Chimeric antigen receptor, microglia expressing chimeric antigen receptor and use thereof

Abstract

A chimeric antigen receptor, a microglia expressing the chimeric antigen receptor, and the use thereof. The chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain and a costimulatory signaling domain, wherein the antigen binding domain is a single-chain antibody against tumor surface antigen disialoganglioside (GD2), the transmembrane domain is a CD8α transmembrane domain, and the costimulatory signaling domain is a combination of a CD86 signaling domain and an FcγR1 signaling domain. The microglia expressing the chimeric antigen receptor against the GD2 antigen can accurately kill tumor cells and survive for a long period of time, and is expected to be used for treating tumors expressing the GD2 antigen, and alleviating the pain of patients. The microglia differentiated from a human pluripotent stem cell and expressing the chimeric antigen receptor has no immunogenicity when being used in the treatment of human, and has no immunological rejection.

Description

Chimeric antigen receptor, microglial cells expressing chimeric antigen receptor and their applications Technical Field

[0001] The present invention relates to a chimeric antigen receptor, in particular to a chimeric antigen receptor, microglial cells expressing the chimeric antigen receptor and applications thereof. Background Art

[0002] Chimeric antigen receptors (CARs) are composed of the antigen-binding portion of an antibody that recognizes tumor-specific antigens, along with a transmembrane domain and an intracellular domain. CARs are primarily composed of three functional domains: the extracellular domain, the transmembrane domain, and the intracellular domain. The extracellular domain consists of a single-chain variable fragment (scFv) of a monoclonal antibody that recognizes and binds to the antigen, and a connecting hinge region. The intracellular domain is composed of a costimulatory domain and a signaling domain.

[0003] Through gene transduction, CAR gene sequences are transfected into immune cells, such as T cells and NK cells, causing them to express CAR, thereby enhancing the function of the patient's immune cells and generating a large number of tumor antigen-specific CAR cells. These CAR immune cells are infused into the patient's body, and the chimeric antigen receptor can specifically track, identify, and guide the immune cells to kill tumor cells. CAR-immune cell therapy, a relatively new cell therapy approach in recent years, has achieved many breakthroughs in the field of cancer treatment. In particular, chimeric antigen receptor T cell (CAR-T) immunotherapy has shown significant therapeutic effects in hematologic tumors such as B cells, capable of specific, efficient, and sustained attack on tumor cells. However, this therapy is affected by factors such as the tumor microenvironment and T cell exhaustion. The application of CAR-T therapy in the field of solid tumors is still under exploration, and its application and development in solid tumors is a bottleneck.

[0004] Gliomas are solid tumors originating from brain glial cells and are the most common primary intracranial tumors. Their 5-year mortality rate is second only to pancreatic cancer and lung cancer among systemic tumors. The pathogenesis of gliomas is still unclear, and treatment still relies on surgery, radiotherapy, and chemotherapy. Microglia are immune cells that reside in the central nervous system and are glioma-associated macrophages. They play an important role in the development of the nervous system and the progression of the disease. If microglial function can be enhanced through modification, enabling microglia to specifically kill tumor cells, improve the tumor microenvironment, and reduce the side effects of cytokine storms, it will benefit glioma patients.

[0005] Disialoganglioside GD2 is an antigen primarily expressed on gliomas (brain tumors, central neuroblastomas such as retinoblastoma, and melanoma). Its expression in normal tissues is low and localized, making it an ideal tumor antigen for glioma immunotherapy. Currently, specific antibodies targeting GD2 are used for neuroblastoma immunotherapy. However, these antibodies are primarily present in the peripheral blood, making it difficult to precisely enter tumor tissue or even tiny residual tumor sites. Furthermore, the antibodies are easily degraded and cannot persist in the body for long periods, complicating treatment. Previously, CN 106536563A and CN 108948211A disclosed GD2-binding chimeric antigen receptors (CARs) constructed on T cells using transgenic technology. While these CARs have shown some promise in cancer treatment, the normal central nervous system and retina contain few T cells. Even if T cells migrate from the peripheral blood to the central nervous system and retina during disease, they have difficulty entering solid tumors, making them less effective therapeutically.

[0006] Summary of the Invention

[0007] In view of this, an object of the present invention is to provide a chimeric antigen receptor, microglial cells expressing the chimeric antigen receptor and their use.

[0008] The chimeric antigen receptor provided by the present invention is a disialoganglioside-based chimeric antigen receptor, which comprises an antigen-binding domain, a transmembrane domain, and a co-stimulatory signal transduction domain; wherein:

[0009] The antigen binding domain is a single-chain antibody against the tumor surface antigen disialoganglioside;

[0010] The transmembrane domain is a CD8α transmembrane domain;

[0011] The co-stimulatory signaling domain is a combination of a CD86 signaling domain and an FcγR1 signaling domain.

[0012] Optionally, the amino acid sequence of the single-chain antibody against the tumor surface antigen disialoganglioside is shown in SEQ ID NO.3 or SEQ ID NO.15;

[0013] The amino acid sequence of the CD8α transmembrane domain is shown in SEQ ID NO.5;

[0014] The costimulatory signaling domain is a sequential combination of a CD86 signaling domain and an FcγR1 signaling domain. The amino acid sequence of the costimulatory signaling domain is shown in SEQ ID NO.6.

[0015] Optionally, the chimeric antigen receptor further comprises a signal peptide; the amino acid sequence of the signal peptide is shown in SEQ ID NO.2.

[0016] Optionally, the chimeric antigen receptor further includes a hinge region, and the amino acid sequence of the hinge region is shown in SEQ ID NO.4.

[0017] Optionally, the chimeric antigen receptor is composed of a signal peptide, an antigen binding domain, a transmembrane domain, a co-stimulatory signal transduction domain, a 2A sequence and a green fluorescent protein sequence in series, and the amino acid sequence of the chimeric antigen receptor is shown in SEQ ID NO.1 or SEQ ID NO.14.

[0018] The present invention also provides a lentivirus containing a chimeric antigen receptor.

[0019] The chimeric antigen receptor-containing lentivirus provided by the present invention includes the chimeric antigen receptor.

[0020] The method for preparing microglial cells expressing chimeric antigen receptors also falls within the scope of protection of the present invention.

[0021] The method for preparing microglial cells expressing a chimeric antigen receptor provided by the present invention comprises the following steps: culturing microglial cells, infecting the microglial cells with a lentivirus containing the chimeric antigen receptor, observing the transfection efficiency by green fluorescence, screening positive clones with puromycin, and finally selecting positive clone cells for culturing and identification to obtain microglial cells expressing the chimeric antigen receptor.

[0022] Optionally, the positive clone screening is performed by observing the transfection efficiency by green fluorescence and then performing positive clone screening by puromycin.

[0023] Optionally, the microglial cells are microglial cell line HMC3; the microglial cells expressing chimeric antigen receptors are CAR-GD2 microglial cells.

[0024] The microglial cells expressing chimeric antigen receptors prepared by the method described also fall within the scope of protection of the present invention.

[0025] The use of microglial cells expressing chimeric antigen receptors in the preparation of drugs for treating tumors expressing disialoganglioside antigens also falls within the scope of protection of the present invention.

[0026] The present invention also provides a method for preparing microglial cells expressing chimeric antigen receptors differentiated from human pluripotent stem cells. The microglial cells expressing chimeric antigen receptors are microglial cells expressing the above-mentioned chimeric antigen receptors. The method comprises the following steps: infecting human pluripotent stem cells with the lentivirus; performing positive clone screening and selecting positive clone cells for culture and identification; and differentiating human pluripotent stem cells expressing chimeric antigen receptors into microglial cells, thereby obtaining the microglial cells expressing chimeric antigen receptors.

[0027] Optionally, the human pluripotent stem cells are human induced pluripotent stem cells.

[0028] The microglial cells expressing chimeric antigen receptors differentiated from human pluripotent stem cells prepared by the method also fall within the protection scope of the present invention.

[0029] The use of microglial cells expressing chimeric antigen receptors differentiated from human pluripotent stem cells in the preparation of drugs for treating tumors expressing disialoganglioside antigens also falls within the scope of protection of the present invention.

[0030] The tumor is a human brain astroglioblastoma expressing disialoganglioside antigen.

[0031] The human brain astrocytoblastoma cells are human brain astrocytoblastoma U87MG cells.

[0032] The tumor is a retinoblastoma expressing disialoganglioside antigen.

[0033] The retinoblastoma is retinoblastoma Y79.

[0034] The microglial cells (i.e., CAR-GD2 microglial cells) expressing a chimeric antigen receptor based on disialoganglioside (i.e., a chimeric antigen receptor targeting the GD2 antigen) provided by the present invention can accurately recognize tumor cells and survive for a long time. They can be used to treat tumors expressing the GD2 antigen and alleviate patients' pain.

[0035] Compared to CAR-T and CAR-NK, CAR-microglia, a novel cellular immunotherapy, offers unique advantages, including enhanced tumor infiltration, enhanced antigen presentation and killing capabilities, and reduced non-tumor-targeted toxicity. We hope that with further research, CAR-microglia will demonstrate efficacy in patients and be applied clinically, benefiting glioma patients.

[0036] The chimeric antigen receptor provided by the present invention has been further optimized and modified to specifically target tumor cells expressing GD2 and has a strong ability to kill tumor cells.

[0037] The microglial cells expressing chimeric antigen receptors differentiated from human pluripotent stem cells provided by the present invention can accurately identify and kill human brain glioblastoma U87MG or retinoblastoma Y79 cells, and have unique advantages such as no immunogenicity and no immune rejection problems when used for human treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] For purposes of illustration and not limitation, the present invention will now be described with reference to preferred embodiments thereof, particularly with reference to the accompanying drawings, in which:

[0039] FIG1 is a diagram of the construction of a chimeric antigen receptor;

[0040] FIG2 is a diagram showing the construction of the vector pCDH CAR-GD2 for expressing the chimeric antigen receptor in Example 1;

[0041] FIG3 is a diagram showing the construction of the chimeric antigen receptor-expressing vector pCDH CAR-CD19;

[0042] Figure 4 shows the expression of microglial markers IBA1 and CD68 in HMC3; scale bar 20 μm;

[0043] FIG5 is a graph showing the results of flow cytometry detection of tumor cells Y79 expressing GD2 but not CD19; microglia expressing neither GD2 nor CD19;

[0044] Figure 6 shows the electrophoresis identification results of PCR products of CAR-GD2 microglia and CAR-CD19 microglia;

[0045] Figure 7 shows the sequencing results of CAR-GD2 microglia;

[0046] Figure 8 shows the sequencing results of CAR-CD19 microglia;

[0047] Figure 9 is a graph showing the results of flow cytometry detection of CAR-CD19 microglia and CAR-GD2 microglia expressing linker G4S in CAR molecules.

[0048] FIG10 shows immunofluorescence detection of microglial HMC3 cells that do not express GD2, while tumor cell lines express GD2; scale bar: 20 μm.

[0049] FIG11 shows the results of live cell imaging to detect the targeting of CAR-GD2 microglia to tumor cells; scale bar: 100 μm.

[0050] Figure 12 is a comparison of the killing effects of CAR-GD2 and CAR-CD19 microglia on tumor cells.

[0051] Figure 13 shows the results of CCK-8 assay to detect the killing rate of CAR-GD2 microglia on Y79 target cells.

[0052] Figure 14 shows the results of ELISA detection of cytokine secretion after CAR-GD2 microglia killed Y79 cells.

[0053] Figure 15 is a diagram showing the construction of the vector pCDH CAR-GD2 human for expressing the chimeric antigen receptor in Example 2.

[0054] Figure 16 shows the electrophoresis identification results of PCR products of microglia differentiated from human induced pluripotent stem cells expressing CAR-GD2 and CAR-CD19.

[0055] FIG17 shows that microglia differentiated from human induced pluripotent stem cells express microglial markers IBA1 (purple) and CD68 (red), but do not express GD2 (green); scale bar: 30 μm.

[0056] FIG18 is a flow cytometry analysis of the identification of microglial cells differentiated from human induced pluripotent stem cells expressing CAR-GD2 and CAR-CD19.

[0057] Figure 19 is a flow cytometry analysis of CAR expression in microglia differentiated from human induced pluripotent stem cells.

[0058] FIG20 shows flow cytometry detection of retinoblastoma cells Y79 expressing GD2 but not CD19; and human astroglioma cells U87MG expressing GD2 but not CD19.

[0059] FIG21 is a live cell imaging diagram of CAR-GD2 and CAR-CD19 microglia cells differentiated from human induced pluripotent stem cells killing retinoblastoma cells Y79.

[0060] Figure 22 shows the killing rate of human brain glioblastoma U87MG cells by CAR-GD2 and CAR-CD19 microglia differentiated from human induced pluripotent stem cells. DETAILED DESCRIPTION

[0061] The following description of the present invention is only intended to illustrate various embodiments of the present invention. Therefore, the specific modifications discussed should not be construed as limiting the scope of the invention. It is apparent to those skilled in the art that various equivalents, changes and modifications can be made without departing from the scope of the present invention, and it should be understood that such equivalent embodiments are intended to be included in the invention. All references cited in the present invention, including publications, patents and patent applications, are incorporated herein by reference in their entirety. If specific techniques or conditions are not indicated in the examples, they are based on the techniques or conditions described in the literature in this area, or are carried out according to the product specifications. If the manufacturers of the reagents or instruments used are not indicated, they are all conventional products that can be purchased through regular channels.

[0062] A. General Definition

[0063] As used herein, the term "comprising" is used in reference to compositions, methods, and their respective components as essential to the method or composition, but remains open to the inclusion of unspecified elements, whether essential or not.

[0064] The term "consisting of refers to the compositions, methods, and corresponding components thereof as described herein, excluding any elements not recited in the description of the embodiment.

[0065] The term "about" or "approximately" means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.

[0066] As used herein, the term "cell" refers to a single cell, a cell line, or a culture derived from such a cell.

[0067] Example 1. Chimeric Antigen Receptor, Microglial Cells Expressing Chimeric Antigen Receptor, and Their Applications

[0068] 1.1 Construction of chimeric antigen receptors

[0069] A chimeric antigen receptor (CAR) was constructed by whole-gene synthesis of a signal peptide sequence, a GD2 antigen binding domain, a hinge region, a transmembrane domain, a costimulatory signaling domain, a 2A sequence, and enhanced green fluorescent protein (EGFP), as shown in FIG1 , namely, signal peptide (Signal peptide)-Anti-GD2scFv-CD8α transmembrane region (CD8αTM)-CD86-FcγR1-T2A-EGFP, and the amino acid sequence is shown in SEQ ID NO. 1:

[0070] in:

[0071] The amino acid sequence of the signal peptide is shown in SEQ ID NO.2:

[0072] The amino acid sequence of the single-chain antibody against the tumor surface antigen GD2 (Anti-GD2scFv) is shown in SEQ ID NO.3:

[0073] The linker sequence is a repeated sequence of multiple GGGGS (G4S). Three GGGGS are added between the heavy chain variable region and the light chain variable region to act as a connector. It is flexible and allows the antibody to easily contact the antigen when forming the CAR molecule.

[0074] The function of the hinge region is to provide flexibility to overcome steric hindrance and contribute to the length of the CAR to allow the antigen binding domain to contact the target epitope. The amino acid sequence of the hinge region is shown in SEQ ID NO.4:

[0075] The transmembrane domain is the CD8α transmembrane region (CD8αTM), and its amino acid sequence is shown in SEQ ID NO.5:

[0076] The co-stimulatory signaling domain is a combination of the CD86 signaling domain and the FcγR1 signaling domain, that is, a sequential combination of CD86-FcγR1. The amino acid sequence of CD86-FcγR1 is shown in SEQ ID NO. 6:

[0077] The amino acid sequence of T2A is shown in SEQ ID NO.7:

[0078] The amino acid sequence of enhanced green fluorescent protein is shown in SEQ ID NO.8:

[0079] Since glioma does not express CD19 antigen, the present invention uses microglial cells expressing CD19 chimeric antigen receptor including anti-CD19 antibody scFv segment, CD8α transmembrane region and CD86 intracellular segment as control group cells.

[0080] The CD19 chimeric antigen receptor of the control group cells includes a signal peptide, an antigen binding domain, a transmembrane domain, a co-stimulatory signal transduction domain, and a 2A sequence in series. The amino acid sequence is shown in SEQ ID NO.9, which is as follows:

[0081] 1.2 Construction of chimeric antigen receptor vector

[0082] The vector used in the present invention for constructing the chimeric antigen receptor expression vector is named pCDH-EF1α-puro (purchased from Ningbo Annobot Biopharmaceutical Technology Co., Ltd.). The chimeric antigen sequence synthesized by the whole gene is used as a template, and primers are designed for amplification. The sequence of the upstream primer (with EcoRI endonuclease sequence) is F:

[0083] GATTCGAATTCGCCGCCACCATGGCCCTCCCTGTCACCGCCCTGCTGC (SEQ ID NO. 10); the downstream primer sequence (with XbaI endonuclease sequence) is R: GAATTTCTAGATTACTTGTACAGCTCGTCCATGCCGAGAGT (SEQ ID NO. 11). The amplified PCR product was subjected to electrophoresis and then recovered by gel excision. The recovered PCR product was digested with EcoRI and XbaI restriction endonucleases. Simultaneously, the pCDH-EF1α-puro vector was digested with EcoRI and XbaI restriction endonucleases at 37°C for 2 hours. After digestion, the PCR product and vector were electrophoresed, excision was performed to recover the digested product, and ligation was performed. The PCR digested product and the vector digested product were ligated with T4 ligase at 16°C for 12 hours. The ligated product was transformed into the competent strain Stbl3 (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). The transformation steps were as follows:

[0084] 1. Thaw the competent cell on ice, add all the ligation products to the competent cells, flick the tube wall to mix, and place on ice for 30 minutes.

[0085] 2. Heat shock at 42°C for 1 minute 30 seconds, then quickly incubate on ice for 2 minutes.

[0086] 3. Add 500 μl of LB medium without antibiotics and shake at 37°C for 30 minutes.

[0087] 4. After centrifugation, discard 300 μl of the supernatant, resuspend the remaining culture, and evenly spread the bacterial solution on LB ampicillin-positive agar plates. Incubate at 37°C overnight. After 12 hours, observe the bacterial growth. Select individual, large, and plump bacteria and place them in LB ampicillin-positive culture medium and shake for 12 hours. A portion of the bacterial solution is frozen with 20% glycerol, and the remaining portion is sent to the company (Beijing Qingke Biotechnology Co., Ltd.) for sequencing. The correctly identified bacteria are revived and shaken for large-scale extraction and labeled as pCDH CAR-GD2 and pCDH CAR-CD19. The vector maps are shown in Figures 2 and 3.

[0088] 1.3 Lentiviral packaging

[0089] This example uses the HEK-293T cell line to produce lentivirus. pCDH CAR-GD2 and pCDH CAR-CD19 are lentiviral vectors. Adding the lentiviral backbone plasmids to transfect 293T cells allows for packaging into lentivirus containing the CAR sequence. (See Gene Ther. 2011 Jun; 18(6):531-8.)

[0090] (1) HEK293T cells in good growth condition (the non-patent literature describing HEK293T cells is: Gene Ther. 2011 Jun; 18(6): 531-8.) were digested with 0.25% trypsin for 2 minutes, and DMEM medium containing 10% FBS (purchased from Thermo Fisher Scientific) was added to terminate the digestion. The cells at the bottom of the culture dish were blown into single cells, and 1×10 7 Inoculate into a 10cm dish and transfect the packaged virus 12 hours later. To collect more lentivirus, you can culture several more dishes of cells according to actual conditions.

[0091] (2) Preparation of transfection reagent and plasmid complex

[0092] a. Dissolve 35 μg of the viral plasmid to be transfected (10 μg pCDH CAR DNA vector plasmid, 10 μg pMD2.G (purchased from Wuhan Shumi Brain Science and Technology Co., Ltd.) and 15 μg psPAX2 (purchased from Wuhan Shumi Brain Science and Technology Co., Ltd.)) in Opti-MEM medium (purchased from Thermo Fisher Scientific) in a total volume of 500 μl, mix gently, and let stand for 5 minutes to obtain a mixed solution containing the plasmid.

[0093] b. Take 100 μl of the transfection reagent lipofectamin2000 (purchased from Thermo Fisher Scientific) and 200 μl of the enhancement reagent and dissolve them in Opti-MEM medium to a total volume of 500 μl, mix gently, and let it stand for 5 minutes.

[0094] c. Add the mixture containing the plasmid to the mixture containing the transfection reagent, mix gently while adding, and then leave it at room temperature for 20 minutes to allow the DNA and transfection reagent to fully combine to form a stable transfection complex.

[0095] (3) Remove the culture dish and add the prepared DNA transfection reagent mixture to the HEK293T cells in step (1).

[0096] (4) Change medium after transfection: After 6 hours, aspirate the culture medium, wash once with PBS, add 10 ml of fresh DMEM culture medium containing 10% FBS, and culture in a 37°C 5% CO2 incubator.

[0097] 1.4 Extraction and Concentration of Lentivirus

[0098] Lentivirus extraction:

[0099] 1) Collect HEK293T cell supernatants 48 and 72 hours after transfection (transfection time is 0 hours) and transfer them into 50 ml centrifuge tubes. Centrifuge at 3500 rpm for 10 minutes at room temperature to remove cells and large debris.

[0100] 2) Filter the supernatant through a 0.45 μm filter membrane into an ultracentrifuge tube.

[0101] Ultracentrifugation to concentrate viruses:

[0102] 3) Centrifuge at 30,000 rpm and 4°C for 2 h. A white virus precipitate can be observed on one side of the tube wall.

[0103] 4) Discard the supernatant and invert the centrifuge tube onto sterilized absorbent paper to remove any remaining supernatant. Add 80–120 μl of phosphate-buffered saline (DPBS) to each tube, depending on the amount of precipitate. Seal the tube with sealing film and dissolve the precipitate overnight at 4°C.

[0104] 5) Aliquot the virus as required and store in a -80°C refrigerator.

[0105] 1.5 Lentiviral titer determination

[0106] Quantitative PCR was used to determine the copy number of the integrated viral genome in the cells. The initial viral titer was inferred based on the volume of virus added and the number of cells infected. The viral genome was detected using the WPRE sequence on the vector, which is not present in HEK293T cells.

[0107] 1) One day before infection, 1×10 5 Cells were seeded in 24-well plates.

[0108] 2) Take 10 μl, 1 μl, and 0.1 μl of the virus and add them to each cell culture well, followed by the addition of Polybrene (purchased from Merck). The virus can be diluted before addition.

[0109] 3) After 24 hours of infection, the culture medium was changed and culture was continued.

[0110] 4) 48 hours after infection, discard the cell supernatant. Collect the cells and extract the 293T cell genome.

[0111] 5) Using the obtained genome as a template, the internal reference gene and viral sequence WPRE were quantified by relative quantification method using 2 -ΔΔ The Ct method was used to calculate the ratio of viral genome numbers to cellular genome numbers.

[0112] Results: The titer of the lentivirus used in the present invention was 1×10 8 TU / ml, and the lentiviruses containing CAR were named lenti CAR-GD2 and lenti CAR-CD19, respectively.

[0113] 1.6 Preparation of CAR-microglia

[0114] Microglial cells HMC3 (purchased from Wuhan Punosai Life Science Co., Ltd.) were added to DMEM medium containing 10% FBS (purchased from Thermo Fisher Scientific) and seeded into 6-well plates at 5×10 cells per well. 5 After culturing for 24 h, cells were infected with lenti-CAR GD2 and lenti-CAR CD19 (20 μl / well), respectively. Polybrene (10 ug / ml) was then added and the six-well plate was gently shaken to mix evenly.

[0115] As shown in Figure 4, HMC3 cells expressed the microglial markers IBA1 and CD68. Microglial cells did not express CD19 and GD2. As shown in Figure 5, no GD2- or CD19-positive cell populations were found in HMC3 cells (J Neuroimmunol. 2017 Aug 15;309:12-22).

[0116] 6 hours after viral infection, the viral supernatant was removed and replaced with fresh DMEM medium containing 10% FBS (purchased from Thermo Fisher Scientific). The lentiviral vector has green fluorescent protein GFP and puromycin resistance. After 48 hours of cell culture, cells expressing green fluorescence were observed in the lentiviral-infected cells. Puromycin was then added to the lentiviral-infected and uninfected cell wells for screening. Some cell death could be seen on the first day after the addition of puromycin. When all cells in the uninfected lentiviral cell wells died, screening was stopped and the culture medium was changed to complete medium for continued culture. When the lentiviral-infected cell wells could be cloned, single clones were selected for culture. When the single clones could be passaged, the cells were collected to extract DNA, and PCR products were identified and sequenced. The PCR identification primer is F: TTCTCAAGCCTCAGACAGTGGT (SEQ ID NO.12);

[0117] R: AGCGCATGCTCCAGACTGCCTT (SEQ ID NO. 13), the PCR product was electrophoresed, the electrophoresis diagram is shown in Figure 6, and the sequencing results are compared in Figures 7 and 8. In this way, CAR-GD2 (Figure 7) and control group CAR-CD19 microglial cells (Figure 8) were obtained.

[0118] Part of the cloned cells with correct CAR gene sequencing was expanded and frozen, and the other part was expanded for subsequent experiments. The expression of CAR molecules by microglia is shown in Figure 9. G4S is the linker between the heavy chain variable region and the light chain variable region of the CAR molecule. By labeling with a fluorescent antibody that recognizes G4S, it can be seen that the proportion of positive cell populations is very high (>80%), indicating that microglia express CAR molecules.

[0119] 1.7 In vitro killing experiment of CAR-GD2 microglia

[0120] Flow cytometry and immunofluorescence were used to detect that retinoblastoma Y79 cells (purchased from Fenghui Biotechnology Co., Ltd.) expressed GD2 but did not express CD19 (as shown in Figures 5 and 10) (J Immunother Cancer. 2022 Sep; 10(9): e005187.). CAR-GD2 microglia and CAR-CD19 microglia were co-cultured with Y79 cells, respectively. The targeting of CAR-microglia to tumor cells Y79 was observed by live cell imaging. As shown in Figure 11, CAR-microglia had green fluorescence, and Y79 was stained with CellTrace. violet expresses blue fluorescence. The picture on the left of Figure 11 shows the picture of CAR-microglia co-cultured with Y79 cells. It can be seen that the cells are evenly distributed. The picture on the right of Figure 11 shows the result of co-culture of CAR-microglia and Y79 for 3 hours. It can be seen that CAR-GD2 microglia obviously target Y79 cells and surround Y79 cells. Subsequently, the killing effect of CAR-microglia on tumor cells Y79 was analyzed by flow cytometry. As shown in Figure 12, it can be seen that after co-culture of CAR-GD2 microglia and Y79 cells, the death of Y79 cells increased significantly, showing the specific killing effect of CAR-GD2 microglia on Y79.

[0121] Target cell killing assay detected by CCK-8:

[0122] CAR-microglia were digested into single cells and then resuspended in complete culture medium and counted at 1×10 4 Each well of a 96-well plate was plated with 1×10 cells / well. Five replicate wells were set up for each group of experiments. Retinoblastoma Y79 cells were plated with 1×10 4 pcs / hole or 5×10 4 / well, after co-culture for 12 hours, 20 μl / well of CCK-8 solution was added and incubated in a cell culture incubator for another 0.5-4 hours. In the present invention, the cells were incubated for another 2 hours and then the absorbance was measured at 450 nm. After measurement, the cell killing ratio was calculated by the OD value. As shown in Figure 13, CAR-GD2 significantly killed retinoblastoma Y79 cells.

[0123] 1.8 CAR-microglial cytokine release assay

[0124] The most significant side effect of CAR gene-edited cells is excessive cytokine release, which can cause toxicity to normal tissues. Cytokine release levels after co-culture of CAR-microglia with tumor cells were measured by enzyme-linked immunosorbent assay (ELISA). ELISA kits (Biolegend) were used to quantify the concentrations of human IL-6 and TNF-α in the culture supernatant. Standards and culture supernatants were added to the corresponding wells, and the IL-6 or TNF-α in the standards and cell culture supernatants bound to the immobilized capture antibody. Biotinylated monoclonal anti-human IL-6 or TNF-α detection antibodies were then added to form an antibody-antigen-antibody "sandwich." Avidin-HRP reagent was then added, followed by TMB substrate. Finally, stop solution was added to the wells to terminate the reaction. The absorbance of each well was measured at 450 nm using a microplate reader. As shown in Figure 14, cytokine secretion after co-culture of CAR-GD2 microglia with retinoblastoma Y79 cells was comparable to that of the control group, as measured by ELISA, indicating a low risk of cytokine toxicity and minimal side effects.

[0125] Example 2: Chimeric Antigen Receptor, Microglial Cells Expressing Chimeric Antigen Receptor Differentiated from Human Pluripotent Stem Cells, and Their Applications

[0126] 2.1 Construction of chimeric antigen receptors

[0127] A chimeric antigen receptor (CAR) was constructed by whole-gene synthesis of a signal peptide sequence, a GD2 antigen binding domain, a hinge region, a transmembrane domain, a costimulatory signaling domain, a 2A sequence, and enhanced green fluorescent protein (EGFP), as shown in FIG1 , namely, signal peptide (Signal peptide)-Anti-GD2scFv-CD8α transmembrane region (CD8αTM)-CD86-FcγR1-T2A-EGFP, and the amino acid sequence is shown in SEQ ID NO. 14:

[0128] in:

[0129] The amino acid sequence of the signal peptide is shown in SEQ ID NO.2.

[0130] The amino acid sequence of the single-chain antibody against the tumor surface antigen GD2 (Anti-GD2scFv) is shown in SEQ ID NO.15:

[0131] The linker sequence is a repeated sequence of multiple GGGGS (G4S). Three GGGGS are added between the heavy chain variable region and the light chain variable region to act as a connector. It is flexible and allows the antibody to easily contact the antigen when forming the CAR molecule.

[0132] The function of the hinge region is to provide flexibility to overcome steric hindrance and contribute to the length of the CAR to allow the antigen binding domain to contact the target epitope. The amino acid sequence of the hinge region is shown in SEQ ID NO.4.

[0133] The transmembrane domain is the CD8α transmembrane region (CD8αTM), and its amino acid sequence is shown in SEQ ID NO.5:

[0134] The co-stimulatory signaling domain is a combination of the CD86 signaling domain and the FcγR1 signaling domain, that is, a sequential combination of CD86-FcγR1. The amino acid sequence of CD86-FcγR1 is shown in SEQ ID NO.6.

[0135] The amino acid sequence of T2A is shown in SEQ ID NO.7.

[0136] The amino acid sequence of enhanced green fluorescent protein is shown in SEQ ID NO.8.

[0137] Since glioma does not express CD19 antigen, the present invention uses microglial cells expressing CD19 chimeric antigen receptor including anti-CD19 antibody scFv segment, CD8α transmembrane region and CD86 intracellular segment as control group cells.

[0138] The CD19 chimeric antigen receptor of the control group cells includes a signal peptide, an antigen binding domain, a transmembrane domain, a co-stimulatory signal transduction domain, and a 2A sequence connected in series, and the amino acid sequence is shown in SEQ ID NO.9.

[0139] 2.2 Construction of chimeric antigen receptor vector

[0140] The method for constructing the chimeric antigen receptor vector in this example is the same as that in Example 1.

[0141] Correctly identified bacteria were revived and shaken for mass extraction, labeled as pCDH CAR-GD2 human and pCDH CAR-CD19. Vector maps are shown in Figures 15 and 3.

[0142] 2.3 Lentiviral packaging

[0143] The lentivirus packaging method of this embodiment is the same as that of Example 1.

[0144] 2.4 Lentivirus Extraction and Concentration

[0145] The extraction and concentration methods of the lentivirus in this example are the same as those in Example 1.

[0146] 2.5 Lentiviral titer determination

[0147] The method for determining the lentivirus titer in this example is the same as that in Example 1.

[0148] Results: The titer of the lentivirus used in this example was 1×10 8 TU / ml, and the lentiviruses containing CAR were named lenti CAR-GD2 human and lenti CAR-CD19, respectively.

[0149] 2.6 Preparation of CAR-microglia

[0150] Human induced pluripotent stem cells (reference PNAS Nexus. 2022 Aug 17; 1(4): pgac162; Stem Cell Reports. 2018 Apr 10; 10(4): 1267-1281.) were added to the stem cell culture medium TeSR-E8 (purchased from Stem Cell Company) and seeded into 6-well plates at 5×10 cells per well. 5 After culturing for 24 hours, cells were infected with lentiCAR-GD2 human and lenti-CAR CD19 (20μl / well) respectively, and polybrene (10ug / ml) was added immediately, and the six-well plate was gently shaken to mix evenly. 6 hours after viral infection, the viral supernatant was removed and replaced with fresh stem cell culture medium TeSR-E8 (purchased from a stem cell company). The lentiviral vector has green fluorescent protein GFP and puromycin resistance. After 48 hours of cell culture, cells expressing green fluorescence were observed in the lentiviral-infected cells. Puromycin was then added to the lentiviral-infected cell wells and the uninfected lentiviral cell wells for screening. Some cell death could be seen on the first day of adding puromycin. When all cells in the uninfected lentiviral cell wells died, the screening was stopped and the culture was continued. When the lentiviral-infected cell wells could be cloned, single clones were selected for culture. When the single clones could be passaged, the cells were collected to extract DNA, and PCR products were identified and sequenced. The PCR identification primer is F: TTCTCAAGCCTCAGACAGTGGT (SEQ ID NO.12);

[0151] R: AGCGCATGCTCCAGACTGCCTT (SEQ ID NO. 13). The PCR product was subjected to electrophoresis. The electrophoresis pattern is shown in FIG16 , and it can be seen that the selected monoclonal stem cells contain the specific CAR sequence.

[0152] The stem cells containing CAR-GD2 and CAR-CD19 were then differentiated into microglia (for microglia differentiation methods, see patent documents CN 114752565 A, CN114426951A and reference Sci. China Life Sci. 2022.65(6), 1057-1071.). The specific method is: when the cultured human induced pluripotent stem cells reach 80% density, the cells are digested with 0.5mM EDTA. In order to form embryoid bodies (EBs), hiPSCs are transferred to a suspension culture plate containing embryoid body culture medium (containing 10μM Y-27632). The embryoid body culture medium is carefully changed every day. On the 5th day, the EBs are resuspended in monocyte culture medium and transferred to a 100mm cell culture dish pre-coated with 0.1% gelatin to generate pre-marrow cells. The culture medium is changed weekly, and hematopoietic progenitor cells appear in the supernatant after 4 weeks of culture in monocyte culture medium. These hematopoietic progenitor cells are harvested by collecting the supernatant weekly, and this process lasts for about two months. To differentiate and mature microglia, the collected hematopoietic progenitor cells were placed in a suspension culture plate containing microglia maturation medium. After one week of culture, the microglia matured and could be used for experiments. Microglia differentiated from human induced pluripotent stem cells were immunofluorescently stained with the specific markers IBA1 and CD68. The results are shown in Figure 17. Microglia expressed IBA1 (purple) and CD68 (red). Simultaneously, microglia expression of the GD2 antigen was detected, indicating that microglia differentiated from human induced pluripotent stem cells did not express GD2 (green). Using the microglia-specific markers CD11b and CD45, flow cytometry confirmed that the purity of microglia differentiated from stem cells was high, reaching over 90%, as shown in Figure 18. The CAR molecule contains EGFP, which exhibits green fluorescence. Flow cytometry was further used to identify EGFP expression, as shown in Figure 19. Thus, microglia derived from human induced pluripotent stem cells expressing CAR-GD2 and a control group of CAR-CD19 were obtained.

[0153] 2.7 In vitro killing experiment of CAR-GD2 microglia differentiated from human induced pluripotent stem cells

[0154] Retinoblastoma Y79 cells (purchased from Fenghui Biotechnology Co., Ltd.) were labeled with specific flow cytometry antibodies against GD2 (purchased from Dakoway Biotechnology Co., Ltd.) and CD19 (purchased from Dakoway Biotechnology Co., Ltd.), and then detected by flow cytometry. As shown in Figure 20, Y79 expressed GD2 but did not express CD19. Flow cytometry detection method: Y79 cells were collected and centrifuged at 200g for 5 minutes, the supernatant was discarded, and the cells were resuspended in phosphate buffered saline (DPBS) (purchased from Thermo Fisher Scientific), centrifuged at 200g for 5 minutes, the supernatant was discarded, and the cells were resuspended in cell labeling buffer (purchased from Dakoway Biotechnology Co., Ltd.) and counted to 1×107 100ul of cells were incubated with 5ul of GD2 flow cytometry antibody and 5ul of CD19 flow cytometry antibody at room temperature for 20 minutes in the dark. Subsequently, 500ul of cell labeling buffer was added, centrifuged at 300g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 500ul of cell labeling buffer for flow cytometry detection. CAR-GD2 microglia and CAR-CD19 microglia were co-cultured with Y79 cells, and the killing effect of CAR-microglia on tumor cells Y79 was observed by live cell imaging. As shown in Figure 21, CAR-microglia have green fluorescence, and Y79 stained with CellTrace violet expresses blue fluorescence. The upper part of Figure 21 shows the picture of CAR-microglia co-cultured with Y79, and it can be seen that the cells are evenly distributed. The lower part of Figure 21 shows the picture of CAR-microglia co-cultured with Y79 for 100 hours. It can be seen that CAR-GD2 microglia significantly kill Y79 cells, and there are almost no residual Y79 cells.

[0155] 2.8 In vitro killing experiment of CAR-GD2 microglia differentiated from human induced pluripotent stem cells

[0156] It has been reported in the literature (Cancers (Basel). 2020 Oct 31; 12(11): 3211.) that human brain astroglioma U87MG cells are malignant gliomas that express GD2. We tested the expression of GD2 and CD19 in purchased U87MG cells (purchased from Mirror Qidian (Shanghai) Cell Technology Co., Ltd.). U87MG cells were labeled with specific flow cytometry antibodies for GD2 and CD19, and then detected by flow cytometry. As shown in Figure 20, the flow cytometry histogram shows that human brain astroglioma U87MG cells express GD2, with an expression ratio of more than 89%, and almost no expression of CD19. After co-culture of CAR-GD2 microglia and CAR-CD19 microglia differentiated from human embryonic stem cells with U87MG cells (labeled with blue fluorescent Celltrack violet (purchased from Thermo Fisher Scientific)) at a ratio of 10:1 and 5:1, respectively, for 24 hours, live cell imaging and counting showed that U87MG cells co-cultured with CAR-GD2 microglia were significantly dead, and the proportion of residual U87MG cells was significantly lower than that in the control group (Figure 22).

[0157] The above specific embodiments do not limit the scope of protection of the present invention. Those skilled in the art will appreciate that various modifications, combinations, sub-combinations, and substitutions may occur depending on design requirements and other factors. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are intended to be included within the scope of protection of the present invention.

Claims

1. A chimeric antigen receptor, wherein the chimeric antigen receptor is a disialylganglioside-based chimeric antigen receptor, characterized in that: The chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, and a co-stimulatory signal transduction domain; wherein: The antigen binding domain is a single-chain antibody against the tumor surface antigen disialoganglioside; The transmembrane domain is a CD8α transmembrane domain; The co-stimulatory signaling domain is a combination of a CD86 signaling domain and an FcγR1 signaling domain.

2. The chimeric antigen receptor according to claim 1, characterized in that: The amino acid sequence of the single-chain antibody against the tumor surface antigen disialylganglioside is shown in SEQ ID NO.3 or SEQ ID NO.15; The amino acid sequence of the CD8α transmembrane domain is shown in SEQ ID NO.5; The co-stimulatory signaling domain is a sequential combination of a CD86 signaling domain and an FcγR1 signaling domain, and the amino acid sequence of the co-stimulatory signaling domain is shown in SEQ ID NO.

6.

3. The chimeric antigen receptor according to claim 1, characterized in that: The chimeric antigen receptor also includes a signal peptide; the amino acid sequence of the signal peptide is shown in SEQ ID NO.

2.

4. The chimeric antigen receptor according to claim 1, characterized in that: The chimeric antigen receptor further comprises a hinge region, and the amino acid sequence of the hinge region is shown in SEQ ID NO.

4.

5. The chimeric antigen receptor according to any one of claims 1 to 4, characterized in that: The chimeric antigen receptor is composed of a signal peptide, an antigen binding domain, a transmembrane domain, a co-stimulatory signal transduction domain, a 2A sequence and a green fluorescent protein sequence in series, and the amino acid sequence of the chimeric antigen receptor is shown in SEQ ID NO.1 or SEQ ID NO.

14.

6. A lentivirus containing a chimeric antigen receptor, characterized in that: The invention comprises the chimeric antigen receptor according to any one of claims 1 to 5.

7. A method for preparing microglial cells expressing chimeric antigen receptors, wherein the microglial cells expressing chimeric antigen receptors are microglial cells expressing the chimeric antigen receptors according to any one of claims 1 to 5, characterized in that: The method comprises the following steps: culturing microglia, infecting the lentivirus according to claim 6, screening positive clones, selecting positive clone cells for culturing and identification, and obtaining microglia expressing chimeric antigen receptors.

8. The method for preparing microglia expressing chimeric antigen receptor according to claim 7, characterized in that: The microglial cells are microglial cell line HMC3; the microglial cells expressing chimeric antigen receptors are CAR-GD2 microglial cells.

9. Microglial cells expressing chimeric antigen receptor prepared by the method according to claim 7 or 8.

10. Use of microglia expressing chimeric antigen receptors in the preparation of drugs for treating tumors expressing disialoganglioside antigens.

11. A method for preparing microglial cells expressing chimeric antigen receptors differentiated from human pluripotent stem cells, wherein the microglial cells expressing chimeric antigen receptors are microglial cells expressing the chimeric antigen receptors according to any one of claims 1 to 5, characterized in that: The method comprises the following steps: infecting human pluripotent stem cells with the lentivirus of claim 6; performing positive clone screening and selecting positive clone cells for culture and identification; differentiating human pluripotent stem cells expressing chimeric antigen receptors into microglia, thereby obtaining the microglia expressing chimeric antigen receptors.

12. The method for preparing microglia expressing chimeric antigen receptor differentiated from human pluripotent stem cells according to claim 11, characterized in that: The human pluripotent stem cells are human induced pluripotent stem cells.

13. Microglia expressing chimeric antigen receptor differentiated from human pluripotent stem cells prepared by the method of claim 11 or 12.

14. Use of microglia expressing chimeric antigen receptors differentiated from human pluripotent stem cells in the preparation of drugs for treating tumors expressing disialoganglioside antigens.

15. The use according to claim 10 or 14, characterized in that: The tumor is a human brain astroglioma expressing disialoganglioside antigen.

16. The use according to claim 15, characterized in that: The human brain glioblastoma astrocytoma is human brain glioblastoma astrocytoma U87MG cells.

17. The use according to claim 10 or 14, characterized in that: The tumor is a retinoblastoma expressing disialoganglioside antigen.

18. The use according to claim 17, characterized in that: The retinoblastoma is retinoblastoma Y79.

Images