Pharmaceutical composition for preventing or treating bone diseases

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating bone diseases, and more specifically, includes a TCP-(MP)-Caffeic acid analogue, and thus can inhibit osteoclast differentiation and / or generation and exhibit an excellent prevention or treatment effect on various bone diseases including osteoporosis and the like.

Description

Pharmaceutical composition for preventing or treating bone disease

[0001] The present invention relates to a pharmaceutical composition for preventing or treating bone diseases.

[0002]

[0003] Bone tissue is a tissue in which bone resorption by osteoclasts and bone formation by osteoblasts are continuously maintained. Osteoblast differentiation is promoted by signaling factors such as bone morphogenetic protein 2 (BMP2). Osteoclast differentiation is promoted by the receptor activator of nuclear factor kappa-β ligand (RANKL) signaling molecule produced during osteoblast differentiation, and apoptosis occurs upon completion of differentiation. Therefore, it is important for the normal bone regeneration process to achieve a harmonious differentiation and activity of osteoblasts and osteoclasts.

[0004] When the balance between osteoblasts and osteoclasts is disrupted, bone resorption exceeds bone formation, resulting in decreased calcium in bone tissue, a decrease in bone density, and a widening of the medullary cavity. As the condition progresses, the bones become weaker, making them susceptible to fracture even from minor impacts. The disease caused by these symptoms is osteoporosis.

[0005] Osteoporosis is a condition in which bone matrix becomes pathologically thinned, resulting in decreased bone density and strength, and an increased risk of fracture. Skeletal strength is primarily formed and maintained by the bone matrix and mineral deposition within it, which is clinically reflected in bone density. Osteoporosis is classified into primary osteoporosis and secondary osteoporosis based on its etiology.

[0006] Osteoclasts play a crucial role in inducing bone resorption in bone diseases such as osteoporosis, periostitis, and rheumatoid arthritis. Therefore, numerous efforts have been made to discover alternative drugs that can treat bone diseases by inhibiting osteoclast differentiation.

[0007]

[0008] The present invention aims to provide a novel compound capable of inhibiting hyperdifferentiation of osteoclasts.

[0009] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating bone disease.

[0010] The purpose of the present invention is to provide a health functional food for preventing or improving bone disease.

[0011]

[0012] 1. A compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:

[0013] [Chemical Formula 1]

[0014]

[0015] (In the formula, R is hydrogen or t-butyldimethylsilyl).

[0016]

[0017] 2. A pharmaceutical composition for preventing or treating bone disease, comprising a compound represented by the following chemical formula 1:

[0018] [Chemical Formula 1]

[0019]

[0020] (In the formula, R is hydrogen or t-butyldimethylsilyl).

[0021] 3. In the above 2, the bone disease is any one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, a pharmaceutical composition for preventing or treating bone disease:

[0022] 4. Health functional food for improving bone health containing a compound represented by chemical formula 1:

[0023] [Chemical Formula 1]

[0024]

[0025] (In the formula, R is hydrogen or t-butyldimethylsilyl).

[0026]

[0027] The novel compound of the present invention and the pharmaceutical composition comprising the same can exhibit excellent preventive or therapeutic effects on various bone diseases, including osteoporosis, by inhibiting osteoclast differentiation and / or production.

[0028] A health functional food containing the novel compound of the present invention can exhibit excellent preventive or improvement effects on various bone diseases, including osteoporosis, by inhibiting osteoclast differentiation and / or production.

[0029]

[0030] Figures 1 a and b schematically illustrate the synthesis process of a TCP-(MP)-caffeic acid (Tranylcypromine-Methylpiperidine-Caffeic acid) analogue.

[0031] Figures 2a to 2g relate to the osteoclast formation inhibitory effect (in vitro) of TCP-(MP)-caffeic acid analogs (CD-I-448 and 478) and three TCP-caffeic acid analogs (CD-I-389, CD-I-439, CD-I-442) corresponding to the chemical formula 1 compound of the present invention. a and b are the results of fixation and staining of mature osteoclasts using a Tartrate-Resistant Acid Phosphatase (TRAP) staining kit after culturing bone marrow-derived macrophages (BMDM) in the induction medium supplemented with macrophage-colony stimulating factor (M-CSF) (30 ng / mL) and RANKL (50 ng / mL) for 4 days, and calculation of the area of ​​TRAP-positive multinucleated osteoclasts (b). M+R+D (M-CSF, RANKL, and DMSO (Dimethyl sulfoxide) treated group) is the control group. c is the result of in vitro LSD1 (Lysine-specific histone demethylase 1) activity assay. CTRL (DMSO treatment) is the control group. d and e show the effect of CD-I-448 and CD-I-478, corresponding to compounds of formula 1, on protein methylation in bone-marrow derived macrophages (BMDMs) using the LSD1 activity x-in vivo assay. MR ((group treated with M-CSF and RANKL) and GSK-LSD1 (group treated with GSK-LSD1 Dihydrochloride) are controls.f and g show the results of staining cells using an alkaline phosphatase (ALP) assay kit (f) and the ALP positivity density (%) (g), which indicates osteoblast differentiation, measured by Image J after primary calvarial cells were treated with BMP2 (100 ng / mL) and cultured with DMSO or a labeled novel LSD1 inhibitor (2 μM) for 9 days. BMP2 is the control. Data reflect three independent experiments (scale bar: 100 μm. * p < 0.05 and ** p < 0.05 vs. DMSO control).

[0032] Figures 3a to 3h show the dose-dependent osteoclastogenesis inhibitory effect (in vitro) of TCP-(MP)-caffeic acid analogues. a to d show the results of fixing the formed mature osteoclasts and staining them using a TRAP staining kit after culturing BMDMs in an induction medium supplemented with M-CSF (30 ng / mL) and RANKL (50 ng / mL) with or without the indicated doses of CD-I-448 for 4 days (a), and calculating the area of ​​TRAP-positive multinucleated osteoclasts (b), the number of cells by nuclear type (c), and the total number of cells per well (d). MR (M-CSF and RANKL-treated group) is the control group. e to g show the osteoclast bone resorption assay effect (in vitro) to evaluate the effect of CD-I-448 (e), the results of supernatant fluorescence analysis of the indicated groups (f), and the results of calculating the resorbed pore area (%) (g) of the indicated groups using Image J software. MR (M-CSF and RANKL-treated group) is the control group. h represents the results of cell viability assays with CD-I-448 at the indicated doses. Data are representative of at least three independent experiments. (Scale bar: 200 μm. 0 μM - control group vs. MR (M-CSF and RANKL-treated group): * p < 0.05, ** p < 0.01, and *** p < 0.001; G indicates GSK-LSD1.)

[0033] Figures 4a and b show that CD-I-448 inhibits the formation of F-actin belts (in vitro). a shows the results of F-actin staining analysis to evaluate the effect of CD-I-448 on RANKL-induced F-actin belt formation. b shows the results of calculating the size (%) of the F-actin ring in the indicated groups using Image J. CTRL (M-CSF + RANKL treatment group) is the control group.

[0034] Figures 5a and b show that CD-I-478 inhibits osteoclast bone resorption (in vitro). a shows the results of a bone resorption assay performed to evaluate the extent of osteoclast bone resorption according to the difference in the indicated dose of CD-I-478. b shows the results of calculating the resorption pit area (%) of the indicated groups using Image J. MR (the group treated with M-CSF and RANKL) is the control group.

[0035] Figures 6a to 6f show the preventive effect of CDI-448 on bone loss in ovariectomized rat (OVX)-induced osteoporotic mice. a shows representative micro-CT 3D reconstructed images of the control (Sham) (n=10), OVX (n=7), low-dose-5 mg / kg (n=7), and high-dose-10 mg / kg (n=7) treated mouse groups. b and c show measured and calculated bone mineral density (BMD), bone surface (BS), trabecular volume (Tb-V), and total volume (TV) of each sample. d shows the body weight of each group for in vivo analysis. e shows histological evaluation of the effect of CDI-448 (5 or 10 mg / kg) on ​​OVX-induced bone loss and representative images of demineralized bone stained with TRAP and H&E (hematoxylin and eosin). f represents quantitative analysis of osteoclast surface percentage per bone surface (OC. S / BS (OsteoClast Surface per Bone Surface)). (* p<0.05 vs. OVX group, “ns” indicates not significant (scar bar = 200 μm)).

[0036] Figure 7 shows the results of purifying the LSD1 / CoREST (Corepressor for RE1-Silencing Transcription factor) complex.

[0037] Figures 8a to 8f show the interaction of CD-I-448 and CD-I-478 with the LSD1 / CoREST complex, and the structure of CD-I-478 within the LSD1 / CoREST complex. a and b show the SPR (Surface Plasmon Resonance) analysis results of CD-I-448 and CD-I-478 with the LSD1 / CoREST complex. c shows the ITC (Isothermal Titration Calorimetry) analysis results of the CD-I-478 and LSD1 / CoREST complex. d shows the crystal structure of the complexed LSD1 / CoREST, and the two protein chains of LSD1 and CoREST are represented as ribbons and are distinguished by color (LSD1 is green, CoREST is turquoise). Here, the cylinder and arrow represent alpha-helix and beta-strand, respectively. The FAD cofactor within the active site of LSD1 was derived from CD-I-478 and is magnified in the lower left panel. It is represented as a stick model with different atomic colors in the 2Fo-Fc electron density, with yellow contour lines drawn at the 1.5 s level. e is shown for comparison of inhibitors bound to the active site of LSD1. Inhibitors bound to protein backbones are indicated in different colors. Quinazoline-derived reversible inhibitors are indicated as 5L3E, tranylcypromine-derived irreversible inhibitors as 7VQT, GSK2879552-derived irreversible inhibitors as 6NQU, and CD-I-478-derived irreversible inhibitors as CDI. f is an enlarged view of the inhibitors compared in (B), showing cases where FAD is derivatized or positioned close to the reversible inhibitor in each inhibitor.

[0038] Figures 9a to h show the results of SPR and differential scanning fluorimetry (DSF) analyses of TCP-(MP)-caffeic acid analogues using the LSD1 / CoREST complex. SPR kinetic analyses of GSK-LSD1 and GSK2879552 (a and b), and DSF analyses of GSK2879552, CD-I-448, and CD-I-478 (c to h) are shown.

[0039] Figures 10a to d show that CD-I-448 is converted to CD-I-478 by releasing TBS (t-butyldimethylsilyl) and the like. Blank rat plasma (a), CD-I-448 in mouse plasma (b), CD-I-478 in mouse plasma (c), and mouse plasma after intravenous injection of CD-I-448 (d) are shown. Samples (b) and (c) were prepared at a concentration of 5 μg / ml and incubated in rat plasma for 0.5 h, and plasma sample (d) was obtained 5 minutes after intravenous administration at a dose of 20 mg / kg, and the chromatograms of each sample represent the results measured using mass spectrometry.

[0040] Figures 11a to g show the inhibitory effect of CDI-448 on the expression of osteoclast-specific genes and proteins. a to f show the inhibitory effect of CDI-448 on the expression of osteoclast-specific markers induced by RANKL. The results of qRT-PCR analysis for the relative mRNA expression of osteoclast-specific genes Acp5 (Acid Phosphatase 5), NFATc1 (Nuclear factor of activated T-cells, cytoplasmic 1), DC-STAMP (Dendritic cell-specific transmembrane protein), ATP6v0d2 (ATPase H+ Transporting V0 Subunit D2), Oscar, and CtsK were shown for 0, 1, 2, and 4 days with or without treatment with CD-I-448 (2 μM). The black bar represents the control group (Con), and the gray bar represents the CD-I-448-treated group. Transcript levels are normalized to the expression of the control group on day 0. g indicates that CD-I-448 inhibits the expression of key osteoclast proteins induced by RANKL, such as NFATc1, c-fos, and Ctsk. β-Actin is shown as a loading control. (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. vehicle-treated "Con" (0 μM))

[0041] Figures 12a to d show the analysis of protein expression of NFATc1 after culturing BMDM with or without 2 μM of CD-I-448 or CD-I-448+MG132 (Z-Leu-leu-leu-al), and treating them with 10 μM of MG132 for the last 6 hours (a). b shows the analysis of protein expression of CtsK, an osteoclast maturation-specific protein, and the analysis of expression of CBL (Casitas B-lineage Lymphoma), p-LSD1, and methyl lysine for 0, 1, 2, and 4 days. c shows the analysis of lysine methylation of CBL protein in the indicated groups, and the analysis of the interaction of CBL with p-LSD1 and NFATc1. CBL protein was used as an input control. d shows the effect of CD-I-448 and GSK-LSD1 at the indicated doses on NFATc1 lysine 48-linked Ub. (0 μM - treated as “Con”, “M” indicates ‘M-CSF’.)

[0042] Figures 13a and b show the results of CO-IP analysis (a) to examine CBL methylation via IP methyl lysine and Western blot CBL, and the results of CO-IP analysis (b) to confirm the interaction of p-LSD1 and CBL via IP p-LSD1 and Western blot CBL.

[0043] Figure 14 shows a mechanism diagram of a proposed TCP-(MP)-caffeic acid analogue in the treatment of osteoclast bone loss. (Generated with BioRender.com)

[0044]

[0045] The present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof; and uses thereof.

[0046] In the chemical formula (structural formula) of the present invention, if a substituent is required but no substituent is described, the hydrogen substituent is omitted, and this applies equally to all chemical formulas (structural formulas) of the present invention.

[0047] The present invention provides a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:

[0048] [Chemical Formula 1]

[0049]

[0050] In chemical formula 1, R is hydrogen or t-butyldimethylsilyl (TBS).

[0051] For example, the compound represented by Chemical Formula 1 is a compound represented by Chemical Formula 2 or Chemical Formula 3 below.

[0052] [Chemical Formula 2]

[0053]

[0054] [Chemical Formula 3]

[0055]

[0056] The compound represented by Chemical Formula 1 and a pharmaceutically acceptable salt thereof can exhibit an effect of inhibiting osteoclast differentiation. More specifically, the compound represented by Chemical Formula 1 and a pharmaceutically acceptable salt thereof can inhibit the demethylation activity of LSD1 and stabilize the CBL protein by reducing the direct interaction between LSD1 and CBL, thereby inhibiting osteoclast differentiation.

[0057] In one embodiment of the present invention, it was confirmed that osteoclast bone loss was inhibited after treatment with CD-I-448 corresponding to the compound of chemical formula 1 in an OVX-induced osteoporosis mouse model.

[0058] The present invention provides a pharmaceutical composition for preventing or treating bone disease, comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:

[0059]

[0060] [Chemical Formula 1]

[0061]

[0062]

[0063] In chemical formula 1, R is hydrogen or t-butyldimethylsilyl (TBS).

[0064] The term "pharmaceutically acceptable" means that the compound or composition exhibits the property of not causing serious irritation to the subject, cell, tissue, etc. to which it is administered and does not impair the biological activity and physical properties of the compound.

[0065] Pharmaceutically acceptable salts may be, for example, acid addition salts, base addition salts or metal salts.

[0066] Acid addition salts can be formed from inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, nitrous or phosphorous acids and non-toxic organic acids such as aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates and alkanedioates, aromatic acids, aliphatic and aromatic sulfonic acids. These pharmaceutically non-toxic salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, fluorides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caprates, heptanoates, propylates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyn-1,4-dioate, hexanoate-1,6-dioate, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, It may include terephthalate, benzenesulfonate, tert-butyl sulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate or mandelate. For example, an acid addition salt of a compound represented by formula 1 can be obtained by dissolving the compound in an excess aqueous acid solution and precipitating the salt using a hydratable organic solvent, such as methanol, ethanol, acetone or acetonitrile.

[0067] The metal salt may be a sodium, potassium, or calcium salt. The metal salt may be prepared using a base, for example, an alkali metal or alkaline earth metal salt may be obtained by dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering off the undissolved compound salt, and evaporating and / or drying the filtrate.

[0068] Bone diseases that can be prevented or treated by the pharmaceutical composition of the present invention may be caused by an imbalance in the activity of osteoblasts and osteoclasts, and more specifically, the bone diseases may be caused by osteoclast hyperdifferentiation or decreased osteoblast activity.

[0069] When osteoclasts become overdifferentiated, they may increase abnormally, resulting in excessive bone resorption and a decrease in bone density. This may lead to various diseases such as osteoporosis, osteomalacia, osteopenia, bone atrophy, and periodontitis.

[0070] The above bone disease may be, but is not limited to, a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, osteoatrophy, osteoarthritis or avascular necrosis of the femur, bone defect, osteoporotic fracture, diabetic fracture, nonunion fracture, osteogenesis imperfecta, osteomalacia fracture, osteogenesis disorder, degenerative bone disease, malocclusion, osteosynthesis disorder, pseudoarthrosis, osteonecrosis, osteoarthritis, bone tumor, bone cancer, etc. Preferably, the bone disease may be any one selected from the group consisting of a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, osteoatrophy, osteoarthritis, and avascular necrosis of the femur.

[0071] Periodontitis is an inflammatory response driven by immune cells' defense against periapical bacterial infection. Neutrophils, which are primarily involved in periodontitis, secrete prostaglandins, inflammatory mediators. Cell signaling molecules such as prostaglandins activate osteoclasts, which resorb bone tissue, resulting in alveolar bone loss around the inflamed area. Furthermore, chronic periodontitis presents with persistent periapical inflammation and alveolar bone erosion. If periodontitis worsens and the tooth becomes unsalvageable, extraction is necessary and implant placement is performed. To prevent this, antibiotics can be administered in the early stages of periodontitis to reduce the number of cells causing infection, and osteoclast inhibitors can be administered to overcome osteoclast activation induced by inflammatory mediators, thereby alleviating and treating chronic periodontitis. Therefore, the pharmaceutical composition of the present invention can be used to prevent or treat periodontitis by inhibiting osteoclast differentiation and thus preventing bone resorption.

[0072] The term “prevention” as used herein includes any action that inhibits or delays the onset of bone disease.

[0073] The term "treatment" includes any action that improves or beneficially alters the symptoms of an individual with a bone disease.

[0074] The pharmaceutical composition of the present invention may be administered in combination with known substances for the prevention or treatment of bone diseases. For example, the pharmaceutical composition of the present invention may be administered in combination with cinchonine, brown mealworm extract, aloe-imodin, and omega-3 fatty acids, arteannuin B, indole-2-carboxylate derivatives, euphobia factor L1, skullcapflavone derivatives, and fraxinelone.

[0075] As used herein, the term "administration" means introducing a given substance into an individual through an appropriate method, and "individual" means any animal, including humans, rats, mice, and livestock, that has developed or may develop a bone disease. A specific example may be a mammal, including humans.

[0076] The pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage.

[0077] The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as external preparations, suppositories, and injections.

[0078] The pharmaceutical composition of the present invention may contain the active ingredient alone, or may further contain one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0079] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, fragrances, etc. for oral administration; buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. for injections; and bases, excipients, lubricants, preservatives, etc. for topical administration.

[0080] The pharmaceutical composition of the present invention may be prepared in various forms by mixing it with a pharmaceutically acceptable carrier. For example, for oral administration, it may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it may be prepared in the form of unit dose ampoules or multiple doses. In addition, the pharmaceutical composition of the present invention may be prepared in the form of solutions, suspensions, tablets, capsules, sustained-release preparations, etc.

[0081] Carriers, excipients and diluents for formulation may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers or preservatives.

[0082] The route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal, but is not limited thereto.

[0083] The pharmaceutical composition of the present invention can be administered orally or parenterally, and when administered parenterally, the method of injection can be selected, such as topical application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.

[0084] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's condition and weight, the degree of the disease, the drug form, the route of administration, and the period of administration, but may be appropriately selected by a person skilled in the art.

[0085] For example, the pharmaceutical composition of the present invention may be administered at a daily dose of 0.0001 mg to 1000 mg / kg or 0.001 mg to 500 mg / kg. The pharmaceutical composition of the present invention may be administered once a day or divided into several doses.

[0086] The present invention provides a health functional food for improving bone health, comprising a compound represented by the following chemical formula 1 or a food-related acceptable salt thereof:

[0087] [Chemical Formula 1]

[0088]

[0089] In chemical formula 1, R is hydrogen or t-butyldimethylsilyl (TBS).

[0090] The compound represented by chemical formula 1 is the same as described above.

[0091] As used herein, the term “improving bone health” includes any effect that maintains the balance between bone breakdown and remodeling.

[0092] The health functional food of the present invention can improve bone health by helping to maintain the balance between bone decomposition and bone remodeling.

[0093] Health functional foods refer to foods manufactured and processed using raw materials or ingredients with functionality useful to the human body according to the Health Functional Foods Act. The functionality may mean consuming them for the purpose of obtaining beneficial effects for health purposes, such as regulating nutrients for the structure and functions of the human body or physiological effects.

[0094] A health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including one or more of a carrier, diluent, excipient, and additive.

[0095] Health functional foods can be, for example, various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, or health functional foods.

[0096] Additives that may be included in health functional foods may be selected from the group consisting of natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, antioxidants, glycerin, alcohol, carbonating agents, and fruit pulp.

[0097] Natural carbohydrates include, for example, monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and common sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As the flavoring agent, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

[0098] Health functional foods may further include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and fruit pulp for the production of natural fruit juices and vegetable beverages.

[0099] Carriers, excipients, diluents and additives may be selected from the group consisting of, but not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0100] When formulating the health functional food of the present invention, it can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0101]

[0102] Hereinafter, the present invention will be described in more detail through examples.

[0103]

[0104] Manufacturing example

[0105] TCP-(MP)-caffeic acid analogs (CD-I-448 (compound 12 below) and 478 (compound 13 below)) and TCP-caffeic acid analogs (CD-I-389 (compound 6 below), CD-I-439 (compound 7 below), CD-I-442 (compound 9 below)) corresponding to the chemical formula 1 compound of the present invention were synthesized using the following scheme.

[0106]

[0107] (A) a) Ac2O, pyridine, room temperature, 24 h; b) EDC·HCl, HOBt·H2O, DIEA, CH2Cl2, from 0°C to room temperature, 12 h; c) LiOH·H2O, THF / MeOH / H2O (3:1:1 v / v), 0°C, 20 min. (B) a) (i) TBDMSCl, DIEA, CH2Cl2, 25°C, 14 h; (ii) K2CO3, THF / H2O (5:1 v / v), room temperature, 2 h; b) TMSCl, Et3N, CH2Cl2, from 0°C to room temperature, 3 h; c) EDC·HCl, HOBt·H2O, DIEA, CH2Cl2, room temperature, 12 h; d) (i) Dess-Martin periodinane, CH2Cl2, 0°C to room temperature, 3 h; (ii) TCP·HCl(3), NaBH(OAc)3, DCE, 0°C to room temperature, 12 h; e) 6N HCl propanol solution, MeOH, 0°C, 3 h

[0108]

[0109] Manufacturing Example 1. Manufacturing of trans-(±)-tranylcypromine-caffeic acid analogue (TCP-CA, 7) and TCP-3,4,5-trimethoxy cinnamic acid derivative (CD-I-442,9)

[0110] Trans-(±)-tranylcypromine-hydrochloride (trans-(±)-TCP-HCl) (3) and caffeic acid (4) were prepared in four steps to produce trans-(±)-tranylcypromine-caffeic acid analogue (TCP-CA, 7) and TCP-3,4,5-trimethoxy cinnamic acid derivative (9).

[0111]

[0112] (1) Step 1: Preparation of (E)-3-(3,4-diacetoxyphenyl)acrylic acid (diacetylated caffeic acid derivative) (5)

[0113]

[0114] To a solution of caffeic acid (4) (10 g, 55.5 mmol) in 4.5 mL of pyridine was added 45 mL of acetic anhydride and stirred at room temperature. After 24 h, 100 mL of ice and cold water were added to the mixture and refrigerated until sufficient solid formation occurred. The resulting white precipitate was filtered, washed four times (40 mL) with ice-cold water, and dried at 50°C to obtain a white solid product (13.1 g, 49.4 mmol) in 94% yield.

[0115] 1 H NMR (DMSO-d6, 400 MHz) δ12.47 (br, 1H), 7.66 (d,J= 1.6 Hz, 1H), 7.65 (d,J= 1.6 Hz, 1H), 7.62 (d,J= 1.6 Hz, 1H), 7.59 (d,J= 16.0 Hz, 1H), 7.32 (d,J= 8.4 Hz, 1H), 6.56 (d,J= 16.0 Hz, 1H), 2.29 (s, 3H), 2.28 (s, 3H).

[0116]

[0117] (2) Step 2: Preparation of 4-((E)-3-oxo-3-(((1S,2R)-2-phenylcyclopropyl)amino)prop-1-en-1-yl)-1,2-phenylene diacetate (diacylated TCP-CA derivative) (6)

[0118]

[0119] To a solution of compound 5 (0.2 g, 0.75 mmol) in 25 mL of anhydrous CH2Cl2, EDC hydrochloride (0.118 g, 0.75 mmol), 1-hydroxybenzotriazole hydrate (0.1 g, 0.75 mmol), DIEA (0.195 g, 1.52 mmol), and tranylcypromine hydrochloride (0.086 g, 0.50 mmol) were added at 0 °C under an argon atmosphere. The resulting solution was stirred at room temperature for 12 h and then poured into ice-EtOAc (4:1 v / v). The organic layer was separated, and the aqueous solution was extracted with EtOAc (25 mL x 3). The organic layers were combined, dried over Na2SO4, and concentrated under reduced pressure. The concentrate was purified by silica gel column chromatography (hexane:EtOAc = 5:1 to 3:1 v / v) to obtain compound 6 (0.25 g, 0.66 mmol) in 89% yield.

[0120] 1 H NMR (CDCl3, 400 MHz)δ7.59 (d,J= 15.6 Hz, 1H), 7.34-7.22 (m, 5H), 7.18 (d,J= 8.4 MHz, 3H), 6.30 (d,J= 15.6 Hz, 1H), 6.14 (br, 1H), 3.03-2.98 (m, 1H), 2.29 (s, 6H), 2.14-2.09 (m, 1H), 1.32-1.20 (m, 2H); 13 C NMR (CDCl3, 100 MHz) δ168.13, 168.11, 166.47, 142.97, 142.34, 140.30, 139.42, 133.76, 128.39, 126.58, 126.20, 126.18, 123.82, 122.35, 121.40, 32.31, 24.98, 20.66, 20.64, 16.22; HRMS-ESI + : C 22 H 21NO5(M+H + ) calculated m / z 380.1498, observed 380.1496.

[0121]

[0122] (3) Step 3: Preparation of (E)-3-(3,4-dihydroxyphenyl)-N-((1S,2R)-2-phenylcyclopropyl)acrylamide (TCP-caffeic acid)(7)

[0123]

[0124] To a solution of compound 6 (0.037 g, 0.10 mmol) in 1.6 mL of THF / MeOH / H2O (3:1:1 v / v) was added lithium hydroxide monohydrate (0.012 g, 0.3 mmol) at 0 °C under argon. After stirring at the same temperature for 20 min, the reaction mixture was poured into ice water (5 mL) and then treated with 5% HCl solution until pH 2 was reached. The aqueous solution was extracted with EtOAc (10 mL x 3). The organic layer was combined, dried over Na2SO4, and purified under reduced pressure to give compound 7 (0.02 g, 0.07 mmol) in 71% yield.

[0125] 1 H NMR (CD3OD, 400 MHz) δ7.42 (d,J= 15.6 Hz, 1H), 7.26-7.21 (m, 2H), 7.15-7.09 (m, 3H), 7.00 (d,J= 2.0 Hz, 1H), 6.91 (dd,J= 2.0 Hz, 1H), 6.76 (d,J= 8.0 Hz, 1H), 6.34 (d,J= 15.6 Hz, 1H), 2.99-2.95 (m, 1H), 2.09-2.04 (m, 1H), 1.28-1.20 (m, 2H); 13C NMR (CD3OD, 100 MHz) δ169.03, 147.44, 145.33, 140.99, 140.86, 127.93, 126.81, 125.80, 125.57, 120.78, 116.52, 115.04, 113.64, 32.16, 24.06, 14.82; HRMS-ESI + : C 18 H 17 NO3(M+H + ) calculated m / z 296.1287, observed 296.1287.

[0126]

[0127] (4) Step 4: Preparation of (E)-N-((1S,2R)-2-phenylcyclopropyl)-3-(3,4,5-trimethoxyphenyl)acrylamido(TCP-3,4,5-trimethoxy cinnamic acid derivative)(9)

[0128]

[0129] Compound 9 was prepared in 84% yield according to the same synthetic process as compound 6.

[0130] 1 H NMR (acetone-d6, 400 MHz) δ 7.62 (br, 1H), 7.48 (d, J = 15.6 Hz, 1H), 7.28-7.25 (m, 2H), 7.19-7.14 (m, 3H), 6.87 (s, 2H), 6.59 (d, J = 15.6 Hz, 1H), 3.85 (s, 6H), 3.74 (s, 3H), 3.08-3.03 (m, 1H), 2.11-2.07 (m, 1H), 1.28-1.21 (m, 2H); 13 C NMR (acetone-d6, 100 MHz) δ 166.00, 165.91, 153.67, 141.49, 139.61, 139.43, 130.81, 128.19, 126.16, 125.69, 120.87, 120.83, 105.04, 59.70, 55.50, 32.69, 32.56, 24.54, 24.52, 15.11, 15.08; HRMS-ESI+ : C 21 H 23 NO4(M+H + ) calculated m / z 354.1705, observed 354.1704.

[0131]

[0132] Manufacturing Example 2. Manufacturing of disilylated TCP-MP-CA derivatives (CD-I-448, 12) and TCP-MP-CA derivatives (CD-I-478, 13) corresponding to chemical formula 1 of the present invention.

[0133] TCP-MP-CA (13) was prepared as an analogue of GSK-2879552 (TCP-MP-BzOH structure) through five steps from trans-(±)-TCP-HCl (TCP-HCl) (3).

[0134]

[0135] (1) Step 1: Preparation of (E)-3-(3,4-bis((tyr-butyldimethylsilyl)oxy)phenyl)acrylic acid (non-silylated caffeic acid derivative)(10)

[0136]

[0137] To a solution of caffeic acid (4) (2 g, 11.10 mmol) in 14 mL of anhydrous CH2Cl2, DIEA (7.89 g, 61.05 mmol) and TBSCl (8.37 g, 55.50 mmol) were added at 0°C under argon. The resulting solution was stirred at room temperature for 14 h and then poured into ice-ether (1:1 v / v). The organic layer was separated, and the aqueous solution was extracted with ether (15 mL x 3). The combined organic layers were dried over Na2SO4 and concentrated under reduced pressure. The concentrate was dissolved in 18 mL of THF / H2O (5:1 v / v) and treated with 1.6 g of K2CO3 at 0°C. The resulting solution was stirred at room temperature for 2 h and then poured into ice-ether (1:1 v / v). The organic layer was separated, and the aqueous solution was extracted with ether (20 mL x 3). The organic layers were collected, dried over Na2SO4, and concentrated under reduced pressure. The concentrate was purified by silica gel column chromatography (hexane:EtOAc = 5:1 to 1:1 v / v) to obtain compound 10 (4.31 g, 10.54 mmol) in 95% yield.

[0138] 1 H NMR (400 MHz, CDCl3)δ7.70 (d,J= 16.0 Hz, 1H), 7.06-7.03 (m, 2H), 6.85 (d,J= 8.8 Hz, 1H), 6.27 (d,J= 16.0 Hz, 1H), 1.00 (d,J= 4.4 Hz, 18H), 0.22 (d,J= 3.2 Hz, 12H).

[0139]

[0140] (2) Step 2: Preparation of perilylated 4-(hydroxymethyl)piperidine (4-HOMP, 9)

[0141] It was prepared in situ by adding trimethylsilyl chloride (TMSCl) in the presence of triethylamine (Et3N).

[0142]

[0143] (3) Step 3: Preparation of (E)-3-(3,4-bis((tyr-butyldimethylsilyl)oxy)phenyl)-1-(4-(hydroxymethyl)piperidin-1-yl)prop-2-en-1-one (disilylated 4-HOMP-CA derivative)(11)

[0144]

[0145] To a solution of 4-piperidinemethanol (9) (0.3 g, 2.60 mmol) dissolved in 4.4 mL of anhydrous CH2Cl2, Et3N (0.29 g, 2.86 mmol) and TMSCl (0.31 g, 2.86 mmol) were added at 0°C under argon, and the resulting solution was stirred for 3 hours. A solution of compound 10 (1.27 g, 3.12 mmol) was added to 14 mL of anhydrous CH2Cl2, and EDC hydrochloride (0.52 g, 3.38 mmol), 1-hydroxybenzotriazole hydrate (0.45 g, 3.38 mmol), and DIEA (0.87 g, 1.52 mmol) were slowly added to the reaction mixture at 0°C over 1 min. The resulting solution was stirred at room temperature for 12 h and then poured into ice-ether (4:1 v / v). The organic layer was separated, and the aqueous solution was extracted with ether (20 mL x 3). The organic layers were combined, dried over Na2SO4, and concentrated under reduced pressure. The concentrate was purified by silica gel column chromatography (hexane:EtOAc = 1:1 to 1:10 v / v) to obtain compound 11 (0.91 g, 1.78 mmol) in 68% yield.

[0146] 1H NMR (CDCl3, 400 MHz) δ7.54 (d,J= 15.6 Hz, 1H), 7.04 (dd,J= 2.4 Hz, 8.4 Hz, 1H), 6.96 (d,J= 2.4 Hz, 1H), 6.81 (d,J= 8.0 Hz, 1H), 6.71 (d,J= 15.6 Hz, 1H), 4.73 (br, 1H), 4.12 (br, 1H), 3.53 (d,J= 6.0 Hz, 2H), 3.07 (br, 1H), 2.70 (br, 1H), 1.85-1.74 (m, 2H), 1.50 (br, 2H), 1.27 (qd,J= 4.0 Hz, 12.0 Hz, 2H), 0.98 (d,J= 3.2 Hz, 18H), 0.20 (d,J= 2.8 Hz, 12H); 13 C NMR (CDCl3, 100 MHz) δ206.98, 165.73, 148.55, 147.00, 142.37, 129.05, 121.16, 120.93, 120.90, 115.29, 67.39, 38.94, 30.94, 25.92, 25.88, 18.48, 18.45, -0.01, -4.08, -4.10; HRMS-ESI + : C 27 H 47 NO4Si2(M+H + ) calculated m / z 506.3122, observed 506.3116

[0147]

[0148] (4) Step 4: Preparation of (E)-3-(3,4-bis((tyr-butyldimethylsilyl)oxy)phenyl)-1-(4-(((1R,2S)-2-phenylcyclopropyl)amino)methyl)piperiden-1-yl)prop-2-en-1-one (disilylated TCP-MP-CA derivative)(12)

[0149]

[0150] To a solution of compound 11 (0.91 g, 1.78 mmol) was added 12 mL of anhydrous CH2Cl2, and Dess-Martin periodinane (0.43 g, 1.02 mmol) was added at 0°C under argon. The resulting solution was stirred at room temperature for 3 h and then poured into ice water (25 mL). The resulting aqueous solution was extracted with ether (15 mL x 3), washed with saturated aqueous NaHCO3 (10 mL) and saturated aqueous Na2S2O3 (10 mL), and dried over Na2SO4. The excess Na2SO4 was filtered, and the filtrate was concentrated under reduced pressure. The concentrate was dissolved in 6.5 mL of anhydrous DCE and treated with tranylcypromine hydrochloride (0.6 g, 3.56 mmol) and sodium triacetoxyborohydride (1.5 g, 7.12 mmol) at 0°C. The reaction solution was stirred at room temperature for 12 h and then poured into ice-ether (1:1 v / v). The organic layer was separated and washed with saturated NaHCO3 (10 mL). The organic layer was dried over Na2SO4 and concentrated under reduced pressure. The concentrate was collected and purified by silica gel column chromatography (CH2Cl2:CH3OH = 70:1 to 10:1 v / v) to give compound 12 (0.57 g, 0.92 mmol) in 52% yield.

[0151] 1H NMR (400 MHz, CDCl3)δ7.54 (d,J= 15.2 Hz, 1H), 7.26 (t,J= 7.2 Hz, 2H), 7.16 (t,J= 7.2 Hz, 1H), 7.04 (dd,J= 1.6, 8.4 Hz, 2H), 6.96 (d,J= 2.0 Hz, 1H), 6.81 (d,J= 8.4 Hz, 1H), 6.71 (d,J= 15.2 Hz, 1H), 4.71 (br, 1H), 4.09 (br, 1H), 3.08 (br, 1H), 2.65 (d,J= 6.8 Hz, 3H), 2.35-2.31 (m, 1H), 1.92-1.97 (m, 1H), 1.81-1.72 (m, 3H), 1.25 (s, 1H), 1.23 (qd, J = 4.0, 12.4 Hz, 2H), 1.09-1.05 (m, 1H), 0.99 (d,J= 3.6 Hz, 18H), 0.20 (d,J= 2.0 Hz, 12H); 13 C NMR (acetone-d6, 100 MHz)δ164.57, 163.59, 163.53, 148.14, 146.87, 141.27, 141.15, 140.44, 129,73, 128.40, 128.15, 126.57, 126.11, 125.89, 121.32, 121.30, 121.23, 121.21, 120.89, 120.84, 116.51, 116.40, 52.69, 48.91, 45.19, 41.66, 38.96, 35.26, 35.07, 34.39, 25.45, 25.42, 23.99, 18.21, 18.17, 15.04; HRMS-ESI + : C 36 H 57 N2O3Si2(M+H + )에 대한 m / z 계산치 621.3908, 실측치 621.3893.

[0152]

[0153] (5) Step 5: Preparation of (E)-3-(3,4-dihydroxyphenyl)-1-(4-(((1R,2S)-2-phenylcyclopropyl)amino)methyl)piperidin-1-yl)propy-2-en-1-one (TCP-MP-CA derivative) (13)

[0154]

[0155] Compound 12 was dissolved in 5 mL of MeOH and treated with 2 mL of 6N HCl propanol solution at 0°C. The reaction mixture was stirred at 0°C for 1 h and then concentrated under reduced pressure. The concentrate was purified by silica gel column chromatography (CH2Cl2:CH3OH = 10:1 v / v) to obtain compound 13 (0.03 g, 0.07 mmol) in 47% yield.

[0156] 1 H NMR (400 MHz, CD3OD) δ7.47 (d,J= 15.2 Hz), 7.32 (t,J= 7.2 Hz, 2H), 7.24 (t,J= 7.2 Hz, 1H), 7.19 (d,J= 6.8 Hz, 2H), 7.05 (d,J= 2.0 Hz, 1H), 6.98 (dd,J= 2.0, 8.0 Hz, 1H), 6.90 (d,J= 15.2 Hz, 1H), 6.78 (d,J= 8.0 Hz, 1H), 4.67 (br, 1H), 4.33 (br, 1H), 3.20-3.17 (m, 1H), 31.15 (d,J= 6.8 Hz, 2H), 3.02-2.98 (m, 1H), 2.77 (br, 1H), 2.57-2.52 (m, 1H), 2.11 (m, 1H), 1.91 (m, 2H), 1.59-1.53 ​​(m, 1H), 1.42-1.36 (m, 1H), 1.29 (br, 2H); 13C NMR (CD3OD, 100 MHz) δ166.81, 147.53, 145.30, 143.67, 137.91, 128.35, 127.06, 126.63, 126.02, 120.87, 115.05, 113.94, 113.08, 53.40, 52.88, 45.09, 41.61, 38.30, 33.35, 30.01, 29.02, 21.06, 12.05; HRMS-ESI + : C 24 H 29 N2O3(M+H + ) calculated m / z 393.2178, observed 393.2180.

[0157]

[0158] Experimental example

[0159] 1. Method

[0160] 1.1. Materials and Reagents

[0161] GSK-LSD1 Dihydrochloride (PubChem CID: 91663353, molecular formula: C 14 H 22Cl2N2, molecular weight: 289.24) was purchased from MedChemExpress and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich). Fetal bovine serum (FBS) and alpha modification of Eagle's minimum essential medium (α-MEM) were purchased from Thermo Fisher Scientific. Mouse M-CSF and RANKL were purchased from PeproTech. Anti-β-actin (A5441) from Sigma-Aldrich; anti-cathepsin K (sc-48353), anti-cbl (sc-1651) from Santa Cruz Biotechnology; Anti-K48-linked specific polyubiquitin (8081s), anti-c-fos (4384s), anti-NFATc1 (8032s), and secondary antibodies (7074s and 7076s) were purchased from Cell Signaling Technology. Anti-methyl-lysine (nb500-824) was purchased from Novus, and anti-p-LSD1 (ABE1462) was purchased from Merck Millipore. The ECL system (RPN2106) for chemiluminescent signal detection was purchased from iNtRON. The tartrate-resistant acid phosphatase staining kit was purchased from CosmoBio.

[0162]

[0163] 1.2. Isolation and culture of bone marrow-derived macrophages

[0164] Bone marrow cells (BMCs) from 8-week-old C57 / BL6 female mice were isolated by rinsing or washing the femurs and tibias with α-MEM. BMCs were then cultured in α-MEM containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin at 37°C in a 5% CO2 incubator for 24–36 h. Supernatant cells were collected and cultured for 3 days with 30 ng / mL M-CSF. Adherent cells were then collected and used as BMDM for osteoclast induction. All animal experiments were approved by the Chonnam National University IACUC (Approval Number: CNU IACUC-YB-2022-123).

[0165]

[0166] 1.3. Osteoclast formation (in vitro), TRAP staining, and cell viability analysis

[0167] To establish a cellular analysis model for osteoclast formation, adherent cells (BMDM) were harvested and cultured in α-MEM containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, 30 ng / mL M-CSF, and 50 ng / mL RANKL with or without TCP-(MP)-caffeic acid analogs for approximately 4 days. When the positive group formed mature osteoclasts, all osteoclasts were fixed using 4% formalin for approximately 20 min. After washing once with PBS, the cells were stained using a TRAP staining kit. The spread osteoclast area was visualized using a microscope and calculated using ImageJ. BMDM (1 × 10 4 The viability of the cells (10 cells / well) was assessed in 96-well plates using a cell viability assay kit as previously described.

[0168]

[0169] 1.4. Bone formation and ALP (Alkaline Phosphatase) staining analysis

[0170] Primary osteoblasts were isolated from the calvarias of 3-4-day-old mice. Cells were cultured in α-MEM containing 10% FBS and 1% penicillin-streptomycin solution with or without a TCP-(MP)-caffeic acid analog in the presence of BMP2 (100 ng / mL) for 9 days at 37°C in a 5% CO2 incubator, with the medium changed every other day. Cells were washed with PBS; then fixed with 70% ice-cold ethanol for 1 h and rinsed twice with double-distilled H2O. Cells were then stained with the BCIP® / NBT Liquid Substrate System according to the manufacturer's instructions at room temperature for 5-15 min. Images were captured under a microscope or scanned directly. The intensity of ALP positivity was calculated using Image J.

[0171]

[0172] 1.5. Bone resorption and F-actin belt staining analysis

[0173] Bone resorption analysis was performed as previously described. 2 × 10 4Dog cells / well BMDM were cultured in coated 48-well plates (CSR-BRA-48X2KIT) provided in the kit. They were then cultured with or without the indicated doses of CD-I-448 and CD-I-478 until mature osteoclasts were observed. 100 μL of supernatant from each well was collected into a black polypropylene 96-well microplate, and fluorescence intensity was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm using a SpectraMax i3x fluorescence plate reader. Resorbed pit areas were visualized under a microscope and calculated by ImageJ. For F-actin ring analysis, belts were visually identified using a rhodamine-conjugated phalloidin staining kit (abcam) as previously described.

[0174]

[0175] 1.6. RNA isolation and quantitative real-time PCR

[0176] Total RNA was extracted from cells using TRIzol reagent. RNA concentration was quantified and reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara). The cDNA was then used for real-time PCR amplification using Power SYBR Green PCR Master Mix. The mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene was used as a reference gene.

[0177] The primers used are as shown in Table 1 below.

[0178]

[0179] Gene name Primer sequence (5' → 3')Acp5ForwardCAGCTGTCCTGGCTCAAAA (SEQ ID NO: 1)ReverseACATAGCCCACACCGTTCTC (SEQ ID NO: 2)Nfatc1ForwardACCACCTTTCCGCAACCA (SEQ ID NO: 3)ReverseGGTACTGGCTTCTCTTCCGTTTC (SEQ ID NO: 4)Dc-stampForwardCGCACGATGCTTCATTCTTC (SEQ ID NO: 5)ReverseCAGTGCCAGCCGCAATC (SEQ ID NO: 6)Atp6v0d2ForwardACTATGGCCACCCGGGAAT (SEQ ID NO: 7)ReverseGGCCCAAGGGAGTCATGTG (SEQ ID NO: 8)OscarForwardTGGCGGTTTGCACTCTTCA (SEQ ID NO: 9)ReverseGGAAGAACTCAGCCAGCTCA (SEQ ID NO: 10)Cathepsin kForwardGGACGCAGCGATGCTAACTAA (SEQ ID NO: 11) ReverseCAGAGAGAAGGGAA (SEQ ID NO: 12) GapdhForwardTGTGTCCGTCGTGGATCTGA (SEQ ID NO: 13) ReverseGATGCCTGCTTCACCACCTT (SEQ ID NO: 14)

[0180] 1.7. Western Blot Analysis

[0181] Total protein was extracted from osteoclasts treated or not with CD-I-448 using cold RIPA buffer on ice for 30 min. Protein concentration was quantified using a gold BCA protein assay kit, and proteins were loaded and separated using 8% or 12% SDS-PAGE. They were then transferred to polyvinylidene fluoride (PVDF) membranes. Next, the PVDF membranes were blocked with 5% skim milk for 1 h, excised based on the molecular weight of the target protein, and incubated overnight with primary antibodies diluted 1:2,000. The membranes were washed with 1 × TBST and reacted with secondary antibodies diluted 1:2,000 for 2 h at room temperature (RT). Finally, the membranes were washed and developed using Super Plus chemiluminescence (ECL) buffer for exposure and imaging.

[0182]

[0183] 1.8. LSD1 activity analysis

[0184] The effects of TCP-(MP)-caffeic acid analogs on LSD1 activity were assayed using the LSD1 Inhibitor Screening Kit according to the manufacturer's instructions (Caymanchem, Michigan, USA). First, mixture samples, assay buffer, LSD1 human recombinant assay reagent, LSD1 assay fluorometric substrate, LSD1 assay horseradish peroxidase, and LSD1 assay peptide were added to a 96-well plate (black). Background wells did not contain LSD1 assay peptide, and the LSD1 assay peptide group used as the initial activity and the inhibitor were not added. The inhibitor activity group refers to wells to which various types or concentrations of TCP-(MP)-caffeic acid analogs were added. Fluorescence was measured at an excitation wavelength of 530–540 nm and an emission wavelength of 585–595 nm using a SpectraMax i3x multimode microplate detection platform (Molecular Devices, Silicon Valley, CA, USA), and the inhibition rate was calculated (inhibition (%) = [(initial activity - inhibitor activity) / initial activity] x 100).

[0185]

[0186] 1.9. OVX-induced osteoclast bone loss mouse model

[0187] A specific pathogen-free facility was used to grow C57BL / 6 mice. To determine the effects of GSK-LSD1 and CD-I-448 in vivo, an OVX-induced osteoporosis mouse model was established as previously described. Seven-week-old C57BL / 6 female mice were divided into two groups. One group consisted of the control group (Sham), OVX, and CD-I-448 (5 mg / kg) and (10 mg / kg), while the other group consisted of the control group (Sham), OVX, and GSK-LSD1 (10 mg / kg).

[0188] Among them, mice in the OVX, CD-I-448, and GSK-LSD1 groups underwent OVX surgery. The control group underwent abdominal incision. After a 1-week recovery period, the CD-I-448 and GSK-LSD1 groups received intraperitoneal injections of 5 or 10 mg / kg dissolved in a mixture of 10% Tween 80 and 10% DMSO. Mice in the Sham and OVX groups received daily intraperitoneal injections of the same volume of a mixture of 10% Tween 80 and 10% DMSO. The injection volume was 200 μL per mouse, and the experiment was conducted for 4 weeks. The body weights of the mice were measured weekly. On the last day of the experiment, the mice were euthanized, and the femurs were separated, fixed in 4.0% paraformaldehyde, and then used for micro-computed tomography (micro-CT) analysis.

[0189]

[0190] 1.10. Stability of CD-I-448 in the plasma of SD mice

[0191] To investigate the stability and metabolites of CD-I-448 in mouse plasma, chromatographic analysis of this drug was performed using mass spectrometry (MASS) in the presence of mouse plasma at various time points (0.5, 2, 6, and 24 hours), and the resulting chromatograms were compared with chromatograms obtained from plasma after intravenous administration of CD-I-448 to mice. In addition, to investigate the correlation between CD-I-448 and CD-I-478, which is considered a metabolite of CD-I-448, the chromatograms were compared with those of CD-I-478 to investigate the relationship.

[0192]

[0193] 1.11. In vivo experiments for stability testing

[0194] Sprague-Dawley mice (male, 6-7 weeks old, weighing 200-230 g) were purchased from Orient Bio (Seongnam, South Korea). All animal experiments were approved by the Kmedihub Animal Care and Use Committee and conducted in accordance with the Kmedihub guidelines for the welfare and ethics of laboratory animals. Chromatographic analysis of plasma samples for CD-I-448 was performed by LC-MS / MS at the Kmedihub Preclinical Research Center. Chromatograms collected at different time points were analyzed by scanning LC-MS / MS using an Agilent 6400 triple quadrupole instrument (Agilent Technologies, Waldbronn, Germany). The mobile phase was acetonitrile:water (80:20) containing ammonium formate, and the flow rate was set at 0.2 ml / min. The column effluent was monitored by a mass spectrometer equipped with ESI in positive ion mode.

[0195]

[0196] 1.12. Isothermal titration calorimetry (ITC) analysis

[0197] ITC experiments were performed using a NanoITC (TA Instruments, New Castle, DE, USA). LSD1 / CoREST was concentrated to 50 μM in a buffer containing 20 mM HEPES, 100 mM NaCl, and 0.5 mM TCEP, and CD-I-478 was dissolved in the same buffer to minimize the heat of dilution. 500 μM CD-I-478 in 1% DMSO was injected at 2 μL intervals (200 s between injections) into the cell containing 50 μM LSD1 / CoREST in 1% DMSO at 200°C using a rotating syringe at 250 rpm. Binding isotherms were analyzed using the NanoAnalyze software provided by TA Instruments. Baseline controls were obtained in buffer, and CD-I-478 solutions were measured in the same buffer. Fitting was performed using a single-site independent binding model.

[0198]

[0199] 1.13. Crystallization and structural determination

[0200] The purified protein was dissolved in a buffer consisting of 20 mM Tris-HCl (pH 7.5), 200 mM NaCl and 10 mM mercaptoethanol for crystallization at a concentration of 8 mg / mL. -1 The concentration of the purified LSD1 / CoREST protein complex was determined using absorbance measurements at 280 nm and the theoretical extinction coefficient at 280 nm. The purified LSD1 / CoREST was crystallized using the hanging-drop vapor-diffusion method in VDX plates (Hampton Research). 8 mg / mL -1A protein solution (1 μL) of a concentration of 100 K was mixed with an equal volume of reservoir solution at 295 K. The best crystals grew in the presence of 32–38% (v / v) Taximate (pH 7.0). For data collection, single crystals were cryoprotected in reservoir solution supplemented with 15% (v / v) ethylene glycol and flash-frozen directly in a 100 K nitrogen stream using a nylon loop. An X-ray diffraction data set consisting of 180 frames was collected at beamline 11C of the Pohang Light Source Ⅲ (PLS Ⅲ) of the Pohang Accelerator Laboratory (PAL, Pohang, Republic of Korea) using a Pilatus 6M detector at a wavelength of 0.9793 Å and a 1° oscillation. Data were indexed and scaled with the HKL-2000 software package. The structure was determined at a resolution of 3.5 Å using the molecular replacement method in the PHENIX package, using the human LSD1 / CoREST complex (PDB ID 6K3E) as a search model. One copy of the LSD1 and CoREST complexes in the asymmetric unit was identified, refined using the PHENIX package, and then manually rebuilt. The final model was obtained at a resolution of 3.0 Å after iterative manual model building and refinement using the Coot17 and PHENIX packages, respectively. Molecular model figures were generated using the PyMol molecular graphics program (Schrφdinger, LLC).

[0201]

[0202] 1.14. Micro CT scanning

[0203] Micro-CT scanning was performed using the Quantum GX Micro-CT imaging system at the Korea Basic Science Institute (Gwangju, Korea).

[0204]

[0205] 1.15. Statistical Analysis

[0206] Unpaired Student's t-test was used to compare differences between two groups. One-way analysis of variance (ANOVA) and Dunnett's multiple comparison test were used to compare differences between multiple groups using GraphPad Prism 8.3.0. (*p<0.05; **p<0.01; ***p<0.001; NS, not significant). All error analyses are expressed as mean ± standard deviation.

[0207]

[0208] 2. Results

[0209] 2.1. [Chemical Formula 1] Inhibitory effect of CD-I-448 and 478 on osteoclast formation (in vitro)

[0210] CD-I-389 (6), CD-I-439 (7), CD-I-442 (9), CD-I-448 (12), CD-I-478 (13)). The inhibitory effect of the compounds on osteoclastogenesis was evaluated using 1 μM. The results confirmed that among the compounds, CD-I-389, 448, and 478 significantly inhibited osteoclast differentiation (Fig. 2a and b). Next, the inhibition of LSD1 enzyme activity using the compounds was analyzed, and it was confirmed that CD-I-448 and CD-I-478 showed significant inhibition of LSD1 demethylation activity in a dose-dependent manner in vitro (Fig. 2c). GSK-LSD1, a commonly known LSD1 demethylation inhibitor, was used as a control (Fig. 2c). We confirmed a significant inhibition of LSD1 demethylation (in vitro), and the effects of the compounds on LSD1-related methylation during osteoclast differentiation were examined using an LSD1 activity kit. As shown in Fig. 2d and e, the protein methylation level increased in a dose-dependent manner during osteoclast differentiation (48 h treatment), confirming that CD-I-448 and CD-I-478 treatment inhibited osteoclast differentiation and decreased LSD1 enzyme activity, thereby increasing methylation during osteoclast formation. Finally, a bone formation assay was also performed, and the results showed that CD-I-448 could be selected as a lead compound because it did not show significant inhibition of bone formation at 2 μM treatment in vitro (Fig. 2f and g). However, bone formation was reduced when treated with high doses (more than 2 μM). This confirmed that the compound [chemical formula 1] inhibited osteoclast formation.

[0211]

[0212] 2.2. [Chemical Formula 1] Inhibitory effects of CD-I-448 on RANKL-induced osteoclast differentiation, F-actin belt formation, and bone resorption (in vitro)

[0213] To further investigate the inhibitory effect of CD-I-448 on osteoclast formation, TRAP staining (a specific characteristic of osteoclasts) analysis was adopted to confirm the inhibitory effect of CD-I-448 on RANKL-induced osteoclast formation in the indicated concentration range (Fig. 3a to d). As shown in Fig. 3a to h, the differentiation of BMDMs was significantly inhibited by CD-I-448. In addition, rhodamine-labeled phalloidin was used to mark the formed F-actin belts of mature osteoclasts. As shown in Fig. 4a and b, the control group (CTRL) had well-formed rings, whereas CD-I-448 inhibited F-actin ring formation at 1 μM CD-I-448. Bone resorption is an important function of osteoclasts in the bone remodeling process. Therefore, the osteoclast bone resorption inhibition ability of CD-I-448 was assayed in vitro using a fluoresceinamine-labeled calcium phosphate plate. As shown in Fig. 3 e to g, obvious bone resorption pits were observed in the group treated with M-CSF and RANKL (MR group); the resorption pit area was significantly reduced by CD-I-448 treatment (1, 2, and 4 μM). In addition, Fig. 3 f and g confirmed that CD-I-448 dose-dependently reduced fluorescence intensity and pit area formation (GSK-LSD1(G) was used as a control inhibitor). In addition, CD-I-478 significantly inhibited osteoclast bone resorption in vitro (Fig. 5 a and b). Finally, CD-I-448 did not significantly affect cell viability of BMDMs at concentrations below 10 μM, whereas it completely blocked the formation of multinucleated mature osteoclasts when treated at 4 μM (Fig. 3 a and b). This indicates that CD-I-448 dose-dependently inhibits RANKL-mediated osteoclast formation.Based on these results, we confirmed that CD-I-448 can significantly inhibit RANKL-mediated osteoclast differentiation and osteoclast-related bone resorption activity by reducing osteoclast formation. In other words, the compound [chemical formula 1] was confirmed to inhibit RANKL-induced osteoclast differentiation, F-actin belt formation, and bone resorption.

[0214]

[0215] 2.3. [Chemical Formula 1] Inhibitory effect on bone loss by OVX-induced osteoclasts after treatment with CD-I-448 corresponding to the compound (In vivo).

[0216] To confirm the therapeutic strategy of CD-I-448 for osteoclastic bone resorption disease, an OVX-induced osteoporosis mouse model (Fig. 6a to c) was established (in vivo). The body weights of each group were recorded weekly (Fig. 6d). Micro-computed tomography (micro-CT) analysis of the region of interest in the femur showed that OVX mice had extensive loss of trabecular bone mass, whereas the CD-I-448-treated group showed a significant decrease, as shown in Fig. 6a to c. In addition, trabecular volume, bone surface density, and total bone volume were more strongly recovered after CD-I-448 treatment than in the OVX group at 5 mg / kg or 10 mg / kg (Fig. 6a to c). Histological analysis using TRAP or H&E staining (Fig. 6e and f) showed that osteoclast-mediated bone loss was significantly increased after OVX, whereas it was reduced after 5 mg / kg or 10 mg / kg treatment. These results confirmed that CD-I-448, unlike GSK-LSD1, prevented OVX-induced bone loss in vivo. In other words, the compound [chemical formula 1] was confirmed to inhibit OVX-induced osteoclast-mediated bone loss.

[0217]

[0218] 2.4. Effect of TCP-(MP)-caffeic acid analogs on LSD1 demethylase activity reduction

[0219] The present data confirmed that TCP-(MP)-caffeic acid analogs CD-I-448 and CD-I-478 dose-dependently inhibited LSD1 demethylation (in vitro, ex vivo). In addition, CoREST (RCOR1) was important for LSD1 to perform demethylation activity. To confirm that TCP-(MP)-caffeic acid analogs inhibit LSD1 demethylase activity through the FAD-associated LSD1 / CoREST complex, LSD1 / CoREST complex proteins were prepared (Fig. 7 and Table 2), and SPR and DSF analyses of TCP-(MP)-caffeic acid analogs (CD-I-448 and CD-I-478) containing the LSD1 / CoREST complex were performed (Figs. 8a and b, 9a to 9f).

[0220]

[0221] Data values ​​LSD1 / CoREST / CD-1-478 Space group I222 Unit cell dimensions a, b, c (Å), α, β, γ (°) 120.3, 181.3, 235.9 90, 90, 90 Wavelength (Å) 0.979 30 Resolution (Å) 50-3.0 (3.05-3.0) R pim (%)8.4 (131.9)I / σ(I)3.9 (0.44)Completeness (%)98.6 (99.2)Redundancy6.1 (5.0)RefinementResolution (Å)50-3.0 (3.07-3.0)No. of reflections50543R work / R free(%)20.3 (41.7) / 22.4 (41.3)No. of atomsProtein / Non-protein6287 / 62RMSDbond length (Å) / angle (°)0.003 / 0.593Average B-value (Å) 2 )100.4Ramachandran plot (%)favored / allowed / outliers96.6 / 3.3 / 0.1(Values ​​in parentheses are for the highest resolution shell. 4% of randomly selected reflections were used to compute the Rfree value.)

[0222] As shown in Figures 8a and b, the results confirmed that both CD-I-448 and CD-I-478 directly bind to the LSD1 / CoREST complex. Furthermore, because we found that CD-I-448 would soon be converted to and function as CD-I-478 (Figures 10a to d), CD-I-478 was selected for isothermal calorimetric titration (ICT) analysis and crystal structure analysis using LSD1 / CoREST (Figures 8c to f). The ICT curves of 50 μM LSD1-CoREST and 500 μM CD-I-478 at 20°C are shown in Figure 8c. The upper panel shows the raw ITC data. The lower panel shows the integrated heat per injection (solid circles) corrected for background plotted for the injection of CD-I-478 into LSD1 / CoREST. The solid line represents stoichiometry 1.1, molar enthalpy change (ΔH) -20.44 kJmol-1, and binding affinity (Kd) 2.331×10 -7This is a goodness-of-fit for a single-site independent binding model that yielded M (Fig. 8c). For crystal structure analysis, the complex crystal structure of LSD1 / CoREST containing CD-I-478 was determined by immersing apo-crystals in a reservoir solution supplemented with CD-I-478. The solved structure shows an adduct that is continuous with the flavin ring of flavin adenine dinucleotide but does not allow for the full chemical composition of CD-I-478 (Fig. 8d). Instead, the adduct may be a portion slightly larger than the phenyl ring that is part of CD-I-478. Because no extra bulky electron density is observed for the full chemical composition in the refined structure, it appears that the highly active cyclopropyl ring of the inhibitor opens to form an extra five-membered ring with the flavin ring atoms of FAD. Covalent bond formation with the N5 atom of this type of flavin ring has been reported in several LSD1 inhibitors (Fig. 8e).

[0223]

[0224] 2.5. [Chemical Formula 1] Inhibitory effect of CD-I-448 corresponding to the compound on the expression of genes and proteins related to osteoclast differentiation.

[0225] The above data indicate that CD-I-448 inhibited osteoclast differentiation and bone resorption, and that CD-I-448 interacted with the LSD1 / CoREST complex and reduced LSD1 demethylation activity in vitro. Therefore, to understand the mechanism by which CD-I-448 inhibits osteoclast formation and function, we analyzed the expression of osteoclast-specific genes and proteins required for osteoclast formation and differentiation. As shown in Figures 11a to 11f, stimulation with M-CSF and RANKL (Con) significantly induced the transcription of the indicated osteoclast-specific genes (black bars), whereas CD-I-448 treatment clearly reduced the relative mRNA expression levels of RANKL-induced osteoclastogenesis-related genes, including Acp5, Nfatc1, Dc-stamp, Atp6v0d2, Mmp9, and Ctsk (gray bars). Western blot analysis of RANKL-induced osteoclast proteins revealed that the protein levels of NFATc1, c-fos, and the major resorption protease CtsK were decreased after incubation with CD-I-448 compared with the M-CSF and RANKL (Con) group (Fig. 11g). Collectively, these results indicate that CD-I-448 inhibits osteoclast differentiation by blocking the expression of RANKL-mediated osteoclast differentiation-inducing genes and proteins.

[0226]

[0227]

[0228] 2.6. CBL protein stabilization effect of CD-I-448 corresponding to the compound of [chemical formula 1].

[0229] We confirmed that CD-I-448 inhibited osteoclastogenesis (in vitro) and osteoclast bone loss (in vivo) (Figs. 3a to h, 4a and b). Furthermore, CD-I-448 directly targeted the LSD1 / CoREST complex to reduce its demethylation activity during osteoclastogenesis (Figs. 8a to f, 2c and d). To investigate the mechanism by which CD-I-448-mediated inhibition of LSD1 demethylation activity blocks osteoclastogenesis, we analyzed the expression of osteoclast-dependent genes and proteins. We found that NFATc1 mRNA expression was slightly decreased for 4 days after CD-I-448 treatment (Fig. 11b). However, dramatically reduced NFATc1 protein levels were observed on days 2 and 4 (Fig. 11g). This finding led us to analyze whether CD-I-448 is involved in regulating NFATc1 degradation. The results showed that the expression of NFATc1 was significantly reduced after CD-I-448 treatment, whereas it was rapidly accumulated 6 hours after MG132 (10 uM) treatment. Therefore, we analyzed the expression of CBL protein during osteoclastogenesis according to the presence or absence of CD-I-448 treatment, and confirmed that osteoclast differentiation was inhibited after CD-I-448 treatment through the corresponding CtsK expression (Fig. 12b). We confirmed that RANKL treatment significantly induced CBL protein expression, whereas the protein level decreased after osteoclast differentiation. However, after CD-I-448 treatment, the rate of decrease of CBL protein after osteoclast differentiation was clearly delayed, which confirmed that CD-I-448-mediated inhibition of osteoclastogenesis may be due to the delayed decrease of CBL protein, which was consistent with the increased NFATc1 protein degradation compared to the control group (Con group).

[0230] To investigate whether the delayed decrease in CBL protein during osteoclastogenesis after CD-I-448 treatment was mediated by an increase in CBL lysine methylation, we analyzed all methyl lysines in the protein during osteoclastogenesis. As shown in Figure 12b, methyl lysine levels clearly increased after CD-I-448 treatment. Meanwhile, p-LSD1 expression was not changed and even showed a slight increase (which was not significant). To further confirm whether the inhibition of LSD1 demethylation activity by TCP-(MP)-caffeic acid analog treatment mediates CBL protein lysine methylation to stabilize CBL protein, we performed a co-IP assay. As shown in Figure 12c, lysine methylation of CBL during osteoclastogenesis increased after TCP-(MP)-caffeic acid analog treatment compared to the control group (Con group), and GSK-LSD1 (a popular LSD1 inhibitor) was used as a control. In addition, the interaction between p-LSD1 and CBL was reduced (converted CO-IP analysis is shown in a and b of Fig. 13). In addition, the interaction between CBL and NFATc1 protein increased with the treatment of TCP-(MP)-caffeic acid analogue. In relation to the injected CBL protein, it was confirmed that only the interaction between p-LSD1 and CBL was disrupted after the treatment of TCP-(MP)-caffeic acid analogue, which meant that CD-I-448 treatment disrupted the interaction between p-LSD1 and CBL protein, increased the lysine methylation of CBL protein, stabilized CBL protein, and then the increased CBL protein increased the degradation of NFATc1 protein, contributing to the inhibition of osteoclastogenesis.

[0231]

[0232] 2.7. [Chemical Formula 1] Induction of ubiquitination of lysine 48 of NFATc1 protein by CD-I-448 corresponding to the compound and inhibition of osteoclast formation through this effect

[0233] CBL protein is an E3 ligase that mediates protein degradation through lysine 48-linked ubiquitination. Therefore, we analyzed the levels of lysine 48-linked ubiquitination of NFATc1 in the presence or absence of CD-I-448 treatment (Fig. 12d). GSK-LSD1 was used as a control inhibitor for LSD1 inhibition.

[0234] As a result, lysine 48 ubiquitination of NFATc1 was significantly increased after treatment with TCP-(MP)-caffeic acid analogues compared to the control group (Con group), confirming that CD-I-448 inhibits osteoclastogenesis induced by RANKL by increasing the degradation of NFATc1 protein through lysine 48 ubiquitination.

Claims

1. A compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] (In the formula, R is hydrogen or t-butyldimethylsilyl).

2. A pharmaceutical composition for preventing or treating bone disease, comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] (In the formula, R is hydrogen or t-butyldimethylsilyl).

3. A pharmaceutical composition for preventing or treating bone disease, wherein the bone disease in claim 2 is any one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur.

4. A health functional food for improving bone health comprising a compound represented by the following chemical formula 1 or a food-based acceptable salt thereof: [Chemical Formula 1] (In the formula, R is hydrogen or t-butyldimethylsilyl).

Images