Expression cassette containing overlapping open reading frames, and use

Abstract

Disclosed in the present invention are an expression cassette containing overlapping open reading frames (ORFs), and a use. The overlapping ORFs are overlapping ORFs comprising a first ORF and a second ORF, and the expression cassette sequentially comprises from a 5' end to a 3' end: at least a first promoter used for driving transcription of a gene of the first ORF; a 5' part of the gene of the first ORF; an intron; and a 3'part of a gene of the second ORF, the intron comprising a second promoter only used for driving transcription of the gene of the second ORF. According to the present invention, two promoters are provided in a single expression cassette and are respectively used for driving expression of proteins of overlapping reading frames and adjusting the relative expression time and expression intensity of different proteins, thereby improving the production efficiency of rAAV vectors in insect cells, and also improving the quality of produced rAAV.

Description

An expression cassette containing overlapping open reading frames and its application

Technical field

[0001] The present invention belongs to the field of genetic engineering, and more particularly, relates to an expression cassette of a gene containing overlapping open reading frames and its application. [Background Technology]

[0002] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependinovirus in the family Parvoviridae. It is the simplest single-stranded DNA defective virus discovered to date and requires a helper virus (usually an adenovirus) to participate in replication. The AAV genome is a single-stranded linear DNA of approximately 4700 bp, including two upstream and downstream open reading frames (ORFs): Rep and Cap, located between two T-shaped inverted terminal repeats (ITRs) consisting of 145 nucleotides each, as shown in Figure 1. The ITRs serve as the origin of viral replication and packaging signal. The Rep gene participates in viral replication and integration, encoding viral replication proteins, while the Cap gene is responsible for encoding the three viral capsid proteins. Recombinant adeno-associated virus (rAAV) is one of the most promising vectors in the field of gene therapy due to its wide host range, low immunogenicity, high safety, and ability to mediate long-term and stable expression of exogenous genes in animals. With the approval of the first recombinant adeno-associated virus (rAAV)-mediated gene therapy drug, the demand for large-scale AAV vector manufacturing technology has continued to increase (Yla-Herttuala S., 2012, Mol Ther, 20:1831-1832).

[0003] At present, there are two main types of systems for producing rAAV: one is the conventional production system using mammalian cells (such as 293 cells, COS cells, HeLa cells, KB cells, etc.); the other is the production system using insect cells. Among them, the production system using insect cells uses baculovirus expression vectors (BEVs) carrying rAAV vector genome, Rep protein and Cap protein to infect Sf9 insect cells to produce rAAV virus. With the characteristics of Sf9 cells that can express recombinant proteins in large quantities, this system uses insect baculovirus containing rAAV genome and AAV-Rep and AAV-Cap genes to transduce Sf9 cells, so that rAAV is assembled in Sf9 cells, and ultimately achieves the purpose of large-scale production of rAAV.

[0004] In this production system, promoters play a crucial role. The selected exogenous gene is placed under the control of a native promoter, then expressed during the infection cycle and released during cell lysis. The promoter is recognized by RNA polymerase and initiates transcription. During RNA synthesis, the promoter interacts with transcription factors, which determine the onset of transcription, controlling the timing and extent of gene expression (transcription). The promoter, consisting of a core promoter region and regulatory regions, acts like a "switch," determining gene activity and, in turn, controlling which protein the cell begins producing. The promoter itself does not have a translational function, but it directs the amino acid sequence of the gene, acting like a flag. Its core component is the RNA polymerase binding site upstream of the noncoding region. Currently, the most commonly used promoters in BEVS are the polyhedrin pol H promoter and the p10 promoter, in addition to basic promoters and a few early promoters. The expression levels of the same exogenous gene can vary significantly under the control of different promoters.

[0005] To achieve maximum expression levels, most utilize very late promoters to drive expression of exogenous genes. While this approach is often successful when large amounts of recombinant protein are required, in some cases, using alternative promoters that express earlier or weaker promoters may benefit the quality and yield of the final protein. Proteins that aggregate during rapid expression and those that require advanced post-translational modifications have also been shown to benefit from sustained, stable expression using early promoters.

[0006] Immediate early and early promoters are activated prior to viral DNA replication. The immediate early promoter (IE) is transcribed by host cell RNA polymerase II and also utilizes host transcription factors. The structural organization of the immediate early and early promoters differs significantly from that of late and very late baculovirus promoters, more similar to the structure of other eukaryotic promoters. The most notable feature of baculovirus immediate early promoters is the conserved CAGT motif, which serves as a transcription start site and plays a key role in regulating downstream gene expression. In some cases, the immediate early promoter contains a TATA-like motif and / or an initiation sequence. This region is recognized by host RNA polymerase II and allows transcription of immediate early viral genes immediately after infection. The IE1 promoter, an immediate early promoter, is the most commonly used constitutive promoter for baculovirus expression because it is active at all time stages and in uninfected insect cells. The 39k promoter is an early promoter that is transactivated by the IE1 protein. The 39k promoter can also be transiently activated when co-expressed with the IE1 protein.

[0007] The late promoter is transcribed by the viral RNA polymerase, which recognizes the conserved (A / G / T)TAAG late / very late promoter motif. Transcription initiates at the second nucleotide within this motif, and its presence is essential for promoter activity. Studies investigating the function of the TAAG motif in the late promoter have shown that mutations in this sequence abolish promoter transcriptional activity. Very late promoter transcriptional activity peaks 18-24 hours after infection and exceeds late promoter activity. At 24 hours after infection, the very late promoter's transcription level in cells exceeds that of all other promoters.

[0008] The p10 protein is expressed at high levels very late in the infection cycle and is thought to play a role in inclusion body maturation and cell lysis required for viral release. Weyer and Possee first defined the 101 nucleotides upstream of the ATG of the p10 gene as the p10 promoter sequence and proposed its use for the expression of foreign proteins. Since then, the p10 promoter has been widely used in BEVS to produce proteins, such as cauliflower mosaic virus gene 1 and human interleukin-2. p10 can also be linked to other promoters for co-expression.

[0009] In an AAV insect cell production system, Urabe et al. replaced the VP1 start codon AUG with the suboptimal start codon ACG for the Cap protein, creating a single polycistronic mRNA that can express all three AAV2 VP proteins without requiring splicing (Urabe et al., 2002, Hum Gene Ther, 13:1935-1943). However, with the increasing number of AAV serotypes, the modification method used by Urabe et al. is not applicable to all serotypes. For example, AAV5 particles produced in the baculovirus system using ACG as the start codon for the VP1 capsid protein exhibited poor infectivity. The method provided in Chinese patent CN106544325A uses a different suboptimal start codon, CTG, to enhance VP1 expression. Although this design improves the infectivity of AAV5 particles, it lacks flexibility in adjusting the relative content of VP1, VP2, and VP3. Furthermore, this method appears to lack the flexibility necessary for serotype-specific sequence adjustments. In the method provided by Chinese patent CN101522903A, an artificial intron containing the polH promoter sequence is inserted into the open reading frame of VP1, and two promoters are used to express VP1 and VP2 / VP3 respectively. Although this design can also achieve the expression of VP1 / VP2 / VP3 in the same reading frame, this method cannot effectively regulate the relative amounts of VP1 / VP2 / VP3, and the relative expression amounts of VP1 / VP2 / VP3 vary greatly in different serotypes, resulting in low production efficiency.

[0010] To express Rep proteins, Urabe et al. constructed two independent expression cassettes containing Rep78 and Rep52 and inserted them into the same baculovirus vector. Rep52 used the polH promoter, while Rep78 used the deltaIE1 promoter, which has weaker initiation activity than the polH promoter (Urabe et al., 2002, Hum Gene Ther, 13:1935-1943). However, the immediate-early promoter deltaIE1 is active early in baculovirus infection, and early, high-level expression of Rep78 in insect cells may negatively impact recombinant baculovirus yield (Urabe et al., 2006, Journal of Virology 80.4:1874-1885). Furthermore, studies have found that the AAV Rep protein expression method developed by Urabe et al. suffers from unstable baculovirus vector passages (Kohlbrenner et al., 2005, Mol. Ther. 12:1217-25). In order to solve the problem of the inherent instability of passage of two independent Rep expression cassettes, Chinese patent CN 103849629 A discloses a method for producing AAV in insect cells, in which the translation start codon of the AAV Rep78 protein is replaced with ACG, which is partially skipped by the scanning ribosome so that translation initiation can also occur at the start codon of the Rep52 protein further downstream. Although this method can achieve the expression of Rep78 and Rep52 proteins in the same reading frame, significantly improving the stability of rAAV vector production in insect cells, it lacks flexibility in regulating the relative content of Rep52 / Rep78 proteins. The high stoichiometric ratio of Rep52 / Rep78 proteins may be a key factor in the high yield of rAAV (Xiao, Xiao et al., 1998, Journal of Virology 72.3 (1998): 2224-2232.). In a method for producing AAV in insect cells disclosed in Chinese patent CN 113897396 A, the inventors achieved the expression of Rep78 and Rep52 proteins in the same reading frame by constructing a Rep expression cassette containing an intron regulatory sequence. This not only improved the stability of rAAV vector production in insect cells, but also flexibly adjusted the relative content of Rep52 / Rep78 proteins by adjusting the intron splicing efficiency. However, there is a lack of flexibility in controlling the relative expression time and relative expression intensity of the two.

[0011] Therefore, the large-scale production of rAAV vectors using baculovirus in insect cells still needs to be further improved. Many studies have shown that earlier promoters may be more efficient in producing some exogenous proteins, especially those that require a lot of post-translational processing and / or secretion, because when the latest promoter is most active, the host cell's processing of exogenous proteins may be impaired. For complex viral particles, the required amount of different proteins may be different. By using different baculovirus promoters that are active at different stages of infection, control of the expression time and expression amount of the target protein can be achieved (Bruder et al., Viruses 2022, 14, 2670). However, the mechanism of synergistic effect between different promoters is not clear.

[0012] [Summary of the invention]

[0013] In response to the above-mentioned defects or improvement needs of the prior art, the present invention provides an expression cassette and application of genes containing overlapping open reading frames. The purpose is to better control the relative expression time and relative intensity of different proteins represented by Rep78 and Rep52 proteins by constructing an expression cassette containing different proteins located in the same overlapping open reading frame and controlling the expression of different proteins with different promoters. The use of overlapping open reading frames to express proteins not only ensures the stability of rAAV vector production in insect cells, but also improves the yield and quality of the produced rAAV.

[0014] To achieve the above object, according to one aspect of the present invention, there is provided an expression cassette for expressing a gene comprising overlapping open reading frames, comprising:

[0015] Operably linked from the 5' end to the 3' end:

[0016] artificially constructed sequences;

[0017] overlapping open reading frames lacking the first translation start codon;

[0018] The artificially constructed sequence comprises a first promoter and a second promoter that are independent of each other; and the complete sequence of the first translation initiation codon is not contained between the first promoter and the second promoter.

[0019] Preferably, the gene is a parvovirus Rep gene, and the first promoter is used to drive the expression of Rep78 / 68 protein and Rep52 / 40 protein; the second promoter is used to additionally drive the expression of Rep52 / 40 protein.

[0020] Preferably, the gene is the parvovirus Cap gene, and the first promoter is used to drive the expression of VP1 protein and VP2 / 3 protein; the second promoter is used to additionally drive the expression of VP2 / 3 protein.

[0021] Preferably, the artificially constructed sequence further comprises an intron, and the intron is used to form the first translation initiation codon in the artificially constructed sequence through selective splicing during post-transcriptional processing.

[0022] As further preferred, the intron is located between any two nucleotides of ATG.

[0023] As further preferred, the first promoter is located before the 5' end of the intron.

[0024] As further preferably, the second promoter is within the intron.

[0025] Preferably, the second promoter precedes the 5' end of the first promoter.

[0026] Preferably, the first promoter is active before the second promoter.

[0027] As further preferred, the first promoter is deltaIE1, IE1, 39K or p6.9, and the second promoter is polH or p10.

[0028] Preferably, the first promoter is p10 and the second promoter is polH.

[0029] According to one aspect of the present invention, an optimized expression cassette of a gene containing overlapping open reading frames is provided, wherein the overlapping open reading frames are overlapping open reading frames of a first ORF and a second ORF, and comprise, from the 5' end to the 3' end:

[0030] a first promoter for driving gene transcription of a first ORF;

[0031] the 5' portion of the gene of the first ORF;

[0032] introns;

[0033] the 3' portion of the gene of the second ORF;

[0034] The intron comprises a second promoter for driving gene transcription of the second ORF, the first promoter is an immediate early promoter, an early promoter or a late promoter, and the second promoter is a very late promoter.

[0035] Preferably, the intron is located between any two nucleotides of the translation start codon ATG of the first ORF; the intron is used to form the first translation start codon in the artificially constructed sequence through selective splicing during post-transcriptional processing.

[0036] Preferably, the intron is located between the translation start codon ATG of the first ORF and the exon of the first ORF.

[0037] Preferably, the first promoter is deltaIE1, IE1, 39K or p6.9, and the second promoter is polH or p10.

[0038] Preferably, the expression cassette is used to encode the parvovirus Rep gene, the first ORF is used to encode the Rep68 / Rep78 protein, and the second ORF is used to encode the Rep40 / Rep52 protein.

[0039] Preferably, the expression cassette is used to encode the parvovirus Cap gene, the first ORF is used to encode the VP1 protein, and the second ORF is used to encode the VP2 / VP3 protein.

[0040] According to another aspect of the present invention, a nucleic acid molecule comprising a first expression cassette is further provided. The first expression cassette is any one of the above expression cassettes.

[0041] Preferably, it further comprises a second expression cassette, wherein the first expression cassette and the second expression cassette are used to encode the parvovirus Cap gene and the parvovirus Rep gene, respectively.

[0042] Preferably, the nucleic acid molecule further comprises an exogenous gene.

[0043] As a further preference, there are AAV inverted terminal repeat sequences at both ends of the exogenous gene.

[0044] As further preferred, the exogenous gene is a reporter gene, and the reporter gene is at least one of a chloramphenicol acetyltransferase encoding gene, a β-galactosidase encoding gene, a β-glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene and a red fluorescent protein encoding gene.

[0045] As further preferred, the exogenous gene is a gene encoding a drug polypeptide, and the drug polypeptide is at least one of lipoprotein lipase, apolipoprotein, cytokine, interleukin and interferon.

[0046] According to another aspect of the present invention, a recombinant baculovirus vector comprising the above expression cassette is also provided.

[0047] Preferably, the recombinant baculovirus vector is an insect cell-compatible vector.

[0048] According to another aspect of the present invention, an insect cell comprising the above-mentioned recombinant baculovirus vector is also provided.

[0049] Preferably, the insect cells are Spodoptera frugiperda cells, Trichoplusia ni cells, Drosophila cells or mosquito cells.

[0050] In general, the above technical solution conceived by the present invention is compared with the prior art because two promoters are provided in a single expression cassette to drive the expression of proteins with overlapping reading frames and to regulate the relative expression time and expression intensity of different proteins. The present invention can better control the relative expression time and relative expression intensity of Rep78 / 68 protein and Rep52 / 40 protein in the Rep gene, as well as the relative expression time and relative expression intensity of VP1 protein and VP2 / 3 protein in the Cap gene. This not only improves the efficiency of rAAV vector production in insect cells, but also improves the quality of the produced AAV.

Brief Description of the Drawings

[0051] Figure 1 is a schematic diagram of the expression regulation of the Cap gene and Rep gene in wild-type AAV;

[0052] Figure 2 is a schematic diagram of the expression regulation of the RepA-D gene expression cassette I in Examples 1-4;

[0053] Figure 3 is a schematic diagram of the expression regulation of the Cap gene expression cassette in Example 1;

[0054] FIG4 is a schematic diagram of expression regulation of the RepI-IV gene expression cassette II in Example 5-8;

[0055] Figure 5 is a schematic diagram of expression regulation of the Rep1-4 gene expression cassette III in the comparative example;

[0056] FIG6 is a Western Blot analysis of the expression of Rep protein by the recombinant baculovirus vector AcRepA-D in Example 1-4;

[0057] FIG7 is a Western Blot analysis of the expression of Rep protein by the recombinant baculovirus vector AcRepI-IV in Example 5-8;

[0058] FIG8 is a Western Blot analysis of the expression of Rep protein by the recombinant baculovirus vector AcRep1-4 in Comparative Examples 1-4;

[0059] Figure 9 is the growth kinetics curve of sf9 cells infected with constructs CRI-0, CRI-1 and CRI-2 in Verification Example 1;

[0060] Figure 10 is a schematic diagram of expression regulation of the RepE gene expression cassette in Example 9;

[0061] Figure 11 is a schematic diagram of the structure of the RepF-H gene expression cassette in Examples 10-12;

[0062] FIG12 is a Western Blot analysis of the expression of Rep protein by the recombinant baculovirus vector AcRepE-H in Example 9-12;

[0063] FIG13 is a Western Blot detection diagram of the recombinant baculovirus vector AcRep5 expressing Rep protein in Comparative Example 5. [Specific implementation method]

[0064] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0065] For ease of understanding, the terms used in this detailed description are defined as follows:

[0066] The term "polynucleotide" refers to a biological macromolecule composed of a single nucleotide. The polynucleotide molecules referred to herein can be either deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). As is known to those skilled in the art, RNA sequences are substantially similar to or share a certain degree of sequence identity with DNA sequences, and thymine (T) in a DNA sequence can be considered equivalent to uracil (U) in an RNA sequence.

[0067] The term "operably linked" refers to the connection of polynucleotide (or polypeptide) sequences in a functional relationship. Two nucleotide sequences are "operably linked" when they are placed in a functional relationship. For example, a transcriptional regulatory sequence (e.g., a promoter) is operably linked to a gene coding sequence if it affects the transcription of that gene coding sequence.

[0068] The term "expression cassette" refers to a nucleic acid construct comprising a coding sequence and regulatory sequences that, when introduced into a host cell, are operably linked to result in the transcription and / or translation of an RNA or polypeptide, respectively. An expression cassette is understood to include a promoter that allows transcription to begin, an open reading frame for the gene of interest, and a transcription terminator. Typically, the promoter sequence is placed upstream of the gene of interest at a distance compatible with expression control. An "expression cassette" may be a multi-segment or single-segment nucleic acid construct.

[0069] The term "Open Reading Frame" (ORF) refers to the normal nucleotide sequence of a structural gene, potentially encoding a protein or polypeptide. It begins with the start codon and ends with the stop codon, with no stop codons in between to interrupt translation. On an mRNA chain, ribosomes begin translation at the start codon and continue to synthesize and extend the polypeptide chain along the mRNA sequence. When a stop codon is encountered, the polypeptide chain extension reaction ends.

[0070] The term "vector" refers to a nucleic acid molecule designed to transport, transfer, and / or store genetic material, as well as to express and / or integrate genetic material into the chromosomal DNA of a host cell. Examples include plasmid vectors, cosmid vectors, artificial chromosomes, phage vectors, and other viral vectors. Vectors typically consist of at least three basic elements: an origin of replication, a selectable marker, and a multiple cloning site.

[0071] The term "intron," also known as intervening sequence, refers to non-coding segments within a gene or mRNA molecule. These sequences are intervening sequences in the DNA of eukaryotic cells. Intron sequences are transcribed in the pre-mRNA and removed through splicing, ultimately disappearing from the mature mRNA molecule. Introns are classified as self-splicing introns and spliceosomal introns, depending on whether the splicing process is spontaneous or requires processing by the spliceosome. Self-splicing introns are a special type of intron that are ribozymes that can be excised from the mRNA by their own action. The introns addressed by the present invention are spliceosomal introns, whose excision requires the assistance of the spliceosome. The intron sequence is flanked by a splice donor sequence and a splice acceptor sequence, which are the sequences flanking the cleavage and rejoining sites. The spliceosome is a ribonucleoprotein complex dynamically composed of small nuclear RNA (snRNA) and protein factors. The spliceosome recognizes the splice sites of the pre-mRNA and catalyzes the splicing reaction, completely excising the intron and rejoining the upstream and downstream RNA sequences.

[0072] The introns mentioned in the present invention may be natural introns or artificially modified introns that have splicing activity in insect cells; however, their sources are not limited to insect cells.

[0073] The term "AAV serotype": Since the discovery of adeno-associated virus (AAV), over 100 AAV serotypes or variants have been isolated from adenovirus, humans, primates, and some mammals. AAV1-9 is the most widely used. The different serotypes of rAAV vectors differ primarily in their capsid proteins. Different AAV serotypes also exhibit varying infection efficiencies and tissue specificity.

[0074] The genome structures of all known adeno-associated virus serotypes are very similar. AAV is a single-stranded DNA virus with a simple genome structure and a total length of approximately 4.7kb, as shown in Figure 1. Its genome contains the rep gene expression cassette, the cap gene expression cassette, and the AAV inverted terminal repeats (ITRs) located at both ends of the genome. The ITR is a 125-nucleotide palindromic structure at both ends of the genome that can form a self-complementary inverted T-shaped hairpin structure. It is a cis-acting element required for the initiation of DNA replication and the packaging of the recombinant AAV genome into infectious viral particles. The viral coding region is located between the ITR sequences, where the rep gene expression cassette and the cap gene expression cassette are located.

[0075] As a defective virus, AAV cannot replicate independently without a helper virus. Therefore, AAV can only integrate into the host cell chromosomes at a specific site, assuming a latent state. In the presence of a helper virus, increased expression of the rep gene can rescue the AAV genome integrated into the host cell chromosomes, leading to massive replication of AAV DNA. The single-stranded rAAV genome is then packaged into infectious viral particles under the action of the VP capsid protein.

[0076] The term "Cap gene" refers to a gene composed of overlapping amino acid sequences that encodes the structural VP capsid protein. It contains three overlapping open reading frames, encoding the three subunits VP1, VP2, and VP3. VP1, VP2, and VP3 have different start codons and share a stop codon. VP1 and VP2 share the VP3 sequence. The N-terminus of VP1 contains a conserved phospholipase A2 sequence, which is involved in viral escape from the body and is crucial for its infectivity. The VP2 protein is not essential for assembly or infection. The core of the VP3 protein is composed of a conserved β-barrel motif, which determines the differences in the host cell receptors of different AAV serotypes. The correct ratio of these three proteins in wild-type AAV is 6:6:54, which is approximately 1:1:10.

[0077] The term "Rep gene" encodes four overlapping multifunctional proteins: Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep68 proteins participate in AAV replication and integration, binding to specific sequences within the ITR. Rep52 and Rep40 proteins possess helicase and ATPase activities, participating in both single-stranded genome replication and viral assembly. Unspliced ​​mRNA encoding Rep78 and Rep52 proteins is sufficient for the production of rAAV in both mammalian and insect cells.

[0078] The term "relative expression level" refers to the relative ratio of the expression levels of different proteins. For example, an increase in the relative expression level of Rep78 / Rep52 proteins may mean an increase in the expression level of Rep78 protein, or a decrease in the expression level of Rep52 protein.

[0079] The term "promoter" refers to a DNA sequence located upstream of the 5' end of a structural gene that activates RNA polymerase, enabling it to bind accurately to the template DNA and have the specificity to initiate transcription.

[0080] The term "solid rate": Taking AAV vectors as an example, solid AAV refers to AAV vectors that carry the target gene. Empty AAV vectors, on the other hand, are AAV vectors that do not carry the target gene and are composed of an AAV protein shell of a specific serotype. They are usually caused by incomplete viral packaging during the production process. This rate must be minimized during the purification of gene therapy products because these viral capsids do not contain DNA. When they are infused into patients, on the one hand, they will compete for the limited number of receptors on the cell surface; on the other hand, they have no benefit for gene therapy and may cause side effects; furthermore, an increase in the content of empty AAV will lead to an increase in the dosage. The higher the dosage, the higher the risk of serious side effects. This is also true for AAV containing incomplete copies of therapeutic genes.

[0081] The solidity rate refers to the proportion of solid AAV in the prepared AAV vector. A higher solidity rate indicates a greater proportion of solid AAV, indicating higher quality of the prepared AAV vector.

[0082] The present invention provides an expression cassette for expressing a gene containing overlapping open reading frames in a cell, particularly an insect cell, comprising:

[0083] Operably linked from the 5' end to the 3' end:

[0084] artificially constructed sequences;

[0085] overlapping open reading frames lacking the first translation start codon;

[0086] The artificially constructed sequence comprises a first promoter and a second promoter that are independent of each other; and the complete sequence of the first translation initiation codon is not contained between the first promoter and the second promoter.

[0087] In some embodiments, the artificially constructed sequence further includes an intron, which is located between the translation start codon ATG, for example, between AT and G, or between A and TG; the intron is used to form the first translation start codon in the artificially constructed sequence through selective splicing during post-transcriptional processing, so that the overlapping open reading frame can be successfully expressed.

[0088] In some embodiments, the second promoter precedes the first promoter (ie, before the 5' end of the first promoter), and the first promoter precedes the intron; in other embodiments, the first promoter precedes the intron, and the second promoter is contained within the intron.

[0089] In some embodiments, the first promoter is used to express all proteins encoded by the overlapping open reading frames, and the second promoter is used to adjust the relative expression time and relative expression content / expression intensity of these proteins. In other embodiments, the gene encoded by the expression cassette is a parvovirus Rep gene; the two promoters of the present invention can be used to adjust the relative expression time and relative expression content / expression intensity of different Rep proteins. In addition, since the functions of Rep40 protein and Rep52 protein are similar, and the functions of Rep68 protein and Rep78 protein are similar, the first promoter can be used to drive the expression of Rep68 and / or Rep78 protein, and can also be used to drive the expression of Rep40 protein and / or Rep52 protein; and the second promoter is used to additionally drive the expression of Rep40 protein and / or Rep52 protein.

[0090] In other embodiments, the gene encoded by the expression cassette is a parvovirus Cap gene; the two promoters of the present invention can be used to adjust the relative expression timing and relative expression levels / intensities of different Cap proteins. Furthermore, the first promoter drives expression of both the VP1 protein and the VP2 / 3 proteins, while the second promoter additionally drives expression of the VP2 / 3 proteins.

[0091] In some embodiments, the first promoter is active before the second promoter; for example, the first promoter may be an early or late promoter such as deltaIE1, IE1, 39K or p6.9, and the second promoter may be a very late promoter such as p10 or polH.

[0092] In other embodiments, the first promoter and the second promoter can be active almost simultaneously, for example, the first promoter is p10 and the second promoter is polH.

[0093] Since variations in some non-critical sites of the promoter have no effect on its function, the sequences of the first promoter and the second promoter may also differ from the original sequences of the above promoters at some sites.

[0094] The present invention also provides an expression cassette for a gene containing overlapping open reading frames optimized in a cell, especially an insect cell, wherein the overlapping open reading frames are overlapping open reading frames of a first ORF and a second ORF, and comprise, from the 5' end to the 3' end:

[0095] a first promoter for driving gene transcription of a first ORF;

[0096] the 5' portion of the gene of the first ORF;

[0097] introns;

[0098] the 3' portion of the gene of the second ORF;

[0099] The intron comprises a second promoter for driving gene transcription of the second ORF, the first promoter is an immediate early promoter, an early promoter or a late promoter, and the second promoter is a very late promoter; for example, in some embodiments, the first promoter is deltaIE1, IE1, 39K or p6.9, and the second promoter is polH or p10.

[0100] In some embodiments, the intron is located between any two nucleotides of the translation start codon ATG of the first ORF; the intron is used to form the first translation start codon in the artificially constructed sequence through selective splicing during post-transcriptional processing.

[0101] In other embodiments, the intron is located between the translation start codon ATG of the first ORF and the exon of the first ORF.

[0102] In some embodiments, the gene encoded by the expression cassette is a parvovirus Rep gene, the first ORF is used to encode the Rep78 protein, and the second ORF is used to encode the Rep52 protein. The two promoters of the present invention can be used to adjust the relative expression time and relative expression level / expression intensity of different Rep proteins. In addition, since the functions of the Rep40 protein and the Rep52 protein are similar, and the functions of the Rep68 protein and the Rep78 protein are similar, the first promoter can be used to drive the expression of the Rep68 and / or Rep78 proteins, while the second promoter is used to drive the expression of the Rep40 protein and / or the Rep52 protein.

[0103] In some embodiments, the second promoter contains a translation start codon and a stop codon sequence that can be recognized by the ribosome, so that when the introns are not spliced ​​during the post-transcriptional processing of the Rep gene expression cassette driven by the first promoter, the Rep40 protein and / or Rep52 protein will not be translated. In other embodiments, the gene encoded by the expression cassette is a parvovirus Cap gene; the two promoters of the present invention can be used to adjust the relative expression time and relative expression content / expression intensity of different Cap proteins. In addition, the first promoter is used to drive the expression of VP1 protein, while the second promoter is used to additionally drive the expression of VP2 and / or VP3 protein.

[0104] Since variations in some non-critical sites of the promoter have no effect on its function, the sequences of the first promoter and the second promoter may also differ from the original sequences of the above promoters at some sites.

[0105] The Rep gene expression cassette and the Cap gene expression cassette, as well as the sequence of the exogenous gene containing AAV inverted terminal repeats at both ends, can be integrated into different baculovirus vectors, or they can be integrated into the same recombinant baculovirus vector. In some embodiments, the Rep gene expression cassette and the Cap gene expression cassette can both use the above expression cassettes, or one of them can use the above expression cassette.

[0106] In some embodiments, the exogenous gene is a reporter gene; for example, a chloramphenicol acetyltransferase encoding gene, a β-galactosidase encoding gene, a β-glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene, and a red fluorescent protein encoding gene, etc.

[0107] In other embodiments, the exogenous gene is a gene encoding a drug polypeptide; the drug polypeptide is lipoprotein lipase, apolipoprotein, cytokine, interleukin, interferon, etc.

[0108] In some embodiments, the insect cells are Spodoptera frugiperda cells, Trichoplusia ni cells, Drosophila cells, or mosquito cells.

[0109] Example 1

[0110] Step 1: Construction of Rep gene expression cassette I and recombinant baculovirus vector containing Rep gene expression cassette I

[0111] See Figure 2, wherein Content A is a schematic diagram of the DNA chain of the Rep gene expression cassette 1; Content B is a schematic diagram of the translation and expression of the Rep52 protein when the intron is not spliced ​​during the post-transcriptional processing driven by the first promoter; Content C is a schematic diagram of the translation and expression of the Rep78 protein after the intron is spliced ​​during the post-transcriptional processing driven by the first promoter; Content D is a schematic diagram of the translation and expression of the Rep78 protein after the second promoter is driven by transcription. The gene expression cassette includes, from the 5' to the 3' end, a first promoter sequence, an adenine nucleotide (A), a donor sequence at the 5' end of the intron, a second promoter sequence, an acceptor sequence at the 3' end of the intron, a thymine nucleotide and a guanine nucleotide (TG), and a nucleotide sequence encoding the AAV serotype 2 Rep protein that only lacks the Rep78 protein translation start codon ATG. The overlapping open reading frame nucleotide sequence used to encode the Rep protein is shown in SEQ ID No. 1, which is used to encode the Rep78 protein in its entirety, while the portion used to encode the Rep52 protein is shown in SEQ ID No. 2. Multiple nucleotide mutations were incorporated between the Rep78 and Rep52 translation start codons to eliminate potential translation start sites within this region. In this example, deltaIE1 was used as the first promoter sequence, and polH was used as the second promoter sequence. These sequences were then linked together via direct synthesis or overlap extension PCR amplification to produce the construct RepA, whose nucleotide sequence is shown in SEQ ID No. 3.

[0112] The construct was cloned into the pFastBac vector to prepare a transfer plasmid; the transfer plasmid was transformed into the DH10Bac strain, and a recombinant baculovirus vector AcRepA containing RepA was obtained through a gene transposition reaction mediated by Tn7 transposase.

[0113] Step 2: Construct Cap gene expression cassette

[0114] Construct a Cap8 expression cassette comprising the AAV serotype 8 Cap gene: The Cap gene expression cassette was constructed with reference to the method described in Example 3 of Chinese Patent (CN202111105263.5). Referring to Figure 3, the Cap8 expression cassette includes, from 5' to 3', a p10 promoter, an artificially constructed sequence, and a nucleotide sequence encoding the AAV serotype 8 VP protein that lacks only the VP1 protein translation start codon ATG. Wherein, the artificially constructed sequence contains the translation start codon ATG and contains two intron variable splicing sites; there is a mutation of at least one nucleotide at the amino terminus encoding the AAV serotype 8 VP protein to eliminate possible splicing sites within the coding sequence. The above sequences were connected by artificial direct synthesis or overlap extension PCR amplification to obtain the construct Cap8 expression cassette, the nucleotide sequence of which is shown in SEQ ID No.4.

[0115] Step 3: Construction of recombinant AAV bacmid

[0116] The method for constructing a recombinant AAV bacmid for producing AAV virus in insect cells in this example refers to Example 1 of the previously applied patent CN112553257A, and includes the following steps:

[0117] (1) A homologous recombination vector containing the essential functional elements Cap and Rep gene expression cassettes of AAV was constructed; then, the essential functional elements in the homologous recombination vector were inserted into the C-terminus of the essential gene Ac135 (116492...117391) in the baculovirus genome by Red homologous recombination in Escherichia coli to obtain a recombinant baculovirus vector containing the Cap and Rep gene expression cassettes, which was numbered Bac-Cap-Rep.

[0118] (2) Constructing a homologous recombination vector containing an ITR core element (ITR-GOI). The ITR core element is numbered IG-1, and its nucleotide sequence is shown in SEQ ID No. 5. In this embodiment, the GOI in the ITR core element uses a red fluorescent protein mcherry gene expression cassette, that is, the expression of mcherry is controlled by the miniEf1a promoter, which facilitates the detection of rAAV activity.

[0119] (3) The shuttle vector constructed in step (2) above is used to transform competent cells containing the Bac-Cap-Rep recombinant bacmid, and then the essential functional elements in the homologous recombination vector are inserted into the C-terminus of the essential gene Ac98 (88502...88464) in the baculovirus genome by Red homologous recombination in Escherichia coli, ultimately obtaining a recombinant bacmid containing the functional protein components and ITR core elements required for rAAV production and a recombinant baculovirus genome, which is numbered Bac-Cap-Rep-ITR-GOI.

[0120] Step 4: Preparation of AAV recombinant baculovirus

[0121] The recombinant AAV bacmid prepared in step 3 is transfected into the host cell line to obtain the AAV recombinant baculovirus. The specific steps are as follows:

[0122] The recombinant bacmid DNA was extracted and transfected into Sf9 insect cells to produce recombinant baculovirus (BEV) and rAAV. The transfected Sf9 insect cells successfully produced BEV. Further infection of the massively replicated and proliferated BEV resulted in significant cytopathic effect (CPE) in the Sf9 cells. The culture supernatant of Sf9 cells experiencing CPE, which contained a large amount of BEV, was collected, and the supernatant, which contained a large amount of rAAV, was also collected. The prepared BEV-P0 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI = 1). After 72 hours of infection, cell viability dropped below 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the culture supernatant and cell pellet were collected separately. The supernatant was labeled as first-generation BEV-P1, and the cells were labeled as rAAV packaged with BEV-P0.

[0123] Examples 2-4

[0124] In Examples 2-4, the deltaIE1 promoter sequence in Example 1 was replaced with 39K, p6.9, and p10, respectively. Other steps were the same as in Example 1 to obtain constructs RepB, ​​RepC, and RepD, recombinant baculovirus vectors AcRepB, ​​AcRepC, and AcRepD, and subsequently recombinant AAV bacmids and AAV recombinant baculoviruses. The nucleotide sequences of RepB-RepD are shown in SEQ ID Nos. 6-8.

[0125] Example 5

[0126] Step 1: Construction of Rep gene expression cassette II and recombinant baculovirus vector containing Rep gene expression cassette II

[0127] See Figure 4, wherein content A is a schematic diagram of the Rep gene expression cassette II DNA chain; content B is a schematic diagram of the translation and expression of Rep52 protein when the intron is not spliced ​​during the post-transcriptional processing driven by the first promoter; content C is a schematic diagram of the translation and expression of Rep78 protein after the intron is spliced ​​during the post-transcriptional processing driven by the first promoter; content D is a schematic diagram of the translation and expression of Rep52 protein after splicing of the first intron splice donor and the splice acceptor during the post-transcriptional processing driven by the second promoter; a TAA translation termination sequence is inserted between the first promoter and the second promoter, and when the intron is not spliced ​​or the second intron splice donor and the splice acceptor are spliced ​​during the post-transcriptional processing driven by the second promoter, protein translation will terminate prematurely and no Rep78 protein will be produced. The gene expression cassette includes, from 5' to 3' end, a second promoter sequence, a first intron 5' end donor sequence, a first promoter sequence, an adenine nucleotide (A), a second intron 5' end donor sequence, an intron 3' end acceptor sequence, a thymine nucleotide and a guanine nucleotide (TG), and a nucleotide sequence encoding AAV serotype 2 Rep protein that only lacks the Rep78 protein translation start codon ATG. In this embodiment, deltaIE1 is used as the first promoter sequence and polH is used as the second promoter sequence. The above sequences are connected by artificial direct synthesis or overlap extension PCR amplification to obtain the construct RepI, whose nucleotide sequence is shown in SEQ ID No.9.

[0128] The construct was cloned into the pFastBac vector to prepare a transfer plasmid; the transfer plasmid was transformed into the DH10Bac strain, and a recombinant baculovirus vector AcRepI containing RepI was obtained through a gene transposition reaction mediated by Tn7 transposase.

[0129] Steps 2 to 4 are the same as those in Example 1.

[0130] Examples 6-8

[0131] In Examples 6-8, deltaIE1 in Example 5 was replaced with 39K, p6.9, and p10 as the first promoter sequence, respectively. The other steps were the same as in Example 5 to obtain constructs RepII, RepIII, and RepIV (their nucleotide sequences are shown in SEQ ID Nos. 10-12), recombinant baculovirus vectors AcRepII, AcRepIII, and AcRepIV, and subsequent recombinant AAV bacmids and AAV recombinant baculoviruses.

[0132] Step 1: Constructing Rep gene expression cassette III and a recombinant baculovirus vector containing Rep gene expression cassette III. The Rep gene expression cassette III was constructed with reference to the method described in Example 6 of Chinese Patent (CN202111105263.5). Referring to Figure 5, Content A is a schematic diagram of the Rep gene expression cassette III DNA chain; Content B is a schematic diagram of the translation and expression of Rep52 protein when introns are not spliced ​​during post-transcriptional processing; Content C is a schematic diagram of the translation and expression of Rep78 protein after introns are spliced ​​during post-transcriptional processing. The gene expression cassette includes, from 5' to 3' end, a promoter sequence, an adenine nucleotide (A), an intron 5' end donor sequence, an intron 3' end acceptor sequence, a thymine nucleotide and a guanine nucleotide (TG), and a nucleotide sequence encoding AAV serotype 2 Rep protein lacking the Rep78 protein translation start codon ATG. Wherein, Comparative Examples 1-4 use deltaIE1, 39K, p6.9 and polH as promoter sequences, respectively. The above sequences were directly synthesized or amplified by overlap extension PCR to obtain constructs Rep1-4, whose nucleotide sequences are shown in SEQ ID No. 13-16.

[0133] The construct was cloned into the pFastBac vector to prepare a transfer plasmid; the transfer plasmid was transformed into the DH10Bac strain, and a gene transposition reaction mediated by Tn7 transposase was performed to obtain recombinant baculovirus vectors AcRep1-4 containing Rep1-4 respectively.

[0134] Steps 2 to 4 are the same as those in Example 1.

[0135] Experimental results verification

[0136] To facilitate the description of the experimental results, the recombinant AAV bacmids (Bac-Cap-Rep-ITR-GOI) constructed according to Examples 1-6 of the present invention and Comparative Example 4 are numbered according to their corresponding Cap gene expression cassettes, Rep gene expression cassettes, and ITR core elements, respectively, as shown in Table 1. The seven different recombinant AAV bacmids constructed in this example all contain a Cap gene expression cassette, a Rep gene expression cassette, and an ITR core element. Among them, the recombinant AAV bacmid CRI-0 is a control bacmid containing a Rep4 gene expression cassette, in which the expression of the Rep78 / 52 proteins is driven by a single strong very late promoter, polH. The details are shown in Table 1.

[0137] Table 1 List of components of 7 different recombinant AAV bacmids constructed in Examples and Comparative Examples

[0138] Verification Example 1: Detect the expression of Rep proteins (Rep78, Rep52). The specific steps are as follows:

[0139] The recombinant baculovirus vector DNA was extracted and transfected into Sf9 insect cells to prepare recombinant baculovirus (BEV). The transfected Sf9 insect cells successfully produced BEV. Further infection with the abundantly replicated and proliferated BEV resulted in a significant cytopathic effect (CPE) in the Sf9 cells. The culture supernatant of Sf9 cells experiencing CPE, which contained a large amount of BEV, was collected and designated as passage 0 BEV (P0). Sf9 cells containing a large amount of rAAV were also collected. The prepared BEV-P0 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI) of 1. After 72 hours of infection, cell viability dropped below 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the supernatant and cell pellet were collected separately. The supernatant was labeled passage 1 BEV-P1. The culture was further expanded and the prepared BEV-P1 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI = 1). After 72 hours of infection, the cell activity dropped below 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the cell pellet was collected for Western Blot analysis of the expression of Rep proteins (Rep78 and Rep52).

[0140] 6-8 are Western Blot detection diagrams of Rep proteins (Rep78, Rep52) of the recombinant baculovirus vectors containing the Rep gene expression cassette in Examples 1-8 and Comparative Examples 1-4, respectively.

[0141] FIG6 is a Western Blot analysis of Rep proteins (Rep78, Rep52) from recombinant baculovirus vectors AcRepA-D containing a Rep gene expression cassette 1, wherein lanes 1-4 represent AcRepA-D, respectively. FIG6 shows that the aforementioned recombinant baculovirus vectors are capable of producing both Rep78 and Rep52 proteins, with the expression level of Rep52 protein significantly higher than that of Rep78 protein. The high stoichiometric ratio of Rep52 to Rep78 may be a key factor in the high yield of rAAV. In constructs AcRepA, AcRepB, ​​AcRepC, and AcRepD, the present inventors have inserted a second promoter within the intron sequence to relatively enhance the expression of Rep52 protein.

[0142] Figure 7 is a Western Blot analysis of Rep proteins (Rep78, Rep52) from recombinant baculovirus vectors AcRepI, AcRepII, AcRepIII, and AcRepIV containing a Rep gene expression cassette II, wherein lanes 1-4 represent AcRepI-IV, respectively. In constructs AcRepI, AcRepII, AcRepIII, and AcRepIV, the inserted second promoter drives post-transcriptional processing, resulting in enhanced expression of Rep52 protein through splicing between the first intron splice donor and the splice acceptor.

[0143] Figure 8 shows the recombinant baculovirus vectors AcRep1-4 containing the Rep gene expression cassette III in Comparative Examples 1-4, wherein lanes 1-4 represent AcRep1-4 in Comparative Examples, respectively. As can be seen from the figure, the above recombinant baculovirus vectors are all capable of producing Rep78 and Rep52 proteins. In the constructs AcRep1, AcRep2, AcRep3, and AcRep4, Rep78 / 52 protein is expressed by a single promoter. Among them, AcRep1, AcRep2 and AcRep3 use deltaIE1, 39K and p6.9 promoters to drive the expression of Rep78 / 52 protein in the immediate early, delayed early and late stages of baculovirus, respectively. The early expression of Rep78 protein may be beneficial to the replication and packaging of the AAV genome; however, compared with the very late promoter (p10 or polH), the lower promoter strength of deltaIE1, 39K and p6.9 leads to insufficient amount of Rep52 protein, which is not conducive to high yield of rAAV. Therefore, it is necessary to enhance the expression of Rep52 protein.

[0144] Verification Example 2 Growth Kinetics Analysis

[0145] The immediate-early promoter deltaIE1 is active early in baculovirus infection, and early, high-level expression of the Rep78 protein in insect cells may negatively impact recombinant baculovirus yield (Urabe et al., 2006, Journal of Virology 80.4:1874-1885). To compare the growth kinetics of recombinant baculoviruses containing different Rep gene expression cassettes in the above examples and comparative examples, Sf9 cells were infected with the aforementioned recombinant baculoviruses at a multiplicity of infection (MOI = 0.5). Supernatants from infected cell cultures were collected 24, 48, 72, and 96 h post-infection, and the titers of second-passage BEV-P2 were determined using quantitative PCR (qPCR). Titers are expressed in VG / ml (VG per virus genome). BEV titers were determined using a pair of primers corresponding to the gp64 gene (Q-GP64-F: AACTTGGACATTACCCCGCC and Q-GP64-R: CCGTTGTACGCATACGCCTG). Titers are expressed in VG / ml (VG, virus genomes). The results are shown in Figure 9 . Rep78 protein is expressed at the very late, immediate early, and delayed early stages in constructs CRI-0, CRI-1, and CRI-2, respectively. As shown in Figure 9 , there is no significant difference in viral titers between CRI-0, CRI-1, and CRI-2, indicating that early expression of Rep78 protein in constructs CRI-1 and CRI-2 has little impact on baculovirus replication. In the Rep expression cassette designed by Urabe et al., deltaIE1 alone drives the expression of Rep78 protein. In CRI-1, the rep gene driven by the deltaIE1 promoter is partially transcribed and translated into Rep78 protein through intron splicing, and partially transcribed and translated into Rep52 protein, resulting in relatively lower Rep78 protein expression, which may be the reason for its reduced effect on baculovirus replication.

[0146] Verification Example 3: Purification of recombinant AAV virus particles and detection of the titer of rAAV virus and the solidity rate of virus particles

[0147] In this verification example, Q-PCR was used to detect the titer of the harvested rAAV virus, and the titer unit was expressed in VG / ml (VG, virus genomes). The rAAV titer was detected using a pair of primers targeting the ITR sequence (Q-ITR-F: GGAACCCCTAGTGATGGAGTT and Q-ITR-R: CGGCCTCAGTGAGCGA). The specific operation is as follows: Continue to expand the culture according to the operation of step 4 of Example 1 until the suspension cultured Sf9 cells are infected with the BEV-P2 seed virus at the multiplicity of infection (MOI=1) for rAAV packaging, and the packaging volume is 300mL to 400mL. Monitor cell activity 3 days after infection. When the activity is lower than 50%, collect the cell culture, take 500μl of the harvested mixture (mixture of cells and supernatant) into a 1.5ml EP tube, and freeze and thaw repeatedly 4 times in liquid nitrogen and 37-degree water bath. Add 0.1 μl of Benzonase to 500 μl of the mixture, mix thoroughly in a 37°C waterbath for 1 hour, then in a 95°C waterbath for 10 minutes. Centrifuge at 2500 g for 10 minutes, and collect the supernatant in a new 1.5 ml EP tube. Add 10 μl of 10% SDS solution to 200 μl of the supernatant to a final concentration of 0.5% SDS. Add 1.2 μl of Proteinase K (working concentration 112 μg / ml) to a final volume of approximately 210 μl, and incubate in a 55°C waterbath for 1 hour. After a brief centrifugation, in a 95°C waterbath for 10 minutes. After mixing, remove 5 μl of the sample and add 145 μl of ddH2O to a final volume of 150 μl. Remove another 10 μl of the sample and add 90 μl of ddH2O to a final volume of 100 μl. A 2 μl sample was used as a template for Q-PCR to measure viral titer. The results are shown in Table 2.

[0148] This example uses analytical ultracentrifugation (AUC) to detect the solidity rate (intact capsid: total capsid) of recombinant adeno-associated virus (rAAV)

[0149] Using sedimentation rate analysis, a technique used in analytical ultracentrifugation, a sample is spun at high speed in a centrifuge. Each component in the sample migrates to the bottom of the sample pool. Different components have different movement rates (i.e., sedimentation coefficients) and take different amounts of time to reach the bottom during centrifugation. During this process, the sample distribution is scanned and its temporal evolution is analyzed to determine the sedimentation properties of the different components. The sedimentation coefficient of each sample component depends on its molecular weight, shape, and conformation. The AUC is generally used to characterize the solidity rate of rAAV.

[0150] The collected cell culture was purified using an affinity chromatography column (AVIPure AAV8 Resin). 400 μl of the purified rAAV sample was diluted to OD 230= 0.90 dilution factor after loading, record the sedimentation coefficient and peak area percentage of each peak, where the sedimentation coefficient of the empty shell virus is 55S ~ 65S, the sedimentation coefficient of the solid virus is 80S ~ 110S, 65S ~ 80S is the partial part, greater than 110S is the aggregate. The peak with a sedimentation coefficient of 20S ~ 150S is normalized to obtain the peak area percentage of each peak, and this result is used to report the empty and solid rate of the virus sample. The experimental results are shown in Table 2.

[0151] Table 2 Titer and solidity test results of rAAV virus particles produced using 7 different recombinant AAV bacmids

[0152] As can be seen from Table 2, the titers of rAAV virus particles produced using recombinant AAV bacmids CRI-1, CRI-2, CRI-5, and CRI-6 were all higher than those of the control bacmid CRI-0, and the filling rate was significantly higher than that of the control bacmid CRI-0. Compared with the control bacmid CRI-0, the early expression of Rep78 protein and the higher Rep52 / Rep78 ratio in bacmids CRI-1, CRI-2, CRI-5, and CRI-6 may be the key factors for their high titers and high filling rate. The titers of rAAV virions produced using the recombinant AAV bacmids CRI-3 and CRI-4 were lower than those produced using the control bacmid CRI-0, but their plucking rates were higher. Bacmids CRI-0, CRI-3, and CRI-4 use the polH, p6.9, and p10 late promoters, respectively, to drive Rep78 expression, with the polH promoter being the most active. Compared to the control bacmid CRI-0, lower Rep78 expression and higher Rep52 / Rep78 ratios in bacmids CRI-3 and CRI-4 may account for their relatively low titers and high plucking rates. Improving plucking rates is beneficial for rAAV production, allowing the use of fewer particles to produce a similar number of genome copies per kilogram and facilitating the establishment of robust downstream purification processes.

[0153] Example 9

[0154] Step 1: Construction of Rep gene expression cassette IV and recombinant baculovirus vector containing Rep gene expression cassette IV

[0155] See Figure 10, wherein Content A is a schematic diagram of the DNA chain of the Rep gene expression cassette IV; Content B is a schematic diagram of the translation and expression of the Rep78 protein after intron splicing during post-transcriptional processing driven by the first promoter; Content C is a schematic diagram of the translation and expression of the Rep78 protein after transcription driven by the second promoter. The gene expression cassette includes, from the 5' to the 3' end, a first promoter sequence, an adenine nucleotide (A), a donor sequence at the 5' end of the intron, a second promoter sequence, an acceptor sequence at the 3' end of the intron, thymine nucleotides and guanine nucleotides (TG), and a nucleotide sequence encoding the AAV serotype 2 Rep protein that only lacks the Rep78 protein translation initiation codon ATG. The overlapping open reading frame nucleotide sequence encoding the Rep protein is shown in SEQ ID No. 1, which is used to encode the Rep78 protein in its entirety, while the portion encoding the Rep52 protein is shown in SEQ ID No. 2. It contains multiple nucleotide mutations between the Rep78 translation initiation codon and the Rep52 translation initiation codon to eliminate possible translation initiation sites within this region. In this example, deltaIE1 was used as the first promoter sequence (nucleotide sequence shown in SEQ ID No. 17), and polH was used as the second promoter sequence (nucleotide sequence shown in SEQ ID No. 18). The second promoter contains translation initiation and termination codon sequences recognized by ribosomes, ensuring that the first promoter drives the Rep gene expression cassette IV, and that introns are not spliced ​​during post-transcriptional processing, without translation to produce Rep52 protein. The above sequences were connected by direct synthesis or overlap extension PCR amplification to obtain the construct RepE, whose nucleotide sequence is shown in SEQ ID No. 19.

[0156] The construct was cloned into the pFastBac vector to prepare a transfer plasmid; the transfer plasmid was transformed into the DH10Bac strain, and a recombinant baculovirus vector AcRepE containing RepE was obtained through a gene transposition reaction mediated by Tn7 transposase.

[0157] Step 2: Construct Cap gene expression cassette

[0158] This step is the same as step 2 in Example 1.

[0159] Step 3: Construction of recombinant AAV bacmid

[0160] This step is the same as step 3 in Example 1.

[0161] Step 4: Preparation of AAV recombinant baculovirus

[0162] This step is the same as step 4 in Example 1.

[0163] Examples 10-12

[0164] In Examples 10-12, the deltaIE1 in Example 9 was replaced with 39K (SEQ ID No. 20), p6.9 (SEQ ID No. 21), and p10 (SEQ ID No. 22) as the first promoter sequence, respectively. The other steps were the same as in Example 9 to obtain constructs RepF, RepG, and RepH, as shown in FIG11 , and the corresponding recombinant baculovirus vectors AcRepF, AcRepG, and AcRepH, as well as the subsequent recombinant AAV bacmid and AAV recombinant baculovirus.

[0165] Comparative Example 5

[0166] Step 1: Construct a Rep gene expression cassette V and a recombinant baculovirus vector containing the Rep gene expression cassette V, and construct the Rep gene expression cassette V with reference to the method described in Example 6 of Chinese Patent (CN202111105263.5). Referring to Figure 5, content A is a schematic diagram of the Rep gene expression cassette V DNA chain; content B is a schematic diagram of the translation and expression of Rep52 protein when introns are not spliced ​​during post-transcriptional processing; content C is a schematic diagram of the translation and expression of Rep78 protein after introns are spliced ​​during post-transcriptional processing. The gene expression cassette includes, from 5' to 3' end, a promoter sequence, adenine nucleotide (A), an intron 5' end donor sequence, an intron 3' end acceptor sequence, thymine nucleotides and guanine nucleotides (TG), and a nucleotide sequence encoding AAV serum type 2 Rep protein lacking the Rep78 protein translation start codon ATG. Wherein, this comparative example 5 uses polH as the promoter sequence. The above sequences were directly synthesized or amplified by overlap extension PCR to obtain the construct Rep5, whose nucleotide sequence is shown in SEQ ID No. 23.

[0167] The construct was cloned into the pFastBac vector to prepare a transfer plasmid; the transfer plasmid was transformed into the DH10Bac strain, and a recombinant baculovirus vector AcRep5 containing Rep5 was obtained through a gene transposition reaction mediated by Tn7 transposase.

[0168] Steps 2 to 4 are the same as those in Example 9.

[0169] Experimental results verification

[0170] To facilitate the description of the experimental results, the recombinant AAV bacmids (Bac-Cap-Rep-ITR-GOI) constructed according to Examples 9-12 of the present invention and Comparative Example 5 are numbered according to their corresponding Cap gene expression cassettes, Rep gene expression cassettes, and ITR core elements, respectively, as shown in Table 3. The five different recombinant AAV bacmids constructed in this example all contain a Cap gene expression cassette, a Rep gene expression cassette, and an ITR core element. Among them, the recombinant AAV bacmid CRI-7 is a control bacmid containing a Rep5 gene expression cassette, in which the expression of the Rep78 / 52 proteins is driven by a single strong very late promoter, polH. The details are shown in Table 3.

[0171] Table 3 List of components of 7 different recombinant AAV bacmids constructed in Example and Comparative Example 5

[0172] Verification Example 4

[0173] Detect the expression of Rep proteins (Rep78, Rep52). The specific steps are as follows:

[0174] The recombinant baculovirus vector DNA was extracted and transfected into Sf9 insect cells to prepare recombinant baculovirus (BEV). The transfected Sf9 insect cells successfully produced BEV. Further infection with the abundantly replicated and proliferated BEV resulted in a significant cytopathic effect (CPE) in the Sf9 cells. The culture supernatant of Sf9 cells experiencing CPE, which contained a large amount of BEV, was collected and designated as passage 0 BEV (P0). Sf9 cells containing a large amount of rAAV were also collected. The prepared BEV-P0 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI) of 1. After 72 hours of infection, cell viability dropped below 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the supernatant and cell pellet were collected separately. The supernatant was labeled passage 1 BEV-P1. The culture was further expanded and the prepared BEV-P1 was used to infect suspension-cultured Sf9 cells at a multiplicity of infection (MOI = 1). After 72 hours of infection, the cell activity dropped below 50%. The cell culture medium was centrifuged at 1000 g for 5 minutes, and the cell pellet was collected for Western Blot analysis of the expression of Rep proteins (Rep78 and Rep52).

[0175] 12-13 are Western Blot detection images of Rep proteins (Rep78, Rep52) of the recombinant baculovirus vectors containing the Rep gene expression cassette in Examples 9-12 and Comparative Example 5, respectively.

[0176] Figure 12 is a Western Blot analysis of Rep proteins (Rep78 and Rep52) from the recombinant baculovirus vector AcRepE-H containing the Rep gene expression cassette IV, with lanes 1-4 representing AcRepE-H, respectively. As shown in Figure 12 , all of the above recombinant baculovirus vectors are capable of producing both Rep78 and Rep52 proteins, with AcRepE-G expressing significantly higher levels of Rep52 than Rep78. The high stoichiometric ratio of Rep52 to Rep78 may be a key factor in the high rAAV yield.

[0177] Figure 13 shows the recombinant baculovirus vector AcRep5 containing the Rep gene expression cassette V in Comparative Example 5, wherein lane 1 represents AcRep5 in Comparative Example 5. As can be seen from the figure, the above recombinant baculovirus vector can produce Rep78 and Rep52 proteins.

[0178] Verification Example 5

[0179] Purification of recombinant AAV virus particles and detection of rAAV virus titer and virus particle solidity rate:

[0180] This verification example uses Q-PCR to detect the titer of the harvested rAAV virus, and the titer unit is expressed in VG / ml (VG, virus genomes). The detection of rAAV titer uses a pair of primers targeting the ITR sequence (Q-ITR-F: GGAACCCCTAGTGATGGAGTT and Q-ITR-R: CGGCCTCAGTGAGCGA). The specific operation is as follows: Continue to expand the culture according to the operation of step 4 of Example 9 until the suspension cultured Sf9 cells are infected with the BEV-P2 seed virus according to the multiplicity of infection (MOI=1) for rAAV packaging, and the packaging volume is 300mL~400mL. Monitor cell activity 3 days after infection. When the activity is lower than 50%, collect the cell culture, take 500μl of the harvested mixture (mixture of cells and supernatant) into a 1.5ml EP tube, and freeze and thaw repeatedly 4 times in liquid nitrogen and 37-degree water bath. Add 0.1 μl of Benzonase to 500 μl of the mixture, mix thoroughly in a 37°C waterbath for 1 hour, then in a 95°C waterbath for 10 minutes. Centrifuge at 2500 g for 10 minutes, and collect the supernatant in a new 1.5 ml EP tube. Add 10 μl of 10% SDS solution to 200 μl of the supernatant to a final concentration of 0.5% SDS. Add 1.2 μl of Proteinase K (working concentration 112 μg / ml) to a final volume of approximately 210 μl, and incubate in a 55°C waterbath for 1 hour. After a brief centrifugation, in a 95°C waterbath for 10 minutes. After mixing, remove 5 μl of the sample and add 145 μl of ddH2O to a final volume of 150 μl. Remove another 10 μl of the sample and add 90 μl of ddH2O to a final volume of 100 μl. A 2 μl sample was used as a template for Q-PCR to measure the viral titer. The results are shown in Table 4.

[0181] This example uses analytical ultracentrifugation (AUC) to detect the solidity rate (intact capsid: total capsid) of recombinant adeno-associated virus (rAAV)

[0182] Using sedimentation rate analysis, a technique used in analytical ultracentrifugation, a sample is spun at high speed in a centrifuge. Each component in the sample migrates to the bottom of the sample pool. Different components have different movement rates (i.e., sedimentation coefficients) and take different amounts of time to reach the bottom during centrifugation. During this process, the sample distribution is scanned and its temporal evolution is analyzed to determine the sedimentation properties of the different components. The sedimentation coefficient of each sample component depends on its molecular weight, shape, and conformation. The AUC is generally used to characterize the solidity rate of rAAV.

[0183] The collected cell culture was purified using an affinity chromatography column (AVIPure AAV8 Resin). 400 μl of the purified rAAV sample was diluted to OD 230= 0.90 dilution factor after loading, record the sedimentation coefficient and peak area percentage of each peak, where the sedimentation coefficient of the empty shell virus is 55S ~ 65S, the sedimentation coefficient of the solid virus is 80S ~ 110S, 65S ~ 80S is the partial part, greater than 110S is the aggregate. The peak with a sedimentation coefficient of 20S ~ 150S is normalized to obtain the peak area percentage of each peak, and this result is used to report the empty and solid rate of the virus sample. The experimental results are shown in Table 4.

[0184] Table 4 Titer and solidity test results of rAAV virus particles produced using 5 different recombinant AAV bacmids

[0185] As can be seen from Table 4, the titers of rAAV virus particles produced using recombinant AAV bacmids CRI-8 and CRI-9 were higher than those of the control bacmid CRI-7, and their filling rates were significantly higher than those of the control bacmid CRI-7. Compared with the control bacmid CRI-7, the early expression of Rep78 protein and the higher Rep52 / Rep78 ratio in bacmids CRI-8 and CRI-9 may be the key factors for their high titers and high filling rates. The titer of rAAV virions produced using the recombinant AAV bacmid CRI-10 was lower than that of the control bacmid CRI-7, but the p6.9 plucking rate was higher. Bacmids CRI-7 and CRI-10 use the polH and p6.9 late promoters, respectively, to drive Rep78 expression, with the polH promoter being the most active. The lower Rep78 expression and higher Rep52 / Rep78 ratio in CRI-10 compared to the control bacmid CRI-7 may account for its relatively low titer and high plucking rate. The titer of rAAV virions produced using the recombinant AAV bacmid CRI-11 was comparable to that of the control bacmid CRI-7, but the plucking rate was slightly lower than that of the control bacmid CRI-7, likely due to the use of a relatively weak very late promoter to drive Rep78 expression. Improving the plucking rate of virions is beneficial for rAAV production, allowing the use of fewer particles to achieve a similar number of genome copies per kilogram and facilitating the establishment of a robust downstream purification process.

[0186] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An expression cassette containing overlapping open reading frames, wherein the overlapping open reading frames are overlapping open reading frames of a first ORF and a second ORF, characterized in that: The second promoter is only used to drive the transcription of the gene of the second ORF, and further includes from the 5' end to the 3' end: at least a first promoter for driving transcription of a gene of a first ORF; the 5' portion of the gene of the first ORF; Introns; the 3' portion of the gene of the second ORF; The second promoter is located in front of the 5' end of the first promoter, or is within the intron.

2. The expression cassette according to claim 1, characterized in that During post-transcriptional processing, the intron forms the translation start codon ATG of the first ORF through alternative splicing.

3. The expression cassette according to claim 2, characterized in that The intron is located between any two nucleotides of the translation start codon ATG of the first ORF; 4. The expression cassette according to claim 2, characterized in that The second promoter is within the intron.

5. The expression cassette according to claim 2, characterized in that The second promoter precedes the 5' end of the first promoter.

6. The expression cassette according to claim 1, characterized in that The intron is located between the translation start codon ATG of the first ORF and the exon of the first ORF.

7. The expression cassette according to claim 1, characterized in that The first promoter is only used to drive gene transcription of the first ORF.

8. The expression cassette according to claim 1, characterized in that The first promoter is used to drive gene transcription of the first ORF and the second ORF.

9. The expression cassette according to claim 1, characterized in that The gene of the first ORF is used to express Rep78 and / or Rep68 protein, and the gene of the second ORF is used to express Rep52 and / or Rep 40 protein.

10. The expression cassette according to claim 1, characterized in that The gene of the first ORF is used to express VP1 protein, and the gene of the second ORF is used to express VP2 and / or VP3 protein.

11. The expression cassette according to claim 1, characterized in that The first promoter is active before the second promoter.

12. The expression cassette according to claim 11, characterized in that The first promoter is an immediate early promoter, an early promoter or a late promoter, and the second promoter is a very late promoter.

13. The expression cassette of claim 1, wherein The first promoter is deltaIE1, IE1, 39K or p6.9, and the second promoter is polH or p10.

14. The expression cassette of claim 1, wherein The first promoter is p10 and the second promoter is polH.

15. A nucleic acid molecule, characterized in that It comprises a Cap gene expression cassette and a Rep gene expression cassette, wherein the Cap gene expression cassette and / or the Rep gene expression cassette is the expression cassette according to any one of claims 1-15.

16. The nucleic acid molecule according to claim 15, wherein Also includes foreign genes.

17. The nucleic acid molecule according to claim 16, wherein There are AAV inverted terminal repeat sequences at both ends of the foreign gene.

18. [Corrected 13.01.2024 in accordance with Rule 26] A nucleic acid molecule according to claim 16, characterized in that The exogenous gene is a reporter gene, and the reporter gene is at least one of a chloramphenicol acetyltransferase encoding gene, a β-galactosidase encoding gene, a β-glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene, and a red fluorescent protein encoding gene.

19. The nucleic acid molecule according to claim 16, characterized in that The exogenous gene is a gene encoding a drug polypeptide, and the drug polypeptide is at least one of lipoprotein esterase, apolipoprotein, cytokine, interleukin and interferon.

20. A recombinant baculovirus vector comprising the expression cassette of any one of claims 1 to 14.

21. The recombinant baculovirus vector according to claim 20, characterized in that The recombinant baculovirus vector is an insect cell compatible vector.

22. An insect cell comprising the recombinant baculovirus vector of claim 20 or 21.

23. The insect cell according to claim 22, characterized in that The insect cells are fall armyworm cells, cabbage looper cells, fruit fly cells or mosquito cells.

Images