACCAGTAG,

[0414] IL-18R:CGGCTAGCCTAGTCTTCGTTTTGAAC.

[0415] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0416] Table 3 Recombinant oncolytic viruses and small molecule anticancer drugs in Preparation Examples 50-83

[0417] Preparation Examples 84-91

[0418] Preparation Examples 84-91 and 109 respectively provide a method for treating tumors using a recombinant oncolytic virus.

[0419] The recombinant oncolytic viruses in the above preparation examples are the recombinant oncolytic viruses in Preparation Examples 2, 11, 28, and 45-49, respectively. The details are shown in Table 4. The difference is that the recombinant oncolytic viruses express different types of antigens (for example, Preparation Examples 84-90, 109-116) or the recombinant oncolytic viruses do not express antigens (for example, Preparation Example 91).

[0420] Table 4 Recombinant oncolytic viruses in preparation examples 71-78

[0421] Preparation Examples 92-108

[0422] Preparation Examples 92-108 respectively provide a method for treating tumors using small molecule anticancer drugs.

[0423] The small molecule anticancer drugs in the above preparation examples are the small molecule anticancer drugs in Preparation Examples 11 to 27, as shown in Table 5. The difference is that the types of small molecule anticancer drugs are different.

[0424] Table 5 Small molecule anticancer drugs in Preparation Examples 92-108

[0425] Example

[0426] This example uses the recombinant oncolytic virus and / or small molecule anticancer drug provided in Preparation Examples 1-116 to conduct animal experiments on the method of treating tumors.

[0427] Prepare Balb / c mice and inoculate H22 cells (mouse liver cancer cells) at a concentration of 5×10^5 / 0.1mL / animal. When the average tumor size of the mice reaches 50mm 3 The mice were weighed three times a week and observed once a day. The weight (g) and tumor volume (mm) of the mice were recorded during the experiment. 3 ) changes.

[0428] Euthanize mice if: 1. Tumor volume reaches 2000 mm 3 ; 2. The weight of the mice decreases by more than 20%; 3. There is ulceration on the surface of the tumor; 4. The mice become paralyzed, etc.

[0429] The administration of the recombinant oncolytic virus can be a variety of different administration methods. In this application, the administration of wild oncolytic virus and recombinant oncolytic virus is intratumoral injection (IT) and / or intravenous injection (IV), with a dose of 3e8 PFU / mouse, and an IT administration volume of 2.5 ml / kg. The IV administration volume is 5 ml / kg, and the administration frequency is every 2 days for 6 consecutive times (Q2D*6).

[0430] The administration method for small molecule anticancer drugs is oral administration (PO), the dosage is related to the type of small molecule anticancer drugs, the administration volume is 10 ml / kg, and the administration frequency is once a day for 12 consecutive days (QD*12); or, the administration frequency is twice a day for 12 consecutive days (BID*12).

[0431] The vehicle control (blank control) uses (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline) instead of a small molecule anticancer drug. The administration method is oral administration (PO), the dosage is N / A, the administration volume is 10 ml / kg, and the administration frequency is once a day for 12 consecutive days (QD*12).

[0432] 1. Animal Trials on the Small Molecule Anticancer Drug Mobocertinib

[0433] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 1-10, 11, 28, 45-49, 50, 67, 84-91, and 92. The specific details of the experiments are shown in Table 6.

[0434] The test results are shown in Figure 1.

[0435] Table 6 Animal studies of the small molecule anticancer drug Mobocertinib

[0436] 2. Animal trials of the small molecule anticancer drug Ceritinib

[0437] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 12, 29, 51, 68, 87, 109, 91, and 93. The specific details of the experiments are shown in Table 7.

[0438] The test results are shown in Figure 2.

[0439] Table 7 Animal studies of the small molecule anticancer drug Ceritinib

[0440] III. Animal Trials on the Small Molecule Anticancer Drug Ibrutinib

[0441] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 13, 30, 52, 69, 87, 110, 91, and 94, respectively. The specific details of the experiments are shown in Table 8.

[0442] The test results are shown in Figure 3.

[0443] Table 8 Animal studies of the small molecule anticancer drug Ibrutinib

[0444] IV. Animal Trials on the Small Molecule Anticancer Drug Afatinib

[0445] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 14, 31, 53, 70, 87, 89, 91, and 95. The specific details of the experiments are shown in Table 9.

[0446] The test results are shown in Figure 4.

[0447] Table 9 Animal studies of the small molecule anticancer drug Afatinib

[0448] 5. Animal Trials of the Small Molecule Anticancer Drug Dacomitinib

[0449] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 15, 32, 54, 71, 87, 89, 91, and 96. The specific details of the experiments are shown in Table 10.

[0450] The test results are shown in Figure 5.

[0451] Table 10 Animal studies of the small molecule anticancer drug Dacomitinib

[0452] VI. Animal Trials of the Small Molecule Anticancer Drug Icotinib

[0453] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 16, 33, 55, 72, 87, 89, 91, and 97. The specific details of the experiments are shown in Table 11.

[0454] The test results are shown in Figure 6.

[0455] Table 11 Animal studies of the small molecule anticancer drug Icotinib

[0456] VII. Animal Trials of the Small Molecule Anticancer Drug Lenvatinib

[0457] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 17, 34, 56, 73, 87, 111, 91, and 98. The specific details of the experiments are shown in Table 12.

[0458] The test results are shown in Figure 7.

[0459] Table 12 Animal studies of the small molecule anticancer drug Lenvatinib

[0460] 8. Animal trials of the small molecule anticancer drug Pazopanib

[0461] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 18, 35, 57, 74, 87, 111, 91, and 99. The specific details of the experiments are shown in Table 13.

[0462] The test results are shown in Figure 8.

[0463] Table 13 Animal studies of the small molecule anticancer drug Pazopanib

[0464] IX. Animal Trials of the Small Molecule Anticancer Drug Anlotinib

[0465] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 19, 36, 58, 75, 87, 111, 91, and 100, respectively. The specific details of the experiments are shown in Table 14.

[0466] The test results are shown in Figure 9.

[0467] Table 14 Animal studies of the small molecule anticancer drug Anlotinib

[0468] 10. Animal trials of the small molecule anticancer drug Pyrotinib

[0469] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 20, 37, 59, 76, 87, 90, 91, and 101. The specific details of the experiments are shown in Table 15.

[0470] The test results are shown in Figure 10.

[0471] Table 15 Animal studies of the small molecule anticancer drug Pyrotinib

[0472] 11. Animal trials of the small molecule anticancer drug Niraparib

[0473] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 21, 38, 60, 77, 87, 90, 91, and 102. The specific details of the experiments are shown in Table 16.

[0474] The test results are shown in Figure 11.

[0475] Table 16 Animal studies of the small molecule anticancer drug Niraparib

[0476] 12. Animal trials of the small molecule anticancer drug Olaparib

[0477] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 22, 39, 61, 78, 87, 90, 91, and 103. The specific details of the experiments are shown in Table 17.

[0478] The test results are shown in Figure 12.

[0479] Table 17 Animal studies of the small molecule anticancer drug Olaparib

[0480] 13. Animal Trials of the Small Molecule Anticancer Drug Regorafenib

[0481] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 23, 40, 62, 79, 87, 112, 91, and 104. The specific details of the experiments are shown in Table 18.

[0482] The test results are shown in Figure 13.

[0483] Table 18 Animal studies of the small molecule anticancer drug Regorafenib

[0484] 14. Animal Trials on the Small Molecule Anticancer Drug Palbociclib

[0485] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 24, 41, 63, 80, 87, 113, 91, and 105. The specific details of the experiments are shown in Table 19.

[0486] The test results are shown in Figure 14.

[0487] Table 19 Animal studies of small molecule anticancer drug Palbociclib

[0488] 15. Animal Trials on the Small Molecule Anticancer Drug Vemurafenib

[0489] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 25, 42, 64, 81, 87, 114, 91, and 106. The specific details of the experiments are shown in Table 20.

[0490] The test results are shown in Figure 15.

[0491] Table 20 Animal studies of the small molecule anticancer drug Vemurafenib

[0492] 16. Animal Trials on the Small Molecule Anticancer Drug Savolitinib

[0493] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 26, 43, 65, 82, 87, 115, 91, and 107. The specific details of the experiments are shown in Table 21.

[0494] The test results are shown in Figure 16.

[0495] Table 21 Animal studies of small molecule anticancer drug Savolitinib

[0496] 17. Animal trials of the small molecule anticancer drug Sotorasib

[0497] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or small molecule anticancer drugs provided in Preparation Examples 27, 44, 66, 83, 87, 116, 91, and 108. The specific details of the experiments are shown in Table 22.

[0498] The test results are shown in Figure 17.

[0499] Table 22 Animal studies of small molecule anticancer drug Sotorasib

[0500] The test results are shown in Figures 1 to 17.

[0501] As can be seen from the above figures, the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in the present application has a significant inhibitory effect on tumor growth. And the test results of the recombinant oncolytic virus directly combined with a small molecule anticancer drug for the treatment of tumors are better than the test results of treating tumors with a recombinant oncolytic virus alone or treating tumors with a small molecule anticancer drug alone; the test results of the recombinant oncolytic virus combined with an antigen and then combined with a small molecule anticancer drug for the treatment of tumors are better than the test results of the recombinant oncolytic virus directly combined with a small molecule anticancer drug for the treatment of tumors or the test results of the recombinant oncolytic virus combined with an antigen for the direct treatment of tumors. Therefore, the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided in the present application further effectively improves the therapeutic effect on tumor cells.

[0502] At the same time, in the present application, the method of treating tumors by combining recombinant oncolytic viruses and small molecule anticancer drugs, when the recombinant oncolytic virus has a target paired with a small molecule anticancer drug, the test results are better than the test results when the recombinant oncolytic virus does not have a target paired with a small molecule anticancer drug. Furthermore, when the recombinant oncolytic virus has a target paired with a small molecule anticancer drug and the recombinant oncolytic virus expresses cytokines, the test results are better than the test results when the recombinant oncolytic virus has a target paired with a small molecule anticancer drug but the recombinant oncolytic virus does not express cytokines.

[0503] The above test results indicate that the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided herein has a good ability to inhibit the growth of tumor cells. It can be inferred that the method for treating tumors using a recombinant oncolytic virus and a small molecule anticancer drug provided herein also has a good ability to inhibit other cancer cells and has broad clinical application prospects.

[0504] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. A method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug, characterized in that: Combination therapy of small molecule anticancer drugs and recombinant oncolytic viruses for tumor treatment; The small molecule anticancer drugs include small molecule anticancer drugs targeting ALK, small molecule anticancer drugs targeting BTK, small molecule anticancer drugs targeting EGFR, small molecule anticancer drugs targeting FGFR, small molecule anticancer drugs targeting HER2, small molecule anticancer drugs targeting Parp, small molecule anticancer drugs targeting PI3K, small molecule anticancer drugs targeting VEGFR, small molecule anticancer drugs targeting CDK4 / 6, and small molecule anticancer drugs targeting KRAS; The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, The site mutation of the M protein includes any one or more of M51R, V221F, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, deletion of the leucine encoding base at position 111, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutation of the P protein includes any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

2. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus includes any one or more of rhabdovirus, poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus.

3. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 2, characterized in that: The rhabdovirus includes vesicular stomatitis virus.

4. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes an antigen encoded by an exogenous gene.

5. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The antigen is selected from the group consisting of a hematological tumor antigen and a solid tumor antigen.

6. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 5, characterized in that: The solid tumor antigens include but are not limited to 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD28, CD137, CTLA-4, HER2, HER3, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein, prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, ephrin receptor, PDGFRa, ErbB3, TNFR ... bB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, MET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6 , DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Tyrosine enzyme, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin I I, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycans, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, TPBG, CEA, EpCAM; The hematological tumor antigens include but are not limited to BCMA, CD4, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, and LeY.

7. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 6, characterized in that: The antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, MAGE-A10.

8. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 4, characterized in that: The antigen expressed by the recombinant oncolytic virus is at least one or more.

9. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The small molecule anticancer drugs include: Small molecule anticancer drugs targeting ALK, including but not limited to Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Ensartinib; Small molecule anticancer drugs targeting BTK, including but not limited to Acalabrutinib, Ibrutinib, Zanubrutinib, and Orelabrutinib; Small molecule anticancer drugs targeting EGFR, including but not limited to Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Lapatinib, Mobocertinib, Osimertinib, Rybrevant, Befortinib, Rezortinib, Dasatinib, Brigatinib, Vandetanib, Almonetinib, Furmonertinib; Small molecule anticancer drugs targeting FGFR, including but not limited to Erdafitinib, Infigratinib, Pemazyre, Pemigatinib, Lenvatinib, Pazopanib, Anlotinib, Ponatinib; Small molecule anticancer drugs targeting HER2, including but not limited to Neratinib, Pyrotinib, Tucatinib, Mobocertinib; Small molecule anticancer drugs targeting Parp, including but not limited to Avapritinib, Fluzoparib, Niraparib, Olaparib, and Rucaparib; Small molecule anticancer drugs targeting PI3K, including but not limited to duvelisib and linperlisib; Small molecule anticancer drugs targeting VEGFR, including but not limited to Apatinib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Donafenib, Surufatinib, Fruquintinib; Small molecule anticancer drugs targeting CDK4 / 6, including but not limited to Abemaciclib, Dalpiciclib, Palbociclib, and Ribociclib; Small molecule anticancer drugs targeting KRAS, including but not limited to small molecule anticancer drugs targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H; Small molecule anticancer drugs targeting KRAS G12C, including but not limited to Sotorasib and Adagrasib.

10. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The small molecule anticancer drug is selected from any one or more of the following: Small molecule anticancer drugs for the treatment of melanoma, including but not limited to Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib; Small molecule anticancer drugs for the treatment of cell tumors or sarcomas, including but not limited to Pexidartinib, Tazemetostat, Pazopanib, Anlotinib; Small molecule anticancer drugs for leukemia, including but not limited to Imatinib, Bosutinib, Nilotinib, Gilteritinib, and Ivosidenib; Small molecule anticancer drugs for the indication of NSCLC, including but not limited to Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befortinib.

11. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The small molecule anticancer drug is selected from any one or more of the following: tivazanib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin, Olverembatinib.

12. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The small molecule anticancer drug is selected from any one or more of the following: Danbǎdiǎndexiǎofēnzǐkàngáiyào.bāokuòdànbùxiànyú:Lorlatinib、Acalabrutinib、Ibrutinib、Zanubrutinib、Erlotinib、Gefitinib、Icotinib、Osimertinib、Rybrevant、bèifútìní、ruìzétíni、Erdafitinib、Infigratin ib、Pemazyre、Pemigatinib、Pyrotinib、Tucatinib、Avapritinib、Fluzoparib、Niraparib、Olaparib、Rucaparib、linperlisib、Apatinib、Abemaciclib、Dalpiciclib、Palbociclib ib, Ribociclib, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, Cobimetinib, Pexidartinib, tazemetostat, Gilteritinib, Ivosidenib, Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin; Multi-targeted small molecule anticancer drugs, including but not limited to: Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, tivazanib.

13. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The small molecule anticancer drug is selected from any one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.

14. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes cytokines encoded by exogenous genes.

15. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 14, characterized in that: The cytokine is selected from the group consisting of interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor β, and chemokine family.

16. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 15, characterized in that: The cytokine is selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN- γ, IFN-β, TGF-β and TNF-α.

17. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 16, characterized in that: The cytokine is selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, TNF-α.

18. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with a site mutation, a nucleic acid sequence encoding the G protein with a site mutation, a nucleic acid sequence encoding the N protein with a site mutation, a nucleic acid sequence encoding the P protein with a site mutation, and a nucleic acid sequence encoding the L protein with a site mutation.

19. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 18, characterized in that: The nucleic acid molecule further comprises a nucleic acid sequence encoding a cytokine; and / or the nucleic acid molecule further comprises a nucleic acid sequence encoding an antigen.

20. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 19, characterized in that: The nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with a site mutation; and / or, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with a site mutation.

21. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 1, characterized in that: The method for treating tumors by combining the recombinant oncolytic virus and a small molecule anticancer drug is used to continuously kill abnormally proliferative cells.

22. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 21, characterized in that: The abnormally proliferative cells are selected from tumor cells or cells related to tumor tissue.

23. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 21, characterized in that: The tumor includes a solid tumor or a hematological tumor.

24. The method for treating tumors by combining a recombinant oncolytic virus and a small molecule anticancer drug according to claim 21, characterized in that: The tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma, sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma carcinoma, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.

25. A composition, characterized in that The composition comprises the recombinant oncolytic virus according to claim 1 and a small molecule anticancer drug.

Images