Inhibitors of expression and / or function

Abstract

The present invention relates to inhibitors, and compositions containing inhibitors, and uses of the same in the treatment or prevention of vascular and / or metabolic diseases.

Description

[0001] INHIBITORS OF EXPRESSION AND / OR FUNCTION FIELD The present invention provides inhibitors, such as nucleic acid compounds, such as siRNA, suitable for therapeutic use. Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions. BACKGROUND OF THE INVENTION Inhibitors, such as oligonucleoside / oligonucleotide compounds which are inhibitors of gene expression and / or expression or function of other targets such as LNCRNAs, can have important therapeutic applications in medicine. Oligonucleotides / oligonucleosides can be used to silence genes that are responsible for a particular disease. Gene-silencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleoside / oligonucleotides that prevent the formation of proteins by gene-silencing. A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for the treatment of various diseases including central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases. The present invention relates to inhibitors, such as oligomers e.g. nucleic acids, e.g. oligonucleoside / oligonucleotide compounds, and their use in the treatment and / or prevention of disease. In particular, suitable inhibitors are still needed to help in the prevention and or treatment of diseases such as vascular and / or metabolic disorders. STATEMENTS OF INVENTION The invention is defined as in the claims and relates to, inter alia: In one aspect, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides in a patient. In another aspect, the invention relates to an inhibitor of expression and / or function of B4GALT1, for use in the prevention and / or treatment and / or management of the levels of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides and / or diabetes, in a patient having or at risk of developing a metabolic and / or vascular disease. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of insulin resistance, preferably wherein the inhibitor results in an improvement of insulin resistance. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of glucose, preferably wherein the inhibitor results in lowering of elevated blood levels of glucose. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of insulin, preferably wherein the inhibitor results in lowering of elevated blood levels of insulin. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of HbA1c, preferably wherein the inhibitor results in lowering of elevated blood levels of HbA1c. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of elevated levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated levels of triglycerides. In another aspect, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of vascular disease in a patient, wherein the vascular disease is associated with insulin resistance, and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, and / or diabetes. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with insulin resistance, preferably wherein the inhibitor results in improvement of insulin resistance. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. In one aspect, the invention relates to the inhibitor for use according to the invention, for use in the prevention and / or treatment and / or management of a vascular disease associated with diabetes, preferably wherein the inhibitor results in improvement of diabetes. In another aspect, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, and / or elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol. In one aspect, the invention relates to the inhibitor for use according to the invention, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. In one aspect, the invention relates to the inhibitor for use according to any preceding claim, wherein the patient is a mammalian patient, preferably a human patient. In one aspect, the invention relates to the inhibitor for use according to any preceding claim, wherein the inhibitor of expression and / or function of B4GALT1 is an siRNA oligomer. In one aspect, the invention relates to the inhibitor for use according to the invention, which is an siRNA oligomer is conjugated to one or more ligand moieties. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises: i 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v 2, or more than 2, consecutive abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or vi a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards that terminus; x abasic nucleosides as the 2 terminal nucleosides connected via a 3’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3’-3’ reversed linkage; xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is a 3’3 reversed linkage. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is a 5’5 reversed linkage. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the first and second strand each comprise 2'-Me and 2’-F modifications. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 72’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA, wherein said first strand comprises at least 52’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region. In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA wherein said first strand comprises 7 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate internucleoside linkages. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located as defined herein. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably a terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3’ terminal region thereof. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said SiRNA through a linker. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the siRNA oligomer, preferably at the 3’ terminal region thereof. In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein the ligand moiety comprises In a further aspect, the invention relates to an inhibitor for use according to the invention, having the structure: wherein: R1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligomer In a further aspect, the invention relates to an inhibitor for use according to the invention, having the structure wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligomer. In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, formulated as a pharmaceutical composition with an excipient and / or carrier. In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to the invention, in combination with a pharmaceutically acceptable excipient or carrier. In another aspect, the invention relates to a nucleic acid or pharmaceutical composition, for use in the prevention or treatment of vascular disease, such as cardiovascular disease. FIGURES Figure 1a shows an exemplary linear configuration for a conjugate. Figure 1b shows an exemplary branched configuration for a conjugate. Figures 2-5 show preferred oligomer – linker – ligand constructs of the invention. Figure 6 shows the detail of the formulae described in Sentences 1-101 disclosed herein. Figure 7 shows the detail of formulae described in Clauses 1-56 disclosed herein. Figure 8 shows a selection of active GalNAc-siRNAs with EC50 values less than 100nM. Dose- response in B4GALT1 mRNA knockdown in primary mouse hepatocytes was measured after 48hr incubation with GalNAc-siRNAs targeting mouse B4GALT1 at 10 serial dilutions from 1000nM . EC50values were determined by fitting data to a 4-parameter sigmoidal dose-response (variable slope) equation using GraphPad Prism. 4 active GalNAc-siRNAs, ETXM619, ETXM624, ETXM628 and ETXM633, were selected for in vivo pharmacology. Figure 9 is a summary of B4GALT1 mRNA knockdown effects of multiple dosing of GalNAc- siRNAs, ETXM619, ETXM624, ETXM628 and ETXM633 (10mg / kg) in mouse liver tissues. The y-axis values are the relative mRNA expression to the non-treated group (n=5). Each data point represents the relative mRNA expression as Mean ± SD from n=3 experiment. Red arrows on the top of the graph indicate the days test articles were administered. Figure 10 shows the effect of B4GALT1 mRNA knockdown in plasma LDL-c, glucose and fibrinogen levels. Plasma samples were collected on day 14 after three dosings of ETXMs (10mg / kg, s.c.) on day 0, day 3 and day 7. Compared to the non-treated group ( n=5), the ETXM treated group (n=12) shows significantly reduced levels of LDL-c, glucose and fibrinogen in normal C57BL / 6 mice. Data presented here are Mean± SD. Figure 11 shows liver B4galt1 mRNA expression following 12-week treatment with 3 mg / kg and 10 mg / kg ETXM1201. Compared to negative control animals, liver B4galt1 mRNA levels were significantly reduced. N=12 for all groups. Data presented here are Mean± SD. Data were modelled by a simple linear model. Treatment groups were compared by a t-test. P-values were corrected for multiple comparisons by the FDR method. # indicates p-value for negative control vs. 3 mg / kg ETXM1201, * indicates p-value for negative control against 10 mg / kg ETXM1201. Figure 12 shows the effect of hepatic B4GATL1 inhibition on body weight change over the course of the study. Compared to negative control animals, weight gain was significantly reduced with B4GALT1 inhibition. N=12 for all groups. Data presented here are Mean± SD. Data were modelled by a simple linear model. Treatment groups were compared by a t-test. P-values were corrected for multiple comparisons by the FDR method. # indicates p-value for negative control vs. 3 mg / kg ETXM1201, * indicates p-value for negative control against 10 mg / kg ETXM1201. Figure 13 shows the effect of hepatic B4GALT1 inhibition on plasma total cholesterol (a), LDL cholesterol (LDL-c) (b) and total triglycerides (c) throughout the time-course as well as Plasma FPLC profiles (d,e) at the 12-week timepoint. Compared to negative control animals, B4GALT1 inhibition reduced the levels of circulating cholesterol, LDL-c and triglycerides, and lowered VLDL and LDL levels in the FPLC profile. N=12-15 for all groups. Data presented here are Mean± SD except (d) and (e) which shows data from pooled samples. (a)-(c): Data were modelled by a Generalised Additive Mixed Model. Treatment groups were compared by an F-test. Multiple comparison correction by FDR method. # indicates p-value for negative control vs. 3 mg / kg ETXM1201, * indicates p-value for negative control against 10 mg / kg ETXM1201. Figure 14 shows the effect of hepatic B4GALT1 inhibition on plasma free fatty acids at the 12- week timepoint. Compared to negative control animals, B4GALT1 inhibition significantly reduced the levels of circulating FFA. N=12 for all groups. Data presented here are Mean± SD. Data were modelled by a simple linear model. Treatment groups were compared by a t-test using robust standard errors. P-values were corrected for multiple comparisons by the FDR method. * indicates p-value for negative control against 10 mg / kg ETXM1201. Figure 15 shows the effect of hepatic B4GALT1 inhibition on plasma fibrinogen levels throughout the time-course. Compared to negative control animals, B4GALT1 inhibition significantly reduced the levels of plasma fibrinogen. N=12-15 for all groups. Data presented here are Mean± SD. Data were modelled by a Generalised Additive Mixed Model. Treatment groups were compared by an F-test. Multiple comparison correction by FDR method. * indicates p-value for negative control against 10 mg / kg ETXM1201. Figure 16 shows the effect of hepatic B4GALT1 inhibition on plasma glucose (a), insulin (b) QUICKI index (c) and HbA1c (d) throughout the time-course, as well as the results of an oral glucose tolerance test (OGTT), (e, f). Compared to negative control animals, B4GALT1 inhibition reduced the levels of glucose, insulin and HbA1c and increased the QUICKI index indicating higher insulin sensitivity. Compared to negative control animals, B4GALT1 inhibition reduced the glucose levels in the OGTT as well as the area under the glucose curve (AUC). N=12-15 for all groups. Data presented here are Mean± SD. Time-course: Data were modelled by a Generalised Additive Mixed Model. Treatment groups were compared by an F-test. Multiple comparison correction by FDR method. OGTT curve: Data were modelled by a Generalised Additive Model. Treatment groups were compared by a parametric bootstrap. Multiple comparison correction by FDR method. AUC: Data were modelled by a simple linear model. Treatment groups were compared by a t-test using robust standard errors. P-values were corrected for multiple comparisons by the FDR method. # indicates p-value for negative control vs.3 mg / kg ETXM1201, * indicates p-value for negative control against 10 mg / kg ETXM1201. DETAILED DESCRIPTION The present invention provides, inter alia, inhibitors, for example oligomers such as nucleic acids, such as inhibitory RNA molecules (which may be referred to as iRNA or siRNA ), and compositions containing the same which can affect expression of a target, for example by binding to mRNA transcribed from a gene, or by inhibiting the function of nucleic acids such as long non- coding RNAs (herein “LNCRNA”). The target may be within a cell, e.g. a cell within a subject, such as a human. The inhibitors can be used to prevent and / or treat medical conditions associated with the e.g. the expression of a target gene or presence / activity of a nucleic acid in a cell e.g. such as a long non-coding RNA. In particular, the present invention identifies inhibitors of post translational glycosylation, such as an inhibitor of B4GALT1, as useful in the prevention and / or treatment of vascular and / or metabolic diseases, as defined in more detail herein below. B4GALT1 is Beta-1,4-galactosyltransferase 1, an enzyme that in humans is encoded by the B4GALT1 gene (SEQ ID NO:1). DEFINITIONS The “first strand”, also called the antisense strand or guide strand herein and which can be used interchangeably herein, refers to the nucleic acid strand, e.g. the strand of an siRNA, e.g. a dsiRNA, which includes a region that is substantially complementary to a target sequence, e.g. to an mRNA. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. In some embodiments, a double stranded nucleic acid e.g. an siRNA agent of the invention includes a nucleotide mismatch in the antisense strand. The “second strand” (also called the sense strand or passenger strand herein, and which can be used interchangeably herein), refers to the strand of a nucleic acid e.g. siRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. In the context of molecule comprising a nucleic acid provided with a ligand moiety, optionally also with a linker moiety, the nucleic acid of the invention may be referred to as an oligonucleotide moiety or oligonucleoside moiety Oligonucleotides are short nucleic acid polymers. Whilst oligonucleotides contain phosphodiester bonds between the nucleoside component thereof (base plus sugar), the present invention is not limited to oligonucleotides always joined by such a phosphodiester bond between adjacent nucleosides, and other oligomers of nucleosides joined by bonds which are bonds other than a phosphate bond are contemplated. For example, a bond between nucleotides may be a phosphorothioate bond. Therefore, the term “oligonucleoside” herein covers both oligonucleotides and other oligomers of nucleosides. An oligonucleoside which is a nucleic acid having at least a portion which is an oligonucleotide is preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides is also preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides, and also having one or more phosphorothioate backbone bonds between nucleosides (typically in a terminal region of the first and / or second strands) is also preferred according to the present invention. In some embodiments, a double stranded nucleic acid e.g. siRNA agent of the invention includes a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is, for example, within 5, 4, 3, 2, or 1 nucleosides from the 3 '-end of the nucleic acid e.g. siRNA. In another embodiment, the nucleoside mismatch is, for example, in the 3'- terminal nucleoside of the nucleic acid e.g. siRNA. A "target sequence" (which may be called a target RNA or a target mRNA) refers to a contiguous portion of the nucleoside sequence of an mRNA molecule formed during the transcription of a gene, including mRNA that is a product of RNA processing of a primary transcription product, or can be a contiguous portion of the nucleotide sequence of any RNA molecule such as a LNCRNA which it is desired to inhibit. The target sequence may be from about 10-35 nucleosides in length, e.g., about 15-30 nucleosides in length. For example, the target sequence can be from about 15-30 nucleosides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18- 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20- 23, 20-22, 20- 21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. The term “ribonucleoside” or “nucleoside” can also refer to a modified nucleoside as further detailed below. A nucleic acid can be a DNA or an RNA, and can comprise modified nucleosides. RNA is a preferred nucleic acid. The terms "iRNA", “siRNA”, "RNAi agent," and "iRNA agent," "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA through RNA interference (RNAi). A double stranded RNA is referred to herein as a "double stranded siRNA (dsiRNA) agent", "double stranded siRNA (dsiRNA) molecule", "double stranded RNA (dsRNA) agent", "double stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", which refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti- parallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA. The majority of nucleosides of each strand of the nucleic acid, e.g. a dsiRNA molecule, are preferably ribonucleosides, but in that case each or both strands can also include one or more non-ribonucleosides, e.g., a deoxyribonucleoside or a modified ribonucleoside. In addition, as used in this specification, an "siRNA" may include ribonucleosides with chemical modifications. The term "modified nucleoside" refers to a nucleoside having, independently, a modified sugar moiety, a modified internucleoside linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleoside encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. Any such modifications, as used in a siRNA type molecule, are encompassed by "iRNA" or "RNAi agent" or “siRNA” or “siRNA agent” for the purposes of this specification and claims. The duplex region of a nucleic acid of the invention e.g. a dsRNA may range from about 9 to 40 base pairs in length such as 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15- 25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. The two strands forming the duplex structure may be different portions of one larger molecule, or they may be separate molecules e.g. RNA molecules. The term "nucleoside overhang" refers to at least one unpaired nucleoside that extends from the duplex structure of a double stranded nucleic acid. A ds nucleic acid can comprise an overhang of at least one nucleoside; alternatively the overhang can comprise at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more. A nucleoside overhang can comprise or consist of a nucleoside analog, including a deoxynucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the / nucleoside(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand. In certain embodiments, the antisense strand has a 1-10 nucleoside, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleoside overhang at the 3'-end or the 5'-end. "Blunt" or "blunt end" means that there are no unpaired nucleoside at that end of the double stranded nucleic acid, i.e., no nucleoside overhang. The nucleic acids of the invention include those with no nucleoside overhang at one end or with no nucleoside overhangs at either end. Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence, refers to the ability of an oligonucleoside comprising the first nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleoside or polynucleoside comprising the second nucleoside sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Complementary sequences within nucleic acid e.g. a dsiRNA, as described herein, include base- pairing of the oligonucleoside or polynucleoside comprising a first nucleoside sequence to an oligonucleoside or polynucleoside comprising a second nucleoside sequence over the entire length of one or both nucleoside sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" or “partially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably not more than 5, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g. , inhibition of mRNA expression via a RISC pathway. Overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a nucleic acid e.g. dsRNA comprising one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside comprises a sequence of 17 nucleosides that is fully complementary to the shorter oligonucleoside, can yet be referred to as "fully complementary". "Complementary" sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non- Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms "complementary," "fully complementary" and "substantially / partially complementary" herein can be used with respect to the base matching between the sense strand and the antisense strand of a nucleic acid e.g. dsiRNA, or between the antisense strand of a double stranded nucleic acid e.g. siRNA agent and a target sequence. Within the present invention, the second strand of the nucleic acid according to the invention, in particular a dsiRNA for inhibiting B4GALT1, is at least partially complementary to the first strand of said nucleic acid. In certain embodiments, a first and second strand of a nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. Alternatively, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs, wherein at least 14, 15, 16 or 17 of said base pairs are complementary base pairs, in particular Watson-Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs, wherein at least 14, 15, 16, 17, 18 or all 19 base pairs are complementary base pairs, in particular Watson- Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs, wherein at least 16, 17, 18, 19, 20 or all 21 base pairs are complementary base pairs, in particular Watson-Crick base pairs. As used herein, a nucleic acid that is "substantially complementary” or “partially complementary” to at least part of a messenger RNA (mRNA) refers to a polynucleoside that is substantially or partially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a protein). In certain embodiments, the contiguous portion of the mRNA is a sequence as listed in Table 1, i.e., any one of SEQ ID NOs:2-21 or 102-201. For example, a polynucleoside is complementary to at least a part of an mRNA of a gene of interest if the sequence is substantially or partially complementary to a non-interrupted portion of the mRNA. Accordingly, in some preferred embodiments, the antisense oligonucleosides as disclosed herein are fully complementary to the target mRNA sequence. In other embodiments, the antisense oligonucleosides disclosed herein are substantially or partially complementary to a target RNA sequence and comprise a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the target RNA sequence, such as at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary or 100% complementary. In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention is partially or fully complementary to a contiguous portion of RNA transcribed from the B4GALT1 gene. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of at least 17 nucleosides of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18 or 19 nucleosides of any one of the sequences as listed in Table 1, i.e., any one of SEQ ID NOs: 2-21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 19, 20, 21, 22 or 23 nucleosides of any one of SEQ ID NOs: 102-201. In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention is partially complementary to a contiguous portion of the B4GALT1 mRNA if it comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2- 21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 19 nucleosides, wherein at least 14, 15, 16, 17, 18 or all 19 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2- 21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 21 nucleosides, wherein at least 16, 17, 18, 19, 20 or all 21 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of SEQ ID NOs: 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 23 nucleosides, wherein at least 18, 19, 20, 21, 22 or all 23 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of SEQ ID NOs: 102-201. In some embodiments, a nucleic acid e.g. an siRNA of the invention includes a sense strand that is substantially or partially complementary to an antisense polynucleoside which, in turn, is complementary to a target mRNA sequence and comprises a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleoside sequence of the antisense strand, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. In some embodiments, a nucleic acid e.g. an siRNA of the invention includes an antisense strand that is substantially or partially complementary to the target sequence and comprises a contiguous nucleoside sequence which is at least 80% complementary over its entire length to the target sequence such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate or a bird that expresses the target gene, either endogenously or heterologously, when the target mRNA sequence has sufficient complementarity to the nucleic acid e.g. iRNA agent to promote target knockdown. In certain preferred embodiments, the subject is a human. The terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with gene expression. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Treatment can include prevention of development of co-morbidities, e.g. reduced liver damage in a subject with a hepatic infection. The terms "manage" or “management” are used herein in their conventional sense to mean that the symptoms associated with the condition afflicting the subject are at least kept under control (i.e., magnitude of the symptom are kept within a predetermined level), where in some instances the symptoms are ameliorated without eliminating the underlying condition. The terms “prevent” or “prevention” as used herein are defined as eliminating or reducing the likelihood of occurrence of one or more symptoms of a disease or disorder. For example, the inhibitor disclosed herein can be used to prevent the occurrence of metabolic and / or vascular diseases. "Therapeutically effective amount," as used herein, is intended to include the amount of a nucleic acid e.g. an iRNA that, when administered to a patient for treating a subject having disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease or its related comorbidities). The phrase "pharmaceutically acceptable" is employed herein to refer to compounds, materials, compositions, or dosage forms which are suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Where a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention. The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. For example, "sense strand or antisense strand" is understood as "sense strand or antisense strand or sense strand and antisense strand." The term "about" is used herein to mean within the typical ranges of tolerances in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that "about" can modify each of the numbers in the series or range. The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21 nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range. As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of "no more than 2 nucleosides" has a 2, 1, or 0 nucleoside overhang. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range. The terminal region of a strand is the last 5 nucleotides from the 5’ or the 3’ end. A nucleobase sequence is the sequence of the bases of the nucleic acid in an oligomer. Various embodiments of the invention can be combined as determined appropriate by one of skill in the art. TARGET A target for inhibition disclosed herein may be, without limitation, an mRNA, LNCRNA, polypeptide, protein, or gene. The target herein is a target involved in the post translational glycosylation pathway for proteins. These are preferably a target the inhibition of which helps in the prevention or treatment of diabetes. A preferred target for inhibition is B4GALT1, and inhibition may be effected by inhibition of expression or function of the mRNA or protein or both. In one aspect the target is a mRNA expressed from a gene or a long non-coding RNA (LNCRNA). In a preferred embodiment, the target is an mRNA that is the result of expression of the B4GALT1 gene. Exemplary target sequences on the B4GALT1 mRNA are listed below in Table 1. Table 1 SEQ ID NO Oligonucleoside mRNA target sequence Starting position on 5’ ^ 3’ NM_001497.4 SEQ ID NO: 2 CUUGAAUUUCCUAUGUAUU 2210 SEQ ID NO: 3 AAUGGAUUUCCUAAUAAUU 1068 SEQ ID NO: 4 UCAGUAUUUUGGAGGUGUC 1016 SEQ ID NO: 5 UGGAUUUCCUAAUAAUUAU 1070 SEQ ID NO: 6 UGAAUUUCCUAUGUAUUUU 2212 SEQ ID NO: 7 GCUGGAUGUACAGAGAUAC 1301 SEQ ID NO: 8 CCAAAGUGCCUUAAAAGAA 3448 SEQ ID NO: 9 UAUGUAAACUUGAAUUUCC 2202 SEQ ID NO: 10 GGCACAUUUCCGUUGCAAU 967 SEQ ID NO: 11 AUGUAAACUUGAAUUUCCU 2203 SEQ ID NO: 12 AUGGAUUUCCUAAUAAUUA 1069 SEQ ID NO: 13 UGUCUCUGCUCUAAGUAAA 1031 SEQ ID NO: 14 CAAAGUGCCUUAAAAGAAA 3449 SEQ ID NO: 15 UGAAUGUGCCUUUUAAUUA 2822 SEQ ID NO: 16 ACUUGAAUUUCCUAUGUAU 2209 SEQ ID NO: 17 CUGACUUUUCCAAAGUGCC 3439 SEQ ID NO: 18 CAAUGGAUUUCCUAAUAAU 1067 SEQ ID NO: 19 UUCAGUAUUUUGGAGGUGU 1015 SEQ ID NO: 20 CCUGACUUUUCCAAAGUGC 3438 SEQ ID NO: 21 GGAUUUCCUAAUAAUUAUU 1071 SEQ ID NO: 102 GUAAACUUGAAUUUCCUAUGUAU 2209 SEQ ID NO: 103 GCUAUGUAAACUUGAAUUUCCUA 2204 SEQ ID NO: 104 UAUGUAAACUUGAAUUUCCUAUG 2206 SEQ ID NO: 105 AACUUGAAUUUCCUAUGUAUUUU 2212 SEQ ID NO: 106 AAACUUGAAUUUCCUAUGUAUUU 2211 SEQ ID NO: 107 CUAUGUAAACUUGAAUUUCCUAU 2205 SEQ ID NO: 108 GCAUGCUAUGUAAACUUGAAUUU 2200 SEQ ID NO: 109 UGUCUGAUUUCUGAAUGUAAAGU 2035 SEQ ID NO: 110 UGUAAACUUGAAUUUCCUAUGUA 2208 SEQ ID NO: 111 UCAAUGGAUUUCCUAAUAAUUAU 1070 SEQ ID NO: 112 CAAUGGAUUUCCUAAUAAUUAUU 1071 SEQ ID NO: 113 GGCAUGCUAUGUAAACUUGAAUU 2199 SEQ ID NO: 114 UUUUGGAGGUGUCUCUGCUCUAA 1026 SEQ ID NO: 115 AAUCCUCAGAGGUUUGACCGAAU 1225 SEQ ID NO: 116 AUCAAUGGAUUUCCUAAUAAUUA 1069 SEQ ID NO: 117 GACUUUUCCAAAGUGCCUUAAAA 3445 SEQ ID NO: 118 CAUGCUAUGUAAACUUGAAUUUC 2201 SEQ ID NO: 119 CCAUCAAUGGAUUUCCUAAUAAU 1067 SEQ ID NO: 120 UAAACUUGAAUUUCCUAUGUAUU 2210 SEQ ID NO: 121 UCUGCUCUAAGUAAACAACAGUU 1039 SEQ ID NO: 122 AUGCUAUGUAAACUUGAAUUUCC 2202 SEQ ID NO: 123 GAGGUGUCUCUGCUCUAAGUAAA 1031 SEQ ID NO: 124 AGCAUGAAUGUGCCUUUUAAUUA 2822 SEQ ID NO: 125 GGAGGUGUCUCUGCUCUAAGUAA 1030 SEQ ID NO: 126 UUUCCAAAGUGCCUUAAAAGAAA 3449 SEQ ID NO: 127 UGCUAUGUAAACUUGAAUUUCCU 2203 SEQ ID NO: 128 UUCAGUAUUUUGGAGGUGUCUCU 1019 SEQ ID NO: 129 CCAGCAUGAAUGUGCCUUUUAAU 2820 SEQ ID NO: 130 AGGUGUCUCUGCUCUAAGUAAAC 1032 SEQ ID NO: 131 GGAGGAGAAGAUGAUGACAUUUU 1102 SEQ ID NO: 132 UUGGAGGUGUCUCUGCUCUAAGU 1028 SEQ ID NO: 133 UUGUCUGAUUUCUGAAUGUAAAG 2034 SEQ ID NO: 134 CCACGGCACAUUUCCGUUGCAAU 967 SEQ ID NO: 135 UGGAUUUCCUAAUAAUUAUUGGG 1074 SEQ ID NO: 136 UGUUCAGUAUUUUGGAGGUGUCU 1017 SEQ ID NO: 137 CAUCAAUGGAUUUCCUAAUAAUU 1068 SEQ ID NO: 138 CAAUCCUCAGAGGUUUGACCGAA 1224 SEQ ID NO: 139 GAUGGUUUGAACUCACUCACCUA 1276 SEQ ID NO: 140 UUUUCCAAAGUGCCUUAAAAGAA 3448 SEQ ID NO: 141 ACUUUUCCAAAGUGCCUUAAAAG 3446 SEQ ID NO: 142 GGUGUCUCUGCUCUAAGUAAACA 1033 SEQ ID NO: 143 AUCCUGACUUUUCCAAAGUGCCU 3440 SEQ ID NO: 144 GUAUUUUGGAGGUGUCUCUGCUC 1023 SEQ ID NO: 145 AUGGUUUGAACUCACUCACCUAC 1277 SEQ ID NO: 146 AUUUUGGAGGUGUCUCUGCUCUA 1025 SEQ ID NO: 147 UGUCUCUGCUCUAAGUAAACAAC 1035 SEQ ID NO: 148 CGGCACAUUUCCGUUGCAAUGGA 970 SEQ ID NO: 149 GCAUGAAUGUGCCUUUUAAUUAG 2823 SEQ ID NO: 150 CACGGCACAUUUCCGUUGCAAUG 968 SEQ ID NO: 151 UAUACCCAAAUCACAGUGGACAU 1330 SEQ ID NO: 152 AUCACAGUGGACAUCGGGACACC 1339 SEQ ID NO: 153 GUGUCUCUGCUCUAAGUAAACAA 1034 SEQ ID NO: 154 CAGAUCCUGACUUUUCCAAAGUG 3437 SEQ ID NO: 155 CAGCAUGAAUGUGCCUUUUAAUU 2821 SEQ ID NO: 156 CUUAUGUUCAGUAUUUUGGAGGU 1013 SEQ ID NO: 157 AAUGGAUUUCCUAAUAAUUAUUG 1072 SEQ ID NO: 158 UGGAGGUGUCUCUGCUCUAAGUA 1029 SEQ ID NO: 159 AGGUGCUGGAUGUACAGAGAUAC 1301 SEQ ID NO: 160 CUGCUCUAAGUAAACAACAGUUU 1040 SEQ ID NO: 161 UCUCUGCUCUAAGUAAACAACAG 1037 SEQ ID NO: 162 UAUGUUCAGUAUUUUGGAGGUGU 1015 SEQ ID NO: 163 UAUUUUGGAGGUGUCUCUGCUCU 1024 SEQ ID NO: 164 ACCCAAAUCACAGUGGACAUCGG 1333 SEQ ID NO: 165 CUCUGCUCUAAGUAAACAACAGU 1038 SEQ ID NO: 166 UUUGGAGGUGUCUCUGCUCUAAG 1027 SEQ ID NO: 167 CUUUUCCAAAGUGCCUUAAAAGA 3447 SEQ ID NO: 168 GGUGCUGGAUGUACAGAGAUACC 1302 SEQ ID NO: 169 GAUCCUGACUUUUCCAAAGUGCC 3439 SEQ ID NO: 170 CUGCGUCUCUCCUCACAAGGUGG 684 SEQ ID NO: 171 AUGGAUUUCCUAAUAAUUAUUGG 1073 SEQ ID NO: 172 ACGGCACAUUUCCGUUGCAAUGG 969 SEQ ID NO: 173 UGUAUACCCAAAUCACAGUGGAC 1328 SEQ ID NO: 174 GUUCAGUAUUUUGGAGGUGUCUC 1018 SEQ ID NO: 175 GGCUUUCAAGAAGCCUUGAAGGA 862 SEQ ID NO: 176 AAUUAUUGGGGCUGGGGAGGAGA 1087 SEQ ID NO: 177 GGACAUCGGGACACCGAGCUAGC 1347 SEQ ID NO: 178 AGAUCCUGACUUUUCCAAAGUGC 3438 SEQ ID NO: 179 GUAUACCCAAAUCACAGUGGACA 1329 SEQ ID NO: 180 CCAUUCCGCAACCGGCAGGAGCA 718 SEQ ID NO: 181 GUGCUGGAUGUACAGAGAUACCC 1303 SEQ ID NO: 182 GACUGCGUCUCUCCUCACAAGGU 682 SEQ ID NO: 183 CAAAUCACAGUGGACAUCGGGAC 1336 SEQ ID NO: 184 GUCUCUGCUCUAAGUAAACAACA 1036 SEQ ID NO: 185 AUGUUCAGUAUUUUGGAGGUGUC 1016 SEQ ID NO: 186 AUUAUUGGGGCUGGGGAGGAGAA 1088 SEQ ID NO: 187 CCUUAUGUUCAGUAUUUUGGAGG 1012 SEQ ID NO: 188 AUACCCAAAUCACAGUGGACAUC 1331 SEQ ID NO: 189 GGAUUUCCUAAUAAUUAUUGGGG 1075 SEQ ID NO: 190 UCACAGUGGACAUCGGGACACCG 1340 SEQ ID NO: 191 UUGUAUACCCAAAUCACAGUGGA 1327 SEQ ID NO: 192 AUUGGGGCUGGGGAGGAGAAGAU 1091 SEQ ID NO: 193 UUAUGUUCAGUAUUUUGGAGGUG 1014 SEQ ID NO: 194 UGGACAUCGGGACACCGAGCUAG 1346 SEQ ID NO: 195 ACAGUGGACAUCGGGACACCGAG 1342 SEQ ID NO: 196 UAAUUAUUGGGGCUGGGGAGGAG 1086 SEQ ID NO: 197 UUGGGGCUGGGGAGGAGAAGAUG 1092 SEQ ID NO: 198 GGACUGCGUCUCUCCUCACAAGG 681 SEQ ID NO: 199 CUAAUAAUUAUUGGGGCUGGGGA 1082 SEQ ID NO: 200 AAUCACAGUGGACAUCGGGACAC 1338 SEQ ID NO: 201 ACUGCGUCUCUCCUCACAAGGUG 683 It is to be understood that SEQ ID NOs: 2 to 21 and 102 to 201 relate to human (Homo sapiens) mRNA sequences. DISEASE / CONDITIONS In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides in a patient. In certain embodiment, the patient is a patient having or at risk of developing a metabolic or vascular disease. Accordingly, certain embodiments of the invention relate to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance in a patient, preferably wherein the inhibitor results in the improvement of insulin resistance. The term "insulin resistance" as used herein, relates to a condition in which the cells no longer respond well to insulin. As a result, pancreatic beta cells will normally increase their insulin production and secrete more insulin into the bloodstream in an effort to reduce blood glucose levels and compensate for the insulin resistance. Blood glucose levels will normally increase as a result of insulin resistance. Different methods to determine insulin resistance and / or sensitivity in a patient are known in the art. One commonly used method is the “quantitative insulin sensitivity check index" (QUICKI) method. A QUICKI score may be calculated with the formula QUICKI = 1 / (log(fasting Glucose, mg / dl) + log(fasting Insulin, μU / ml). Fasting glucose and insulin levels may be determined as disclosed herein. It was surprisingly shown herein that treatment of mice with an siRNA that inhibits the expression of B4GALT1 significantly increased insulin sensitivity of mice that have been fed a high caloric diet compared to mice that did not receive the siRNA, as indicated by an increased QUICKI score of these mice (see Example 9 and Figure 16 C). Insulin resistance in humans is typically indicated by a QUICKI score of 0.35 or lower. Accordingly, a human patient may be characterized as being insulin resistant or being at risk of developing insulin resistance when having a QUICKI score of 0.45 or lower, preferably 0.4 or lower, more preferably 0.35 or lower. In certain embodiments, an inhibitor according to the invention may be determined to increase insulin sensitivity and / or to reduce insulin resistance in a patient when, in response to treatment with the inhibitor according to the invention, the QUICKI score increases in said patient. For example, the QUICKI score may increase by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Another indicator of insulin sensitivity / resistance is the concentration of HbA1c levels in the blood. HbA1c has the potential to reflect the history of mean blood glucose levels over the preceding weeks or months, and it serves as a marker of insulin sensitivity / resistance. HbA1c levels can be used as a diagnostic tool for the early detection of insulin sensitivity / resistance, wherein high HbA1c levels indicate insulin resistance and low HbA1c levels indicate insulin sensitivity. It was surprisingly shown herein that HbA1c levels were lower in mice that received a high caloric diet when mice were treated with an siRNA that inhibits expression of B4GALT1 (see Example 9 and Figure 16 D). Healthy human patients typically have HbA1c levels below 6% (42 mmol / mol). Accordingly, a human patient may be characterized as having insulin resistance or being at risk of developing insulin resistance when having HbA1c levels in blood of 6% (0.42 mmol / mol) or higher, preferably 6.5% (48 mmol / mol) or higher. In certain embodiments, an inhibitor according to the invention may be determined to increase insulin sensitivity and / or reduce insulin resistance in a patient when, in response to treatment with the inhibitor according to the invention, the HbA1c levels in the blood in said patient are decreased. For example, the HbA1c levels in the blood may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% during a suitable treatment period. To determine the levels of HbA1c in a patient, blood may be collected as described herein, preferably after a fasting period of at least 8 hours. Subsequently, blood HbA1c may be measured using a clinically-validated HbA1c assay kit according to manufacturer’s instructions. Another method to determine insulin sensitivity / resistance in a patient is the oral glucose tolerance test (OGTT). OGTT is a medical test in which glucose is given orally and blood samples taken afterward to determine how quickly it is cleared from the blood. Accordingly, a higher glucose and / or insulin concentration in the blood in response to a glucose bolus indicates insulin resistance and a lower glucose and / or insulin concentration indicates insulin sensitivity. It was surprisingly shown herein that blood glucose levels of mice that received a high caloric diet and were treated with an siRNA that inhibits expression of B4GALT1 were lower in response to a glucose bolus compared to control mice that did not receive the siRNA (see Example 9 and Figure 16 E and F). Insulin resistance in humans may be characterized by insulin levels of ˃100 mIU / L after 60 minutes and ˃ 75 mIU / L after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). Alternatively or in addition, insulin resistance in humans may be characterized by glucose levels of ˃180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). Accordingly, a human patient may be characterized as having insulin resistance or being at risk of developing insulin resistance when having insulin levels of ˃100 mIU / L after 60 minutes and 75 mIU / L after 120 minutes and / or glucose levels of 180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). In certain embodiments, an inhibitor according to the invention is determined to increase insulin sensitivity and / or reduce insulin resistance in a patient when, in response to treatment with the inhibitor according to the invention, said patient is more efficient at clearing glucose from the blood stream, preferably wherein the more efficient clearance of glucose from the blood stream is verified by an improved OGTT test score. An oral glucose tolerance test (OGTT) may be performed after at least 8 hours of fasting by orally giving a bolus of glucose. In humans, the oral glucose dose may be standardized to 75 g in 300 mL water. Blood glucose and / or insulin measurement may be performed as described herein at t=0 minutes (just before administration of glucose) and t=60 and 120 minutes after receiving the glucose bolus. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of insulin resistance in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of insulin resistance in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of glucose in a patient. It was surprisingly shown herein that treatment of mice with an siRNA that inhibits the expression of B4GALT1 significantly reduces the levels of glucose in the blood of mice that have been fed a high caloric diet (see Example 9 and Figure 16 A). Healthy humans typically have fasting glucose plasma levels in in the range of 3.9 – 5.6 mmoL / L. Accordingly, elevated blood levels of glucose may be defined as fasting glucose plasma levels of at least 5.7 mmol / L, at least 5.8 mmol / L, at least 5.9 mmol / L, at least 6.0 mmol / L, at least 6.1 mmol / L, at least 6.2 mmol / L, at least 6.3 mmol / L, at least 6.4 mmol / L, at least 6.5 mmol / L, at least 6.6 mmol / L, at least 6.7 mmol / L, at least 6.8 mmol / L, at least 6.9 mmol / L, or at least 7.0 mmol / L. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of glucose in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of glucose in plasma decreases in a patient. For example, concentration of glucose in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of glucose in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of glucose in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of glucose in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of glucose in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of glucose in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of hyperglycaemia. Hyperglycaemia, is a condition in which an excessive amount of glucose circulates in the blood and may be characterized by blood glucose levels above 125 mg / dL (6.9 mmol / L) while fasting. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of insulin in a patient. It was surprisingly shown herein that treatment of mice with an siRNA that inhibits the expression of B4GALT1 reduces the levels of insulin in the blood of mice that have been fed a high caloric diet (see Example 9 and Figure 16 B). Healthy humans typically have fasting insulin plasma levels in in the range of 5 – 15 μIU / L. Accordingly, elevated blood levels of insulin may be defined as fasting insulin plasma levels of at least 16 μIU / L, at least 17 μIU / L, at least 18 μIU / L, at least 19 μIU / L, at least 20 μIU / L, at least 21 μIU / L, at least 22 μIU / L, at least 23 μIU / L, at least 24 μIU / L, at least 25 μIU / L, at least 26 μIU / L, at least 27 μIU / L, at least 28 μIU / L, at least 29 μIU / L, or at least 30 μIU / L. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of insulin in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of insulin in plasma decreases in a patient. For example, concentration of insulin in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of insulin in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of insulin in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of insulin in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of insulin in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of insulin in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of hyperinsulinemia. Hyperinsulinemia, is a condition in which an excessive amount of insulin circulates in the blood and may be characterized by blood insulin levels above 20 μIU / mL while fasting. The skilled person is aware of methods to determine the concentration of glucose and insulin in the blood. For example, blood may be harvested after a fasting period and plasma may be obtained as known in the art. For humans, the fasting period should last at least 8 hours. Clinically-validated kits for determining the concentration of glucose and insulin in blood / plasma are known to the person skilled in the art. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of HbA1c in a patient. Healthy human patients typically have HbA1c levels below 6% (42 mmol / mol). Accordingly, a human patient may be characterized as having elevated blood levels of HbA1c when having HbA1c levels in blood of 6% (0.42 mmol / mol) or higher, preferably 6.5% (48 mmol / mol) or higher. Thus, in certain embodiments, an inhibitor according to the invention may be determined to manage and / or reduce blood levels of HbA1c in a patient when, in response to treatment with the inhibitor according to the invention, the HbA1c levels in the blood in said patient are decreased. For example, the HbA1c levels in the blood may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% during a suitable treatment period. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of HbA1c in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of HbA1c in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of HbA1c in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of free fatty acids in a patient. It was surprisingly shown herein that treatment of mice with an siRNA that inhibits the expression of B4GALT1 significantly reduces the levels of circulating free fatty acids in mice that have been fed a high caloric diet (see Example 9 and Figure 14). The free fatty acid (FFA) form of fatty acids is an unesterified anion derived primarily from the lipolysis of triacylglycerols, and FFA circulates predominantly bound to albumin in the bloodstream. Healthy humans typically have circulating free fatty acid plasma levels in in the range of 0.1 – 0.6 mmoL / L. Accordingly, elevated blood levels of free fatty acid may be defined as fasting free fatty acid plasma levels of at least 0.6 mmol / L, at least 0.7 mmol / L, at least 0.8 mmol / L, at least 0.9 mmol / L, at least 1 mmol / L, at least 1.1 mmol / L, at least 1.2 mmol / L, at least 1.3 mmol / L, at least 1.4 mmol / L, at least 1.5 mmol / L, at least 1.6 mmol / L, at least 1.7 mmol / L, at least 1.8 mmol / L, at least 1.9 mmol / L, or at least 2 mmol / L. In certain embodiments, an inhibitor according to the invention is determined to manage and / or reduce the concentration of circulating free fatty acids in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of circulating free fatty acids in plasma decreases in a patient. For example, the concentration of circulating free fatty acids in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of circulating free fatty acids in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of circulating free fatty acids in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of free fatty acids in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of free fatty acids in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of free fatty acids in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. The skilled person is aware of methods to measure the concentration of free fatty acids in the blood, in particular in plasma. For example, blood may be harvested after a fasting period and plasma may be obtained as known in the art. For humans, the fasting period should last at least 8 hours. Clinically-validated kits for determining the concentration of free fatty acids (FFA) in blood / plasma are known to the person skilled in the art. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of fibrinogen in a patient. It was surprisingly shown herein that treatment of mice that have been fed a high caloric diet with an siRNA that inhibits the expression of B4GALT1 significantly reduces the levels of fibrinogen in the blood of said mice (see Example 9 and Figure 15). Healthy humans typically have fibrinogen plasma levels in in the range of 200 – 400 mg / dL. Accordingly, elevated blood levels of fibrinogen may be defined as fasting fibrinogen plasma levels of at least 400 mg / dL, at least 425 mg / dL, at least 450 mg / dL, at least 475 mg / dL, at least 500 mg / dL, at least 525 mg / dL, at least 550 mg / dL, at least 575 mg / dL, at least 600 mg / dL, at least 625 mg / dL, at least 650 mg / dL, at least 675 mg / dL, at least 700 mg / dL, at least 725 mg / dL, or at least 750 mg / dL. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of fibrinogen in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of fibrinogen in plasma decreases in a patient. For example, concentration of fibrinogen in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of fibrinogen in plasma is measured under standardized conditions. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of fibrinogen in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of fibrinogen in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of fibrinogen in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. The skilled person is aware of methods to quantify the levels of fibrinogen in the blood / plasma. Clinically-validated kits for determining the concentration of fibrinogen in blood / plasma are known to the person skilled in the art. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of total cholesterol in a patient. It was surprisingly shown herein that treatment of mice with an siRNA that inhibits the expression of B4GALT1 significantly reduces the levels of total cholesterol, LDL-cholesterol and triglycerides in the blood of mice that have been fed a high caloric diet (see Example 9 and Figure 14 A-C). At the same time, an increase in HDL-cholesterol was observed in mice that received the siRNA (Figure 14 D and E). Healthy humans typically have total cholesterol level of below 200 mg / dL. Accordingly, elevated blood levels of total cholesterol may be defined as fasting total cholesterol plasma levels of at least 200 mg / dL, at least 205 mg / dL, at least 210 mg / dL, at least 215 mg / dL, at least 220 mg / dL, at least 225 mg / dL, at least 230 mg / dL, at least 235 mg / dL, or at least 240 mg / dL. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of total cholesterol in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of total cholesterol in plasma decreases in a patient. For example, concentration of total cholesterol in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of total cholesterol in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of total cholesterol in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of total cholesterol in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of total cholesterol in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of total cholesterol in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of LDL cholesterol in a patient. Healthy humans typically have LDL-cholesterol level of below 100 mg / dL. Accordingly, elevated blood levels of LDL-cholesterol may be defined as fasting LDL-cholesterol plasma levels of at least 100 mg / dL, at least 105 mg / dL, at least 110 mg / dL, at least 115 mg / dL, at least 120 mg / dL, at least 125 mg / dL, at least 130 mg / dL, at least 135 mg / dL, at least 140 mg / dL, at least 145 mg / dL, at least 150 mg / dL, at least 155 mg / dL, or at least 160 mg / dL. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of LDL-cholesterol in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of LDL cholesterol in plasma decreases in a patient. For example, concentration of LDL cholesterol in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of LDL cholesterol in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of LDL cholesterol in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of LDL-cholesterol in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of LDL-cholesterol in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of LDL-cholesterol in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In certain embodiments, the invention relates to a pharmaceutical composition comprising a nucleic acid used for the treatment of cardiovascular disease, preferably coronary artery disease, wherein the treatment results in a reduction in LDL-cholesterol (LDL-c) levels in the blood. In certain embodiments, the invention relates to a pharmaceutical composition comprising a nucleic acid used for the treatment of cardiovascular disease, preferably coronary artery disease, wherein the treatment results in a reduction in fibrinogen levels in the blood. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of triglycerides in a patient. Healthy humans typically have triglyceride levels of below 150 mg / dL. Accordingly, elevated blood levels of triglyceride may be defined as fasting triglyceride plasma levels of at least 150 mg / dL, at least 175 mg / dL, at least 200 mg / dL, at least 225 mg / dL, at least 250 mg / dL, at least 275 mg / dL, at least 300 mg / dL, at least 325 mg / dL, at least 350 mg / dL, at least 375 mg / dL, or at least 400 mg / dL. In certain embodiments, an inhibitor according to the invention is determined to manage and / or lower the concentration of triglycerides in the plasma when, in response to treatment with the inhibitor according to the invention, the concentration of triglycerides in plasma decreases in a patient. For example, concentration of triglycerides in plasma may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, or at least 15% during a suitable treatment period. Preferably, the concentration of triglycerides in plasma is measured under standardized conditions, i.e., in a state of fasting. More preferably, the concentration of triglycerides in plasma is measured after a fasting period of at least 8 hours. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of elevated blood levels of triglycerides in a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of triglycerides in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of elevated blood levels of triglycerides in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. The skilled person is aware of methods to quantify the levels of cholesterol and triglycerides in the blood / plasma. Clinically-validated kits for determining the concentration of total cholesterol, LDL-cholesterol and / or triglycerides in blood / plasma are known to the person skilled in the art. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids in a patient, preferably wherein the patient is a patient having or being at risk of developing a metabolic or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, preferably wherein said patient is a patient having or being at risk of developing a metabolic and / or vascular disease, such as any of the metabolic and / or vascular diseases disclosed herein. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with insulin resistance, and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, and / or diabetes. In certain embodiments, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with insulin resistance, and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, and / or diabetes. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with insulin resistance, preferably wherein the inhibitor results in increased insulin sensitivity / in the improvement of insulin resistance. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with insulin resistance, preferably wherein the inhibitor results in increased insulin sensitivity / in the improvement of insulin resistance. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have a QUICKI score of 0.4 or lower and / or HbA1c levels in blood of 6% (0.42 mmol / mol) or higher and / or insulin levels of ˃100 mIU / L after 60 minutes and ˃ 75 mIU / L after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period) and / or glucose levels of ˃180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). In certain embodiments, a patient having or being at risk of developing a vascular disease may have a QUICKI score of 0.35 or lower and / or HbA1c levels in blood of 6.5% (0.48 mmol / mol) or higher and / or insulin levels of ˃100 mIU / L after 60 minutes and ˃ 75 mIU / L after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period) and / or glucose levels of ˃180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may increase insulin sensitivity in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient suffering from insulin resistance and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient suffering from insulin resistance and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have fasting free fatty acids plasma levels of at least 0.6 mmol / L, at least 0.7 mmol / L, at least 0.8 mmol / L, at least 0.9 mmol / L, at least 1 mmol / L, at least 1.1 mmol / L, at least 1.2 mmol / L, at least 1.3 mmol / L, at least 1.4 mmol / L, at least 1.5 mmol / L, at least 1.6 mmol / L, at least 1.7 mmol / L, at least 1.8 mmol / L, at least 1.9 mmol / L, or at least 2 mmol / L. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may lower blood free fatty acid levels in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient having elevated blood levels of free fatty acids and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having elevated blood levels of free fatty acids and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have fasting fibrinogen plasma levels of at least 400 mg / dL, at least 425 mg / dL, at least 450 mg / dL, at least 475 mg / dL, at least 500 mg / dL, at least 525 mg / dL, at least 550 mg / dL, at least 575 mg / dL, at least 600 mg / dL, at least 625 mg / dL, at least 650 mg / dL, at least 675 mg / dL, at least 700 mg / dL, at least 725 mg / dL, or at least 750 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may lower blood fibrinogen levels in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient having elevated blood levels of fibrinogen and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having elevated blood levels of fibrinogen and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have fasting total cholesterol plasma levels of at least 200 mg / dL, at least 205 mg / dL, at least 210 mg / dL, at least 215 mg / dL, at least 220 mg / dL, at least 225 mg / dL, at least 230 mg / dL, at least 235 mg / dL, or at least 240 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may lower blood total cholesterol levels in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient having elevated blood levels of total cholesterol and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having elevated blood levels of total cholesterol and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with elevated blood levels of LDL-cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL-cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with elevated blood levels of LDL-cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL-cholesterol. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have fasting LDL-cholesterol plasma levels of at least 100 mg / dL, at least 105 mg / dL, at least 110 mg / dL, at least 115 mg / dL, at least 120 mg / dL, at least 125 mg / dL, at least 130 mg / dL, at least 135 mg / dL, at least 140 mg / dL, at least 145 mg / dL, at least 150 mg / dL, at least 155 mg / dL, or at least 160 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may lower blood LDL-cholesterol levels in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient having elevated blood levels of LDL-cholesterol and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having elevated blood levels of LDL-cholesterol and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. That is, in certain embodiments, a patient having or being at risk of developing a vascular disease may have fasting triglycerides plasma levels of at least 150 mg / dL, at least 175 mg / dL, at least 200 mg / dL, at least 225 mg / dL, at least 250 mg / dL, at least 275 mg / dL, at least 300 mg / dL, at least 325 mg / dL, at least 350 mg / dL, at least 375 mg / dL, or at least 400 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing a vascular disease may lower blood triglyceride levels in said patient and, in turn, result in the prevention, alleviation or cure of said vascular disease. For example, treating a patient having elevated blood levels of triglycerides and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having elevated blood levels of triglycerides and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of a vascular disease in a patient, wherein the vascular disease is associated with diabetes, preferably wherein the inhibitor results in improvement of diabetes. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with diabetes, preferably wherein the inhibitor results in improvement of diabetes. According to the invention, the term “diabetes” as used herein, refers to a group of metabolic diseases in which a person has high blood sugar, either because the body does not produce enough insulin, or because cells do not respond to the insulin that is produced. There are three main types of diabetes: (1) Type 1 diabetes (T1D): results from the body's failure to produce insulin, and presently requires the person to inject insulin. (Also referred to as insulin-dependent diabetes mellitus, IDDM for short, and juvenile diabetes.) (2) Type 2 diabetes T2D): results from insulin resistance, a condition in which cells fail to use insulin properly, sometimes combined with an absolute insulin deficiency. (Formerly referred to as non-insulin-dependent diabetes mellitus, NIDDM for short, and adult-onset diabetes.) (3) Gestational diabetes (GD): is when pregnant women, who have never had diabetes before, have a high blood glucose level during pregnancy. It may precede development of T2D. In a preferred embodiment, diabetes is T2D. Diabetes may be, without limitation, diagnosed with an oral glucose tolerance test, as disclosed herein. Over time, high blood sugar can damage blood vessels and the nerves that control the heart. Patients with diabetes are also more likely to have other conditions that raise the risk for heart disease. For example, high blood pressure increases the force of blood through the arteries and can damage artery walls. Accordingly, patients suffering from diabetes are more likely to develop vascular and, in particular, cardiovascular diseases. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a diabetes patient having or being at risk of developing a vascular disease may manage or revert diabetes in said patient and, in turn, result in the prevention, alleviation or cure of the vascular disease. For example, treating a patient having diabetes and being at risk of developing a vascular disease with the inhibitor of the invention may prevent manifestation of the vascular disease. Similarly, treating a patient having diabetes and already having a vascular disease with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even cure the vascular disease. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, and / or elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In certain embodiments, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient. In certain embodiments, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, and / or elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, preferably wherein the inhibitor results in the improvement of insulin resistance. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, preferably wherein the inhibitor results in the improvement of insulin resistance. That is, in certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain, and / or metabolic syndrome may have a QUICKI score of 0.4 or lower and / or HbA1c levels in blood of 6% (0.42 mmol / mol) or higher and / or insulin levels of ˃100 mIU / L after 60 minutes and ˃ 75 mIU / L after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period) and / or glucose levels of ˃180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). In certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain, and / or metabolic syndrome may have a QUICKI score of 0.35 or lower and / or HbA1c levels in blood of 6.5% (0.48 mmol / mol) or higher and / or insulin levels of ˃100 mIU / L after 60 minutes and ˃ 75 mIU / L after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period) and / or glucose levels of ˃180 mg / dL (10 mmol / L) after 60 minutes and ˃ 140 mg / dL (7.8 mmol / L) after 120 minutes in an oral glucose tolerance test (75g glucose intake after 12 hour fasting period). Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing obesity and / or body weight gain may increase insulin sensitivity in said patient and, in turn, result in the prevention or reversal of obesity and / or body weight gain. For example, treating a patient suffering from insulin resistance and being at risk of developing obesity and / or body weight gain with the inhibitor of the invention may prevent weight gain or induce weight loss. Similarly, treating a patient suffering from insulin resistance and already being obese with the inhibitor of the invention may prevent further weight gain or induce weight loss. Alternatively, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing metabolic syndrome may increase insulin sensitivity in said patient and, in turn, result in the prevention, alleviation or reversal of metabolic syndrome. For example, treating a patient suffering from insulin resistance and being at risk of developing metabolic syndrome with the inhibitor of the invention may prevent the manifestation of metabolic syndrome in said patient. Similarly, treating a patient suffering from insulin resistance and already having metabolic syndrome with the inhibitor of the invention may prevent worsening or further manifestation of metabolic syndrome or even reverse metabolic syndrome. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids.. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids. That is, in certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain, and / or metabolic syndrome may have fasting free fatty acids plasma levels of at least 0.6 mmol / L, at least 0.7 mmol / L, at least 0.8 mmol / L, at least 0.9 mmol / L, at least 1 mmol / L, at least 1.1 mmol / L, at least 1.2 mmol / L, at least 1.3 mmol / L, at least 1.4 mmol / L, at least 1.5 mmol / L, at least 1.6 mmol / L, at least 1.7 mmol / L, at least 1.8 mmol / L, at least 1.9 mmol / L, or at least 2 mmol / L. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing obesity and / or body weight gain may lower blood levels of free fatty acids in said patient and, in turn, result in the prevention or reversal of obesity and / or body weight gain. For example, treating a patient having elevated blood levels of free fatty acids and being at risk of developing obesity and / or body weight gain with the inhibitor of the invention may prevent weight gain or induce weight loss. Similarly, treating a patient having elevated blood levels of free fatty acids and already being obese with the inhibitor of the invention may prevent further weight gain or induce weight loss. Alternatively, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing metabolic syndrome may lower blood levels of free fatty acids in said patient and, in turn, result in the prevention, alleviation or cure of metabolic syndrome. For example, treating a patient having elevated blood levels of free fatty acids and being at risk of developing metabolic syndrome with the inhibitor of the invention may prevent the manifestation of metabolic syndrome in said patient. Similarly, treating a patient having elevated blood levels of free fatty acids and already having metabolic syndrome with the inhibitor of the invention may prevent worsening or further manifestation of metabolic syndrome or even reverse metabolic syndrome. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In certain embodiments, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. That is, in certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain may have fasting total cholesterol plasma levels of at least 200 mg / dL, at least 205 mg / dL, at least 210 mg / dL, at least 215 mg / dL, at least 220 mg / dL, at least 225 mg / dL, at least 230 mg / dL, at least 235 mg / dL, or at least 240 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing obesity and / or body weight gain may lower blood levels of total cholesterol in said patient and, in turn, result in the prevention or reversal of obesity and / or body weight gain. For example, treating a patient having elevated blood levels of total cholesterol and being at risk of developing obesity and / or body weight gain with the inhibitor of the invention may prevent weight gain or induce weight loss. Similarly, treating a patient having elevated blood levels of total cholesterol and already being obese with the inhibitor of the invention may prevent further weight gain or induce weight loss. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of LDL-cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL-cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of LDL-cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL-cholesterol. That is, in certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain may have fasting LDL-cholesterol plasma levels of at least 100 mg / dL, at least 105 mg / dL, at least 110 mg / dL, at least 115 mg / dL, at least 120 mg / dL, at least 125 mg / dL, at least 130 mg / dL, at least 135 mg / dL, at least 140 mg / dL, at least 145 mg / dL, at least 150 mg / dL, at least 155 mg / dL, or at least 160 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing obesity and / or body weight gain may lower blood levels of LDL-cholesterol in said patient and, in turn, result in the prevention or reversal of obesity and / or body weight gain. For example, treating a patient having elevated blood levels of LDL-cholesterol and being at risk of developing obesity and / or body weight gain with the inhibitor of the invention may prevent weight gain or induce weight loss. Similarly, treating a patient having elevated blood levels of LDL-cholesterol and already being obese with the inhibitor of the invention may prevent further weight gain or induce weight loss. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. That is, in certain embodiments, a patient having or being at risk of developing obesity, and / or body weight gain may have fasting triglyceride plasma levels of at least 150 mg / dL, at least 175 mg / dL, at least 200 mg / dL, at least 225 mg / dL, at least 250 mg / dL, at least 275 mg / dL, at least 300 mg / dL, at least 325 mg / dL, at least 350 mg / dL, at least 375 mg / dL, or at least 400 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing obesity and / or body weight gain may lower blood levels of triglycerides in said patient and, in turn, result in the prevention or reversal of obesity and / or body weight gain. For example, treating a patient having elevated blood levels of triglycerides and being at risk of developing obesity and / or body weight gain with the inhibitor of the invention may prevent weight gain or induce weight loss. Similarly, treating a patient having elevated blood levels of triglycerides and already being obese with the inhibitor of the invention may prevent further weight gain or induce weight loss. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of metabolic syndrome in a patient, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In certain embodiments, the invention relates to a method for prevention and / or treatment and / or management of metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of metabolic syndrome in a patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol. That is, in certain embodiments, a patient having or being at risk of developing metabolic syndrome may have fasting total cholesterol plasma levels of at least 200 mg / dL, at least 205 mg / dL, at least 210 mg / dL, at least 215 mg / dL, at least 220 mg / dL, at least 225 mg / dL, at least 230 mg / dL, at least 235 mg / dL, or at least 240 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing metabolic syndrome may lower blood total cholesterol levels in said patient and, in turn, result in the prevention, alleviation or reversal of metabolic syndrome. For example, treating a patient having elevated blood levels of total cholesterol and being at risk of developing metabolic syndrome with the inhibitor of the invention may prevent manifestation of metabolic syndrome. Similarly, treating a patient having elevated blood levels of total cholesterol and already having metabolic syndrome with the inhibitor of the invention may prevent worsening or further manifestation of metabolic syndrome or even reverse metabolic syndrome. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of metabolic syndrome in a patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol. That is, in certain embodiments, a patient having or being at risk of developing metabolic syndrome may have fasting LDL-cholesterol plasma levels of at least 100 mg / dL, at least 105 mg / dL, at least 110 mg / dL, at least 115 mg / dL, at least 120 mg / dL, at least 125 mg / dL, at least 130 mg / dL, at least 135 mg / dL, at least 140 mg / dL, at least 145 mg / dL, at least 150 mg / dL, at least 155 mg / dL, or at least 160 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing metabolic syndrome may lower blood LDL-cholesterol levels in said patient and, in turn, result in the prevention, alleviation or reversal of metabolic syndrome. For example, treating a patient having elevated blood levels of LDL-cholesterol and being at risk of developing metabolic syndrome with the inhibitor of the invention may prevent manifestation of metabolic syndrome. Similarly, treating a patient having elevated blood levels of LDL- cholesterol and already having metabolic syndrome with the inhibitor of the invention may prevent worsening or further manifestation of the vascular disease or even reverse the vascular disease. In a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of metabolic syndrome in a patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. In a particular embodiment, the invention relates to a method for prevention and / or treatment and / or management of metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein metabolic syndrome is further, or independently, associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides. That is, in certain embodiments, a patient having or being at risk of developing metabolic syndrome may have fasting triglycerides plasma levels of at least 150 mg / dL, at least 175 mg / dL, at least 200 mg / dL, at least 225 mg / dL, at least 250 mg / dL, at least 275 mg / dL, at least 300 mg / dL, at least 325 mg / dL, at least 350 mg / dL, at least 375 mg / dL, or at least 400 mg / dL. Preferably, administration of the inhibitor of expression and / or function of B4GALT1 to a patient having or being at risk of developing metabolic syndrome may lower blood triglyceride levels in said patient and, in turn, result in the prevention, alleviation or reversal of metabolic syndrome. For example, treating a patient having elevated blood levels of triglycerides and being at risk of developing metabolic syndrome with the inhibitor of the invention may prevent manifestation of metabolic syndrome. Similarly, treating a patient having elevated blood levels of triglycerides and already having metabolic syndrome with the inhibitor of the invention may prevent worsening or further manifestation of metabolic syndrome or even reverse metabolic syndrome. As discussed in more detail herein, the inhibitor according to the invention may be used in the prevention and / or treatment and / or management of a metabolic disease. As used herein, the term "metabolic disease" refers to a disease or condition affecting a metabolic process in a subject. Preferably, the metabolic disease refers to disease associated with any of the factors disclosed herein, such as weight gain, obesity, insulin resistance, elevated blood levels of glucose, elevated blood levels of insulin, elevated blood levels of HbA1c, elevated blood levels of free fatty acids, elevated blood levels of fibrinogen, elevated blood levels of total cholesterol, elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides. The patient to be treated may be a patient that already has a metabolic disease or that is at risk of developing a metabolic disease. That is, in certain embodiments, the inhibitor of the present invention may be used in the treatment and / or management of an existing metabolic disease. Treatment and / or management of an existing metabolic disease with the inhibitor of the present invention may prevent worsening of the metabolic disease and / or reverse the metabolic disease. In some instances, treatment of an existing metabolic disease with the inhibitor of the present invention may even cure the metabolic disease. In certain embodiments, the inhibitor of the present invention may be used to prevent manifestation of a metabolic disease in a patient that is at risk of developing a metabolic disease. The skilled person is capable of diagnosing whether a patient has a metabolic disease or is at risk of developing a metabolic disease. For example, a metabolic disease may be diagnosed based weight gain and / or one or more of the blood markers disclosed here. The skilled person is aware of threshold values of one or more blood markers that indicate the presence of a metabolic disease or the risk of developing a metabolic disease. In certain embodiments, the metabolic disease is diabetes, in particular type 2 diabetes (T2D), as defined elsewhere herein. In certain embodiments, the metabolic disease is fatty liver disease, in particular non-alcoholic fatty liver disease (NAFLD). As used herein “fatty-liver disease” refers to a disease wherein fat is excessively accumulated in the liver and can cause severe diseases such as chronic hepatitis and hepatic cirrhosis. In patients with fatty liver disease, lipids, particularly neutral fat, accumulate in hepatocytes to the extent that the amount exceeds the physiologically permissible range. From a biochemical point of view, a standard for judgment of fatty liver is that the weight of neutral fat is about 10% (100 mg / g wet weight) or more of the wet weight of hepatic tissue. Fatty liver disease is generally detected by observation of elevated serum levels of liver-specific enzymes such as the transaminases ALT and AST, which serve as indices of hepatocyte injury, as well as by presentation of symptoms, which include fatigue and pain in the region of the liver, though definitive diagnosis often requires a biopsy. The term “NAFLD” or “non-alcoholic fatty liver disease”, as used herein, relates to a condition occurring when fat is deposited in the liver (steatosis) not due to excessive alcohol use. It is related to insulin resistance and the metabolic syndrome. In certain embodiments, the metabolic disease is non-alcoholic steatohepatitis (NASH). The term “NASH”, as used herein, collectively refers to the state where the liver develops a hepatic disorder (e.g., inflammation, ballooning, fibrosis, cirrhosis, or cancer), or the state where the liver may induce such a pathological condition, and “NASH” is distinguished from “simple steatosis”; i.e., a condition in which fat is simply accumulated in the liver, and which does not progress to another hepatic-disorder-developing condition. In certain embodiments, the metabolic disease is metabolic syndrome. According to the invention, the term “metabolic syndrome” as used herein, refers to a collection of factors (metabolic abnormalities), such as hypertension, obesity, hyperlipidemia, diabetes, central obesity, hyperglycemia, hypertension, and hepatic steatosis among others, associated with increased risk for cardiovascular disease. Metabolic syndrome is becoming increasingly common, largely as a result of the increase in the prevalence of obesity. The International Diabetes Foundation definition of metabolic syndrome is central obesity (body mass index >30 kg / m2) and two or more of: 1) triglycerides >150 mg / dL) high density lipoprotein (HDL)<40 mg / kL in males, <50 mg / dL in females, or specific treatment for low HDL) elevated blood pressure (BP), e.g., systolic BP >130 mm Hg or diastolic BP >85 mm Hg, or treatment for elevated BP, or previous diagnosis of elevated BP) fasting blood glucose >100 mg / dL or previous diagnosis of type 2 diabetes. In certain embodiments, the metabolic disease is obesity. The term “obesity” as used herein refers to a condition in which the natural energy reserve, stored in the fatty tissue of animals, in particular humans and other mammals, is increased to a point where it is associated with certain health conditions or increased mortality. The term “obese” as used herein is defined for an adult human as having a body mass index (BMI) greater than 30. Obesity is commonly associated with excessive body weight gain, in particular diet-induced body weight gain. "(Diet-induced) body weight gain" is defined herein as body weight gain resulting from an excessive dietary intake, including an excessive dietary intake of fat, in particular saturated fat, and optionally an excessive dietary intake of simple sugars, including sucrose and fructose. For a given subject, an excessive dietary intake, in particular of fat and optionally of simple sugars, refers to the consumption of an amount of diet, in particular of fat and optionally of simple sugars, higher than the amount necessary to meet the physiological needs and maintain the energy balance of said subject. The effect of a treatment on reduction of - or prevention - of diet-induced body weight gain in a subject can be assessed by comparing body weight gain observed in a subject receiving the treatment with those observed in the same subject without treatment receiving the same diet and having the same level of physical activity. It has been demonstrated herein that reducing the expression of B4GALT1 mRNA with an siRNA molecule in mice fed a high caloric diet resulted in significantly reduced weight gain compared to mice that did not receive the siRNA molecule (see Example 9 and Fig 12). Accordingly, it has been surprisingly found that inhibiting the expression and / or function of B4GALT1 can prevent body weight gain and / or help in the management of body weight gain. In certain embodiments, an inhibitor according to the invention is determined to manage and / or decrease body weight gain in a patient when, in response to treatment with the inhibitor according to the invention, the body weight of said patient decreases. For example, the body weight of said patient may decrease by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% during a suitable treatment period. In certain embodiments, a patient is at risk of developing obesity if the patient has a BMI greater than 25. In certain embodiments, a patient is obese if the patient has a BMI greater than 30. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 suitable for use, or for use, in prevention and / or treatment and / or management of body weight gain in a patient, wherein the patient is characterized by a BMI ≥ 25, preferably ≥30. In certain embodiments, the invention relates to an inhibitor of expression and / or function of B4GALT1 suitable for use, or for use, in the prevention and / or treatment and / or management of obesity in a patient, wherein the patient is characterized by a BMI ≥ 25, preferably ≥30. The term “body mass index” as used herein means the ratio of weight in kg divided by the height in metres, squared. In certain embodiments, the inhibitor according to the invention may be used in the prevention and / or treatment and / or management of a vascular disease. The term “vascular disease” as used herein refers to any disease, disorder or condition that affects the vascular system, including the heart and blood vessels. Vascular diseases include, without limitation, cardiovascular diseases, cerebrovascular diseases, peripheral vascular diseases, atherosclerosis and arteriosclerotic vascular diseases. Preferably, the vascular disease is a vascular disease that is associated with any of the factors disclosed herein, such as insulin resistance, elevated blood levels of glucose, elevated blood levels of insulin, elevated blood levels of HbA1c, elevated blood levels of free fatty acids, elevated blood levels of fibrinogen, elevated blood levels of total cholesterol, elevated blood levels of LDL cholesterol, elevated blood levels of triglycerides, and / or diabetes. Preferably, the vascular disease is a vascular disease that is associated with any of the factors disclosed herein, such as insulin resistance, elevated blood levels of free fatty acids, elevated blood levels of fibrinogen, elevated blood levels of total cholesterol, elevated blood levels of LDL cholesterol, elevated blood levels of triglycerides and / or diabetes. The patient to be treated may be a patient that already has a vascular disease or that is at risk of developing a vascular disease. That is, in certain embodiments, the inhibitor of the present invention may be used in the treatment and / or management of an existing vascular disease. Treatment and / or management of an existing vascular disease with the inhibitor of the present invention may prevent worsening of the vascular disease and / or reverse the vascular disease. In some instances, treatment of an existing vascular disease with the inhibitor of the present invention may even cure the vascular disease. In certain embodiments, the inhibitor of the present invention may be used to prevent manifestation of a vascular disease in a patient that is at risk of developing a vascular disease. The skilled person is capable of diagnosing whether a patient has a vascular disease or is at risk of developing a vascular disease. For example, a vascular disease may be diagnosed based on one or more of the blood markers disclosed here. The skilled person is aware of threshold values of one or more blood markers that indicate the presence of a vascular disease or the risk of developing a vascular disease. Moreover, various imaging techniques may be used to examine the heart or blood vessels. It is preferred herein that the vascular disease is a cardiovascular disease. The term "cardiovascular disease," as used herein refers to diseases affecting the heart or blood vessels or both, including but not limited to: hypercholesterolemia, atherosclerosis, coronary and cerebral diseases, for instance myocardial infarction, secondary myocardial infarction, myocardial ischemia, angina pectoris, congestive heart diseases, cerebral infarction, cerebral thrombosis, cerebral ischemia and temporary ischemic attacks. In certain embodiments, the vascular disease is atherosclerosis. The term "atherosclerosis" as used herein encompasses vascular diseases and conditions that are recognized and understood by physicians practicing in the relevant fields of medicine. Atherosclerotic cardiovascular disease, coronary heart disease (also known as coronary artery disease or ischemic heart disease), cerebrovascular disease and peripheral vessel disease are all clinical manifestations of atherosclerosis and are therefore encompassed by the terms "atherosclerosis" and "atherosclerotic disease." The inhibitor of the present invention may be administered to prevent or reduce the risk of occurrence, or recurrence where the potential exists, of a coronary heart disease event, a cerebrovascular event, or intermittent claudication. Coronary heart disease events are intended to include CHD death, myocardial infarction (i.e., a heart attack), and coronary revascularization procedures. Cerebrovascular events are intended to include ischemic or haemorrhagic stroke (also known as cerebrovascular accidents) and transient ischemic attacks. Intermittent claudication is a clinical manifestation of peripheral vessel disease. The term "atherosclerotic disease event" as used herein is intended to encompass coronary heart disease events, cerebrovascular events, and intermittent claudication. It is intended that persons who have previously experienced one or more non-fatal atherosclerotic disease events are those for whom the potential for recurrence of such an event exists. The term "atherosclerosis related disorders" should be understood to mean disorders associated with, caused by, or resulting from atherosclerosis. In certain embodiments, the inhibitor for use in the treatment of a cardiovascular disease or atherosclerosis is a double stranded siRNA is conjugated to a ligand, even more preferably a targeting ligand moiety as disclosed herein. Accordingly, in a particular embodiment, the invention relates to an inhibitor of expression and / or function of B4GALT1 for use in management, and / or treatment and / or prevention of cardiovascular disease or atherosclerosis, wherein the inhibitor of expression and / or function of B4GALT1 is an siRNA that is conjugated to a targeting ligand. INHIBITORS Inhibitors of the invention include nucleic acids such as siRNAs, antibodies and antigen binding fragments thereof, e.g., monoclonal antibodies, polypeptides, antibody–drug conjugates, and small molecules. Preferred are nucleic acids such as siRNA. The inhibitor of the present invention may be an inhibitor of expression and / or function of B4GALT1. That is, in certain embodiments, the inhibitor may be an inhibitor of expression of B4GALT1 in a cell. In certain embodiments, the inhibitor may inhibit the function of the B4GALT1 enzyme. It is preferred herein that the inhibitor of the invention inhibits expression of B4GALT1, thus resulting in a knockdown of the B4GALT1 mRNA Knockdown of the B4GALT1 mRNA is preferably achieved with hybridizing nucleic acids, such as siRNAs. The B4GALT1 gene is expressed in various cell types / tissues of the human body. Therefore, targeting specific cell types / tissues with the inhibitor of the invention is not strictly required. However, blood glucose levels and fat metabolism are mainly controlled in the liver. Therefore, targeting the liver and, in particular, hepatocytes with the inhibitor of the invention may be advantageous for obtaining the therapeutic effects disclosed herein. Accordingly, in a particular embodiment, the invention relates to an inhibitor of expression of B4GALT1, wherein the inhibitor results in hepatocyte-specific knockdown of B4GALT1. The skilled person is aware of methods to direct an inhibitor to the liver and, in particular to hepatocytes. For example the inhibitor may be directly injected into the liver. However, it is preferred herein that the inhibitor is chemically modified with a ligand that improves or enables targeting of the liver. For example, the inhibitor of the invention may be chemically modified with a ligand of a receptor that is expressed on hepatocytes, such as the hepatocyte-specific asialoglycoprotein receptor (ASGPR). Hepatocytes expressing ASGPR may be efficiently targeted with an inhibitor that is conjugated to one or more GalNAc residues or derivatives thereof, as defined in more detail elsewhere herein. Certain preferred features of inhibitors of the invention, where these are oligonucelosides such as siRNA, are given below. In certain embodiments, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene (SEQ ID NO:1). In a preferred embodiment, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a B4GALT1 mRNA (NM_001497.4). In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:22-41 or 202-301. In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO:22-41 or 202-301. In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 202-301. In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 202-301. In certain embodiments, the first strand comprises any one of SEQ ID NO:22-41 or 202-301. In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:42-61 or 302- 401; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 302-401; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 302-401; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises any one of SEQ ID NO:42-61 or 302-401. In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:22-41 or 202-301; and a second strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:42-61 or 302-401. It is preferred herein that the duplex region is formed between a first (antisense) strand and a complementary second (sense) strand. Exemplary pairs of complementary antisense and sense strands are listed in Table 2 below: Table 2 First (Antisense) Strand Base Second (Sense) Strand Base Sequence Sequence Corresponding SEQ ID SEQ ID 5’ ^ 3’ 5’ ^ 3’ positions on NO (AS) NO (SS) (Shown as an Unmodified (Shown as an Unmodified NM_001497.4 Nucleoside Sequence) Nucleoside Sequence) SEQ ID AAUACAUAGGAAAUUCA SEQ ID CUUGAAUUUCCUAUGUA 2210-2229NO: 22 AG NO: 42UUSEQ ID AAUUAUUAGGAAAUCCA SEQ ID AAUGGAUUUCCUAAUAA 1068-1087NO: 23 UU NO: 43UUSEQ ID GACACCUCCAAAAUACU SEQ ID UCAGUAUUUUGGAGGU 1016-1035NO: 24 GA NO: 44GUCSEQ ID AUAAUUAUUAGGAAAUC SEQ ID UGGAUUUCCUAAUAAUU 1070-1089NO: 25 CA NO: 45AUSEQ ID AAAAUACAUAGGAAAUU SEQ ID UGAAUUUCCUAUGUAUU 2212-2231NO: 26 CA NO: 46UUSEQ ID GUAUCUCUGUACAUCCA SEQ ID GCUGGAUGUACAGAGAU 1301-1320NO: 27 GC NO: 47AC SEQ ID UUCUUUUAAGGCACUUU SEQ ID CCAAAGUGCCUUAAAAG 3448-3467NO: 28 GG NO: 48AASEQ ID GGAAAUUCAAGUUUACA SEQ ID UAUGUAAACUUGAAUU 2202-2221NO: 29 UA NO: 49UCCSEQ ID AUUGCAACGGAAAUGUG SEQ ID GGCACAUUUCCGUUGCA 967-986NO: 30 CC NO: 50AUSEQ ID AGGAAAUUCAAGUUUAC SEQ ID AUGUAAACUUGAAUUUC 2203-2222NO: 31 AU NO: 51CUSEQ ID UAAUUAUUAGGAAAUCC SEQ ID AUGGAUUUCCUAAUAAU 1069-1088NO: 32 AU NO: 52UASEQ ID UUUACUUAGAGCAGAGA SEQ ID UGUCUCUGCUCUAAGUA 1031-1050NO: 33 CA NO: 53AASEQ ID UUUCUUUUAAGGCACUU SEQ ID CAAAGUGCCUUAAAAGA 3449-3468NO: 34 UG NO: 54AASEQ ID UAAUUAAAAGGCACAUU SEQ ID UGAAUGUGCCUUUUAAU 2822-2841NO: 35 CA NO: 55UASEQ ID AUACAUAGGAAAUUCAA SEQ ID ACUUGAAUUUCCUAUGU 2209-2228NO: 36 GU NO: 56AUSEQ ID GGCACUUUGGAAAAGUC SEQ ID CUGACUUUUCCAAAGUG 3439-3458NO: 37 AG NO: 57CCSEQ ID AUUAUUAGGAAAUCCAU SEQ ID CAAUGGAUUUCCUAAUA 1067-1086NO: 38 UG NO: 58AUSEQ ID ACACCUCCAAAAUACUG SEQ ID UUCAGUAUUUUGGAGG 1015-1034NO: 39 AA NO: 59UGUSEQ ID GCACUUUGGAAAAGUCA SEQ ID CCUGACUUUUCCAAAGU 3438-3457NO: 40 GG NO: 60GCSEQ ID AAUAAUUAUUAGGAAAU SEQ ID GGAUUUCCUAAUAAUUA 1071-1090NO: 41 CC NO: 61UUSEQ ID AUACAUAGGAAAUUCAA SEQ ID AAACUUGAAUUUCCUAU 2209-2230NO: 202 GUUUAC NO: 302GUAUSEQ ID UAGGAAAUUCAAGUUUA SEQ ID UAUGUAAACUUGAAUU 2204-2225NO: 203 CAUAGC NO: 303UCCUASEQ ID CAUAGGAAAUUCAAGUU SEQ ID UGUAAACUUGAAUUUCC 2206-2227NO: 204 UACAUA NO: 304UAUGSEQ ID AAAAUACAUAGGAAAUU SEQ ID CUUGAAUUUCCUAUGUA 2212-2233NO: 205 CAAGUU NO: 305UUUUSEQ ID AAAUACAUAGGAAAUUC SEQ ID ACUUGAAUUUCCUAUGU 2211-2232NO: 206 AAGUUU NO: 306AUUUSEQ ID AUAGGAAAUUCAAGUUU SEQ ID AUGUAAACUUGAAUUUC 2205-2226NO: 207 ACAUAG NO: 307CUAU SEQ ID AAAUUCAAGUUUACAUA SEQ ID AUGCUAUGUAAACUUGA 2200-2221NO: 208 GCAUGC NO: 308AUUUSEQ ID ACUUUACAUUCAGAAAU SEQ ID UCUGAUUUCUGAAUGUA 2035-2056NO: 209 CAGACA NO: 309AAGUSEQ ID UACAUAGGAAAUUCAAG SEQ ID UAAACUUGAAUUUCCUA 2208-2229NO: 210 UUUACA NO: 310UGUASEQ ID AUAAUUAUUAGGAAAUC SEQ ID AAUGGAUUUCCUAAUAA 1070-1091NO: 211 CAUUGA NO: 311UUAUSEQ ID AAUAAUUAUUAGGAAAU SEQ ID AUGGAUUUCCUAAUAAU 1071-1092NO: 212 CCAUUG NO: 312UAUUSEQ ID AAUUCAAGUUUACAUAG SEQ ID CAUGCUAUGUAAACUUG 2199-2220NO: 213 CAUGCC NO: 313AAUUSEQ ID UUAGAGCAGAGACACCU SEQ ID UUGGAGGUGUCUCUGCU 1026-1047NO: 214 CCAAAA NO: 314CUAASEQ ID AUUCGGUCAAACCUCUG SEQ ID UCCUCAGAGGUUUGACC 1225-1246NO: 215 AGGAUU NO: 315GAAUSEQ ID UAAUUAUUAGGAAAUCC SEQ ID CAAUGGAUUUCCUAAUA 1069-1090NO: 216 AUUGAU NO: 316AUUASEQ ID UUUUAAGGCACUUUGGA SEQ ID CUUUUCCAAAGUGCCUU 3445-3466NO: 217 AAAGUC NO: 317AAAASEQ ID GAAAUUCAAGUUUACAU SEQ ID UGCUAUGUAAACUUGAA 2201-2222NO: 218 AGCAUG NO: 318UUUCSEQ ID AUUAUUAGGAAAUCCAU SEQ ID AUCAAUGGAUUUCCUAA 1067-1088NO: 219 UGAUGG NO: 319UAAUSEQ ID AAUACAUAGGAAAUUCA SEQ ID AACUUGAAUUUCCUAUG 2210-2231NO: 220 AGUUUA NO: 320UAUUSEQ ID AACUGUUGUUUACUUAG SEQ ID UGCUCUAAGUAAACAAC 1039-1060NO: 221 AGCAGA NO: 321AGUUSEQ ID GGAAAUUCAAGUUUACA SEQ ID GCUAUGUAAACUUGAAU 2202-2223NO: 222 UAGCAU NO: 322UUCCSEQ ID UUUACUUAGAGCAGAGA SEQ ID GGUGUCUCUGCUCUAAG 1031-1052NO: 223 CACCUC NO: 323UAAASEQ ID UAAUUAAAAGGCACAUU SEQ ID CAUGAAUGUGCCUUUUA 2822-2843NO: 224 CAUGCU NO: 324AUUASEQ ID UUACUUAGAGCAGAGAC SEQ ID AGGUGUCUCUGCUCUAA 1030-1051NO: 225 ACCUCC NO: 325GUAASEQ ID UUUCUUUUAAGGCACUU SEQ ID UCCAAAGUGCCUUAAAA 3449-3470NO: 226 UGGAAA NO: 326GAAASEQ ID AGGAAAUUCAAGUUUAC SEQ ID CUAUGUAAACUUGAAUU 2203-2224NO: 227 AUAGCA NO: 327UCCU SEQ ID AGAGACACCUCCAAAAU SEQ ID CAGUAUUUUGGAGGUG 1019-1040NO: 228 ACUGAA NO: 328UCUCUSEQ ID AUUAAAAGGCACAUUCA SEQ ID AGCAUGAAUGUGCCUUU 2820-2841NO: 229 UGCUGG NO: 329UAAUSEQ ID GUUUACUUAGAGCAGAG SEQ ID GUGUCUCUGCUCUAAGU 1032-1053NO: 230 ACACCU NO: 330AAACSEQ ID AAAAUGUCAUCAUCUUC SEQ ID AGGAGAAGAUGAUGAC 1102-1123NO: 231 UCCUCC NO: 331AUUUUSEQ ID ACUUAGAGCAGAGACAC SEQ ID GGAGGUGUCUCUGCUCU 1028-1049NO: 232 CUCCAA NO: 332AAGUSEQ ID CUUUACAUUCAGAAAUC SEQ ID GUCUGAUUUCUGAAUGU 2034-2055NO: 233 AGACAA NO: 333AAAGSEQ ID AUUGCAACGGAAAUGUG SEQ ID ACGGCACAUUUCCGUUG 967-988NO: 234 CCGUGG NO: 334CAAUSEQ ID CCCAAUAAUUAUUAGGA SEQ ID GAUUUCCUAAUAAUUAU 1074-1095NO: 235 AAUCCA NO: 335UGGGSEQ ID AGACACCUCCAAAAUAC SEQ ID UUCAGUAUUUUGGAGG 1017-1038NO: 236 UGAACA NO: 336UGUCUSEQ ID AAUUAUUAGGAAAUCCA SEQ ID UCAAUGGAUUUCCUAAU 1068-1089NO: 237 UUGAUG NO: 337AAUUSEQ ID UUCGGUCAAACCUCUGA SEQ ID AUCCUCAGAGGUUUGAC 1224-1245NO: 238 GGAUUG NO: 338CGAASEQ ID UAGGUGAGUGAGUUCAA SEQ ID UGGUUUGAACUCACUCA 1276-1297NO: 239 ACCAUC NO: 339CCUASEQ ID UUCUUUUAAGGCACUUU SEQ ID UUCCAAAGUGCCUUAAA 3448-3469NO: 240 GGAAAA NO: 340AGAASEQ ID CUUUUAAGGCACUUUGG SEQ ID UUUUCCAAAGUGCCUUA 3446-3467NO: 241 AAAAGU NO: 341AAAGSEQ ID UGUUUACUUAGAGCAGA SEQ ID UGUCUCUGCUCUAAGUA 1033-1054NO: 242 GACACC NO: 342AACASEQ ID AGGCACUUUGGAAAAGU SEQ ID CCUGACUUUUCCAAAGU 3440-3461NO: 243 CAGGAU NO: 343GCCUSEQ ID GAGCAGAGACACCUCCA SEQ ID AUUUUGGAGGUGUCUCU 1023-1044NO: 244 AAAUAC NO: 344GCUCSEQ ID GUAGGUGAGUGAGUUCA SEQ ID GGUUUGAACUCACUCAC 1277-1298NO: 245 AACCAU NO: 345CUACSEQ ID UAGAGCAGAGACACCUC SEQ ID UUUGGAGGUGUCUCUGC 1025-1046NO: 246 CAAAAU NO: 346UCUASEQ ID GUUGUUUACUUAGAGCA SEQ ID UCUCUGCUCUAAGUAAA 1035-1056NO: 247 GAGACA NO: 347CAAC SEQ ID UCCAUUGCAACGGAAAU SEQ ID GCACAUUUCCGUUGCAA 970-991NO: 248 GUGCCG NO: 348UGGASEQ ID CUAAUUAAAAGGCACAU SEQ ID AUGAAUGUGCCUUUUAA 2823-2844NO: 249 UCAUGC NO: 349UUAGSEQ ID CAUUGCAACGGAAAUGU SEQ ID CGGCACAUUUCCGUUGC 968-989NO: 250 GCCGUG NO: 350AAUGSEQ ID AUGUCCACUGUGAUUUG SEQ ID UACCCAAAUCACAGUGG 1330-1351NO: 251 GGUAUA NO: 351ACAUSEQ ID GGUGUCCCGAUGUCCAC SEQ ID CACAGUGGACAUCGGGA 1339-1360NO: 252 UGUGAU NO: 352CACCSEQ ID UUGUUUACUUAGAGCAG SEQ ID GUCUCUGCUCUAAGUAA 1034-1055NO: 253 AGACAC NO: 353ACAASEQ ID CACUUUGGAAAAGUCAG SEQ ID GAUCCUGACUUUUCCAA 3437-3458NO: 254 GAUCUG NO: 354AGUGSEQ ID AAUUAAAAGGCACAUUC SEQ ID GCAUGAAUGUGCCUUUU 2821-2842NO: 255 AUGCUG NO: 355AAUUSEQ ID ACCUCCAAAAUACUGAA SEQ ID UAUGUUCAGUAUUUUG 1013-1034NO: 256 CAUAAG NO: 356GAGGUSEQ ID CAAUAAUUAUUAGGAAA SEQ ID UGGAUUUCCUAAUAAUU 1072-1093NO: 257 UCCAUU NO: 357AUUGSEQ ID UACUUAGAGCAGAGACA SEQ ID GAGGUGUCUCUGCUCUA 1029-1050NO: 258 CCUCCA NO: 358AGUASEQ ID GUAUCUCUGUACAUCCA SEQ ID GUGCUGGAUGUACAGAG 1301-1322NO: 259 GCACCU NO: 359AUACSEQ ID AAACUGUUGUUUACUUA SEQ ID GCUCUAAGUAAACAACA 1040-1061NO: 260 GAGCAG NO: 360GUUUSEQ ID CUGUUGUUUACUUAGAG SEQ ID UCUGCUCUAAGUAAACA 1037-1058NO: 261 CAGAGA NO: 361ACAGSEQ ID ACACCUCCAAAAUACUG SEQ ID UGUUCAGUAUUUUGGA 1015-1036NO: 262 AACAUA NO: 362GGUGUSEQ ID AGAGCAGAGACACCUCC SEQ ID UUUUGGAGGUGUCUCUG 1024-1045NO: 263 AAAAUA NO: 363CUCUSEQ ID CCGAUGUCCACUGUGAU SEQ ID CCAAAUCACAGUGGACA 1333-1354NO: 264 UUGGGU NO: 364UCGGSEQ ID ACUGUUGUUUACUUAGA SEQ ID CUGCUCUAAGUAAACAA 1038-1059NO: 265 GCAGAG NO: 365CAGUSEQ ID CUUAGAGCAGAGACACC SEQ ID UGGAGGUGUCUCUGCUC 1027-1048NO: 266 UCCAAA NO: 366UAAGSEQ ID UCUUUUAAGGCACUUUG SEQ ID UUUCCAAAGUGCCUUAA 3447-3468NO: 267 GAAAAG NO: 367AAGA SEQ ID GGUAUCUCUGUACAUCC SEQ ID UGCUGGAUGUACAGAGA 1302-1323NO: 268 AGCACC NO: 368UACCSEQ ID GGCACUUUGGAAAAGUC SEQ ID UCCUGACUUUUCCAAAG 3439-3460NO: 269 AGGAUC NO: 369UGCCSEQ ID CCACCUUGUGAGGAGAG SEQ ID GCGUCUCUCCUCACAAG 684-705NO: 270 ACGCAG NO: 370GUGGSEQ ID CCAAUAAUUAUUAGGAA SEQ ID GGAUUUCCUAAUAAUUA 1073-1094NO: 271 AUCCAU NO: 371UUGGSEQ ID CCAUUGCAACGGAAAUG SEQ ID GGCACAUUUCCGUUGCA 969-990NO: 272 UGCCGU NO: 372AUGGSEQ ID GUCCACUGUGAUUUGGG SEQ ID UAUACCCAAAUCACAGU 1328-1349NO: 273 UAUACA NO: 373GGACSEQ ID GAGACACCUCCAAAAUA SEQ ID UCAGUAUUUUGGAGGU 1018-1039NO: 274 CUGAAC NO: 374GUCUCSEQ ID UCCUUCAAGGCUUCUUG SEQ ID CUUUCAAGAAGCCUUGA 862-883NO: 275 AAAGCC NO: 375AGGASEQ ID UCUCCUCCCCAGCCCCAA SEQ ID UUAUUGGGGCUGGGGA 1087-1108NO: 276 UAAUU NO: 376GGAGASEQ ID GCUAGCUCGGUGUCCCG SEQ ID ACAUCGGGACACCGAGC 1347-1368NO: 277 AUGUCC NO: 377UAGCSEQ ID GCACUUUGGAAAAGUCA SEQ ID AUCCUGACUUUUCCAAA 3438-3459NO: 278 GGAUCU NO: 378GUGCSEQ ID UGUCCACUGUGAUUUGG SEQ ID AUACCCAAAUCACAGUG 1329-1350NO: 279 GUAUAC NO: 379GACASEQ ID UGCUCCUGCCGGUUGCG SEQ ID AUUCCGCAACCGGCAGG 718-739NO: 280 GAAUGG NO: 380AGCASEQ ID GGGUAUCUCUGUACAUC SEQ ID GCUGGAUGUACAGAGAU 1303-1324NO: 281 CAGCAC NO: 381ACCCSEQ ID ACCUUGUGAGGAGAGAC SEQ ID CUGCGUCUCUCCUCACA 682-703NO: 282 GCAGUC NO: 382AGGUSEQ ID GUCCCGAUGUCCACUGU SEQ ID AAUCACAGUGGACAUCG 1336-1357NO: 283 GAUUUG NO: 383GGACSEQ ID UGUUGUUUACUUAGAGC SEQ ID CUCUGCUCUAAGUAAAC 1036-1057NO: 284 AGAGAC NO: 384AACASEQ ID GACACCUCCAAAAUACU SEQ ID GUUCAGUAUUUUGGAG 1016-1037NO: 285 GAACAU NO: 385GUGUCSEQ ID UUCUCCUCCCCAGCCCCA SEQ ID UAUUGGGGCUGGGGAG 1088-1109NO: 286 AUAAU NO: 386GAGAASEQ ID CCUCCAAAAUACUGAAC SEQ ID UUAUGUUCAGUAUUUU 1012-1033NO: 287 AUAAGG NO: 387GGAGG SEQ ID GAUGUCCACUGUGAUUU SEQ ID ACCCAAAUCACAGUGGA 1331-1352NO: 288 GGGUAU NO: 388CAUCSEQ ID CCCCAAUAAUUAUUAGG SEQ ID AUUUCCUAAUAAUUAUU 1075-1096NO: 289 AAAUCC NO: 389GGGGSEQ ID CGGUGUCCCGAUGUCCAC SEQ ID ACAGUGGACAUCGGGAC 1340-1361NO: 290 UGUGA NO: 390ACCGSEQ ID UCCACUGUGAUUUGGGU SEQ ID GUAUACCCAAAUCACAG 1327-1348NO: 291 AUACAA NO: 391UGGASEQ ID AUCUUCUCCUCCCCAGCC SEQ ID UGGGGCUGGGGAGGAG 1091-1112NO: 292 CCAAU NO: 392AAGAUSEQ ID CACCUCCAAAAUACUGA SEQ ID AUGUUCAGUAUUUUGG 1014-1035NO: 293 ACAUAA NO: 393AGGUGSEQ ID CUAGCUCGGUGUCCCGA SEQ ID GACAUCGGGACACCGAG 1346-1367NO: 294 UGUCCA NO: 394CUAGSEQ ID CUCGGUGUCCCGAUGUCC SEQ ID AGUGGACAUCGGGACAC 1342-1363NO: 295 ACUGU NO: 395CGAGSEQ ID CUCCUCCCCAGCCCCAAU SEQ ID AUUAUUGGGGCUGGGG 1086-1107NO: 296 AAUUA NO: 396AGGAGSEQ ID CAUCUUCUCCUCCCCAGC SEQ ID GGGGCUGGGGAGGAGA 1092-1113NO: 297 CCCAA NO: 397AGAUGSEQ ID CCUUGUGAGGAGAGACG SEQ ID ACUGCGUCUCUCCUCAC 681-702NO: 298 CAGUCC NO: 398AAGGSEQ ID UCCCCAGCCCCAAUAAUU SEQ ID AAUAAUUAUUGGGGCU 1082-1103NO: 299 AUUAG NO: 399GGGGASEQ ID GUGUCCCGAUGUCCACU SEQ ID UCACAGUGGACAUCGGG 1338-1359NO: 300 GUGAUU NO: 400ACACSEQ ID CACCUUGUGAGGAGAGA SEQ ID UGCGUCUCUCCUCACAA 683-704NO: 301 CGCAGU NO: 401GGUGIn a particular embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 202 SEQ ID NO: 302 SEQ ID NO: 205 SEQ ID NO: 305 SEQ ID NO: 217 SEQ ID NO: 317 SEQ ID NO: 228 SEQ ID NO: 328 In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:62-81 or 402-513. In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO:62-81 or 402-513. In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 402-513. In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 402-513. In certain embodiments, the first strand comprises any one of SEQ ID NO:62-81 or 402-513. The modification pattern of the nucleic acids as set forth in SEQ ID NO:62-81 and 402-513 is summarized in Table 3 below: Table 3 Underlying Base Sequence Modified First (Antisense) Strand SEQ ID 5’ ^ 3’ SEQ ID Antisense 5’ ^ 3’ NO (AS (Shown as an Unmodified NO (AS strand ID - mod) Nucleoside Sequence) - unmod) AmsAfsUmAfCmAfUmAfGmGfAmAfASEQ ID AAUACAUAGGAAAUUC SEQ ID ETXS1238mUfUmCfAmsAfsGmNO: 62 AAG NO: 22 AmsAfsUmUfAmUfUmAfGmGfAmAfASEQ ID AAUUAUUAGGAAAUCC SEQ ID ETXS1240mUfCmCfAmsUfsUmNO: 63 AUU NO: 23GmsAfsCmAfCmCfUmCfCmAfAmAfAmSEQ ID GACACCUCCAAAAUAC SEQ IDETXS1242UfAmCfUmsGfsAmNO: 64 UGA NO: 24 AmsUfsAmAfUmUfAmUfUmAfGmGfASEQ ID AUAAUUAUUAGGAAAU SEQ IDETXS1244mAfAmUfCmsCfsAmNO: 65 CCA NO: 25 AmsAfsAmAfUmAfCmAfUmAfGmGfASEQ ID AAAAUACAUAGGAAAU SEQ IDETXS1246mAfAmUfUmsCfsAmNO: 66 UCA NO: 26 GmsUfsAmUfCmUfCmUSEQ ID GUAUCUCUGUACAUCC SEQ IDETXS1248fGmUfAmCfAmUfCmCfAmsGfsCmNO: 67 AGC NO: 27 UmsUfsCmUfUmUfUmAfAmGfGmCfASEQ ID UUCUUUUAAGGCACUU SEQ IDETXS1250mCfUmUfUmsGfsGmNO: 68 UGG NO: 28 GmsGfsAmAfAmUfUmCfAmAfGmUfUSEQ ID GGAAAUUCAAGUUUAC SEQ IDETXS1252mUfAmCfAmsUfsAmNO: 69 AUA NO: 29 AmsUfsUmGfCmAfAmCfGmGfAmAfASEQ ID AUUGCAACGGAAAUGU SEQ IDETXS1254mUfGmUfGmsCfsCmNO: 70 GCC NO: 30 AmsGfsGmAfAmAfUmUfCmAfAmGfUSEQ ID AGGAAAUUCAAGUUUA SEQ IDETXS1256mUfUmAfCmsAfsUmNO: 71 CAU NO: 31 UmsAfsAmUfUmAfUmUfAmGfGmAfASEQ ID UAAUUAUUAGGAAAUC SEQ IDETXS1258mAfUmCfCmsAfsUmNO: 72 CAU NO: 32 UmsUfsUmAfCmUfUmAfGmAfGmCfASEQ ID UUUACUUAGAGCAGAG SEQ IDETXS1260mGfAmGfAmsCfsAmNO: 73 ACA NO: 33 UmsUfsUmCfUmUfUmUfAmAfGmGfCSEQ ID UUUCUUUUAAGGCACU SEQ IDETXS1262mAfCmUfUmsUfsGmNO: 74 UUG NO: 34 UmsAfsAmUfUmAfAmAfAmGfGmCfASEQ ID UAAUUAAAAGGCACAU SEQ IDETXS1264mCfAmUfUmsCfsAmNO: 75 UCA NO: 35 AmsUfsAmCfAmUfAmGfGmAfAmAfUSEQ ID AUACAUAGGAAAUUCA SEQ IDETXS1266mUfCmAfAmsGfsUmNO: 76 AGU NO: 36 GmsGfsCmAfCmUfUmUfGmGfAmAfASEQ ID GGCACUUUGGAAAAGU SEQ IDETXS1268mAfGmUfCmsAfsGmNO: 77 CAG NO: 37 AmsUfsUmAfUmUfAmGfGmAfAmAfUSEQ ID AUUAUUAGGAAAUCCA SEQ IDETXS1270mCfCmAfUmsUfsGmNO: 78 UUG NO: 38 AmsCfsAmCfCmUfCmCfAmAfAmAfUmSEQ ID ACACCUCCAAAAUACU SEQ IDETXS1272AfCmUfGmsAfsAmNO: 79 GAA NO: 39 GmsCfsAmCfUmUfUmGfGmAfAmAfASEQ ID GCACUUUGGAAAAGUC SEQ IDETXS1274mGfUmCfAmsGfsGmNO: 80 AGG NO: 40 AmsAfsUmAfAmUfUmAfUmUfAmGfGSEQ ID AAUAAUUAUUAGGAAA SEQ IDETXS1276mAfAmAfUmsCfsCmNO: 81 UCC NO: 41 AmsAfsUmAmCmAfUmAfGfGmAmAmSEQ ID AAUACAUAGGAAAUUC SEQ IDETXS1038AmUfUmCfAmAmGmUmUmsUmsAmNO: 402 AAGUUUA NO: 220 AmsAfsUmUmAmUfUmAfGfGmAmAmSEQ ID AAUUAUUAGGAAAUCC SEQ IDETXS1040AmUfCmCfAmUmUmGmAmsUmsGmNO: 403 AUUGAUG NO: 237GmsAfsCmAmCmCfUmCfCfAmAmAmSEQ ID GACACCUCCAAAAUAC SEQ IDETXS1042AmUfAmCfUmGmAmAmCmsAmsUmNO: 404 UGAACAU NO: 285 AmsUfsAmAmUmUfAmUfUfAmGmGmSEQ ID AUAAUUAUUAGGAAAU SEQ IDETXS1044AmAfAmUfCmCmAmUmUmsGmsAmNO: 405 CCAUUGA NO: 211 AmsAfsAmAmUmAfCmAfUfAmGmGmSEQ ID AAAAUACAUAGGAAAU SEQ IDETXS1046AmAfAmUfUmCmAmAmGmsUmsUmNO: 406 UCAAGUU NO: 205 GmsUfsAmUmCmUfCmUfSEQ ID GUAUCUCUGUACAUCC SEQ IDETXS1048GfUmAmCmAmUfCmCfAmGmCmAmCmsCmsUmNO: 407 AGCACCU NO: 259 UmsUfsCmUmUmUfUmAfAfGmGmCmSEQ ID UUCUUUUAAGGCACUU SEQ IDETXS1050AmCfUmUfUmGmGmAmAmsAmsAmNO: 408 UGGAAAA NO: 240 GmsGfsAmAmAmUfUmCfAfAmGmUmSEQ ID GGAAAUUCAAGUUUAC SEQ IDETXS1052UmUfAmCfAmUmAmGmCmsAmsUmNO: 409 AUAGCAU NO: 222 AmsUfsUmGmCmAfAmCfGfGmAmAmSEQ ID AUUGCAACGGAAAUGU SEQ IDETXS1054AmUfGmUfGmCmCmGmUmsGmsGmNO: 410 GCCGUGG NO: 234 AmsGfsGmAmAmAfUmUfCfAmAmGmSEQ ID AGGAAAUUCAAGUUUA SEQ IDETXS1056UmUfUmAfCmAmUmAmGmsCmsAmNO: 411 CAUAGCA NO: 227 UmsAfsAmUmUmAfUmUfAfGmGmAmSEQ ID UAAUUAUUAGGAAAUC SEQ IDETXS1058AmAfUmCfCmAmUmUmGmsAmsUmNO: 412 CAUUGAU NO: 216 UmsUfsUmAmCmUfUmAfGfAmGmCmSEQ ID UUUACUUAGAGCAGAG SEQ IDETXS1060AmGfAmGfAmCmAmCmCmsUmsCmNO: 413 ACACCUC NO: 223 UmsUfsUmCmUmUfUmUfAfAmGmGmSEQ ID UUUCUUUUAAGGCACU SEQ IDETXS1062CmAfCmUfUmUmGmGmAmsAmsAmNO: 414 UUGGAAA NO: 226 UmsAfsAmUmUmAfAmAfAfGmGmCmSEQ ID UAAUUAAAAGGCACAU SEQ IDETXS1064AmCfAmUfUmCmAmUmGmsCmsUmNO: 415 UCAUGCU NO: 224 AmsUfsAmCmAmUfAmGfGfAmAmAmSEQ ID AUACAUAGGAAAUUCA SEQ IDETXS1066UmUfCmAfAmGmUmUmUmsAmsCmNO: 416 AGUUUAC NO: 202 GmsGfsCmAmCmUfUmUfGfGmAmAmSEQ ID GGCACUUUGGAAAAGU SEQ IDETXS1068AmAfGmUfCmAmGmGmAmsUmsCmNO: 417 CAGGAUC NO: 269 AmsUfsUmAmUmUfAmGfGfAmAmAmSEQ ID AUUAUUAGGAAAUCCA SEQ IDETXS1070UmCfCmAfUmUmGmAmUmsGmsGmNO: 418 UUGAUGG NO: 219 AmsCfsAmCmCmUfCmCfAfAmAmAmSEQ ID ACACCUCCAAAAUACU SEQ IDETXS1072UmAfCmUfGmAmAmCmAmsUmsAmNO: 419 GAACAUA NO: 262 GmsCfsAmCmUmUfUmGfGfAmAmAmSEQ ID GCACUUUGGAAAAGUC SEQ IDETXS1074AmGfUmCfAmGmGmAmUmsCmsUmNO: 420 AGGAUCU NO: 278 AmsAfsUmAmAmUfUmAfUfUmAmGmSEQ ID AAUAAUUAUUAGGAAA SEQ IDETXS1076GmAfAmAfUmCmCmAmUmsUmsGmNO: 421 UCCAUUG NO: 212 AmsUfsUmAmAmAfAmGfGfCmAmCmSEQ ID AUUAAAAGGCACAUUC SEQ IDETXS1078AmUfUmCfAmUmGmCmUmsGmsGmNO: 422 AUGCUGG NO: 229 UmsGfsUmUmUmAfCmUfUfAmGmAmSEQ ID UGUUUACUUAGAGCAG SEQ IDETXS1080GmCfAmGfAmGmAmCmAmsCmsCmNO: 423 AGACACC NO: 242CmsAfsCmCmUmCfCmAfAfAmAmUmSEQ ID CACCUCCAAAAUACUG SEQ IDETXS1082AmCfUmGfAmAmCmAmUmsAmsAmNO: 424 AACAUAA NO: 293 CmsAfsCmUmUmUfGmGfAfAmAmAmSEQ ID CACUUUGGAAAAGUCA SEQ IDETXS1084GmUfCmAfGmGmAmUmCmsUmsGmNO: 425 GGAUCUG NO: 254 AmsAfsAmUmUmCfAmAfGfUmUmUmSEQ ID AAAUUCAAGUUUACAU SEQ IDETXS1086AmCfAmUfAmGmCmAmUmsGmsCmNO: 426 AGCAUGC NO: 208 AmsAfsAmCmUmGfUmUfSEQ ID AAACUGUUGUUUACUU SEQ IDETXS1088GfUmUmUmAmCfUmUfAmGmAmGmCmsAmsGmNO: 427 AGAGCAG NO: 260 GmsGfsGmUmAmUfCmUfCfUmGmUmSEQ ID GGGUAUCUCUGUACAU SEQ IDETXS1090AmCfAmUfCmCmAmGmCmsAmsCmNO: 428 CCAGCAC NO: 281 GmsUfsUmGmUmUfUmAfCfUmUmAmSEQ ID GUUGUUUACUUAGAGC SEQ IDETXS1092GmAfGmCfAmGmAmGmAmsCmsAmNO: 429 AGAGACA NO: 247 UmsAfsGmGmAmAfAmUfUfCmAmAmSEQ ID UAGGAAAUUCAAGUUU SEQ IDETXS1094GmUfUmUfAmCmAmUmAmsGmsCmNO: 430 ACAUAGC NO: 203 AmsUfsGmUmCmCfAmCfUfGmUmGmSEQ ID AUGUCCACUGUGAUUU SEQ IDETXS1096AmUfUmUfGmGmGmUmAmsUmsAmNO: 431 GGGUAUA NO: 251 AmsUfsUmCmGmGfUmCfAfAmAmCmSEQ ID AUUCGGUCAAACCUCU SEQ IDETXS1098CmUfCmUfGmAmGmGmAmsUmsUmNO: 432 GAGGAUU NO: 215 AmsAfsAmUmAmCfAmUfAfGmGmAmSEQ ID AAAUACAUAGGAAAUU SEQ IDETXS1100AmAfUmUfCmAmAmGmUmsUmsUmNO: 433 CAAGUUU NO: 206 CmsUfsAmAmUmUfAmAfAfAmGmGmSEQ ID CUAAUUAAAAGGCACA SEQ IDETXS1102CmAfCmAfUmUmCmAmUmsGmsCmNO: 434 UUCAUGC NO: 249 CmsCfsAmCmCmUfUmGfUfGmAmGmSEQ ID CCACCUUGUGAGGAGA SEQ IDETXS1104GmAfGmAfGmAmCmGmCmsAmsGmNO: 435 GACGCAG NO: 270 UmsGfsUmCmCmAfCmUfGfUmGmAmSEQ ID UGUCCACUGUGAUUUG SEQ IDETXS1106UmUfUmGfGmGmUmAmUmsAmsCmNO: 436 GGUAUAC NO: 279 UmsAfsCmAmUmAfGmGfAfAmAmUmSEQ ID UACAUAGGAAAUUCAA SEQ IDETXS1108UmCfAmAfGmUmUmUmAmsCmsAmNO: 437 GUUUACA NO: 210 CmsUfsUmUmAmCfAmUfUfCmAmGmSEQ ID CUUUACAUUCAGAAAU SEQ IDETXS1110AmAfAmUfCmAmGmAmCmsAmsAmNO: 438 CAGACAA NO: 233 CmsCfsAmAmUmAfAmUfUfAmUmUmSEQ ID CCAAUAAUUAUUAGGA SEQ IDETXS1112AmGfGmAfAmAmUmCmCmsAmsUmNO: 439 AAUCCAU NO: 271 UmsGfsCmUmCmCfUmGfCfCmGmGmSEQ ID UGCUCCUGCCGGUUGC SEQ IDETXS1114UmUfGmCfGmGmAmAmUmsGmsGmNO: 440 GGAAUGG NO: 280 UmsUfsGmUmUmUfAmCfUfUmAmGmSEQ ID UUGUUUACUUAGAGCA SEQ IDETXS1116AmGfCmAfGmAmGmAmCmsAmsCmNO: 441 GAGACAC NO: 253 AmsCfsUmGmUmUfGmUfUfUmAmCmSEQ ID ACUGUUGUUUACUUAG SEQ IDETXS1118UmUfAmGfAmGmCmAmGmsAmsGmNO: 442 AGCAGAG NO: 265 CmsUfsUmUmUmAfAmGfGfCmAmCmSEQ ID CUUUUAAGGCACUUUG SEQ IDETXS1120UmUfUmGfGmAmAmAmAmsGmsUmNO: 443 GAAAAGU NO: 241AmsCfsCmUmCmCfAmAfAfAmUmAmSEQ ID ACCUCCAAAAUACUGA SEQ IDETXS1122CmUfGmAfAmCmAmUmAmsAmsGmNO: 444 ACAUAAG NO: 256 CmsGfsGmUmGmUfCmCfCfGmAmUmSEQ ID CGGUGUCCCGAUGUCC SEQ IDETXS1124GmUfCmCfAmCmUmGmUmsGmsAmNO: 445 ACUGUGA NO: 290 CmsCfsCmCmAmAfUmAfAfUmUmAmSEQ ID CCCCAAUAAUUAUUAG SEQ IDETXS1126UmUfAmGfGmAmAmAmUmsCmsCmNO: 446 GAAAUCC NO: 289 GmsAfsUmGmUmCfCmAfSEQ ID GAUGUCCACUGUGAUU SEQ IDETXS1128CfUmGmUmGmAfUmUfUmGmGmGmUmsAmsUmNO: 447 UGGGUAU NO: 288 UmsAfsGmAmGmCfAmGfAfGmAmCmSEQ ID UAGAGCAGAGACACCU SEQ IDETXS1130AmCfCmUfCmCmAmAmAmsAmsUmNO: 448 CCAAAAU NO: 246 CmsCfsGmAmUmGfUmCfCfAmCmUmSEQ ID CCGAUGUCCACUGUGA SEQ IDETXS1132GmUfGmAfUmUmUmGmGmsGmsUmNO: 449 UUUGGGU NO: 264 UmsCfsUmUmUmUfAmAfGfGmCmAmSEQ ID UCUUUUAAGGCACUUU SEQ IDETXS1134CmUfUmUfGmGmAmAmAmsAmsGmNO: 450 GGAAAAG NO: 267 CmsCfsCmAmAmUfAmAfUfUmAmUmSEQ ID CCCAAUAAUUAUUAGG SEQ IDETXS1136UmAfGmGfAmAmAmUmCmsCmsAmNO: 451 AAAUCCA NO: 235 GmsUfsCmCmAmCfUmGfUfGmAmUmSEQ ID GUCCACUGUGAUUUGG SEQ IDETXS1138UmUfGmGfGmUmAmUmAmsCmsAmNO: 452 GUAUACA NO: 273 GmsUfsAmGmGmUfGmAfGfUmGmAmSEQ ID GUAGGUGAGUGAGUUC SEQ IDETXS1140GmUfUmCfAmAmAmCmCmsAmsUmNO: 453 AAACCAU NO: 245 AmsCfsUmUmAmGfAmGfCfAmGmAmSEQ ID ACUUAGAGCAGAGACA SEQ IDETXS1142GmAfCmAfCmCmUmCmCmsAmsAmNO: 454 CCUCCAA NO: 232 CmsAfsCmCmUmUfGmUfGfAmGmGmSEQ ID CACCUUGUGAGGAGAG SEQ IDETXS1144AmGfAmGfAmCmGmCmAmsGmsUmNO: 455 ACGCAGU NO: 301 AmsAfsAmAmUmGfUmCfAfUmCmAmSEQ ID AAAAUGUCAUCAUCUU SEQ IDETXS1146UmCfUmUfCmUmCmCmUmsCmsCmNO: 456 CUCCUCC NO: 231 CmsUfsUmAmGmAfGmCfAfGmAmGmSEQ ID CUUAGAGCAGAGACAC SEQ IDETXS1148AmCfAmCfCmUmCmCmAmsAmsAmNO: 457 CUCCAAA NO: 266 UmsCfsUmCmCmUfCmCfCfCmAmGmCSEQ ID UCUCCUCCCCAGCCCCA SEQ IDETXS1150mCfCmCfAmAmUmAmAmsUmsUmNO: 458 AUAAUU NO: 276 AmsGfsGmCmAmCfUmUfUfGmGmAmSEQ ID AGGCACUUUGGAAAAG SEQ IDETXS1152AmAfAmGfUmCmAmGmGmsAmsUmNO: 459 UCAGGAU NO: 243 CmsCfsAmUmUmGfCmAfAfCmGmGmSEQ ID CCAUUGCAACGGAAAU SEQ IDETXS1154AmAfAmUfGmUmGmCmCmsGmsUmNO: 460 GUGCCGU NO: 272 AmsAfsCmUmGmUfUmGfUfUmUmAmSEQ ID AACUGUUGUUUACUUA SEQ IDETXS1156CmUfUmAfGmAmGmCmAmsGmsAmNO: 461 GAGCAGA NO: 221 UmsUfsAmGmAmGfCmAfGfAmGmAmSEQ ID UUAGAGCAGAGACACC SEQ IDETXS1158CmAfCmCfUmCmCmAmAmsAmsAmNO: 462 UCCAAAA NO: 214 GmsAfsAmAmUmUfCmAfAfGmUmUmSEQ ID GAAAUUCAAGUUUACA SEQ IDETXS1160UmAfCmAfUmAmGmCmAmsUmsGmNO: 463 UAGCAUG NO: 218CmsAfsAmUmAmAfUmUfAfUmUmAmSEQ ID CAAUAAUUAUUAGGAA SEQ IDETXS1162GmGfAmAfAmUmCmCmAmsUmsUmNO: 464 AUCCAUU NO: 257 CmsUfsCmCmUmCfCmCfCfAmGmCmCSEQ ID CUCCUCCCCAGCCCCAA SEQ IDETXS1164mCfCmAfAmUmAmAmUmsUmsAmNO: 465 UAAUUA NO: 296 UmsUfsUmUmAmAfGmGfCfAmCmUmSEQ ID UUUUAAGGCACUUUGG SEQ IDETXS1166UmUfGmGfAmAmAmAmGmsUmsCmNO: 466 AAAAGUC NO: 217 UmsUfsCmUmCmCfUmCSEQ ID UUCUCCUCCCCAGCCCC SEQ IDETXS1168fCfCmCmAmGmCfCmCfCmAmAmUmAmsAmsUmNO: 467 AAUAAU NO: 286 CmsUfsAmGmCmUfCmGfGfUmGmUmSEQ ID CUAGCUCGGUGUCCCG SEQ IDETXS1170CmCfCmGfAmUmGmUmCmsCmsAmNO: 468 AUGUCCA NO: 294 AmsGfsAmCmAmCfCmUfCfCmAmAmSEQ ID AGACACCUCCAAAAUA SEQ IDETXS1172AmAfUmAfCmUmGmAmAmsCmsAmNO: 469 CUGAACA NO: 236 UmsAfsCmUmUmAfGmAfGfCmAmGmSEQ ID UACUUAGAGCAGAGAC SEQ IDETXS1174AmGfAmCfAmCmCmUmCmsCmsAmNO: 470 ACCUCCA NO: 258 UmsAfsGmGmUmGfAmGfUfGmAmGmSEQ ID UAGGUGAGUGAGUUCA SEQ IDETXS1176UmUfCmAfAmAmCmCmAmsUmsCmNO: 471 AACCAUC NO: 239 AmsCfsUmUmUmAfCmAfUfUmCmAmSEQ ID ACUUUACAUUCAGAAA SEQ IDETXS1178GmAfAmAfUmCmAmGmAmsCmsAmNO: 472 UCAGACA NO: 209 CmsAfsUmAmGmGfAmAfAfUmUmCmSEQ ID CAUAGGAAAUUCAAGU SEQ IDETXS1180AmAfGmUfUmUmAmCmAmsUmsAmNO: 473 UUACAUA NO: 204 GmsUfsUmUmAmCfUmUfAfGmAmGmSEQ ID GUUUACUUAGAGCAGA SEQ IDETXS1182CmAfGmAfGmAmCmAmCmsCmsUmNO: 474 GACACCU NO: 230 AmsCfsCmUmUmGfUmGfAfGmGmAmSEQ ID ACCUUGUGAGGAGAGA SEQ IDETXS1184GmAfGmAfCmGmCmAmGmsUmsCmNO: 475 CGCAGUC NO: 282 CmsCfsUmCmCmAfAmAfAfUmAmCmSEQ ID CCUCCAAAAUACUGAA SEQ IDETXS1186UmGfAmAfCmAmUmAmAmsGmsGmNO: 476 CAUAAGG NO: 287 GmsGfsUmGmUmCfCmCfGfAmUmGmSEQ ID GGUGUCCCGAUGUCCA SEQ IDETXS1188UmCfCmAfCmUmGmUmGmsAmsUmNO: 477 CUGUGAU NO: 252 CmsUfsGmUmUmGfUmUfUfAmCmUmSEQ ID CUGUUGUUUACUUAGA SEQ IDETXS1190UmAfGmAfGmCmAmGmAmsGmsAmNO: 478 GCAGAGA NO: 261 CmsAfsUmUmGmCfAmAfCfGmGmAmSEQ ID CAUUGCAACGGAAAUG SEQ IDETXS1192AmAfUmGfUmGmCmCmGmsUmsGmNO: 479 UGCCGUG NO: 250 GmsAfsGmAmCmAfCmCfUfCmCmAmSEQ ID GAGACACCUCCAAAAU SEQ IDETXS1194AmAfAmUfAmCmUmGmAmsAmsCmNO: 480 ACUGAAC NO: 274 UmsCfsCmAmUmUfGmCfAfAmCmGmSEQ ID UCCAUUGCAACGGAAA SEQ IDETXS1196GmAfAmAfUmGmUmGmCmsCmsGmNO: 481 UGUGCCG NO: 248 AmsAfsUmUmCmAfAmGfUfUmUmAmSEQ ID AAUUCAAGUUUACAUA SEQ IDETXS1198CmAfUmAfGmCmAmUmGmsCmsCmNO: 482 GCAUGCC NO: 213 UmsUfsCmGmGmUfCmAfAfAmCmCmSEQ ID UUCGGUCAAACCUCUG SEQ IDETXS1200UmCfUmGfAmGmGmAmUmsUmsGmNO: 483 AGGAUUG NO: 238GmsUfsGmUmCmCfCmGfAfUmGmUmSEQ ID GUGUCCCGAUGUCCAC SEQ IDETXS1202CmCfAmCfUmGmUmGmAmsUmsUmNO: 484 UGUGAUU NO: 300 UmsCfsCmUmUmCfAmAfGfGmCmUmSEQ ID UCCUUCAAGGCUUCUU SEQ IDETXS1204UmCfUmUfGmAmAmAmGmsCmsCmNO: 485 GAAAGCC NO: 275 UmsUfsAmCmUmUfAmGfAfGmCmAmSEQ ID UUACUUAGAGCAGAGA SEQ IDETXS1206GmAfGmAfCmAmCmCmUmsCmsCmNO: 486 CACCUCC NO: 225 AmsGfsAmGmCmAfGmAfSEQ ID AGAGCAGAGACACCUC SEQ IDETXS1208GfAmCmAmCmCfUmCfCmAmAmAmAmsUmsAmNO: 487 CAAAAUA NO: 263 AmsAfsUmUmAmAfAmAfGfGmCmAmSEQ ID AAUUAAAAGGCACAUU SEQ IDETXS1210CmAfUmUfCmAmUmGmCmsUmsGmNO: 488 CAUGCUG NO: 255 GmsCfsUmAmGmCfUmCfGfGmUmGmSEQ ID GCUAGCUCGGUGUCCC SEQ IDETXS1212UmCfCmCfGmAmUmGmUmsCmsCmNO: 489 GAUGUCC NO: 277 CmsCfsUmUmGmUfGmAfGfGmAmGmSEQ ID CCUUGUGAGGAGAGAC SEQ IDETXS1214AmGfAmCfGmCmAmGmUmsCmsCmNO: 490 GCAGUCC NO: 298 UmsCfsCmAmCmUfGmUfGfAmUmUmSEQ ID UCCACUGUGAUUUGGG SEQ IDETXS1216UmGfGmGfUmAmUmAmCmsAmsAmNO: 491 UAUACAA NO: 291 GmsGfsUmAmUmCfUmCfUfGmUmAmSEQ ID GGUAUCUCUGUACAUC SEQ IDETXS1218CmAfUmCfCmAmGmCmAmsCmsCmNO: 492 CAGCACC NO: 268 AmsUfsAmGmGmAfAmAfUfUmCmAmSEQ ID AUAGGAAAUUCAAGUU SEQ IDETXS1220AmGfUmUfUmAmCmAmUmsAmsGmNO: 493 UACAUAG NO: 207 CmsAfsUmCmUmUfCmUfCfCmUmCmCSEQ ID CAUCUUCUCCUCCCCA SEQ IDETXS1222mCfCmAfGmCmCmCmCmsAmsAmNO: 494 GCCCCAA NO: 297 UmsGfsUmUmGmUfUmUfAfCmUmUmSEQ ID UGUUGUUUACUUAGAG SEQ IDETXS1224AmGfAmGfCmAmGmAmGmsAmsCmNO: 495 CAGAGAC NO: 284 AmsUfsCmUmUmCfUmCfCfUmCmCmCSEQ ID AUCUUCUCCUCCCCAG SEQ IDETXS1226mCfAmGfCmCmCmCmAmsAmsUmNO: 496 CCCCAAU NO: 292 GmsUfsCmCmCmGfAmUfGfUmCmCmSEQ ID GUCCCGAUGUCCACUG SEQ IDETXS1228AmCfUmGfUmGmAmUmUmsUmsGmNO: 497 UGAUUUG NO: 283 CmsUfsCmGmGmUfGmUfCfCmCmGmSEQ ID CUCGGUGUCCCGAUGU SEQ IDETXS1230AmUfGmUfCmCmAmCmUmsGmsUmNO: 498 CCACUGU NO: 295 UmsCfsCmCmCmAfGmCfCfCmCmAmASEQ ID UCCCCAGCCCCAAUAA SEQ IDETXS1232mUfAmAfUmUmAmUmUmsAmsGmNO: 499 UUAUUAG NO: 299 AmsGfsAmGmAmCfAmCfCfUmCmCmSEQ ID AGAGACACCUCCAAAA SEQ IDETXS1234AmAfAmAfUmAmCmUmGmsAmsAmNO: 500 UACUGAA NO: 228 GmsAfsGmCmAmGfAmGfAfCmAmCmSEQ ID GAGCAGAGACACCUCC SEQ IDETXS1236CmUfCmCfAmAmAmAmUmsAmsCmNO: 501 AAAAUAC NO: 244 AmsUfsAmCfAmUfAmGmGmAmAmASEQ ID AUACAUAGGAAAUUCA SEQ IDETXS2400mUmUfCmAfAmGmUmUmUmsAmsCmNO: 502 AGUUUAC NO: 202 AmsUfsAmCmAmUfAmGmGfAmAmASEQ ID AUACAUAGGAAAUUCA SEQ IDETXS2402mUmUfCmAfAmGmUmUmUmsAmsCmNO: 503 AGUUUAC NO: 202AmsAfsAmAfUmAfCmAmUmAmGmGSEQ ID AAAAUACAUAGGAAAU SEQ ID ETXS2406mAmAfAmUfUmCmAmAmGmsUmsUmNO: 504 UCAAGUU NO: 205 AmsAfsAmAmUmAfCmAmUfAmGmGSEQ ID AAAAUACAUAGGAAAU SEQ ID ETXS2408mAmAfAmUfUmCmAmAmGmsUmsUmNO: 505 UCAAGUU NO: 205 UmsUfsUmUfAmAfGmGmCmAmCmUmSEQ ID UUUUAAGGCACUUUGG SEQ ID ETXS2424UmUfGmGfAmAmAmAmGmsUmsCmNO: 506 AAAAGUC NO: 217 UmsUfsUmUmAmAfGmGSEQ ID UUUUAAGGCACUUUGG SEQ ID ETXS2426mCfAmCmUmUmUfGmGfAmAmAmAmGmsUmsCmNO: 507 AAAAGUC NO: 217 AmsGfsAmGfAmCfAmCmCmUmCmCmSEQ ID AGAGACACCUCCAAAA SEQ ID ETXS2430AmAfAmAfUmAmCmUmGmsAmsAmNO: 508 UACUGAA NO: 228 AmsGfsAmGmAmCfAmCmCfUmCmCmSEQ ID AGAGACACCUCCAAAA SEQ ID ETXS2432AmAfAmAfUmAmCmUmGmsAmsAmNO: 509 UACUGAA NO: 228 AmsUfsAmCmAmUfAmGmGmAmAmASEQ ID AUACAUAGGAAAUUCA SEQ ID ETXS2434mUmUfCmAfAmGfUmUmUmsAmsCmNO: 510 AGUUUAC NO: 202 AmsAfsAmAmUmAfCmAmUmAmGmGSEQ ID AAAAUACAUAGGAAAU SEQ ID ETXS2436mAmAfAmUfUmCfAmAmGmsUmsUmNO: 511 UCAAGUU NO: 205 UmsUfsUmUmAmAfGmGmCmAmCmUSEQ ID UUUUAAGGCACUUUGG SEQ ID ETXS2438mUmUfGmGfAmAfAmAmGmsUmsCmNO: 512 AAAAGUC NO: 217 AmsGfsAmGmAmCfAmCmCmUmCmCSEQ ID AGAGACACCUCCAAAA SEQ ID ETXS2440mAmAfAmAfUmAfCmUmGmsAmsAmNO: 513 UACUGAA NO: 228 In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:82-101 or 514-621; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 514-621; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 514-621; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises any one of SEQ ID NO:82-101 or 514-621. The modification pattern of the nucleic acids as set forth in SEQ ID NO:82-101 and 514-621 is summarized in Table 4 below: Table 4 Underlying Base Sequence Modified Second (Sense) Strand SEQ ID 5’ ^ 3’ SEQ ID Sense 5’ ^ 3’ NO (SS - (Shown as an Unmodified NO (SS - strand ID mod) Nucleoside Sequence) unmod) CfsUmsUfGmAfAmUfUmUfCmCfUmAfSEQ ID CUUGAAUUUCCUAUGU SEQ ID ETXS1237UmGfUmAfUmUfNO: 82 AUU NO: 42 AfsAmsUfGmGfAmUfUmUfCmCfUmAfSEQ ID AAUGGAUUUCCUAAUA SEQ ID ETXS1239AmUfAmAfUmUfNO: 83 AUU NO: 43 UfsCmsAfGmUfAmUfUmUfUmGfGmAfSEQ ID UCAGUAUUUUGGAGGU SEQ ID ETXS1241GmGfUmGfUmCfNO: 84 GUC NO: 44 UfsGmsGfAmUfUmUfCmCfUmAfAmUfSEQ ID UGGAUUUCCUAAUAAU SEQ ID ETXS1243AmAfUmUfAmUfNO: 85 UAU NO: 45 UfsGmsAfAmUfUmUfCmCfUmAfUmGfSEQ ID UGAAUUUCCUAUGUAU SEQ ID ETXS1245UmAfUmUfUmUfNO: 86 UUU NO: 46 GfsCmsUfGmGfAmUfGmUfAmCfAmGfSEQ ID GCUGGAUGUACAGAGA SEQ ID ETXS1247AmGfAmUfAmCfNO: 87 UAC NO: 47 CfsCmsAfAmAfGmUfGmCfCmUfUmAfSEQ ID CCAAAGUGCCUUAAAA SEQ ID ETXS1249AmAfAmGfAmAfNO: 88 GAA NO: 48 UfsAmsUfGmUfAmAfAmCfUmUfGmAfSEQ ID UAUGUAAACUUGAAUU SEQ ID ETXS1251AmUfUmUfCmCfNO: 89 UCC NO: 49 GfsGmsCfAmCfAmUfUmUfCmCfGmUfSEQ ID GGCACAUUUCCGUUGC SEQ ID ETXS1253UmGfCmAfAmUfNO: 90 AAU NO: 50 AfsUmsGfUmAfAmAfCmUfUmGfAmAfSEQ ID AUGUAAACUUGAAUUU SEQ ID ETXS1255UmUfUmCfCmUfNO: 91 CCU NO: 51 AfsUmsGfGmAfUmUfUmCfCmUfAmAfSEQ ID AUGGAUUUCCUAAUAA SEQ ID ETXS1257UmAfAmUfUmAfNO: 92 UUA NO: 52 UfsGmsUfCmUfCmUfGmCfUmCfUmAfSEQ ID UGUCUCUGCUCUAAGU SEQ ID ETXS1259AmGfUmAfAmAfNO: 93 AAA NO: 53 CfsAmsAfAmGfUmGfCmCfUmUfAmAfSEQ ID CAAAGUGCCUUAAAAG SEQ ID ETXS1261AmAfGmAfAmAfNO: 94 AAA NO: 54 UfsGmsAfAmUfGmUfGmCfCmUfUmUfSEQ ID UGAAUGUGCCUUUUAA SEQ ID ETXS1263UmAfAmUfUmAfNO: 95 UUA NO: 55 AfsCmsUfUmGfAmAfUmUfUmCfCmUfSEQ ID ACUUGAAUUUCCUAUG SEQ ID ETXS1265AmUfGmUfAmUfNO: 96 UAU NO: 56 CfsUmsGfAmCfUmUfUmUfCmCfAmAfSEQ ID CUGACUUUUCCAAAGU SEQ ID ETXS1267AmGfUmGfCmCfNO: 97 GCC NO: 57CfsAmsAfUmGfGmAfUmUfUmCfCmUfSEQ ID CAAUGGAUUUCCUAAU SEQ IDETXS1269AmAfUmAfAmUfNO: 98 AAU NO: 58 UfsUmsCfAmGfUmAfUmUfUmUfGmGfSEQ ID UUCAGUAUUUUGGAGG SEQ IDETXS1271AmGfGmUfGmUfNO: 99 UGU NO: 59 CfsCmsUfGmAfCmUfUmUfUmCfCmAfSEQ ID CCUGACUUUUCCAAAG SEQ IDETXS1273AmAfGmUfGmCfNO: 100 UGC NO: 60 GfsSEQ ID GGAUUUCCUAAUAAUU SEQ IDETXS1275GmsAfUmUfUmCfCmUfAmAfUmAfAmUfUmAfUmUfNO: 101 AUU NO: 61 AmsAmsCmUmUmGmAfAmUfUfUfCmSEQ ID AACUUGAAUUUCCUAU SEQ IDETXS1037CmUmAmUmGmUmAmUmUmNO: 618 GUAUU NO: 320 UmsCmsAmAmUmGmGfAmUfUfUfCmSEQ ID UCAAUGGAUUUCCUAA SEQ IDETXS1039CmUmAmAmUmAmAmUmUmNO: 619 UAAUU NO: 337 GmsUmsUmCmAmGmUfAmUfUfUfUmSEQ ID GUUCAGUAUUUUGGAG SEQ IDETXS1041GmGmAmGmGmUmGmUmCmNO: 620 GUGUC NO: 385 AmsAmsUmGmGmAmUfUmUfCfCfUmSEQ ID AAUGGAUUUCCUAAUA SEQ IDETXS1043AmAmUmAmAmUmUmAmUmNO: 621 AUUAU NO: 311 CmsUmsUmGmAmAmUfUmUfCfCfUmSEQ ID CUUGAAUUUCCUAUGU SEQ IDETXS1045AmUmGmUmAmUmUmUmUmNO: 514 AUUUU NO: 305 GmsUmsGmCmUmGmGfAmUfGfUfAmSEQ ID GUGCUGGAUGUACAGA SEQ IDETXS1047CmAmGmAmGmAmUmAmCmNO: 515 GAUAC NO: 359 UmsUmsCmCmAmAmAfGmUfGfCfCmSEQ ID UUCCAAAGUGCCUUAA SEQ IDETXS1049UmUmAmAmAmAmGmAmAmNO: 516 AAGAA NO: 340 GmsCmsUmAmUmGmUfAmAfAfCfUmSEQ ID GCUAUGUAAACUUGAA SEQ IDETXS1051UmGmAmAmUmUmUmCmCmNO: 517 UUUCC NO: 322 AmsCmsGmGmCmAmCfAmUfUfUfCmSEQ ID ACGGCACAUUUCCGUU SEQ IDETXS1053CmGmUmUmGmCmAmAmUmNO: 518 GCAAU NO: 334 CmsUmsAmUmGmUmAfAmAfCfUfUmSEQ ID CUAUGUAAACUUGAAU SEQ IDETXS1055GmAmAmUmUmUmCmCmUmNO: 519 UUCCU NO: 327 CmsAmsAmUmGmGmAfUmUfUfCfCmSEQ ID CAAUGGAUUUCCUAAU SEQ IDETXS1057UmAmAmUmAmAmUmUmAmNO: 520 AAUUA NO: 316 GmsGmsUmGmUmCmUfCmUfGfCfUmSEQ ID GGUGUCUCUGCUCUAA SEQ IDETXS1059CmUmAmAmGmUmAmAmAmNO: 521 GUAAA NO: 323 UmsCmsCmAmAmAmGfUmGfCfCfUmSEQ ID UCCAAAGUGCCUUAAA SEQ IDETXS1061UmAmAmAmAmGmAmAmAmNO: 522 AGAAA NO: 326 CmsAmsUmGmAmAmUfGmUfGfCfCmSEQ ID CAUGAAUGUGCCUUUU SEQ IDETXS1063UmUmUmUmAmAmUmUmAmNO: 523 AAUUA NO: 324 AmsAmsAmCmUmUmGfAmAfUfUfUmSEQ ID AAACUUGAAUUUCCUA SEQ IDETXS1065CmCmUmAmUmGmUmAmUmNO: 524 UGUAU NO: 302 UmsCmsCmUmGmAmCfUmUfUfUfCmSEQ ID UCCUGACUUUUCCAAA SEQ IDETXS1067CmAmAmAmGmUmGmCmCmNO: 525 GUGCC NO: 369AmsUmsCmAmAmUmGfGmAfUfUfUmSEQ ID AUCAAUGGAUUUCCUA SEQ IDETXS1069CmCmUmAmAmUmAmAmUmNO: 526 AUAAU NO: 319 UmsGmsUmUmCmAmGfUmAfUfUfUmSEQ ID UGUUCAGUAUUUUGGA SEQ IDETXS1071UmGmGmAmGmGmUmGmUmNO: 527 GGUGU NO: 362 AmsUmsCmCmUmGmAfCmUfUfUfUmSEQ ID AUCCUGACUUUUCCAA SEQ IDETXS1073CmCmAmAmAmGmUmGmCmNO: 528 AGUGC NO: 378 AmsUmsGmGmAmUmUSEQ ID AUGGAUUUCCUAAUAA SEQ IDETXS1075fUmCfCfUfAmAmUmAmAmUmUmAmUmUmNO: 529 UUAUU NO: 312 AmsGmsCmAmUmGmAfAmUfGfUfGmSEQ ID AGCAUGAAUGUGCCUU SEQ IDETXS1077CmCmUmUmUmUmAmAmUmNO: 530 UUAAU NO: 329 UmsGmsUmCmUmCmUfGmCfUfCfUmSEQ ID UGUCUCUGCUCUAAGU SEQ IDETXS1079AmAmGmUmAmAmAmCmAmNO: 531 AAACA NO: 342 AmsUmsGmUmUmCmAfGmUfAfUfUmSEQ ID AUGUUCAGUAUUUUGG SEQ IDETXS1081UmUmGmGmAmGmGmUmGmNO: 532 AGGUG NO: 393 GmsAmsUmCmCmUmGfAmCfUfUfUmSEQ ID GAUCCUGACUUUUCCA SEQ IDETXS1083UmCmCmAmAmAmGmUmGmNO: 533 AAGUG NO: 354 AmsUmsGmCmUmAmUfGmUfAfAfAmSEQ ID AUGCUAUGUAAACUUG SEQ IDETXS1085CmUmUmGmAmAmUmUmUmNO: 534 AAUUU NO: 308 GmsCmsUmCmUmAmAfGmUfAfAfAmSEQ ID GCUCUAAGUAAACAAC SEQ IDETXS1087CmAmAmCmAmGmUmUmUmNO: 535 AGUUU NO: 360 GmsCmsUmGmGmAmUfGmUfAfCfAmSEQ ID GCUGGAUGUACAGAGA SEQ IDETXS1089GmAmGmAmUmAmCmCmCmNO: 536 UACCC NO: 381 UmsCmsUmCmUmGmCfUmCfUfAfAmSEQ ID UCUCUGCUCUAAGUAA SEQ IDETXS1091GmUmAmAmAmCmAmAmCmNO: 537 ACAAC NO: 347 UmsAmsUmGmUmAmAfAmCfUfUfGmSEQ ID UAUGUAAACUUGAAUU SEQ IDETXS1093AmAmUmUmUmCmCmUmAmNO: 538 UCCUA NO: 303 UmsAmsCmCmCmAmAfAmUfCfAfCmSEQ ID UACCCAAAUCACAGUG SEQ IDETXS1095AmGmUmGmGmAmCmAmUmNO: 539 GACAU NO: 351 UmsCmsCmUmCmAmGfAmGfGfUfUmSEQ ID UCCUCAGAGGUUUGAC SEQ IDETXS1097UmGmAmCmCmGmAmAmUmNO: 540 CGAAU NO: 315 AmsCmsUmUmGmAmAfUmUfUfCfCmSEQ ID ACUUGAAUUUCCUAUG SEQ IDETXS1099UmAmUmGmUmAmUmUmUmNO: 541 UAUUU NO: 306 AmsUmsGmAmAmUmGfUmGfCfCfUmSEQ ID AUGAAUGUGCCUUUUA SEQ IDETXS1101UmUmUmAmAmUmUmAmGmNO: 542 AUUAG NO: 349 GmsCmsGmUmCmUmCfUmCfCfUfCmSEQ ID GCGUCUCUCCUCACAA SEQ IDETXS1103AmCmAmAmGmGmUmGmGmNO: 543 GGUGG NO: 370 AmsUmsAmCmCmCmAfAmAfUfCfAmSEQ ID AUACCCAAAUCACAGU SEQ IDETXS1105CmAmGmUmGmGmAmCmAmNO: 544 GGACA NO: 379 UmsAmsAmAmCmUmUfGmAfAfUfUmSEQ ID UAAACUUGAAUUUCCU SEQ IDETXS1107UmCmCmUmAmUmGmUmAmNO: 545 AUGUA NO: 310GmsUmsCmUmGmAmUfUmUfCfUfGmSEQ ID GUCUGAUUUCUGAAUG SEQ IDETXS1109AmAmUmGmUmAmAmAmGmNO: 546 UAAAG NO: 333 GmsGmsAmUmUmUmCfCmUfAfAfUmSEQ ID GGAUUUCCUAAUAAUU SEQ IDETXS1111AmAmUmUmAmUmUmGmGmNO: 547 AUUGG NO: 371 AmsUmsUmCmCmGmCfAmAfCfCfGmSEQ ID AUUCCGCAACCGGCAG SEQ IDETXS1113GmCmAmGmGmAmGmCmAmNO: 548 GAGCA NO: 380 GmsUmsCmUmCmUmGSEQ ID GUCUCUGCUCUAAGUA SEQ IDETXS1115fCmUfCfUfAmAmGmUmAmAmAmCmAmAmNO: 549 AACAA NO: 353 CmsUmsGmCmUmCmUfAmAfGfUfAmSEQ ID CUGCUCUAAGUAAACA SEQ IDETXS1117AmAmCmAmAmCmAmGmUmNO: 550 ACAGU NO: 365 UmsUmsUmUmCmCmAfAmAfGfUfGmSEQ ID UUUUCCAAAGUGCCUU SEQ IDETXS1119CmCmUmUmAmAmAmAmGmNO: 551 AAAAG NO: 341 UmsAmsUmGmUmUmCfAmGfUfAfUmSEQ ID UAUGUUCAGUAUUUUG SEQ IDETXS1121UmUmUmGmGmAmGmGmUmNO: 552 GAGGU NO: 356 AmsCmsAmGmUmGmGfAmCfAfUfCmSEQ ID ACAGUGGACAUCGGGA SEQ IDETXS1123GmGmGmAmCmAmCmCmGmNO: 553 CACCG NO: 390 AmsUmsUmUmCmCmUfAmAfUfAfAmSEQ ID AUUUCCUAAUAAUUAU SEQ IDETXS1125UmUmAmUmUmGmGmGmGmNO: 554 UGGGG NO: 389 AmsCmsCmCmAmAmAfUmCfAfCfAmSEQ ID ACCCAAAUCACAGUGG SEQ IDETXS1127GmUmGmGmAmCmAmUmCmNO: 555 ACAUC NO: 388 UmsUmsUmGmGmAmGfGmUfGfUfCmSEQ ID UUUGGAGGUGUCUCUG SEQ IDETXS1129UmCmUmGmCmUmCmUmAmNO: 556 CUCUA NO: 346 CmsCmsAmAmAmUmCfAmCfAfGfUmSEQ ID CCAAAUCACAGUGGAC SEQ IDETXS1131GmGmAmCmAmUmCmGmGmNO: 557 AUCGG NO: 364 UmsUmsUmCmCmAmAfAmGfUfGfCmSEQ ID UUUCCAAAGUGCCUUA SEQ IDETXS1133CmUmUmAmAmAmAmGmAmNO: 558 AAAGA NO: 367 GmsAmsUmUmUmCmCfUmAfAfUfAmSEQ ID GAUUUCCUAAUAAUUA SEQ IDETXS1135AmUmUmAmUmUmGmGmGmNO: 559 UUGGG NO: 335 UmsAmsUmAmCmCmCfAmAfAfUfCmSEQ ID UAUACCCAAAUCACAG SEQ IDETXS1137AmCmAmGmUmGmGmAmCmNO: 560 UGGAC NO: 373 GmsGmsUmUmUmGmAfAmCfUfCfAmSEQ ID GGUUUGAACUCACUCA SEQ IDETXS1139CmUmCmAmCmCmUmAmCmNO: 561 CCUAC NO: 345 GmsGmsAmGmGmUmGfUmCfUfCfUmSEQ ID GGAGGUGUCUCUGCUC SEQ IDETXS1141GmCmUmCmUmAmAmGmUmNO: 562 UAAGU NO: 332 UmsGmsCmGmUmCmUfCmUfCfCfUmSEQ ID UGCGUCUCUCCUCACA SEQ IDETXS1143CmAmCmAmAmGmGmUmGmNO: 563 AGGUG NO: 401 AmsGmsGmAmGmAmAfGmAfUfGfAmSEQ ID AGGAGAAGAUGAUGAC SEQ IDETXS1145UmGmAmCmAmUmUmUmUmNO: 564 AUUUU NO: 331 UmsGmsGmAmGmGmUfGmUfCfUfCmSEQ ID UGGAGGUGUCUCUGCU SEQ IDETXS1147UmGmCmUmCmUmAmAmGmNO: 565 CUAAG NO: 366UmsUmsAmUmUmGmGfGmGfCfUfGmSEQ ID UUAUUGGGGCUGGGGA SEQ IDETXS1149GmGmGmAmGmGmAmGmAmNO: 566 GGAGA NO: 376 CmsCmsUmGmAmCmUfUmUfUfCfCmSEQ ID CCUGACUUUUCCAAAG SEQ IDETXS1151AmAmAmGmUmGmCmCmUmNO: 567 UGCCU NO: 343 GmsGmsCmAmCmAmUfUmUfCfCfGmSEQ ID GGCACAUUUCCGUUGC SEQ IDETXS1153UmUmGmCmAmAmUmGmGmNO: 568 AAUGG NO: 372 UmsGmsCmUmCmUmASEQ ID UGCUCUAAGUAAACAA SEQ IDETXS1155fAmGfUfAfAmAmCmAmAmCmAmGmUmUmNO: 569 CAGUU NO: 321 UmsUmsGmGmAmGmGfUmGfUfCfUmSEQ ID UUGGAGGUGUCUCUGC SEQ IDETXS1157CmUmGmCmUmCmUmAmAmNO: 570 UCUAA NO: 314 UmsGmsCmUmAmUmGfUmAfAfAfCmSEQ ID UGCUAUGUAAACUUGA SEQ IDETXS1159UmUmGmAmAmUmUmUmCmNO: 571 AUUUC NO: 318 UmsGmsGmAmUmUmUfCmCfUfAfAmSEQ ID UGGAUUUCCUAAUAAU SEQ IDETXS1161UmAmAmUmUmAmUmUmGmNO: 572 UAUUG NO: 357 AmsUmsUmAmUmUmGfGmGfGfCfUmSEQ ID AUUAUUGGGGCUGGGG SEQ IDETXS1163GmGmGmGmAmGmGmAmGmNO: 573 AGGAG NO: 396 CmsUmsUmUmUmCmCfAmAfAfGfUmSEQ ID CUUUUCCAAAGUGCCU SEQ IDETXS1165GmCmCmUmUmAmAmAmAmNO: 574 UAAAA NO: 317 UmsAmsUmUmGmGmGfGmCfUfGfGmSEQ ID UAUUGGGGCUGGGGAG SEQ IDETXS1167GmGmAmGmGmAmGmAmAmNO: 575 GAGAA NO: 386 GmsAmsCmAmUmCmGfGmGfAfCfAmSEQ ID GACAUCGGGACACCGA SEQ IDETXS1169CmCmGmAmGmCmUmAmGmNO: 576 GCUAG NO: 394 UmsUmsCmAmGmUmAfUmUfUfUfGmSEQ ID UUCAGUAUUUUGGAGG SEQ IDETXS1171GmAmGmGmUmGmUmCmUmNO: 577 UGUCU NO: 336 GmsAmsGmGmUmGmUfCmUfCfUfGmSEQ ID GAGGUGUCUCUGCUCU SEQ IDETXS1173CmUmCmUmAmAmGmUmAmNO: 578 AAGUA NO: 358 UmsGmsGmUmUmUmGfAmAfCfUfCmSEQ ID UGGUUUGAACUCACUC SEQ IDETXS1175AmCmUmCmAmCmCmUmAmNO: 579 ACCUA NO: 339 UmsCmsUmGmAmUmUfUmCfUfGfAmSEQ ID UCUGAUUUCUGAAUGU SEQ IDETXS1177AmUmGmUmAmAmAmGmUmNO: 580 AAAGU NO: 309 UmsGmsUmAmAmAmCfUmUfGfAfAmSEQ ID UGUAAACUUGAAUUUC SEQ IDETXS1179UmUmUmCmCmUmAmUmGmNO: 581 CUAUG NO: 304 GmsUmsGmUmCmUmCfUmGfCfUfCmSEQ ID GUGUCUCUGCUCUAAG SEQ IDETXS1181UmAmAmGmUmAmAmAmCmNO: 582 UAAAC NO: 330 CmsUmsGmCmGmUmCfUmCfUfCfCmSEQ ID CUGCGUCUCUCCUCAC SEQ IDETXS1183UmCmAmCmAmAmGmGmUmNO: 583 AAGGU NO: 382 UmsUmsAmUmGmUmUfCmAfGfUfAmSEQ ID UUAUGUUCAGUAUUUU SEQ IDETXS1185UmUmUmUmGmGmAmGmGmNO: 584 GGAGG NO: 387 CmsAmsCmAmGmUmGfGmAfCfAfUmSEQ ID CACAGUGGACAUCGGG SEQ IDETXS1187CmGmGmGmAmCmAmCmCmNO: 585 ACACC NO: 352UmsCmsUmGmCmUmCfUmAfAfGfUmSEQ ID UCUGCUCUAAGUAAAC SEQ IDETXS1189AmAmAmCmAmAmCmAmGmNO: 586 AACAG NO: 361 CmsGmsGmCmAmCmAfUmUfUfCfCmSEQ ID CGGCACAUUUCCGUUG SEQ IDETXS1191GmUmUmGmCmAmAmUmGmNO: 587 CAAUG NO: 350 UmsCmsAmGmUmAmUfUmUfUfGfGmSEQ ID UCAGUAUUUUGGAGGU SEQ IDETXS1193AmGmGmUmGmUmCmUmCmNO: 588 GUCUC NO: 374 GmsCmsAmCmAmUmUSEQ ID GCACAUUUCCGUUGCA SEQ IDETXS1195fUmCfCfGfUmUmGmCmAmAmUmGmGmAmNO: 589 AUGGA NO: 348 CmsAmsUmGmCmUmAfUmGfUfAfAmSEQ ID CAUGCUAUGUAAACUU SEQ IDETXS1197AmCmUmUmGmAmAmUmUmNO: 590 GAAUU NO: 313 AmsUmsCmCmUmCmAfGmAfGfGfUmSEQ ID AUCCUCAGAGGUUUGA SEQ IDETXS1199UmUmGmAmCmCmGmAmAmNO: 591 CCGAA NO: 338 UmsCmsAmCmAmGmUfGmGfAfCfAmSEQ ID UCACAGUGGACAUCGG SEQ IDETXS1201UmCmGmGmGmAmCmAmCmNO: 592 GACAC NO: 400 CmsUmsUmUmCmAmAfGmAfAfGfCmSEQ ID CUUUCAAGAAGCCUUG SEQ IDETXS1203CmUmUmGmAmAmGmGmAmNO: 593 AAGGA NO: 375 AmsGmsGmUmGmUmCfUmCfUfGfCmSEQ ID AGGUGUCUCUGCUCUA SEQ IDETXS1205UmCmUmAmAmGmUmAmAmNO: 594 AGUAA NO: 325 UmsUmsUmUmGmGmAfGmGfUfGfUmSEQ ID UUUUGGAGGUGUCUCU SEQ IDETXS1207CmUmCmUmGmCmUmCmUmNO: 595 GCUCU NO: 363 GmsCmsAmUmGmAmAfUmGfUfGfCmSEQ ID GCAUGAAUGUGCCUUU SEQ IDETXS1209CmUmUmUmUmAmAmUmUmNO: 596 UAAUU NO: 355 AmsCmsAmUmCmGmGfGmAfCfAfCmSEQ ID ACAUCGGGACACCGAG SEQ IDETXS1211CmGmAmGmCmUmAmGmCmNO: 597 CUAGC NO: 377 AmsCmsUmGmCmGmUfCmUfCfUfCmSEQ ID ACUGCGUCUCUCCUCA SEQ IDETXS1213CmUmCmAmCmAmAmGmGmNO: 598 CAAGG NO: 398 GmsUmsAmUmAmCmCfCmAfAfAfUmSEQ ID GUAUACCCAAAUCACA SEQ IDETXS1215CmAmCmAmGmUmGmGmAmNO: 599 GUGGA NO: 391 UmsGmsCmUmGmGmAfUmGfUfAfCmSEQ ID UGCUGGAUGUACAGAG SEQ IDETXS1217AmGmAmGmAmUmAmCmCmNO: 600 AUACC NO: 368 AmsUmsGmUmAmAmAfCmUfUfGfAmSEQ ID AUGUAAACUUGAAUUU SEQ IDETXS1219AmUmUmUmCmCmUmAmUmNO: 601 CCUAU NO: 307 GmsGmsGmGmCmUmGfGmGfGfAfGmSEQ ID GGGGCUGGGGAGGAGA SEQ IDETXS1221GmAmGmAmAmGmAmUmGmNO: 602 AGAUG NO: 397 CmsUmsCmUmGmCmUfCmUfAfAfGmSEQ ID CUCUGCUCUAAGUAAA SEQ IDETXS1223UmAmAmAmCmAmAmCmAmNO: 603 CAACA NO: 384 UmsGmsGmGmGmCmUfGmGfGfGfAmSEQ ID UGGGGCUGGGGAGGAG SEQ IDETXS1225GmGmAmGmAmAmGmAmUmNO: 604 AAGAU NO: 392 AmsAmsUmCmAmCmAfGmUfGfGfAmSEQ ID AAUCACAGUGGACAUC SEQ IDETXS1227CmAmUmCmGmGmGmAmCmNO: 605 GGGAC NO: 383AmsGmsUmGmGmAmCfAmUfCfGfGmSEQ ID AGUGGACAUCGGGACA SEQ ID ETXS1229GmAmCmAmCmCmGmAmGmNO: 606 CCGAG NO: 395 AmsAmsUmAmAmUmUfAmUfUfGfGmSEQ ID AAUAAUUAUUGGGGCU SEQ ID ETXS1231GmGmCmUmGmGmGmGmAmNO: 607 GGGGA NO: 399 CmsAmsGmUmAmUmUfUmUfGfGfAmSEQ ID CAGUAUUUUGGAGGUG SEQ ID ETXS1233GmGmUmGmUmCmUmCmUmNO: 608 UCUCU NO: 328 SEQ ID AUUUUGGAGGUGUCUC SEQ I 1235AmsUmsUmUmUmGmD ETXSGfAmGfGfUfGmUmCmUmCmUmGmCmUmCmNO: 609 UGCUC NO: 344 iaiaAmsAmsAmCmUmUmGfAmAfUfUfSEQ ID AAACUUGAAUUUCCUA SEQ ID ETXS2399UfCmCmUmAmUmGmUmAmUmNO: 610 UGUAU NO: 302 iaiaAmsAmsAmCmUmUmGmAmAfUfUfSEQ ID AAACUUGAAUUUCCUA SEQ ID ETXS2401UmCmCmUmAmUmGmUmAmUmNO: 611 UGUAU NO: 302 iaiaCmsUmsUmGmAmAmUfUmUfCfCfSEQ ID CUUGAAUUUCCUAUGU SEQ ID ETXS2405UfAmUmGmUmAmUmUmUmUmNO: 612 AUUUU NO: 305 iaiaCmsUmsUmGmAmAmUmUmUfCfCfSEQ ID CUUGAAUUUCCUAUGU SEQ ID ETXS2407UmAmUmGmUmAmUmUmUmUmNO: 613 AUUUU NO: 305 iaiaCmsUmsUmUmUmCmCfAmAfAfGfSEQ ID CUUUUCCAAAGUGCCU SEQ ID ETXS2423UfGmCmCmUmUmAmAmAmAmNO: 614 UAAAA NO: 317 iaiaCmsUmsUmUmUmCmCmAmAfAfGfSEQ ID CUUUUCCAAAGUGCCU SEQ ID ETXS2425UmGmCmCmUmUmAmAmAmAmNO: 615 UAAAA NO: 317 iaiaCmsAmsGmUmAmUmUfUmUfGfGfSEQ ID CAGUAUUUUGGAGGUG SEQ ID ETXS2429AfGmGmUmGmUmCmUmCmUmNO: 616 UCUCU NO: 328 iaiaCmsAmsGmUmAmUmUmUmUfGfGfSEQ ID CAGUAUUUUGGAGGUG SEQ ID ETXS2431AmGmGmUmGmUmCmUmCmUmNO: 617 UCUCU NO: 328 As used herein, and in particular in Tables 3 and 4, the following abbreviations are used for modified nucleosides: Am stands for 2'-O-methyl-adenosine, Cm stands for 2'-O-methyl-cytidine, Gm stands for 2'-O- methyl-guanosine, Um stands for 2'-O-methyl-uridine, Af stands for 2'-Fluoro-adenosine, Cf stands for 2'-Fluoro-cytidine, Gf stands for 2'-Fluoro-guanosine and Uf stands for 2'-Fluoro- uridine. Furthermore, the letter “s” is used as abbreviation for a phosphorothioate linkage between two consecutive (modified) nucleosides. For example, the abbreviation “AmsAm” is used for two consecutive 2'-O-methyl-adenosine nucleosides that are linked via a 3’-5’ phosphorothioate linkage. No abbreviation is used for nucleosides that are linked via a standard 3’-5’ phosphodiester linkage. For example, the abbreviation “AmAm” is used for two consecutive 2'-O-methyl- adenosine nucleosides that are linked via a 3’-5’ phosphodiester linkage. In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:62-81 or 402-513; and a second strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:82-101 or 514-621. Preferred combinations of complementary modified antisense (first) and sense (second) strands are listed below in Table 5: Table 5 Duplex ID First (Antisense) strand ID Second (Sense) strand ID ETXM619 ETXS1238 ETXS1237 ETXM620 ETXS1240 ETXS1239 ETXM621 ETXS1242 ETXS1241 ETXM622 ETXS1244 ETXS1243 ETXM623 ETXS1246 ETXS1245 ETXM624 ETXS1248 ETXS1247 ETXM625 ETXS1250 ETXS1249 ETXM626 ETXS1252 ETXS1251 ETXM627 ETXS1254 ETXS1253 ETXM628 ETXS1256 ETXS1255 ETXM629 ETXS1258 ETXS1257 ETXM630 ETXS1260 ETXS1259 ETXM631 ETXS1262 ETXS1261 ETXM632 ETXS1264 ETXS1263 ETXM633 ETXS1266 ETXS1265 ETXM634 ETXS1268 ETXS1267 ETXM635 ETXS1270 ETXS1269 ETXM636 ETXS1272 ETXS1271 ETXM637 ETXS1274 ETXS1273 ETXM638 ETXS1276 ETXS1275 ETXM519 ETXS1038 ETXS1037 ETXM520 ETXS1040 ETXS1039 ETXM521 ETXS1042 ETXS1041 ETXM522 ETXS1044 ETXS1043 ETXM523 ETXS1046 ETXS1045 ETXM524 ETXS1048 ETXS1047 ETXM525 ETXS1050 ETXS1049 ETXM526 ETXS1052 ETXS1051 ETXM527 ETXS1054 ETXS1053 ETXM528 ETXS1056 ETXS1055 ETXM529 ETXS1058 ETXS1057 ETXM530 ETXS1060 ETXS1059 ETXM531 ETXS1062 ETXS1061 ETXM532 ETXS1064 ETXS1063 ETXM533 ETXS1066 ETXS1065 ETXM534 ETXS1068 ETXS1067 ETXM535 ETXS1070 ETXS1069 ETXM536 ETXS1072 ETXS1071 ETXM537 ETXS1074 ETXS1073 ETXM538 ETXS1076 ETXS1075 ETXM539 ETXS1078 ETXS1077 ETXM540 ETXS1080 ETXS1079 ETXM541 ETXS1082 ETXS1081 ETXM542 ETXS1084 ETXS1083 ETXM543 ETXS1086 ETXS1085 ETXM544 ETXS1088 ETXS1087 ETXM545 ETXS1090 ETXS1089 ETXM546 ETXS1092 ETXS1091 ETXM547 ETXS1094 ETXS1093 ETXM548 ETXS1096 ETXS1095 ETXM549 ETXS1098 ETXS1097 ETXM550 ETXS1100 ETXS1099 ETXM551 ETXS1102 ETXS1101 ETXM552 ETXS1104 ETXS1103 ETXM553 ETXS1106 ETXS1105 ETXM554 ETXS1108 ETXS1107 ETXM555 ETXS1110 ETXS1109 ETXM556 ETXS1112 ETXS1111 ETXM557 ETXS1114 ETXS1113 ETXM558 ETXS1116 ETXS1115 ETXM559 ETXS1118 ETXS1117 ETXM560 ETXS1120 ETXS1119 ETXM561 ETXS1122 ETXS1121 ETXM562 ETXS1124 ETXS1123 ETXM563 ETXS1126 ETXS1125 ETXM564 ETXS1128 ETXS1127 ETXM565 ETXS1130 ETXS1129 ETXM566 ETXS1132 ETXS1131 ETXM567 ETXS1134 ETXS1133 ETXM568 ETXS1136 ETXS1135 ETXM569 ETXS1138 ETXS1137 ETXM570 ETXS1140 ETXS1139 ETXM571 ETXS1142 ETXS1141 ETXM572 ETXS1144 ETXS1143 ETXM573 ETXS1146 ETXS1145 ETXM574 ETXS1148 ETXS1147 ETXM575 ETXS1150 ETXS1149 ETXM576 ETXS1152 ETXS1151 ETXM577 ETXS1154 ETXS1153 ETXM578 ETXS1156 ETXS1155 ETXM579 ETXS1158 ETXS1157 ETXM580 ETXS1160 ETXS1159 ETXM581 ETXS1162 ETXS1161 ETXM582 ETXS1164 ETXS1163 ETXM583 ETXS1166 ETXS1165 ETXM584 ETXS1168 ETXS1167 ETXM585 ETXS1170 ETXS1169 ETXM586 ETXS1172 ETXS1171 ETXM587 ETXS1174 ETXS1173 ETXM588 ETXS1176 ETXS1175 ETXM589 ETXS1178 ETXS1177 ETXM590 ETXS1180 ETXS1179 ETXM591 ETXS1182 ETXS1181 ETXM592 ETXS1184 ETXS1183 ETXM593 ETXS1186 ETXS1185 ETXM594 ETXS1188 ETXS1187 ETXM595 ETXS1190 ETXS1189 ETXM596 ETXS1192 ETXS1191 ETXM597 ETXS1194 ETXS1193 ETXM598 ETXS1196 ETXS1195 ETXM599 ETXS1198 ETXS1197 ETXM600 ETXS1200 ETXS1199 ETXM601 ETXS1202 ETXS1201 ETXM602 ETXS1204 ETXS1203 ETXM603 ETXS1206 ETXS1205 ETXM604 ETXS1208 ETXS1207 ETXM605 ETXS1210 ETXS1209 ETXM606 ETXS1212 ETXS1211 ETXM607 ETXS1214 ETXS1213 ETXM608 ETXS1216 ETXS1215 ETXM609 ETXS1218 ETXS1217 ETXM610 ETXS1220 ETXS1219 ETXM611 ETXS1222 ETXS1221 ETXM612 ETXS1224 ETXS1223 ETXM613 ETXS1226 ETXS1225 ETXM614 ETXS1228 ETXS1227 ETXM615 ETXS1230 ETXS1229 ETXM616 ETXS1232 ETXS1231 ETXM617 ETXS1234 ETXS1233 ETXM618 ETXS1236 ETXS1235 ETXM1200 ETXS2400 ETXS2399 ETXM1201 ETXS2402 ETXS2401 ETXM1203 ETXS2406 ETXS2405 ETXM1204 ETXS2408 ETXS2407 ETXM1212 ETXS2424 ETXS2423 ETXM1213 ETXS2426 ETXS2425 ETXM1215 ETXS2430 ETXS2429 ETXM1216 ETXS2432 ETXS2431 ETXM1217 ETXS2434 ETXS2401 ETXM1218 ETXS2436 ETXS2407 ETXM1219 ETXS2438 ETXS2425 ETXM1220 ETXS2440 ETXS2431 In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Modified first strand Modified second strand SEQ ID NO: 502 (ETXS2400) SEQ ID NO: 610 (ETXS2399) SEQ ID NO: 503 (ETXS2402) SEQ ID NO: 611 (ETXS2401) SEQ ID NO: 504 (ETXS2406) SEQ ID NO: 612 (ETXS2405) SEQ ID NO: 505 (ETXS2408) SEQ ID NO: 613 (ETXS2407) SEQ ID NO: 506 (ETXS2424) SEQ ID NO: 614 (ETXS2423) SEQ ID NO: 507 (ETXS2426) SEQ ID NO: 615 (ETXS2425) SEQ ID NO: 508 (ETXS2430) SEQ ID NO: 616 (ETXS2429) SEQ ID NO: 509 (ETXS2432) SEQ ID NO: 617 (ETXS2431) SEQ ID NO: 510 (ETXS2434) SEQ ID NO: 611 (ETXS2401) SEQ ID NO: 511 (ETXS2436) SEQ ID NO: 613 (ETXS2407) SEQ ID NO: 512 (ETXS2438) SEQ ID NO: 615 (ETXS2425) SEQ ID NO: 513 (ETXS2440) SEQ ID NO: 617 (ETXS2431) In case of ambiguity between the sequences in this specification and the sequences in the attached sequence listing, the sequences provided herein are considered to be the correct sequences. ABASIC NUCLEOTIDES In certain embodiments, there are 1, e.g. 2, e.g. 3, e.g. 4 or more abasic nucleosides present in nucleic acids according to the invention. Abasic nucleosides are modified nucleosides because they lack the base normally seen at position 1 of the sugar moiety. Typically, there will be a hydrogen at position 1 of the sugar moiety of the abasic nucleosides present in a nucleic acid according to the present invention. The abasic nucleosides are in the terminal region of the second strand, preferably located within the terminal 5 nucleosides of the end of the strand. The terminal region may be the terminal 5 nucleosides, which includes abasic nucleosides. The second strand may comprise, as preferred features (which are all specifically contemplated in combination unless mutually exclusive): 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides; and / or 2, or more than 2, consecutive abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the 2 terminal nucleosides connected via a 3’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3’-3’ reversed linkage; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. Preferably there is an abasic nucleoside at the terminus of the second strand. Preferably there are 2 or at least 2 abasic nucleosides in the terminal region of the second strand, preferably at the terminal and penultimate positions. Preferably 2 or more abasic nucleosides are consecutive, for example all abasic nucleosides may be consecutive. For example, the terminal 1 or terminal 2 or terminal 3 or terminal 4 nucelotides may be abasic nucleosides. An abasic nucleoside may also be linked to an adjacent nucleoside through a 5’-3’ phosphodiester linkage or reversed linkage unless there is only 1 abasic nucleoside at the terminus, in which case it will have a reversed linkage to the adjacent nucleoside. A reversed linkage (which may also be referred to as an inverted linkage, which is also seen in the art), comprises either a 5’-5’, a 3’-3’, a 3’-2’ or a 2’-3’ phosphodiester linkage between the adjacent sugar moieties of the nucleosides. Abasic nucleosides which are not terminal will have 2 phosphodiester bonds, one with each adjacent nucleoside, and these may be a reversed linkage or may be a 5’-3 phosphodiester bond or may be one of each. A preferred embodiment comprises 2 abasic nucleosides at the terminal and penultimate positions of the second strand, and wherein the reversed internucleoside linkage is located between the penultimate (abasic) nucleoside and the antepenultimate nucleoside. Preferably there are 2 abasic nucleosides at the terminal and penultimate positions of the second strand and the penultimate nucleoside is linked to the antepenultimate nucleoside through a reversed internucleoside linkage and is linked to the terminal nucleoside through a 5’-3’ or 3’-5’ phosphodiester linkage (reading in the direction of the terminus of the molecule). Different preferred features are as follows: The reversed internucleoside linkage is a 3’-3’ reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal phosphate of the second strand. The reversed internucleoside linkage is a 5’-5’ reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 3’ terminal hydroxide of the second strand. In certain embodiments, the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 5-5’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3’-5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 19 or 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 5’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand. Alternatively the second strand comprises 2 consecutive abasic nucleosides preferably in an overhang in the 3’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 3’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 3’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 3’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 3-3’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 5’-3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 19 or 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 3’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 3’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 3’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 5’ terminal region of the second strand. Examples of the structures are as follows (where the specific RNA nucleosides shown are not limiting and could be any RNA nucleoside): A A 3’-3’ reversed bond (and also showing the 5’-3 direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule) B Illustrating a 5’-5’ reversed bond (and also showing the 3’-5’ direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule)

[0002] The abasic nucleoside or abasic nucleosides present in the nucleic acid are provided in the presence of a reversed internucleoside linkage or linkages, namely a 5’-5’ or a 3’-3’ reversed internucleoside linkage. A reversed linkage occurs as a result of a change of orientation of an adjacent nucleoside sugar, such that the sugar will have a 3’ – 5’ orientation as opposed to the conventional 5’ – 3’ orientation (with reference to the numbering of ring atoms on the nucleoside sugars). The abasic nucleoside or nucleosides as present in the nucleic acids of the invention preferably include such inverted nucleoside sugars. In the case of a terminal nucleoside having an inverted orientation, then this will result in an “inverted” end configuration for the overall nucleic acid. Whilst certain structures drawn and referenced herein are represented using conventional 5’ - 3’ direction (with reference to the numbering of ring atoms on the nucleoside sugars), it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 3’-3’ reversed linkage, will result in a nucleic acid having an overall 5’- 5’ end structure (i.e. the conventional 3’ end nucleoside becomes a 5’ end nucleoside). Alternatively, it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 5’-5’ reversed linkage will result in a nucleic acid with an overall 3’- 3’ end structure. The proximal 3’-3’ or 5’-5’ reversed linkage as herein described, may comprise the reversed linkage being directly adjacent / attached to a terminal nucleoside having an inverted orientation, such as a single terminal nucleoside having an inverted orientation. Alternatively, the proximal 3’-3’ or 5’-5’ reversed linkage as herein described, may comprise the reversed linkage being adjacent 2, or more than 2, nucleosides having an inverted orientation, such as 2, or more than 2, terminal region nucleosides having an inverted orientation, such as the terminal and penultimate nucleosides. In this way, the reversed linkage may be attached to a penultimate nucleoside having an inverted orientation. While a skilled addressee will appreciate that inverted orientations as described above can result in nucleic acid molecules having overall 3’ - 3’ or 5’- 5’ end structures as described herein, it will also be appreciated that with the presence of one or more additional reversed linkages and / or nucleosides having an inverted orientation, then the overall nucleic acid may have 3’ - 5’ end structures corresponding to the conventionally positioned 5’ / 3’ ends. In one aspect the nucleic acid may have a 3’-3’ reversed linkage, and the terminal sugar moiety may comprise a 5’ OH rather than a 5’ phosphate group at the 5’ position of that terminal sugar. A skilled person would therefore clearly understand that 5’-5’, 3’-3’ and 3’-5’ (reading in the direction of that terminus) end variants of the more conventional 5’- 3’ structures (with reference to the numbering of ring atoms on the end nucleoside sugars) drawn herein are included in the scope of the disclosure, where a reversed linkage or linkages is / are present. In the situation of e.g. a reversed internucleoside linkage and / or one or more nucleosides having an inverted orientation creating an inverted end, and where the relative position of a linkage (e.g. to a linker) or the location of an internal feature (such as a modified nucleoside) is defined relative to the 5’ or 3’ end of the nucleic acid, then the 5’ or 3’ end is the conventional 5’ or 3’ end which would have existed had a reversed linkage not been in place, and wherein the conventional 5’ or 3’ end is determined by consideration of the directionality of the majority of the internal nucleoside linkages and / or nucleoside orientation within the nucleic acid. It is possible to tell from these internal bonds and / or nucleoside orientation which ends of the nucleic acid would constitute the conventional 5’ and 3’ ends (with reference to the numbering of ring atoms on the end nucleoside sugars) of the molecule absent the reversed linkage. For example, in the structure shown below there are abasic residues in the first 2 positions located at the “5’” end. Where the terminal nucleoside has an inverted orientation then the “5’” end indicated in the diagram below, which is the conventional 5’ end, can in fact comprise a 3’ OH in view of the inverted nucleoside at the terminal position. Nevertheless the majority of the molecule will comprise conventional internucleoside linkages that run from the 3’ OH of the sugar to the 5’ phosphate of the next sugar, when reading in the standard 5’ [PO4] to 3’ [OH] direction of a nucleic acid molecule (with reference to the numbering of ring atoms on the nucleoside sugars), which can be used to determine the conventional 5’ and 3’ ends that would be found absent the inverted end configuration. A 5’ A-A-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me 3’ The reversed bond is preferably located at the end of the nucleic acid e.g. RNA which is distal to a ligand moiety, such as a GalNAc containing portion, of the molecule. GalNAc-siRNA constructs with a 5’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. GalNAc-siRNA constructs with a 3’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. NUCLEIC ACID LENGTHS In one aspect the i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides. Typically, the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 nucleosides in length. Similarly, the region of complementarity between the first strand and the portion of RNA transcribed from the B4GALT1 gene is between 17 and 30 nucleosides in length. In one aspect the i) the first strand of the nucleic acid has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; and / or ii) the second strand of the nucleic acid has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23. Generally, the duplex structure of the nucleic acid e.g. an iRNA is about 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19- 29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. Similarly, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is about 15 to 30 nucleosides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18- 20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20- 24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21- 25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. In certain preferred embodiments, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is at least 17 nucleosides in length. For example, the region of complementarity between the antisense strand and the target is 19 to 21 nucleosides in length, for example, the region of complementarity is 21 nucleosides in length. In preferred embodiments, each strand is no more than 30 nucleosides in length. In certain embodiments, the duplex structure of the nucleic acid e.g. an siRNA is 19 base pairs in length. In particularly preferred embodiment, the duplex may have the following structure: A nucleic acid e.g. a dsRNA as described herein can further include one or more single-stranded nucleoside overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleosides. A nucleoside overhang can comprise or consist of a nucleoside / nucleoside analog, including a deoxynucleoside / nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleoside(s) of an overhang can be present on the 5'-end, 3'- end, or both ends of an antisense or sense strand of a nucleic acid e.g. a dsRNA. In certain preferred embodiments, at least one strand comprises a 3' overhang of at least 1 nucleoside, e.g., at least one strand comprises a 3' overhang of at least 2 nucleosides. The overhang is suitably on the antisense / guide strand and / or the sense / passenger strand. NUCLEIC ACID MODIFICATIONS In certain embodiments, the nucleic acid e.g. an RNA of the invention e.g., a dsiRNA, does not comprise further modifications, e.g., chemical modifications or conjugations known in the art and described herein. In other preferred embodiments, the nucleic acid e.g. RNA of the invention, e.g., a dsiRNA, is further chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleosides are modified. The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3 '-end modifications (conjugation, DNA nucleosides within an RNA, or RNA nucleosides within a DNA, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, conjugated bases; sugar modifications (e.g. , at the 2'- position or 4'- position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of nucleic acids such as siRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. Nucleic acids such as RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleic acids e.g. RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified nucleic acid e.g. an siRNA will have a phosphorus atom in its internucleoside backbone. Modified nucleic acid e.g. RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 5'-3' or 5'-2'. Various salts, mixed salts and free acid forms are also included. Modified nucleic acids e.g. RNAs can also contain one or more substituted sugar moieties. The nucleic acids e.g. siRNAs, e.g., dsiRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O- alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted. 2’ O-methyl and 2’-F are preferred modifications. In certain preferred embodiments, the nucleic acid comprises at least one modified nucleoside. The nucleic acid of the invention may comprise one or more modified nucleosides on the first strand and / or the second strand. In some embodiments, substantially all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification. In some embodiments, all of the nucleosides of the sense strand and substantially all of the nucleosides of the antisense strand comprise a modification. In some embodiments, all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification. In one embodiment, at least one of the modified nucleosides is selected from the group consisting of a deoxy- nucleoside, a 3'-terminal deoxy-thymine (dT) nucleoside, a 2'-O-methyl modified nucleoside (also called herein 2’-Me, where Me is a methoxy) , a 2'-fluoro modified nucleoside, a 2'-deoxy- modified nucleoside, a locked nucleoside, an unlocked nucleoside, a conformationally restricted nucleoside, a constrained ethyl nucleoside, an abasic nucleoside, a 2'-amino- modified nucleoside, a 2'-O-allyl- modified nucleoside, 2' -C-alkyl- modified nucleoside, 2'-hydroxly- modified nucleoside, a 2'- methoxyethyl modified nucleoside, a 2'-O-alkyl-modified nucleoside, a morpholino nucleoside, a phosphoramidate, a non-natural base comprising nucleoside, a tetrahydropyran modified nucleoside, a 1 ,5-anhydrohexitol modified nucleoside, a cyclohexenyl modified nucleoside, a nucleoside comprising a phosphorothioate group, a nucleoside comprising a methylphosphonate group, a nucleoside comprising a 5 '-phosphate, and a nucleoside comprising a 5 '-phosphate mimic. In another embodiment, the modified nucleosides comprise a short sequence of 3 '-terminal deoxy-thymine nucleosides (dT). Modifications on the nucleosides may preferably be selected from the group including, but not limited to, LNA, HNA, CeNA, 2-methoxyethyl, 2'-O-alkyl, 2-O-allyl, 2'-C- allyl, 2'-fluoro, 2'- deoxy, 2'- hydroxyl, and combinations thereof. In another embodiment, the modifications on the nucleosides are 2’O-methyl (“2-Me”) or 2'-fluoro modifications. One preferred modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications. Preferred nucleic acid comprise one or more nucleosides on the first strand and / or the second strand which are modified, to form modified nucleosides, as follows: A nucleic acid wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications. A nucleic acid wherein the first strand comprises a 2’-F modification at any of position 2, position 6, position 14, or any combination thereof, counting from position 1 of said first strand. A nucleic acid wherein the second strand comprises a 2’-F modification at any of position 7, position 9, position 11, or any combination thereof, counting from position 1 of said second strand. A nucleic acid wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11, and / or 13 , counting from position 1 of said second strand. A nucleic acid wherein the second strand comprises a 2’-F modification at position 7 and 9 and 11 counting from position 1 of said second strand. A nucleic acid wherein the first and second strand each comprise 2'-Me and 2’-F modifications. A nucleic which comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid. A nucleic acid wherein the nucleic acid comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 72’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand. A nucleic acid wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand. A nucleic acid wherein said first strand comprises at least 52’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region. A nucleic acid wherein said first strand comprises 7 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region. A nucleic acid which comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand. A nucleic acid which is an siRNA oligonucleoside, wherein the siRNA oligonucleoside comprises at least 32’-F modifications at positions 6 to 12 of the second strand, counting from position 1 of said second strand. A nucleic acid which is an siRNA oligonucleoside, wherein said second strand comprises at least 32’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand. A nucleic acid which is an siRNA oligonucleoside, wherein each of the first and second strands comprises an alternating modification pattern, preferably a fully alternating modification pattern along the entire length of each of the first and second strands, wherein the nucleosides of the first strand are modified by (i) 2’Me modifications on the odd numbered nucleosides counting from position 1 of the first strand, and (ii) 2’F modifications on the even numbered nucleosides counting from position 1 of the first strand, and nucleosides of the second strand are modified by (i) 2’F modifications on the odd numbered nucleosides counting from position 1 of the second strand, and (ii) 2’Me modifications on the even numbered nucleosides counting from position 1 of the second strand. Typically, such fully alternating modification patterns are present in a blunt ended oligonucleoside, wherein each of the first and second strands are 19 or 23 nucleosides in length. Position 1 of the first or the second strand is the nucleoside which is the closest to the end of the nucleic acid (ignoring any abasic nucleosides) and that is joined to an adjacent nucleoside (at Position 2) via a 3’ to 5’ internal bond, with reference to the bonds between the sugar moieties of the backbone, and reading in a direction away from that end of the molecule. It can therefore be seen that “position 1 of the sense strand” is the 5’ most nucleoside (not including abasic nucleosides) at the conventional 5’ end of the sense strand. Typically, the nucleoside at this position 1 of the sense strand will be equivalent to the 5’ nucleoside of the selected target nucleic acid sequence, and more generally the sense strand will have equivalent nucleosides to those of the target nucleic acid sequence starting from this position 1 of the sense strand, whilst also allowing for acceptable mismatches between the sequences. As used herein, “position 1 of the antisense strand” is the 5’ most nucleoside (not including abasic nucleosides) at the conventional 5’ end of the antisense strand. As hereinbefore described, there will be a region of complementarity between the sense and antisense strands, and in this way the antisense strand will also have a region of complementarity to the target nucleic acid sequence as referred to above. In certain embodiments, the nucleic acid e.g. RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. For example the phosphorothioate or methylphosphonate internucleoside linkage can be at the 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkage is at the 5 'terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. In certain embodiments, a phosphorothioate or a methylphosphonate internucleoside linkage is at both the 5'- and 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. Any nucleic acid may comprise one or more phosphorothioate (PS) modifications within the nucleic acid, such as at least two PS internucleoside bonds at the ends of a strand. At least one of the oligoribonucleoside strands preferably comprises at least two consecutive phosphorothioate modifications in the last 3 nucleosides of the oligonucleoside. The invention therefore also relates to: A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions, such as in a 5’ and / or 3’ terminal region and / or near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located. A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably the terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage. The nucleic acid strand may be an RNA comprising a phosphorothioate internucleoside linkage between the three nucleosides contiguous with 2 terminally located abasic nucleosides. A preferred nucleic acid is a double stranded RNA comprising 2 adjacent abasic nucleosides at the 5’ terminus of the second strand and a ligand moiety comprising one or more GalNAc ligand moieties at the opposite 3’ end of the second strand. Further preferred, the same nucleic acid may also comprise a phosphorothioate bond between nucelotides at positions 3-4 and 4-5 of the second strand, reading from the position 1 of the second strand. Further preferred, the same nucleic acid may also comprise a 2’ F modification at positions 7, 9 and 11 of the second strand. Preferred modifications of nucleic acids having the structure are as follows: A nucleic acid wherein modified nucleosides of the first strand have a modification pattern according to (5’-3’): Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me. A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5’-3’): F(s)Me(s)F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F, or F - Me - F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F(s)Me(s)F; wherein (s) is a phosphorothioate internucleoside linkage. A nucleic acid wherein modified nucleosides of the second strand have a modification pattern according to (5’-3’): F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F. A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5’-3’): F(s)Me(s)F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F, or F - Me - F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F(s)Me(s)F; wherein (s) is a phosphorothioate internucleoside linkage. A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5’-3’): ia – ia - F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F, or F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – ia – ia; wherein ia represents an inverted abasic nucleoside. In certain embodiments, the inverted abasic nucleosides as represented by ia - ia are present in a 2 nucleoside overhang. A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to any one of the following (5’-3’): ia – ia – F(s)Me(s)F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F, or F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me – F – Me(s)F(s)ia – ia; wherein (s) is a phosphorothioate internucleoside linkage and ia represents an inverted abasic nucleoside. In certain embodiments, the inverted abasic nucleosides as represented by ia - ia are present in a 2 nucleoside overhang. Preferred modifications of nucleic acids having the structure are as follows: A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5’-3’): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me. A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5’-3’): Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, or Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me – Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me, or Me – Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me – Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me – Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me – Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, wherein (s) is a phosphorothioate internucleoside linkage. A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, or ia – ia - Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or ia – ia - Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, or ia – ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or ia – ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me - ia – ia, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, or Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me- ia – ia, wherein ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3’ terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang. A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, or ia – ia - Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia – ia - Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia – ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, or ia – ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me – Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me - ia – ia, or Me – Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, or Me – Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, or Me – Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia , or Me – Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3’ terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5’-3’): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5’-3’): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me Or Modification pattern 6: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5’-3’): Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein (s) is a phosphorothioate internucleoside linkage. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5’-3’): Me – Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5’-3’): Me – Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein (s) is a phosphorothioate internucleoside linkage. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me Or Modification pattern 6: Second strand (5’-3’): ia – ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me, wherein ia represents an inverted abasic nucleoside. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me – Me - ia – ia, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5’-3’): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5’-3’): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, First strand (5’-3’): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, First strand (5’-3’): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia, First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me Or Modification pattern 6: Second strand (5’-3’): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me - ia – ia,- First strand (5’-3’): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me – Me, wherein ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3’ terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me – Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5’-3’): ia – ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside. A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5’-3’): Me – Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5’-3’): Me – Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5’-3’): Me – Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia – ia, First strand (5’-3’): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3’ terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, provided that the overall number of 2’F sugar modifications in the first strand does not consist of four, or six, 2’F modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three, five or seven 2’F modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three 2’F modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of five 2’F modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – (Me)7– (F – Me)2– X3– Me – X4– (Me)3wherein X2, X3and X4are selected from 2’Me and 2’F sugar modifications, provided that for X2, X3and X4at least one is a 2’F sugar modification, and the other two sugar modifications are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – (Me)7– (F – Me)2– X3– Me – X4– (Me)3wherein X2is a 2’F sugar modification, and X3and X4are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – (Me)7– (F – Me)2– X3– Me – X4– (Me)3wherein X3is a 2’F sugar modification, and X2and X4are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – (Me)7– (F – Me)2– X3– Me – X4– (Me)3wherein X4is a 2’F sugar modification, and X2and X3are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of seven 2’F modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – Me – (F)2– (Me)4– (F – Me)2– X3– Me – X4– (Me)3wherein X2, X3and X4are selected from 2’Me and 2’F sugar modifications, provided that for X2, X3and X4at least one is a 2’F sugar modification, and the other two sugar modifications are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – Me – (F)2– (Me)4– (F – Me)2– X3– Me – X4– (Me)3wherein X2is a 2’F sugar modification, and X3and X4are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – Me – (F)2– (Me)4– (F – Me)2– X3– Me – X4– (Me)3wherein X3is a 2’F sugar modification, and X2and X4are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – Me – X2– Me – F – Me – (F)2– (Me)4– (F – Me)2– X3– Me – X4– (Me)3wherein X4is a 2’F sugar modification, and X2and X3are 2’Me sugar modifications. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– (Me)7– F – Me – F – (Me)7wherein X1is a thermally destabilising modification. A nucleic acid wherein the first strand comprises a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– Me – (F)2– (Me)4– F – Me – F – (Me)7wherein X1is a thermally destabilising modification. A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): (Me)8– (F)3– (Me)10.A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): (Me)8– (F)3– (Me)10, and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, provided that the overall number of 2’F sugar modifications in the first strand does not consist of four, or six, 2’F modifications. A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): (Me)8– (F)3– (Me)10, and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three, five or seven 2’F modifications. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– (Me)7– F – Me – F – (Me)7, wherein X1is a thermally destabilising modification. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): (Me – F)3– (Me)7– F – Me – F – (Me)7.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – (Me)7– (F – Me)2– F – (Me)5.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – (Me)7– F – Me – F – (Me)3– F – (Me)3.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– Me – (F)2– (Me)4– F – Me – F – (Me)7, wherein X1is a thermally destabilising modification. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): (Me – F)3– Me – (F)2– (Me)4– (F – Me)2– (Me)6.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – Me – (F)2– (Me)4– (F – Me)2– F – (Me)5.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar modification pattern as follows (5’-3’): (Me)8– (F)3– (Me)10, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – Me – (F)2– (Me)4– (F – Me)2– (Me)2– F – (Me)3.A nucleic acid wherein the second strand comprises a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10wherein ia represents an inverted abasic nucleoside. A nucleic acid wherein the second strand comprises a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, provided that the overall number of 2’F sugar modifications in the first strand does not consist of four, or six, 2’F modifications. A nucleic acid wherein the second strand comprises a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three, five or seven 2’F modifications. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– (Me)7– F – Me – F – (Me)7, wherein X1is a thermally destabilising modification. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): (Me – F)3– (Me)7– F – Me – F – (Me)7.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – (Me)7– (F – Me)2– F – (Me)5.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – (Me)7– F – Me – F – (Me)3– F – (Me)3.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– X1– Me – (F)2– (Me)4– F – Me – F – (Me)7, wherein X1is a thermally destabilising modification. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): (Me – F)3– Me – (F)2– (Me)4– (F – Me)2– (Me)6.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – Me – (F)2– (Me)4– (F – Me)2– F – (Me)5.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-(Me)8– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me – F – (Me)3– F – Me – (F)2– (Me)4– (F – Me)2– (Me)2– F – (Me)3.A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10,wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage. A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10,wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage; and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, provided that the overall number of 2’F sugar modifications in the first strand does not consist of four, or six, 2’F modifications. A nucleic acid wherein the second strand comprises a 2’ sugar modification pattern as follows (5’- 3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10,wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage; and wherein the first strand comprises a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three, five or seven 2’F modifications. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– X1– (Me)7– F – Me – F – (Me)5(s)Me(s)Me, wherein X1is a thermally destabilising modification. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)Me – F – Me – F – (Me)7– F – Me – F – (Me)5(s)Me(s)Me. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– F – (Me)7– (F – Me)2– F – (Me)3(s)Me(s)Me. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– F – (Me)7– F – Me – F – (Me)3– F – Me(s)Me(s)Me.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– X1– Me – (F)2– (Me)4– F – Me – F – (Me)5(s)Me(s)Me, wherein X1is a thermally destabilising modification.A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)Me – F – Me – F – Me – (F)2– (Me)4– (F – Me)2– (Me)4(s)Me(s)Me. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– F – Me – (F)2– (Me)4– (F – Me)2– F – (Me)3(s)Me(s)Me. A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2’ sugar, and abasic modification pattern as follows (5’-3’): ia-ia-Me(s)Me(s) (Me)6– (F)3– (Me)10, wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2’ sugar modification pattern as follows (5’- 3’): Me(s)F(s)(Me)3– F – Me – (F)2– (Me)4– (F – Me)2– (Me)2– F – Me(s)Me(s)Me. Preferred modifications are as follows: Modification pattern 1: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me – Me – X1– Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – Me – Me – Me – Me – Me - Me, wherein X1is a thermally destabilising modification; Or Modification pattern 2: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – F – Me – F – Me – Me – Me – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me – Me – Me;Or Modification pattern 3: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me – Me – F – Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – F – Me – Me – Me – Me - Me; Or Modification pattern 4: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me - Me – F – Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – Me – Me – F – Me – Me - Me;Or Modification pattern 5: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me - Me – X1– Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me – Me – Me, wherein X1is a thermally destabilising modification; Or Modification pattern 6: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – F – Me - F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me – Me – Me;Or Modification pattern 7: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me – Me – F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – F – Me – Me – Me – Me - Me;Or Modification pattern 8: Second strand (5’-3’): ia – ia – Me – Me – Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me – F – Me – Me – Me – F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – F – Me – Me - Me. Particularly preferred modifications are as follows: Modification pattern 1: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me – Me – X1– Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – Me – Me – Me – Me(s)Me(s)Me, wherein X1is a thermally destabilising modification; Or Modification pattern 2: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – F – Me – F – Me – Me – Me – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me(s)Me(s)Me;Or Modification pattern 3: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me – Me – F – Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – F – Me – Me – Me(s)Me(s)Me;Or Modification pattern 4: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me - Me – F – Me – Me – Me – Me – Me – Me - Me – F – Me – F – Me – Me – Me – F – Me(s)Me(s)Me;Or Modification pattern 5: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me - Me – X1– Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me(s)Me(s)Me, wherein X1is a thermally destabilising modification; Or Modification pattern 6: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – F – Me - F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – Me – Me(s)Me(s)Me;Or Modification pattern 7: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me – Me – F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – F – Me – Me – Me(s)Me(s)Me;Or Modification pattern 8: Second strand (5’-3’): ia – ia – Me(s)Me(s)Me – Me – Me – Me – Me – Me – F – F – F – Me – Me – Me – Me – Me – Me – Me – Me – Me – Me, First strand (5’-3’): Me(s)F(s)Me – Me – Me – F – Me – F – F – Me – Me – Me – Me – F – Me – F – Me – Me – Me – F – Me(s)Me(s)Me; wherein (s) is a phosphorothioate internucleoside linkage. CONJUGATION OF NUCLEIC ACID TO LIGAND Another modification of a nucleic acid e.g. RNA e.g. an siRNA of the invention involves linking the nucleic acid e.g. the siRNA to one or more ligand moieties e.g. to enhance the activity, cellular distribution, or cellular uptake of the nucleic acid e.g. siRNA e.g., into a cell. In some embodiments, the ligand moiety described can be attached to a nucleic acid e.g. an siRNA oligonucleoside, via a linker that can be cleavable or non-cleavable. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. The ligand can be attached to the 3' or 5’ end of the sense strand. The ligand is preferably conjugated to 3’ end of the sense strand of the nucleic acid e.g. an siRNA agent. The invention therefore relates in a further aspect to a conjugate for inhibiting expression of a target e.g. a target gene, in a cell, said conjugate comprising a nucleic acid portion and one or more ligand moieties, said nucleic acid portion comprising a nucleic acid as disclosed herein. In one aspect the second strand of the nucleic acid is conjugated directly or indirectly (e.g. via a linker) to the one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3’ terminal region thereof. In certain embodiments, the ligand moiety comprises a GalNAc or GalNAc derivative attached to the nucleic acid e.g. dsiRNA through a linker. Therefore, the invention relates to a conjugate wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands conjugated to said nucleic acid through a linker. Said GalNAc ligand may be conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3’ terminal region thereof. GalNAc ligands are well known in the art and described in, inter alia, EP3775207A1. In some embodiments, the ligand moiety comprises one or more ligands. In some embodiments, the ligand moiety comprises one or more carbohydrate ligands. In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and / or polysaccharide. In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and / or one or more mannose moieties. In some embodiments, the one or more carbohydrates comprise one or more N-Acetyl- Galactosamine moieties. In some embodiments, the compounds as described anywhere herein comprise two or three N- AcetylGalactosamine moieties. In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker. Exemplary linear configurations and Exemplary branched configurations are shown in Figures 1a and 1b: In Fig 1a, (linear), (a) and / or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups. In Fig 1b, (branched), in some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration. Linker Exemplary compounds of the invention comprise a ‘linker moiety’, such as that as depicted in Formula (I), that is part of an overall ‘linker’. Formula I wherein: R1at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligonucleoside moiety. As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other. The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above. As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist. The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I). Tether moiety of Formula I In relation to Formula (I), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety. In some embodiments, R1is hydrogen at each occurrence. In some embodiments, R1is methyl. In some embodiments, R1is ethyl. In some embodiments, R2is hydroxy. In some embodiments, R2is halo. In some embodiments, R2is fluoro. In some embodiments, R2is chloro. In some embodiments, R2is bromo. In some embodiments, R2is iodo. In some embodiments, R2is nitro. In some embodiments, X1is methylene. In some embodiments, X1is oxygen. In some embodiments, X1is sulfur. In some embodiments, X2is methylene. In some embodiments, X2is oxygen. In some embodiments, X2is sulfur. In some embodiments, m = 3. In some embodiments, n = 6. In some embodiments, X1is oxygen and X2is methylene. In some embodiments, both X1and X2are methylene. In some embodiments, q = 1, r = 2, s = 1, t = 1, v = 1. In some embodiments, q = 1, r = 3, s = 1, t = 1, v = 1. In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is fluoro, X2is methylene, v = 1, t = 1, s = 1, X1is methylene, q = 1 and r = 2. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (IV) In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is fluoro, X2is methylene, v = 1, t = 1, s = 1, X1is oxygen, q = 1 and r = 2. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Alternative tether moieties During the synthesis of compounds of the present invention, alternative tether moiety structures may arise. In some embodiments, alternative tether moieties have a change of one or more atoms in the tether moiety of the overall linker compared to tether moieties described anywhere herein. In some embodiments, the alternative tether moiety is a compound of Formula (I) as described anywhere herein, wherein R2is hydroxy. In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is hydroxy, X2is methylene, v = 1, t = 1, s = 1, X1is methylene, q = 1 and r = 2. Thus, in some embodiments, compounds of the invention comprise the following structure: Formula (V) In some embodiments, R1 is hydrogen at each occurrence, n = 6, m = 3, R2 is hydroxy, X2 is methylene, v = 1, t = 1, s = 1, X1is oxygen, q = 1 and r = 2. Thus, in some embodiments, compounds of the invention comprise the following structure: Formula (III) Linker moiety In relation to Formula (I), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein. In some embodiments: as depicted in Formula (I) as described anywhere herein is any of Formulae (VIa), (VIb) or (VIc), preferably Formula (VIa): Formula (VIa) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or Formula (VIb) wherein: AI is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or Formula (VIc) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10. In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa): Formula (VIa) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3. In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII): Formula (VII) wherein: AIis hydrogen; a is an integer of 2 or 3, preferably 3. Other exemplary compounds of the invention comprise a ‘linker moiety’, as depicted in Formula (I*), that is part of an overall ‘linker’. Formula I* Where: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleoside moiety. As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other. The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I*) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I*) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above. As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist. The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I). Tether moiety In relation to Formula (I*), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety. In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6. In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12. In some embodiments, r is 12 and s is 6. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (II*) In some embodiments, r is 6 and s is 6. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (III*) Linker moiety In relation to Formula (I*), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein. In some embodiments, the moiety: as depicted in Formula (I*) as described anywhere herein is any of Formulae (IV*), (V*) or (VI*), preferably Formula (IV*): Formula (IV*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or Formula (V*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or Formula (VI*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10. In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa*): Formula (VIa*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3. In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII*): Formula (VII*) wherein: AIis hydrogen; a is an integer of 2 or 3. In some embodiments, a = 2. In some embodiments, a = 3. In some embodiments, b = 3. VECTOR AND CELL In one aspect, the invention provides a cell containing a nucleic acid, such as inhibitory RNA [RNAi] as described herein. In one aspect, the invention provides a cell comprising a vector as described herein. In one aspect the invention provides a vector comprising an oligonucleotide inhibitor, e.g.an iRNA e.g. siRNA. PHARMACEUTICALLY ACCEPTABLE COMPOSITIONS In one aspect, the invention provides a pharmaceutical composition for inhibiting expression of a target gene, the composition comprising an inhibitor such as an oligomer such as a nucleic acid as disclosed herein. The pharmaceutically acceptable composition may comprise an excipient and or carrier. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen- free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. Typical pharmaceutical carr...

Claims

CLAIMS 1. An inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides in a patient.

2. An inhibitor of expression and / or function of B4GALT1, for use in the prevention and / or treatment and / or management of the levels of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides and / or diabetes, in a patient having or at risk of developing a metabolic and / or vascular disease.

3. The inhibitor for use according to claim 1 or 2, for use in the prevention and / or treatment and / or management of insulin resistance, preferably wherein the inhibitor results in improvement of insulin resistance.

4. The inhibitor for use according to any of claims 1 to 3, for use in the prevention and / or treatment and / or management of elevated blood levels of glucose, preferably wherein the inhibitor results in lowering of elevated blood levels of glucose.

5. The inhibitor for use according to any of claims 1 to 4, for use in the prevention and / or treatment and / or management of elevated blood levels of insulin, preferably wherein the inhibitor results in lowering of elevated blood levels of insulin.

6. The inhibitor for use according to any of claims 1 to 5, for use in the prevention and / or treatment and / or management of elevated blood levels of HbA1c, preferably wherein the inhibitor results in lowering of elevated blood levels of HbA1c.

7. The inhibitor for use according to any of claims 1 to 6, for use in the prevention and / or treatment and / or management of elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids.

8. The inhibitor for use according to any of claims 1 to 7, for use in the prevention and / or treatment and / or management of elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen.

9. The inhibitor for use according to any of claims 1 to 8, for use in the prevention and / or treatment and / or management of elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol.

10. The inhibitor for use according to any of claims 1 to 9, for use in the prevention and / or treatment and / or management of elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol.

11. The inhibitor for use according to any of claims 1 to 10, for use in the prevention and / or treatment and / or management of elevated levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated levels of triglycerides.

12. An inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of vascular disease in a patient, wherein the vascular disease is associated with insulin resistance, and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, and / or diabetes.

13. The inhibitor for use according to claim 12, for use in the prevention and / or treatment and / or management of a vascular disease associated with insulin resistance, preferably wherein the inhibitor results in improvement of insulin resistance.

14. The inhibitor for use according to claim 12 or 13, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids.

15. The inhibitor for use according to any of claims 12 to 14, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of fibrinogen, preferably wherein the inhibitor results in lowering of elevated blood levels of fibrinogen.

16. The inhibitor for use according to any of claims 12 to 15, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of totalcholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol.

17. The inhibitor for use according to any of claims 12 to 16, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol.

18. The inhibitor for use according to any of claims 12 to 17, for use in the prevention and / or treatment and / or management of a vascular disease associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides.

19. The inhibitor for use according to any of claims 12 to 18, for use in the prevention and / or treatment and / or management of a vascular disease associated with diabetes, preferably wherein the inhibitor results in improvement of diabetes.

20. An inhibitor of expression and / or function of B4GALT1 for use in the prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient.

21. The inhibitor for use according to claim 20, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, and / or elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids.

22. The inhibitor for use according to claim 21, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance.

23. The inhibitor for use according to claim 20 or 21, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of free fatty acids, preferably wherein the inhibitor results in lowering of elevated blood levels of free fatty acids.

24. The inhibitor for use according to any of claims 20 to 23, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of totalcholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides.

25. The inhibitor for use according to any of claims 20 to 24, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides.

26. The inhibitor for use according to any of claims 20 to 25, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of total cholesterol.

27. The inhibitor for use according to any of claims 20 to 26, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of LDL cholesterol, preferably wherein the inhibitor results in lowering of elevated blood levels of LDL cholesterol.

28. The inhibitor for use according to any of claims 20 to 27, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of triglycerides, preferably wherein the inhibitor results in lowering of elevated blood levels of triglycerides.

29. The inhibitor for use according to any preceding claim, wherein the patient is a mammalian patient, preferably a human patient.

30. The inhibitor for use according to any preceding claim, wherein the inhibitor inhibits the expression of B4GALT1 in hepatocytes.

31. The inhibitor for use according to any preceding claim, wherein the inhibitor of expression and / or function of B4GALT1 is an siRNA oligomer.

32. The inhibitor for use according to claim 30 or 31, wherein the siRNA oligomer is conjugated to one or more ligand moieties.

33. The inhibitor for use according to claim 32, wherein said one or more ligand moieties comprise one or more GalNAc ligands, and / or one or more GalNAc ligand derivatives.

34. The inhibitor for use according to one or more preceding claims, which is an siRNA oligomer having a first and a second strand wherein:i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.

35. The inhibitor for use according to claim 34, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage.

36. The inhibitor for use according to claim 35, wherein the second strand comprises: i 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v 2, or more than 2, consecutive abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or vi a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards that terminus;x abasic nucleosides as the 2 terminal nucleosides connected via a 3’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3’-3’ reversed linkage; xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.

37. The inhibitor for use according claim 35 or 36, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand.

38. The inhibitor for use according to any one of claims 35 to 37, wherein the reversed internucleoside linkage is a 3’3 reversed linkage or a 5’5 reversed linkage.

39. The inhibitor for use according to any one of claims 35 to 38, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.

40. The inhibitor for use according to claim 39, wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications.

41. The inhibitor for use according to claim 39 or 40, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.

42. The inhibitor for use according to any one of claims 39 to 41, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.

43. The inhibitor for use according to any one of claims 39 to 42, wherein the first and second strand each comprise 2'-Me and 2’-F modifications.

44. The inhibitor for use according to any one of claims 39 to 43, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.

45. The inhibitor for use according to claim 44, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.

46. The inhibitor for use according to any one of claims 39 to 45, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 72’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand 47. The inhibitor for use according to any one of claims 39 to 46, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.

48. The inhibitor for use according to any one of claims 39 to 47, which is an siRNA, wherein said first strand comprises at least 52’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region.

49. The inhibitor for use according to any one of claims 39 to 48, which is an siRNA wherein said first strand comprises 7 2’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region.

50. The inhibitor for use according to any one of claims 39 to 45, which is an siRNA, wherein said modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5’-3’): (Me)8– (F)3– (Me)10.

51. The inhibitor for use according to any one of claims 39 to 45 or 50, which is an siRNA, wherein nucleosides of said first strand comprise a 2’ sugar modification pattern wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, provided that the overall number of 2’F sugar modifications in the first strand does not consist of four, or six, 2’F modifications.

52. The inhibitor for use according to any one of claims 39 to 45 or 50 to 51, which is an siRNA, wherein said modifications are selected at least from 2’Me and 2’F sugar modifications, wherein the overall number of 2’F sugar modifications in the first strand consists of three, five or seven 2’F modifications.

53. The inhibitor for use according to any one of claims 39 to 52 wherein the siRNA oligomer further comprises one or more phosphorothioate internucleoside linkages.

54. The inhibitor for use according to claim 53, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located according to at least claim 35.

55. The inhibitor for use according to claim 53 or 54, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably a terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage.

56. The inhibitor for use according to any one of claims 34 to 55, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3’ terminal region thereof.

57. The inhibitor for use according to claim 56, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA through a linker.

58. The inhibitor for use according to claim 57, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the siRNA oligomer, preferably at the 3’ terminal region thereof.

59. The inhibitor for use according to claim 57 or 58, wherein the ligand moiety comprises60. The inhibitor for use according to claim 57 or 58, having the structure:wherein: R1at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and(ii) s, t and v cannot all be 0 at the same time; Z is an oligomer 61. The inhibitor for use according to claim 57 or 58, having the structurewherein: r and s are independently an integer selected from 1 to 16; and Z is an oligomer.

62. The inhibitor for use according to one or more preceding claims, formulated as a pharmaceutical composition with an excipient and / or carrier.

63. A method for prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides in a patient, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient.

64. A method for prevention and / or treatment and / or management of insulin resistance, and / or elevated blood levels of glucose and / or elevated blood levels of insulin and / or elevated blood levels of HbA1c and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides in a patient having or at risk of developing a metabolic and / or vascular disease, the method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient.

65. The method according to claim 63 or 64, wherein said method results in the prevention and / or treatment and / or management of insulin resistance preferably wherein the inhibitor results in improvement of insulin resistance.

66. The method according to any of claims 63 to 65, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of glucose, preferably by lowering of elevated blood levels of glucose.

67. The method according to any of claims 63 to 66, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of insulin, preferably by lowering of elevated blood levels of insulin.

68. The method according to any of claims 63 to 67, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of HbA1c, preferably by lowering of elevated blood levels of HbA1c.

69. The method according to any of claims 63 to 68, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of free fatty acids, preferably by lowering of elevated blood levels of free fatty acids.

70. The method according to any of claims 63 to 69, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of fibrinogen, preferably by lowering of elevated blood levels of fibrinogen.

71. The method according to any of claims 63 to 70, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of total cholesterol, preferably by lowering of elevated blood levels of total cholesterol.

72. The method according to any of claims 63 to 71, wherein said method results in the prevention and / or treatment and / or management of elevated blood levels of LDL cholesterol, preferably by lowering of elevated blood levels of LDL cholesterol.

73. The method according to any of claims 63 to 72, wherein said method results in the prevention and / or treatment and / or management of elevated levels of triglycerides, preferably by lowering of elevated levels of triglycerides.

74. A method for prevention and / or treatment and / or management of a vascular disease in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient, wherein the vascular disease is associated with insulin resistance, and / or elevated blood levels of free fatty acids, and / or elevated blood levels of fibrinogen, and / or elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, and / or diabetes.

75. The method according to claim 74, wherein the vascular disease is associated with insulin resistance, preferably wherein the inhibitor results in improvement of insulin resistance.

76. The method according to claim 74 or 75, wherein the vascular disease is associated with elevated blood levels of free fatty acids, preferably wherein the method results in lowering of elevated blood levels of free fatty acids.

77. The method according to any of claims 74 to 76, wherein the vascular disease is associated with elevated blood levels of fibrinogen, preferably wherein the method results in lowering of elevated blood levels of fibrinogen.

78. The method according to any of claims 74 to 77, wherein the vascular disease is associated with elevated blood levels of total cholesterol, preferably wherein the method results in lowering of elevated blood levels of total cholesterol.

79. The method according to any of claims 74 to 78, wherein the vascular disease is associated with elevated blood levels of LDL cholesterol, preferably wherein the method results in lowering of elevated blood levels of LDL cholesterol.

80. The method according to any of claims 74 to 79, wherein the vascular disease is associated with elevated blood levels of triglycerides, preferably wherein the method results in lowering of elevated blood levels of triglycerides.

81. The method use according to any of claims 74 to 80, wherein the vascular disease is associated with diabetes preferably wherein the inhibitor results in improvement of diabetes.

82. A method for prevention and / or treatment and / or management of obesity, and / or body weight gain, and / or metabolic syndrome in a patient, said method comprising administering an inhibitor of expression and / or function of B4GALT1 to said patient.

83. The method according to claim 82, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, and / or elevated blood levels of free fatty acids, preferably wherein the method results in lowering of elevated blood levels of free fatty acids.

84. The method according to claim 83, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with insulin resistance, preferably wherein the inhibitor results in improvement of insulin resistance.

85. The method according to claim 83 or 84, wherein said obesity, and / or body weight gain, and / or metabolic syndrome is associated with elevated blood levels of free fatty acids, preferably wherein the method results in lowering of elevated blood levels of free fatty acids.

86. The method according to any of claims 83 to 85, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides, preferably wherein the method results in lowering of elevated blood levels of total cholesterol and / or elevated blood levels of LDL cholesterol and / or elevated blood levels of triglycerides.

87. The method according to any of claims 83 to 86, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of total cholesterol, preferably wherein the method results in lowering of elevated blood levels of total cholesterol.

88. The method according to any of claims 83 to 87, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of LDL cholesterol, preferably wherein the method results in lowering of elevated blood levels of LDL cholesterol.

89. The method according to any of claims 83 to 88, wherein said metabolic syndrome is further, or independently, associated with elevated blood levels of triglycerides, preferably wherein the method results in lowering of elevated blood levels of triglycerides.

90. The method according to any of claim 63 to 89, wherein the inhibitor inhibits the expression of B4GALT1 in hepatocytes.

91. The method according to any preceding claim, wherein the inhibitor of expression and / or function of B4GALT1 is an siRNA, in particular an siRNA as defined in any one of claims 31 to 61.

92. The method according to any of claim 63 to 91, wherein the patient is a human patient.

93. A nucleic acid or pharmaceutical composition, for use in the prevention or treatment of vascular disease, such as cardiovascular disease.

Images