SARS-COV-2 plpro inhibitors and methods of use thereof

Abstract

Papain-like protease (PLpro) inhibitors are described herein. The disclosed PLpro inhibitors feature an oxirane-containing warhead and can covalently bind in the active site of PLpro. These PLpro inhibitors show an improved potency (i.e., an IC50 value down to about 0.4 nM). The potency of the disclosed PLpro inhibitors outperforms previously reported PLpro inhibitors, such as GRL0617, and non-covalent PLpro inhibitors. Pharmaceutical compositions containing the PLpro inhibitors are also described. Methods of using the PLpro inhibitors or the pharmaceutical compositions for preventing or treating diseases and / or disorders caused by a coronavirus are also described.

Description

[0001] SARS-COV-2 PLPRO INHIBITORS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No.63 / 519,034 filed on August 11, 2023, which is incorporated herein in its entirety. FIELD OF THE INVENTION This invention is generally in the field of SARS-CoV-2 PLpro inhibitors and methods of use thereof. BACKGROUND OF THE INVENTION The COVID-19 pandemic (SARS-CoV-2) is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and has had a profound socioeconomic effect on humankind. The early sequencing of SARS-CoV-2 genome has allowed comparisons with other coronaviruses including the Middle East Respiratory Syndrome CoV (MERS-CoV) and the earlier SARS-CoV, which, similar to SARS-CoV-2, uses the angiotensin- converting enzyme 2 (ACE2) receptor to recognize host cells. SARS-CoV-2 shares 82% overall amino acid sequence identity with SARS-CoV and ~ 50% with MERS-CoV. The high homology of SARS-CoV-2 to other coronaviruses has allowed the rapid understanding of viral biology, from particle attachment, entry, replication, and primary translation (polyprotein processing), assembly, maturation, to release and shedding. The SARS-CoV-2 spike protein recognizes and attaches to ACE2, or the cell surface serine protease TMPRSS2, promoting viral entry. Following entry, viral RNA is translated by the host ribosome to yield two large overlapping open reading frames (ORFs), ORF1a and ORF1b. Two viral cysteine proteases, the coronavirus main protease (3CLpro; nsp5) and the papain-like protease (PLpro; nsp3), proteolytically process these two viral polyproteins to produce individual non-structural proteins (nsps) that then assemble in complexes with host membrane components. The RNA-dependent RNA polymerase encoded by nsp12, a proteolytic product of 3CLpro, is a molecular target of FDA-approved COVID19 treatment, remdesivir. PLpro, recognizes the P4−P1 sequence LxGG and cleaves at three sites to release nsps 1-3. Nsp3 (1922aa, 215 kDa) incorporates PLpro itself (residues 1602−1855) and is the largest component of the replication and transcription complex. The catalytic activity of 3CLpro and PLpro is essential for viral replication and survival, making inhibition of these enzymes a compelling strategy for antiviral therapy. The catalytic activity of PLpro is also important for processing host proteins to disrupt the host innate immune response, notably via the deubiquitinase (DUB) activity of PLpro. The DUB activity of PLpro causes excision of ubitiquitin-like peptides from host proteins, notably via deISGylation and excision of ISG15. The catalytic activity of PLpro is crucial for disruption of host immune response, making inhibition of this enzyme a compelling strategy for antiviral therapy. Despite numerous biochemical, structural, and inhibitor-development studies, potent PLpro inhibitors have yet to be developed. For example, the best PLpro inhibitor reported, GRL0617, only attained 14.5 μM potency in inhibition of host cell death to infectious SARS-CoV. PLpro inhibitors are yet to be reported that are effective in vivo to treat SARS-CoV-2 infections. There remains a need to develop PLpro inhibitors with improved potency. Therefore, it is the object of the present invention to provide PLpro inhibitors with high potency. It is a further object of the present invention to provide methods of using the PLpro inhibitors for preventing or treating infections, diseases, and / or symptoms caused by exposure to a coronavirus, such as SARS-CoV-2, in a subject in need thereof. SUMMARY OF THE INVENTION Papain-like protease inhibitors (also referred to herein as “PLpro inhibitors” or “compounds”) are described herein. The disclosed PLpro inhibitors can covalently bind in the active site of PLpro, and thereby achieve improved potency (i.e., an IC50value down to about 0.4 nM). The potency of the disclosed PLpro inhibitors outperforms previously reported PLpro inhibitors, such as GRL0617 and those described in WO2022 / 169891. For example, the disclosed PLpro inhibitors have an IC50value that is at least 10 times lower than the IC50value of a previously reported PLpro inhibitor (such as GRL0617 and those described in WO2022 / 169891), tested under the same conditions or the same conditions expect for the use of a longer incubation time for the previously reported PLpro inhibitors. For example, as demonstrated by the data in the Examples below, exemplary PLpro inhibitors showed high potency for PLpro, with an IC50value ranging from 0.4 nM to about 300 nM. Such a potency of the disclosed PLpro inhibitors is at least 10 times higher than the non-covalent PLpro inhibitors as described in WO2022 / 169891 (see, e.g., Figures 1A-1I). Without being bound to any theory, it is believed that the surprisingly high potency of the disclosed PLpro inhibitors arises from the covalent binding of these compounds in the active site of PLpro via the oxirane-containing warhead of the compounds. In some forms, the PLpro inh ructure of Formula I: Formula I or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3are independently —N or —CR’, and R’ is H or halogen; Ar is aryl, polyaryl, heteroaryl, heteropolyaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Ar group can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; R1and R2are independently —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups;—C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6 alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, -halogen, -CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl, or —C1-C6haloalkyl. Pharmaceutical composition containing the disclosed PLpro inhibitors and optionally one or more pharmaceutically acceptable excipients are also disclosed. Methods of using the PLpro inhibitors for preventing and / or treating diseases or disorders caused by exposure to coronavirus, such as SARS-CoV-1 or SARS-CoV-2, are also described. Generally, the methods include administering a pharmaceutical composition containing the disclosed PLpro inhibitors to a subject in need thereof. In some forms, for preventing diseases or disorders caused by expose to coronaviruses, the pharmaceutical composition is administered before and / or after the subject is exposed to the coronavirus. Following administration of the pharmaceutical composition, the subject shows no or less symptoms associated with disease or disorder caused by the coronavirus, compared to a control. In some forms, for treating diseases or disorders caused by expose to coronaviruses, the pharmaceutical composition is administered after the subject shows one or more symptoms associated with the disease or disorder caused by the coronavirus. Following administration of the pharmaceutical composition, the subject shows less or none of the symptoms associated with the disease or disorder caused by the coronavirus, compared to the subject prior to the administration or first administration. Optionally, the relief of the symptoms occurs within an hour, within 3 hours, within 6 hours, within 12 hours, within one day, within two days, or within 3 days following the administration of the pharmaceutical composition. BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1H are graphs showing the concentration-response for exemplary PLpro inhibitors: ZN-5-70 (Figure 1A), FU-3-138 (Figure 1B), ZN-5-175 trans (Figure 1C), FU-3-142 (Figure 1D), FU-3-143 (Figure 1E), ZN-5-182 (Figure 1F), FU-3-134 (Figure 1G), and ZN-5-190 (Figure 1H), obtained using in PLpro primary enzyme assay with 6, 30, or 60 min pre-incubation with the enzyme. Figure 1I is a graph showing the concentration-response for the known PLpro inhibitor GRL0617. Figure 2 is a bar graph showing the activity of SARS-CoV-2 PLpro and Mpro inhibitors in vitro. A549:hACE2 cells were infected with SARS-CoV-2 (strain WA1, MOI=0.02). In the presence of the listed compounds at 10µM. Cell mRNA was collected using Trizol and Purelink mini mRNA kit. qPCR was performed using Sybr Green with Spike 1 primer and GAPDH primer. Vehicle treated cells were used as control. A negative control in the absence of virus was used. Figure 3 is a bar graph showing the activity of SARS-CoV-2 PLpro and Mpro inhibitors (10 µM) in A549:hACE2 cell cultures. DETAILED DESCRIPTION OF THE INVENTION I. Definitions It is to be understood that the disclosed compounds, compositions, and methods are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular forms and embodiments only and is not intended to be limiting. “Substituted,” as used herein, refers to all permissible substituents of the compounds or functional groups described herein. In the broadest sense, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, but are not limited to, halogens, hydroxyl groups, or any other organic groupings containing any number of carbon atoms, preferably 1-14 carbon atoms, and optionally include one or more heteroatoms such as oxygen, sulfur, or nitrogen grouping in linear, branched, or cyclic structural formats. Representative substituents include a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted phenyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted aralkyl, a halogen, a hydroxyl, an alkoxy, a phenoxy, an aroxy, a silyl, a thiol, an alkylthio, a substituted alkylthio, a phenylthio, an arylthio, a cyano, an isocyano, a nitro, a substituted or unsubstituted carbonyl, a carboxyl, an amino, an amido, an oxo, a sulfinyl, a sulfonyl, a sulfonic acid, a phosphonium, a phosphanyl, a phosphoryl, a phosphonyl, an amino acid. Such a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted phenyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted aralkyl, a halogen, a hydroxyl, an alkoxy, a phenoxy, an aroxy, a silyl, a thiol, an alkylthio, a substituted alkylthio, a phenylthio, an arylthio, a cyano, an isocyano, a nitro, a substituted or unsubstituted carbonyl, a carboxyl, an amino, an amido, an oxo, a sulfinyl, a sulfonyl, a sulfonic acid, a phosphonium, a phosphanyl, a phosphoryl, a phosphonyl, and an amino acid can be further substituted. Heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. It is understood that “substitution” or “substituted” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. “Alkyl,” as used herein, refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl, and cycloalkyl (alicyclic). In some forms, a straight chain or branched chain alkyl has 30 or fewer carbon atoms in its backbone (e.g., C1-C30for straight chains, C3-C30for branched chains), 20 or fewer, 15 or fewer, or 10 or fewer. Alkyl includes methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, pentyl, hexyl, heptyl, octyl, decyl, tetradecyl, hexadecyl, eicosyl, tetracosyl and the like. Likewise, a cycloalkyl is a non-aromatic carbon-based ring composed of at least three carbon atoms, such as a nonaromatic monocyclic or nonaromatic polycyclic ring containing 3-30 carbon atoms, 3-20 carbon atoms, or 3-10 carbon atoms in their ring structure, and have 5, 6 or 7 carbons in the ring structure. Cycloalkyls containing a polycyclic ring system can have two or more non-aromatic rings in which two or more carbons are common to two adjoining rings (i.e., “fused cycloalkyl rings”). Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctanyl, etc. "Substituted alkyl” refers to alkyl moieties having one or more substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. Such substituents can be any substituents described above, e.g., halogen (such as fluorine, chlorine, bromine, or iodine), hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), aryl, alkoxyl, aralkyl, phosphonium, phosphanyl, phosphonyl, phosphoryl, phosphate, phosphonate, a phosphinate, amino, amido, amidine, imine, cyano, nitro, azido, oxo, sulfhydryl, thiol, alkylthio, silyl, sulfinyl, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, an aromatic or heteroaromatic moiety. -NRR’, wherein R and R’ are independently hydrogen, alkyl, or aryl, and wherein the nitrogen atom is optionally quaternized; -SR, wherein R is a phosphonyl, a sulfinyl, a silyl a hydrogen, an alkyl, or an aryl; -CN; -NO2; -COOH; carboxylate; -COR, -COOR, or -CON(R)2,wherein R is hydrogen, alkyl, or aryl; imino, silyl, ether, haloalkyl (such as -CF3, -CH2-CF3, -CCl3); -CN; -NCOCOCH2CH2;-NCOCOCHCH; and -NCS; and combinations thereof. It will be understood by those skilled in the art that the moieties substituted on the hydrocarbon chain can themselves be substituted, if appropriate. For instance, the substituents of a substituted alkyl may include halogen, hydroxy, nitro, thiols, amino, aralkyl, azido, imino, amido, phosphonium, phosphanyl, phosphoryl (including phosphonate and phosphinate), oxo, sulfonyl (including sulfate, sulfonamido, sulfamoyl and sulfonate), and silyl groups, as well as ethers, alkylthios, carbonyls (including ketones, aldehydes, carboxylates, and esters), haloalkyls, -CN and the like. Cycloalkyls can be substituted in the same manner. Unless the number of carbons is otherwise specified, "lower alkyl" as used herein means an alkyl group, as defined above, but having from one to ten carbons, more preferably from one to six carbon atoms in its backbone structure. Likewise, "lower alkenyl" and "lower alkynyl" have similar chain lengths. “Heteroalkyl,” as used herein, refers to straight or branched chain, or cyclic carbon-containing alkyl radicals, or combinations thereof, containing at least one heteroatom on the carbon backbone. Suitable heteroatoms include, but are not limited to, O, N, Si, P and S, wherein the nitrogen, phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quaternized. For example, the term “heterocycloalkyl group” is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulphur, or phosphorus. The term “alkenyl” as used herein is a hydrocarbon group of from 2 to 24 carbon atoms and structural formula containing at least one carbon-carbon double bond. Alkenyl groups include straight-chain alkenyl groups, branched-chain alkenyl, and cycloalkenyl. A cycloalkenyl is a non-aromatic carbon-based ring composed of at least three carbon atoms and at least one carbon-carbon double bond, such as a nonaromatic monocyclic or nonaromatic polycyclic ring containing 3-30 carbon atoms and at least one carbon-carbon double bond, 3-20 carbon atoms and at least one carbon-carbon double bond, or 3-10 carbon atoms and at least one carbon-carbon double bond in their ring structure, and have 5, 6 or 7 carbons and at least one carbon-carbon double bond in the ring structure. Cycloalkenyls containing a polycyclic ring system can have two or more non-aromatic rings in which two or more carbons are common to two adjoining rings (i.e., “fused cycloalkenyl rings”) and contain at least one carbon-carbon double bond. Asymmetric structures such as (AB)C=C(C’D) are intended to include both the E and Z isomers. This may be presumed in structural formulae herein wherein an asymmetric alkene is present, or it may be explicitly indicated by the bond symbol C. The term "alkenyl" as used throughout the specification, examples, and claims is intended to include both "unsubstituted alkenyls" and "substituted alkenyls,” the latter of which refers to alkenyl moieties having one or more substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. The term “alkenyl” also includes “heteroalkenyl.” The term “substituted alkenyl” refers to alkenyl moieties having one or more substituents replacing one or more hydrogen atoms on one or more carbons of the hydrocarbon backbone. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, oxo, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. “Heteroalkenyl,” as used herein, refers to straight or branched chain, or cyclic carbon-containing alkenyl radicals, or combinations thereof, containing at least one heteroatom. Suitable heteroatoms include, but are not limited to, O, N, Si, P and S, wherein the nitrogen, phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quaternized. For example, the term “heterocycloalkenyl group” is a cycloalkenyl group where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulphur, or phosphorus. The term “alkynyl group” as used herein is a hydrocarbon group of 2 to 24 carbon atoms and a structural formula containing at least one carbon-carbon triple bond. Alkynyl groups include straight-chain alkynyl groups, branched-chain alkynyl, and cycloalkynyl. A cycloalkynyl is a non-aromatic carbon-based ring composed of at least three carbon atoms and at least one carbon-carbon triple bond, such as a nonaromatic monocyclic or nonaromatic polycyclic ring containing 3-30 carbon atoms and at least one carbon-carbon triple bond, 3-20 carbon atoms and at least one carbon-carbon triple bond, or 3-10 carbon atoms and at least one carbon-carbon triple bond in their ring structure, and have 5, 6 or 7 carbons and at least one carbon-carbon triple bond in the ring structure. Cycloalkynyls containing a polycyclic ring system can have two or more non-aromatic rings in which two or more carbons are common to two adjoining rings (i.e., “fused cycloalkynyl rings”) and contain at least one carbon-carbon triple bond. Asymmetric structures such as (AB)C C(C"D) are intended to include both the E and Z isomers. This may be presumed in structural formulae herein wherein an asymmetric alkyne is present, or it may be explicitly indicated by the bond symbol C. The term "alkynyl" as used throughout the specification, examples, and claims is intended to include both "unsubstituted alkynyls" and "substituted alkynyls,” the latter of which refers to alkynyl moieties having one or more substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. The term “alkynyl” also includes “heteroalkynyl.” The term “substituted alkynyl” refers to alkynyl moieties having one or more substituents replacing one or more hydrogen atoms on one or more carbons of the hydrocarbon backbone. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. “Heteroalkynyl,” as used herein, refers to straight or branched chain, or cyclic carbon-containing alkynyl radicals, or combinations thereof, containing at least one heteroatom. Suitable heteroatoms include, but are not limited to, O, N, Si, P and S, wherein the nitrogen, phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quaternized. For example, the term “heterocycloalkynyl group” is a cycloalkynyl group where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulphur, or phosphorus. “Aryl,” as used herein, refers to C4-C26-membered aromatic rings or fused ring systems containing one aromatic ring and optionally one or more non-aromatic rings. Examples of aryl groups are benzene, tetralin, indane, etc. The term “substituted aryl” refers to an aryl group, wherein one or more hydrogen atoms on one or more aromatic rings are substituted with one or more substituents including, but not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxy, carbonyl (such as a ketone, aldehyde, carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (or quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, imino, alkylthio, sulfate, sulfonate, sulfamoyl, sulfoxide, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl (such as CF3, -CH2-CF3, -CCl3), -CN, aryl, heteroaryl, and combinations thereof. “Heterocyclo” and “heterocyclyl” are used interchangeably, and refer to a cyclic radical attached via a ring carbon or nitrogen atom of a monocyclic ring or polycyclic ring system containing 3-30 ring atoms, 3-20 ring atoms, 3-10 ring atoms, or 5-6 ring atoms, where the polycyclic ring system contains one or more non-aromatic rings and optionally one or more aromatic rings, where at least one non-aromatic ring contains carbon and one to four heteroatoms each selected from non-peroxide oxygen, sulfur, and N(Y) wherein Y is absent or is H, O, C1-C10alkyl, phenyl or benzyl, and optionally containing 1-3 double bonds and optionally substituted with one or more substituents. Heterocyclyl are distinguished from heteroaryl by definition. Heterocycles can be a heterocycloalkyl, a heterocycloalkenyl, a heterocycloalkynyl, etc, such as piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, dihydrofuro[2,3-b]tetrahydrofuran, morpholinyl, piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, piperonyl, pyranyl, 2H-pyrrolyl, 4H-quinolizinyl, quinuclidinyl, tetrahydrofuranyl, 6H-1,2,5-thiadiazinyl. Heterocyclic groups can optionally be substituted with one or more substituents as defined above for alkyl and aryl. The term “heteroaryl” refers to C3-C26-membered aromatic rings or fused ring systems containing one aromatic ring and one or more non-aromatic rings, in which one or more carbon atoms on the aromatic ring structure have been substituted with a heteroatom. Suitable heteroatoms include, but are not limited to, oxygen, sulfur, and nitrogen. Examples of heteroaryl groups pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, tetrazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine, and the like. Examples of heteroaryl rings include, but are not limited to, benzimidazolyl, benzofuranyl, benzothiofuranyl, benzothiophenyl, benzoxazolyl, benzoxazolinyl, benzthiazolyl, benztriazolyl, benztetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH-carbazolyl, carbolinyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolinyl, 2H,6H-1,5,2-dithiazinyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, 1H-indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, 3H- indolyl, isatinoyl, isobenzofuranyl, isochromanyl, isoindazolyl, isoindolinyl, isoindolyl, isoquinolinyl, isothiazolyl, isoxazolyl, methylenedioxyphenyl, naphthyridinyl, octahydroisoquinolinyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4- oxadiazolyl, oxazolidinyl, oxazolyl, oxindolyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, phenazinyl, phenothiazinyl, phenoxathinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridooxazole, pyridoimidazole, pyridothiazole, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,4- thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thianthrenyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl and xanthenyl. One or more of the rings can be substituted as defined below for “substituted heteroaryl.” The term “substituted heteroaryl” refers to a heteroaryl group in which one or more hydrogen atoms on one or more heteroaromatic rings are substituted with one or more substituents including, but not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxy, carbonyl (such as a ketone, aldehyde, carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (or quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, imino, alkylthio, sulfate, sulfonate, sulfamoyl, sulfoxide, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl (such as CF3, -CH2-CF3, -CCl3), -CN, aryl, heteroaryl, and combinations thereof. The term “polyaryl” refers to a fused ring system that includes two or more aromatic rings and optionally one or more non-aromatic rings. Examples of polyaryl groups are naphthalene, anthracene, phenanthrene, chrysene, pyrene, corannulene, coronene, etc. When a fused ring system containing two or more aromatic rings and optionally one or more non-aromatic rings, in which one or more carbon atoms on one or more aromatic ring structures have been substituted with a heteroatom, the fused ring system can be referred to as a “heteropolyaryl” or “polyheteroaryl”. The terms “heteropolyaryl” and “polyheteroaryl” are used interchangeably herein. The term “substituted polyaryl” refers to a polyaryl in which one or more of the aryls are substituted, with one or more substituents including, but not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (or quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfoxide, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, and combinations thereof. When a polyheteroaryl is involved, the chemical moiety can be referred to as a “substituted polyheteroaryl.” The term “cyclic,” “cyclic ring” or “cyclic group” refers to a substituted or unsubstituted monocyclic ring or a substituted or unsubstituted polycyclic ring (such as those formed from single or fused ring systems), such as a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted cycloalkynyl, or a substituted or unsubstituted heterocyclyl, that have from three to 30 carbon atoms, as geometric constraints permit. The substituted cycloalkyls, cycloalkenyls, cycloalkynyls, and heterocyclyls are substituted as defined above for the alkyls, alkenyls, alkynyls, and heterocyclyls, respectively. The term “aralkyl” as used herein is an aryl group or a heteroaryl group having an alkyl, alkynyl, or alkenyl group as defined above attached to the aromatic group, such as an aryl, a heteroaryl, a polyaryl, or a polyheteroaryl. An example of an aralkyl group is a benzyl group. The terms “alkoxyl” or “alkoxy,” “aroxy” or “aryloxy,” generally describe compounds represented by the formula -ORv, wherein Rvincludes, but is not limited to, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocycloalkenyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted arylalkyl, a substituted or unsubstituted heteroalkyl, a substituted or unsubstituted alkylaryl, a substituted or unsubstituted alkylheteroaryl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted carbonyl, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, and an amino. Exemplary alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like. A “lower alkoxy” group is an alkoxy group containing from one to six carbon atoms. An “ether” is two functional groups covalently linked by an oxygen as defined below. Accordingly, the substituent of an alkyl that renders that alkyl an ether is or resembles an alkoxyl, such as can be represented by one of -O-alkyl, -O-alkenyl, -O-alkynyl, -O- arakyl, -O-aryl, -O-heteroaryl, -O-polyaryl, -O-polyheteroaryl, -O-heterocyclyl, etc. The term “substituted alkoxy” refers to an alkoxy group having one or more substituents replacing one or more hydrogen atoms on one or more carbons of the alkoxy backbone. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, oxo, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, and combinations thereof. The term “ether” as used herein is represented by the formula A2OA1, where A2and A1can be, independently, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, a substituted or unsubstituted carbonyl, an alkoxy, an amido, or an amino, described above. The term “polyether” as used herein is represented by the formula: where A3can be, independently, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a phosphonium, a phosphanyl, a substituted or unsubstituted carbonyl, an alkoxy, an amido, or an amino, described above; g can be a positive integer from 1 to 30. The term “phenoxy” is art recognized and refers to a compound of the formula -ORvwherein Rvis C6H5(i.e., -O- C6H5). One of skill in the art recognizes that a phenoxy is a species of the aroxy genus. The term “substituted phenoxy” refers to a phenoxy group, as defined above, having one or more substituents replacing one or more hydrogen atoms on one or more carbons of the phenyl ring. Such substituents include, but are not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, and combinations thereof. The terms “aroxy” and “aryloxy,” as used interchangeably herein, are represented by -O-aryl or -O-heteroaryl, wherein aryl and heteroaryl are as defined herein. The terms “substituted aroxy” and “substituted aryloxy,” as used interchangeably herein, represent -O-aryl or -O-heteroaryl, having one or more substituents replacing one or more hydrogen atoms on one or more ring atoms of the aryl and heteroaryl, as defined herein. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. The term "amino" as used herein includes the group wherein, E is absent, or E is substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aralkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, substituted or unsubstituted heterocyclyl, wherein independently of E, Rx, Rxi, and Rxiieach independently represent a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, an amino, or -(CH2)m-R"’; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. The term “quaternary amino” also includes the groups where the nitrogen, Rx, Rxi, and Rxiiwith the N+to which they are attached complete a heterocyclyl or heteroaryl having from 3 to 14 atoms in the ring structure. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The terms “amide” or “amido” are used interchangeably, refer to both “unsubstituted amido” and “substituted amido” and are represented by the general formula: wherein, E is ab sent, or E is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, or a substituted or unsubstituted heterocyclyl, wherein independently of E, R and R’ each independently represent a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, an amino, or –(CH2)m-R"’, or R and R’ taken together with the N atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. In some forms, when E is oxygen, a carbamate is formed. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4- phenylene, cyclohexane-1,2-diyl). “Carbonyl,” as used herein, is art-recognized and includes such moieties as can be represented by the general formula: wherein X is a bond, or represents an oxygen or a sulfur, and R represents a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, an amido, an amino, or -(CH2)m-R", or a pharmaceutical acceptable salt; E" is absent, or E" is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl; R’ represents a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, an amido, an amino, or -(CH2)m-R"; R" represents a hydroxyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphonium, phosphanyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E" groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4- phenylene, cyclohexane-1,2-diyl). Where X is oxygen and R is defined as above, the moiety is also referred to as a carboxyl group. When X is oxygen and R is hydrogen, the formula represents a “carboxylic acid.” Where X is oxygen and R’ is hydrogen, the formula represents a “formate.” Where X is oxygen and R or R’ is not hydrogen, the formula represents an "ester.” In general, where the oxygen atom of the above formula is replaced by a sulfur atom, the formula represents a “thiocarbonyl” group. Where X is sulfur and R or R’ is not hydrogen, the formula represents a “thioester.” Where X is sulfur and R is hydrogen, the formula represents a “thiocarboxylic acid.” Where X is sulfur and R’ is hydrogen, the formula represents a “thioformate.” Where X is a bond and R is not hydrogen, the above formula represents a “ketone.” Where X is a bond and R is hydrogen, the above formula represents an “aldehyde.” The term “phosphanyl” is represented by the formula wherein, E is absent, or E is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, wherein independently of E, Rviand Rviieach independently represent a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g., a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, an amino, or -(CH2)m-R"’, or Rviand Rviitaken together with the P atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “phosphonium” is represented by the formula wherein, E is absent, or E is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, wherein independently of E, Rvi, Rvii, and Rviiieach independently represent a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, an amino, or -(CH2)m-R"’, or Rvi, Rvii, and Rviiitaken together with the P+atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “phosphonyl” is represented by the formula wherein E is absent, or E is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl (e.g., a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, oxygen, alkoxy, aroxy, or substituted alkoxy or substituted aroxy, wherein, independently of E, Rviand Rviiare independently a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a silyl, a thiol, an amido, an amino, or -(CH2)m-R"’, or Rviand Rviitaken together with the P atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “phosphoryl” defines a phosphonyl in which E is absent, oxygen, alkoxy, aroxy, substituted alkoxy or substituted aroxy, as defined above, and independently of E, Rviand Rviiare independently hydroxyl, alkoxy, aroxy, substituted alkoxy or substituted aroxy, as defined above. When E is oxygen, the phosphoryl cannot be attached to another chemical species, such as to form an oxygen-oxygen bond, or other unstable bonds, as understood by one of ordinary skill in the art. When E, Rviand Rviiare substituted, the substituents include, but are not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfinyl” is represented by the formula wherein E is absent, or E is a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl (e.g., a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, wherein independently of E, R represents a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, a phosphonyl, a silyl, a thiol, an amido, an amino, or -(CH2)m-R"’, or E and R taken together with the S atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfonyl” is represented by the formula wherein E is absent, or E i s a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl (e.g., a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, wherein independently of E, R represents a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, an amido, an amino, or -(CH2)m-R"’, or E and R taken together with the S atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfonic acid” refers to a sulfonyl, as defined above, wherein R is hydroxyl, and E is absent, or E is substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted alkylaryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted aryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, or substituted or unsubstituted heteroaryl. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfate” refers to a sulfonyl, as defined above, wherein E is absent, oxygen, alkoxy, aroxy, substituted alkoxy or substituted aroxy, as defined above, and R is independently hydroxyl, alkoxy, aroxy, substituted alkoxy or substituted aroxy, as defined above. When E is oxygen, the sulfate cannot be attached to another chemical species, such as to form an oxygen-oxygen bond, or other unstable bonds, as understood by one of ordinary skill in the art. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfonate” refers to a sulfonyl, as defined above, wherein E is oxygen, alkoxy, aroxy, substituted alkoxy or substituted aroxy, as defined above, and R is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted amino, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aralkyl, substituted or unsubstituted alkylaryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, -(CH2)m-R"’, R"’ represents a hydroxy group, substituted or unsubstituted carbonyl group, an aryl, a cycloalkyl ring, a cycloalkenyl ring, a heterocycle, an amido, an amino, or a polycycle; and m is zero or an integer ranging from 1 to 8. When E is oxygen, sulfonate cannot be attached to another chemical species, such as to form an oxygen-oxygen bond, or other unstable bonds, as understood by one of ordinary skill in the art. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “sulfamoyl” refers to a sulfonamide or sulfonamide represented by the formula wherein E is absent, or E is substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted aralkyl (e.g., a substituted or unsubstituted alkylaryl, a substituted or unsubstituted cycloalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, wherein independently of E, R and R’ each independently represent a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted carbonyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted heterocyclyl, a hydroxyl, an alkoxy, a phosphonium, a phosphanyl, an amido, an amino, or -(CH2)m-R"’, or R and R’ taken together with the N atom to which they are attached complete a heterocycle having from 3 to 14 atoms in the ring structure; R"’ represents a hydroxyl group, a substituted or unsubstituted carbonyl group, a substituted or unsubstituted aryl, a substituted or unsubstituted cycloalkyl, a substituted or unsubstituted cycloalkenyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, an alkoxy, a phosphonium, a phosphanyl, an amido, or an amino; and m is zero or an integer ranging from 1 to 8. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. It is understood by those of ordinary skill in the art, that the E groups listed above are divalent (e.g., methylene, ethane-1,2-diyl, ethene-1,2-diyl, 1,4-phenylene, cyclohexane-1,2-diyl). The term “silyl group” as used herein is represented by the formula -SiRR’R,” where R, R’, and R” can be, independently, a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted carbonyl, a phosphonium, a phosphanyl, a phosphonyl, a sulfinyl, a thiol, an amido, an amino, an alkoxy, or an oxo, described above. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. The terms “thiol” are used interchangeably and are represented by –SR, where R can be a hydrogen, a substituted or unsubstituted alkyl, a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, a substituted or unsubstituted heterocyclyl, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted aralkyl (e.g. a substituted or unsubstituted alkylaryl, a substituted or unsubstituted arylalkyl, etc.), a substituted or unsubstituted polyaryl, a substituted or unsubstituted polyheteroaryl, a substituted or unsubstituted carbonyl, a phosphonium, a phosphanyl, an amido, an amino, an alkoxy, an oxo, a phosphonyl, a sulfinyl, or a silyl, described above. Such substituents can be any substituents described above, e.g., halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), silyl, ether, ester, thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino (e.g. quarternized amino), amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, heterocyclyl, alkylaryl, haloalkyl, -CN, aryl, heteroaryl, polyaryl, polyheteroaryl, and combinations thereof. The disclosed compounds and substituent groups, can, independently, possess two or more of the groups listed above. For example, if the compound or substituent group is a straight chain alkyl group, one of the hydrogen atoms of the alkyl group can be substituted with a hydroxyl group, an alkoxy group, etc. Depending upon the groups that are selected, a first group can be incorporated within second group or, alternatively, the first group can be pendant (i.e., attached) to the second group. For example, with the phrase “an alkyl group comprising an ester group,” the ester group can be incorporated within the backbone of the alkyl group. Alternatively, the ester can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group. The compounds and substituents can be substituted, independently, with the substituents described above in the definition of “substituted.” The numerical ranges disclose individually each possible number that such a range could reasonably encompass, as well as any sub-ranges and combinations of sub-ranges encompassed therein. For example, in a given range carbon range of C3-C9, the range also discloses C3, C4, C5, C6, C7, C8, and C9, as well as any subrange between these numbers (for example, C4-C6), and any possible combination of ranges possible between these values. In yet another example, a given temperature range may be from about 25 ºC to 30 ºC, where the range also discloses temperatures that can be selected independently from about 25, 26, 27, 28, 29, and 30 ºC, as well as any range between these numbers (for example, 26 to 28 ºC), and any possible combination of ranges between these values. Use of the term "about" is intended to describe values either above or below the stated value, which the term “about” modifies, to be within a range of approximately + / - 10%. When the term "about" is used before a range of numbers (i.e., about 1-5) or before a series of numbers (i.e., about 1, 2, 3, 4, etc.) it is intended to modify both ends of the range of numbers and / or each of the numbers recited in the entire series, unless specified otherwise. The disclosed compounds and substituent groups, can, independently, possess two or more of the groups listed above. For example, if the compound or substituent group is a straight chain alkyl group, one of the hydrogen atoms of the alkyl group can be substituted with a hydroxyl group, an alkoxy group, etc. Depending upon the groups that are selected, a first group can be incorporated within second group or, alternatively, the first group can be pendant (i.e., attached) to the second group. For example, with the phrase “an alkyl group comprising an ester group,” the ester group can be incorporated within the backbone of the alkyl group. Alternatively, the ester can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group. The compounds and substituents can be substituted with, independently, with the substituents described above in the definition of “substituted.” II. Compositions Papain-like protease inhibitors (also referred to herein as “PLpro inhibitors” or “compounds”) with high potency have been developed. The disclosed PLpro inhibitors can covalently bind in the active site of PLpro, and thereby achieve improved potency (i.e., an IC50value down to about 0.4 nM, such as an IC50value ranging from 0.4 nM to about 300 nM). In some forms, the potency of the disclosed PLpro inhibitors outperforms previously reported PLpro inhibitors, such as GRL0617 and those described in WO2022 / 169891. For example, the disclosed PLpro inhibitors have an IC50value that is at least 10 times lower than the IC50value of a previously reported PLpro inhibitor (such as GRL0617 and those described in WO2022 / 169891), tested under the same conditions or the same conditions expect for the use of a longer incubation time for the previously reported PLpro inhibitors. The highly potent PLpro inhibitors disclosed herein are generally useful for preventing and / or treating infections and / or diseases caused by a virus that contains PLpro. In particular, the disclosed PLpro inhibitors are useful for preventing and / or treating infections and / or diseases caused by coronaviruses, such as COVID-19 caused by SARS- CoV-2. Pharmaceutical formulations containing the PLpro inhibitors are also disclosed. A. PLpro Inhibitors The compounds disclosed herein are PLpro inhibitors that can covalently bind in the active site of PLpro. The disclosed PLpro inhibitors contain an oxirane-containing warhead, and are highly potent. Without being bound to any theories, it is believed that the surprisingly high potency of the disclosed PLpro inhibitors arises from the covalent binding of these compounds in the active site of PLpro via the oxirane-containing warhead of the compounds. In some forms, the disclosed PLpro inhibitors can have the structure of Formula I: Formula I or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1 can be an oxirane group, and Z2 can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3can be independently —N or —CR’, and R’ can be H or halogen; Ar can be aryl, polyaryl, heteroaryl, heteropolyaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, optionally each Ar group can be substituted with 1, 2, 3, 4, or 5 Rdgroups; R1 and R2 can be independently —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from—ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, optionally each Rcgroup can be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6 alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently —H, -halogen, -CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl, or —C1-C6haloalkyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula II: Formula II or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1-X2-X3can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1can be an oxirane group, and Z2can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y6 can be independently —N or —CR’, and R’ can be H or halogen; R1can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R3 and R5 can be —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which may be substituted with 1, 2, or 3 substituents independently selected from a halogen, -CN, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R4, and R6can be independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1- C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, R4, R5, and R6 can be independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’, or R4and R5together or R5 and R6 together with the carbon atoms to which they are attached form an aryl, a heteroaryl, a heterocyclyl, a cycloalkyl, or a cycloalkenyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula IIIa:

[0002] Formula IIIa or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3 can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1can be an oxirane group, and Z2can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, and cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y4-Y10 can be independently—N or —CH; R1can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, or —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6 alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula IIIb: Formula IIIb or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 can be an oxirane group, and Z2 can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3can be independently — N or —CR’, and R’ can be H or halogen; R1 can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7can be —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which may be substituted with 1, 2, or 3 substituents independently selected from —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R8and R9can be independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’, each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, or —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula IVa: Formula IVa or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3 can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3 cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1can be an oxirane group, and Z2can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl may be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl.

[0003] In some forms, the disclosed PLpro inhibitors can have the structure of Formula IVb: Formula IVb or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 can be an oxirane group, and Z2 can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7 can be —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which may be substituted with 1, 2, or 3 substituents independently selected from —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, or —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently—C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1- C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, — ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, , halogen, —CN, —C1- C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula V: or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 can be an oxirane group, and Z2 can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from— ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R9 and R10 can be independently —H, halogen, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbcan be independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, optionally the —C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’can be independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup may be substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdcan be independently —C1-C6heteroaryl, —CO heteroaryl, wherein it can be optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, — C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, — S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfcan be independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, R9and R10can be independently —H, halogen, or —(C1-C6alkylenyl)Rc, and Rcis a heteroaryl or heterocyclyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula VIa: Formula VIa or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3 can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1can be an oxirane group, and Z2can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7can be —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which may be substituted with 1, 2, or 3 substituents independently selected from —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1, Z2, and Z3are each independently selected from the group of C, O, S, N, NH, CH2; substitution on Z1 can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, — Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Reand Rfcan be independently—H, halogen, —CN, — C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, the disclosed PLpro inhibitors can have the structure of Formula VIb: Formula VIb or a pharmaceutically acceptable salt thereof, wherein: X can be X1-X2-X3-Z1-Z2, wherein X1, X2, X3 can be independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1can be an oxirane group, and Z2can be a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 can be —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from — ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7can be —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which may be substituted with 1, 2, or 3 substituents independently selected from —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Y can be independently keto (C=O), NH, CH2and S(O)2; Z1, Z2, and Z3 are each independently selected from the group of C, O, S, N, NH, CH2; substitution on Z1can be —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, — Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl can be substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Reand Rfcan be independently—H, halogen, —CN, — C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. In some forms, for any of the formulae described herein, R1 can be —H, halide, — NRaRb, —ORa, —C1-C6alkyl, and each occurrence of Raand Rbis independently —H, — C1-C6haloalkyl, or heterocyclyl, optionally wherein the heterocyclyl is azetidinyl, which can be substituted with —C1-C6haloalkyl. In some forms, for any of the formulae described herein, R2 can be —C1-C6alkyl, —C1-C5alkyl, —C1-C4alkyl, —C1-C3alkyl, or —C1-C2alkyl, such as methyl. In some forms, for any of the formulae described herein, X can be and wherein: n1 is an integer from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2; heterocyclyl, n2-n5 can be independently an integer from 0 to 6, from 0 to 5, from o to 4, from 0 to 3, or from 0 to 2; and Z’ can be a carboxyl, an ester, an amide, or a heterocyclyl. In some forms, X’ can be or ; J1-J10 can be independently carbon, oxygen, sulfur, or nitrogen; R’4, R’5, R’6, R’8, and R’9can be independently absent, hydrogen, oxygen, or sulfur. In some forms, L1can be wherein Q1-Q3 can be independently carbon, oxygen, sulfur, or nitrogen, and W can be oxygen or sulfur In some forms, Z’ can be a heterocyclyl or ; R11 can be -OR12, - NR13R14, or a heterocyclyl; and R12-R14can be independently hydrogen or C1-C6alkyl optionally substituted with hydroxyl or halogen. In some forms, for any of the formulae described herein, X can be any one of the following:

[0004] . For any of the formulae described herein, the alkyl (when present) can be a linear alkyl, a branched alkyl, or a cyclic alkyl (either monocyclic or polycyclic). The terms “cyclic alkyl” and “cycloalkyl” are used interchangeably herein. Exemplary alkyl include a linear C1-C30alkyl, a branched C4-C30alkyl, a cyclic C3-C30alkyl, a linear C1-C20alkyl, a branched C4-C20alkyl, a cyclic C3-C20alkyl, a linear C1-C10alkyl, a branched C4-C10alkyl, a cyclic C3-C10alkyl, a linear C1-C6alkyl, a branched C4-C6alkyl, a cyclic C3-C6alkyl, a linear C1-C4alkyl, cyclic C3-C4alkyl, such as a linear C1-C10, C1-C9, C1-C8, C1-C7, C1-C6, C1-C5, C1-C4, C1- C3, or C1-C2alkyl group, a branched C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, or C3-C4alkyl group, or a cyclic C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, or C3-C4alkyl group. The cyclic alkyl can be a monocyclic or polycyclic alkyl, such as a C4-C30, C4-C25, C4-C20, C4-C18, C4-C16, C4-C15, C4-C14, C4-C13, C4-C12, C4-C10, C4-C9, C4-C8, C4-C7, C4-C6, or C4-C5monocyclic or polycyclic alkyl group. For any of the formulae described herein, the alkenyl (when present) can be a linear alkenyl, a branched alkenyl, or a cyclic alkenyl (either monocyclic or polycyclic). The terms “cyclic alkenyl” and “cycloalkenyl” are used interchangeably herein. Exemplary alkenyl include a linear C2-C30alkenyl, a branched C4-C30alkenyl, a cyclic C3-C30alkenyl, a linear C2-C20alkenyl, a branched C4-C20alkenyl, a cyclic C3-C20alkenyl, a linearC2-C10alkenyl, a branched C4-C10alkenyl, a cyclic C3-C10alkenyl, a linear C2-C6alkenyl, a branched C4-C6alkenyl, a cyclic C3-C6alkenyl, a linear C2-C4alkenyl, cyclic C3-C4alkenyl, such as a linear C2-C10, C2-C9, C2-C8, C2-C7, C2-C6, C2-C5, C2-C4, C2-C3alkenyl group, a branched C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4alkenyl group, or a cyclic C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4alkenyl group. The cyclic alkenyl can be a monocyclic or polycyclic alkenyl, such as a C4-C30, C4-C25, C4-C20, C4-C18, C4-C16, C4-C15, C4-C14, C4-C13, C4-C12, C4-C10, C4-C9, C4-C8, C4-C7, C4-C6, or C4-C5monocyclic or polycyclic alkenyl group. For any of the formulae described herein, the alkynyl (when present) can be a linear alkynyl, a branched alkynyl, or a cyclic alkynyl (either monocyclic or polycyclic). The terms “cyclic alkynyl” and “cycloalkynyl” are used interchangeably herein. Exemplary alkynyl include a linear C2-C30alkynyl, a branched C4-C30alkynyl, a cyclic C3-C30alkynyl, a linear C2-C20alkynyl, a branched C4-C20alkynyl, a cyclic C3-C20alkynyl, a linear C2-C10alkynyl, a branched C4-C10alkynyl, a cyclic C3-C10alkynyl, a linear C2-C6alkynyl, a branched C4-C6alkynyl, a cyclic C3-C6alkynyl, a linear C1-C4alkynyl, cyclic C3-C4alkynyl, such as a linear C2-C10, C2-C9, C2-C8, C2-C7, C2-C6, C2-C5, C2-C4, C2-C3alkynyl group, a branched C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4alkynyl group, or a cyclic C3-C9, C3-C9, C3-C8, C3-C7, C3-C6, C3-C5, C3-C4alkynyl group. The cyclic alkynyl can be a monocyclic or polycyclic alkynyl, such as a C4-C30, C4-C25, C4-C20, C4-C18, C4-C16, C4-C15, C4-C14, C4-C13, C4-C12, C4-C10, C4-C9, C4-C8, C4-C7, C4-C6, or C4-C5monocyclic or polycyclic alkynyl group. For any of the formulae described herein, the aryl (when present) can be a C4-C30aryl, a C4-C20aryl, a C4-C12aryl, a C4-C11aryl, a C4-C9aryl, a C5-C30aryl, a C5-C20aryl, a C5-C12 aryl, a C5-C11 aryl, a C5-C9aryl, a C6-C20aryl, a C6-C12 aryl, a C6-C11 aryl, or a C6-C9aryl. It is understood that the aryl can be a heteroaryl, such as a C4-C30heteroaryl, a C4-C20heteroaryl, a C4-C12 heteroaryl, a C4-C11 heteroaryl, a C4-C9heteroaryl, a C5-C30heteroaryl, a C5-C20heteroaryl, a C5-C12heteroaryl, a C5-C11heteroaryl, a C5-C9heteroaryl, a C6-C30heteroaryl, a C6-C20heteroaryl, a C6-C12 heteroaryl, a C6-C11 heteroaryl, or a C6-C9heteroaryl. For any of the formulae described herein, the polyaryl group can be a C8-C30polyaryl, a C8-C20polyaryl, a C8-C12 polyaryl, a C8-C11 polyaryl, a C10-C30polyaryl, a C10-C20polyaryl, a C10-C12polyaryl, a C10-C11polyaryl, or a C12-C20polyaryl. It is understood that the aryl can be a polyheteroaryl, such as a C10-C30polyheteroaryl, a C10-C20polyheteroaryl, a C10-C12polyheteroaryl, a C10-C11polyheteroaryl, or a C12-C20polyheteroaryl. Exemplary PLpro inhibitors are presented below.

[0005] Additional PLpro Inhibitors are shown below: The compounds described herein may be neutral or may be one or more pharmaceutically acceptable salts, crystalline forms, non-crystalline forms, hydrates, or solvates, or a combination thereof. References to the compounds may refer to the neutral molecule, and / or those additional forms thereof collectively and individually from the context. Pharmaceutically acceptable salts of the compounds include the acid addition and base salts thereof. Suitable acid addition salts are formed from acids which form non-toxic salts. Examples include the acetate, aspartate, benzoate, besylate, bicarbonate / carbonate, bisulphate / sulphate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hibenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulphate, naphthylate, 2-napsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate and trifluoroacetate salts. Suitable base salts are formed from bases which form non-toxic salts. Examples include the aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine and zinc salts. Hemisalts of acids and bases may also be formed, for example, hemisulphate and hemicalcium salts. The compounds described herein may be in a prodrug from. The term "prodrug" refers to a pharmacologically inactive substance that is converted in the body (e.g., via enzymatic or non-enzymatic action, including pH dependent bioactivation) into a pharmacologically active drug. In certain forms of such prodrugs, the prodrug may contain the drug promoeity linked to an auxophore in a prodrug designed to take advantage of cellular transporters (e.g. wherein the auxophore is a saccharide or disaccharide, or an amino acid or dipeptide). Such a prodrug may exhibit enhanced active transport across cellular membranes in the body; alternatively such a prodrug may inhibit efflux of drug and prodrug via interaction with cellular efflux transporters in the body. Exemplary groups that can convert the disclosed compounds to a prodrug form include, but are not limited to, hydroxyl, carboxyl, amine, phosphate, phosphonate, amidine, guanine and / or carbohydrate. These can be attached to any suitable position of the disclosed compounds to form a prodrug of the compounds. B. Pharmaceutical Composition Containing PLpro Inhibitors Pharmaceutical compositions that contain one or more of the PLpro inhibitors described herein in a form suitable for in vitro or in vivo applications (such as administration to a mammal), are disclosed. The pharmaceutical composition may include one or more pharmaceutically acceptable carriers and / or one or more pharmaceutically acceptable excipients. For example, the pharmaceutical composition may be in the form of a liquid, such as a solution or a suspension, and contain a plurality of the disclosed PLpro inhibitors in an aqueous medium and, optionally, one or more suitable excipients for the liquid composition. Optionally, the pharmaceutical composition is in a solid form, and contains a plurality of the disclosed PLpro inhibitors and one or more suitable excipients for a solid composition. 1. Carriers and Excipients Suitable pharmaceutically acceptable carriers and excipients are generally recognized as safe (GRAS), and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Representative carriers and excipients include solvents (including buffers), diluents, pH modifying agents, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, and stabilizing agents, and a combination thereof. Excipients can be added to a liquid or solid pharmaceutical composition (for in vivo or in vitro applications) to assist in sterility, stability (e.g. shelf-life), integration, and to adjust and / or maintain pH or isotonicity of the PLpro inhibitors in the pharmaceutical composition, such as diluents, pH modifying agents, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, and stabilizing agents, and a combination thereof. PLpro inhibitors for administering to a subject in need thereof, such as a mammal, can be dissolved or suspended in a suitable carrier to form a liquid pharmaceutical formulation, such as sterile saline, phosphate buffered saline (PBS), balanced salt solution (BSS), viscous gel, or other pharmaceutically acceptable carriers for administration. The pharmaceutical formulation may also be a sterile solution, suspension, or emulsion in a nontoxic, parenterally acceptable diluent or solvent. 2. Forms for Administration The disclosed PLpro inhibitors can be formulated into a pharmaceutical composition, in a liquid form or a solid form, as a liquid formulation or a solid formulation for oral administration, mucosal administration (e.g. intravaginal administration, pulmonary administration, and / or administration to other mucosal surfaces), or parenteral administration (e.g. intramuscular administration, intravenous administration, intraperitoneal administration, and subcutaneous administration) to a subject. a. Oral Formulations The pharmaceutical composition containing one or more of the disclosed PLpro inhibitors may be provided in a form suitable for oral administration to a subject, such as a mammal (i.e., an oral composition). Oral administration may involve swallowing, so that the PLpro inhibitors, optionally including additional active agent(s) in the pharmaceutical composition, enter the gastrointestinal tract, or buccal or sublingual administration may be employed by which the PLpro inhibitors enter the blood stream directly from the mouth. Compositions suitable for oral administration include solid compositions such as tablets, capsules containing particulates, liquids, powders, lozenges (including liquid-filled lozenges), chews, multi- and nano-particulates, gels, solid solutions, liposomes, films, ovules, sprays, and liquid compositions. Liquid compositions for oral administration include suspensions, solutions, syrups, and elixirs. Such oral compositions may be employed as fillers in soft or hard capsules and can contain one or more suitable carriers and / or excipients, for example, water, ethanol, polyethylene glycol, propylene glycol, chitosan polymers and chitosan derivatives (e.g. N- trimethylene chloride chitosan, chitosan esters, chitosan modified with hydrophilic groups, such as amino groups, carboxyl groups, sulfate groups, etc.), methylcellulose, a suitable oil, one or more emulsifying agents, and / or suspending agents. Liquid compositions for oral administration may also be prepared by the reconstitution of a solid, for example, from a sachet. Optionally, the PLpro inhibitors are included in a fast-dissolving and / or fast-disintegrating dosage form. For tablet or capsule dosage forms, in addition to the PLpro inhibitors described herein, tablets generally contain disintegrants, binders, diluents, surface active agents, lubricants, glidants, antioxidants, colourants, flavoring agents, preservatives, or taste masking agents, or a combination thereof. Examples of suitable disintegrants for forming a table or capsule dosage form containing the PLpro inhibitors include, but are not limited to, sodium starch glycolate, sodium carboxymethyl cellulose, calcium carboxymethyl cellulose, croscarmellose sodium, crospovidone, polyvinylpyrrolidone, methyl cellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropyl cellulose, starch, pregelatinised starch and sodium alginate. Generally, the disintegrant can have a concentration in a range from about 1 wt% to about 25 wt%, from about 5 wt% to about 20 wt% of the tablet or capsule dosage form containing the PLpro inhibitors. Binders are generally used to impart cohesive qualities to a tablet composition containing the PLpro inhibitors. Suitable binders for forming a tablet or capsule formulation containing the PLpro inhibitors include, but are not limited to, microcrystalline cellulose, gelatin, sugars, polyethylene glycol, natural and synthetic gums, polyvinylpyrrolidone, pregelatinised starch, chitosan polymers and chitosan derivatives (e.g. N-trimethylene chloride chitosan, chitosan esters, chitosan modified with hydrophilic groups, such as amino groups, carboxyl groups, sulfate groups, etc.), hydroxypropyl cellulose, and hydroxypropyl methylcellulose. Suitable diluents for forming a table or capsule composition containing the PLpro inhibitors include, but are not limited to, lactose (as, for example, the monohydrate, spray-dried monohydrate or anhydrous form), chitosan polymers and chitosan derivatives (e.g. N-trimethylene chloride chitosan, chitosan esters, chitosan modified with hydrophilic groups, such as amino groups, carboxyl groups, sulfate groups, etc.), N-sulfonated derivatives of chitosan, quaternarized derivatives of chitosan, carbosyalkylated chitosan, microcrystalline chitosan, mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch and dibasic calcium phosphate dihydrate. Tablet or capsule composition containing the PLpro inhibitors may also contain surface active agents, such as sodium lauryl sulfate and polysorbate 80, and glidants such as silicon dioxide and talc, in the coating. When present, surface active agents can have a concentration in a range from about 0.2 wt% to 5 wt% of the tablet or capsule formulation. Tablet or capsule compositions containing the PLpro inhibitors also generally contain lubricants, such as magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate with sodium lauryl sulphate. Lubricants can have a concentration in a range from about 0.25 wt% to 10 wt%, from about 0.5 wt% to about 3 wt% of the tablet or capsule composition. Other possible excipients included in a tablet or capsule formulation containing the PLpro inhibitors include glidants (e.g. Talc or colloidal anhydrous silica at about 0.1 wt% to about 3 wt% of the table or capsule formulation), antioxidants, colourants, flavouring agents, preservatives and taste-masking agents. When present, glidants can have a concentration in a range from about 0.2 wt% to 1 wt% of the tablet or capsule composition. An exemplary tablet composition contains up to about 80 wt% of the PLpro inhibitors described herein, from about 10 wt% to about 90 wt% binder, from about 0 wt% to about 85 wt% diluent, from about 2 wt% to about 10 wt% disintegrant, and from about 0.25 wt% to about 10 wt % lubricant. Tablet or capsule blends, including the PLpro inhibitors and one or more suitable excipients, may be compressed directly or by roller to form tablets. Tablet or capsule blends or portions of the blends may alternatively be wet-, dry-, or melt-granulated, melt congealed, or extruded before tableting. The final table or capsule composition may contain one or more layers and may be coated or uncoated; it may even be encapsulated in a particle, such as a polymeric particle or a liposomal particle. Solid formulations containing the PLpro inhibitors for oral administration may be formulated to be immediate and / or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release formulations. b. Mucosal Formulation The disclosed PLpro inhibitors can be formulated for pulmonary or mucosal administration. The administration can include delivery of the composition to the lungs, nasal, oral (sublingual, buccal), vaginal, or rectal mucosa. For example, the PLpro inhibitors can also be administered intranasally or by oral inhalation, typically in the form of a dry powder (either alone, as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler or as an aerosol spray from a pressurised container, pump, spray, atomiser (preferably an atomiser using electrohydrodynamics to produce a fine mist), or nebuliser, with or without the use of a suitable propellant, such as water, ethanol -water mixture, 1,1,1,2-tetrafluoroethane or 1,1,1,2,3,3,3-heptafluoropropane. For intranasal or oral inhalation use, the powder may contain a bioadhesive agent, for example, chitosan or cyclodextrin. The term “aerosol” as used herein refers to any preparation of a fine mist of particles, which can be in solution or a suspension, whether or not it is produced using a propellant. Aerosols can be produced using standard techniques, such as ultrasonication or high-pressure treatment. The pressurized container, pump, spray, atomizer, or nebulizer contains a solution or suspension of one or more of the PLpro inhibitors including, for example, ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilising, or extending release of the active, a propellant(s) as solvent and an optional surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid. Capsules (made, for example, from gelatin or hydroxypropylmethylcellulose), blisters and cartridges for use in an inhaler or insufflator may be formulated to contain a powder mix of the PLpro inhibitors described herein, a suitable powder base such as lactose or starch and a performance modifier such as 1-leucine, mannitol, or magnesium stearate. The lactose may be anhydrous or in the form of a monohydrate, preferably the latter. Other suitable excipients include dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose, and trehalose. A suitable solution formulation for use in an atomizer using electrohydrodynamics to produce a fine mist may contain from 1 µg to 20 mg of one or more of the PLpro inhibitors per actuation and the actuation volume may vary from 1 µl to 100 µl. A typical formulation may contain a plurality of the PLpro inhibitors disclosed herein, propylene glycol, sterile water, ethanol and sodium chloride. Alternative solvents that may be used instead of propylene glycol include glycerol and polyethylene glycol. Suitable flavors, such as menthol and levomenthol, or sweeteners, such as saccharin or saccharin sodium, may be added to those formulations intended for inhaled / intranasal administration. Formulations for inhaled / intranasal administration may be formulated to be immediate and / or modified release using for example, PGLA. Modified release formulations include delayed, sustained, pulsed, controlled, targeted, and programmed release formulations. In the case of dry powder inhalers and aerosols, the dosage unit is determined by means of a valve which delivers a metered amount. Units in accordance with the PLpro inhibitors are typically arranged to administer a metered dose or "puff". The overall daily dose will be administered in a single dose or, more usually, as divided doses throughout the day. In some forms, the PLpro inhibitors can be formulated for pulmonary delivery, such as intranasal administration or oral inhalation. Carriers for pulmonary formulations can be divided into those for dry powder formulations and for administration as solutions. Aerosols for the delivery of therapeutic agents to the respiratory tract are known in the art. For administration via the upper respiratory tract, the PLpro inhibitors can be formulated into an aqueous solution, e.g., water or isotonic saline, buffered or un-buffered, or as an aqueous suspension, for intranasal administration as drops or as a spray. Such aqueous solutions or suspensions may be isotonic relative to nasal secretions and of about the same pH, ranging e.g., from about pH 4.0 to about pH 7.4 or, from pH 6.0 to pH 7.0. Buffers should be physiologically compatible and include, simply by way of example, phosphate buffers. One skilled in the art can readily determine a suitable saline content and pH for an innocuous aqueous solution for nasal and / or upper respiratory administration. In some forms, the aqueous solution is water, physiologically acceptable aqueous solutions containing salts and / or buffers, such as phosphate buffered saline (PBS), or any other aqueous solution acceptable for administration to an animal or human. Such solutions are well known to a person skilled in the art and include, but are not limited to, distilled water, de-ionized water, pure or ultrapure water, saline, phosphate-buffered saline (PBS). Other suitable aqueous vehicles include, but are not limited to, Ringer's solution and isotonic sodium chloride. Aqueous suspensions may include suspending agents such as cellulose derivatives, sodium alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting agent such as lecithin. Suitable preservatives for aqueous suspensions include ethyl and n-propyl p-hydroxybenzoate. In some forms, solvents that are low toxicity organic (i.e. nonaqueous) class 3 residual solvents, such as ethanol, acetone, ethyl acetate, tetrahydrofuran, ethyl ether, and propanol may be used for the formulations. The solvent is selected based on its ability to readily aerosolize the formulation. The solvent should not detrimentally react with the PLpro inhibitors. An appropriate solvent should be used that forms a suspension of the PLpro inhibitors. The solvent should be sufficiently volatile to allow formation of an aerosol of the solution or suspension. Additional solvents or aerosolizing agents, such as freons, can be added as desired to increase the volatility of the solution or suspension. In some forms, the pharmaceutical formulations may contain minor amounts of surfactants or other excipients well known to those of the art. In this context, “minor amounts” means no excipients are present that might affect or mediate penetration of the PLpro inhibitors in tissues and that the excipients that are present in amount that do not adversely affect penetration of the PLpro inhibitors in tissues. In some forms, the pharmaceutical formulations containing one or more of the PLpro inhibitors can be administered directly to the mucous membranes (including the surface membranes of the nose, lungs and mouth), such that PLpro inhibitors cross the mucosal layer and enters the underlying tissues. Such formulations for direct application on the mucous membrane generally contain a dermatologically acceptable carrier that is suitable for application to the mucous membrane, has good aesthetic properties, is compatible with the active agents and any other components, and will not cause any untoward safety or toxicity concerns. The carrier can be in a wide variety of forms. For example, emulsion carriers, including, but not limited to, oil-in-water, water-in-oil, water-in-oil-in-water, and oil-in-water-in-silicone emulsions, are useful herein. These emulsions can cover a broad range of viscosities, e.g., from about 100 cps to about 200,000 cps. These emulsions can also be delivered in the form of sprays using either mechanical pump containers or pressurized aerosol containers using conventional propellants. These carriers can also be delivered in the form of a mousse or a transdermal patch. Other suitable topical carriers include anhydrous liquid solvents such as oils, alcohols, and silicones (e.g., mineral oil, ethanol isopropanol, dimethicone, cyclomethicone, and the like); aqueous-based single phase liquid solvents (e.g., hydro-alcoholic solvent systems, such as a mixture of ethanol and / or isopropanol and water); and thickened versions of these anhydrous and aqueous-based single phase solvents (e.g. where the viscosity of the solvent has been increased to form a solid or semi-solid by the addition of appropriate gums, resins, waxes, polymers, salts, and the like). Examples of topical carrier systems useful in the present formulations are described in the following four references all of which are incorporated herein by reference in their entirety: “Sun Products Formulary” Cosmetics & Toiletries, vol.105, pp.122-139 (December 1990); “Sun Products Formulary,” Cosmetics & Toiletries, vol.102, pp.117-136 (March 1987); U.S. Pat. No.5,605,894 to Blank et al., and U.S. Pat. No.5,681,852 to Bissett. Formulations for direct application on the mucous membrane may be formulated to be immediate and / or modified release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release formulations. Thus, the PLpro inhibitors may be formulated as a solid, semi-solid, or thixotropic liquid for administration as an implanted depot providing modified release of the active agents. Examples of such formulations include drug-coated stents. c. Parenteral Formulations Optionally, the pharmaceutical composition containing one or more of the disclosed PLpro inhibitors is in a form suitable for administration directly into the blood stream, into muscle, or into an internal organ. Suitable routes for such parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intraurethral, intrasternal, intracranial, intramuscular, and subcutaneous delivery. Suitable means for parenteral administration include needle (including microneedle) injectors, needle-free injectors, and infusion techniques. For example, the pharmaceutical formulation containing one or more of the PLpro inhibitors is in a form suitable for intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. Parenteral formulations containing the PLpro inhibitors described herein are typically aqueous solutions which can contain excipients such as salts, carbohydrates and buffering agents (e.g., from about pH 6.5 to about pH 8.0, from about pH 6.5 to about pH 7.4, from about pH 6.5 to about pH 7.0, from about pH 7.0 to pH 8.0, or from about pH 7.0 to about pH 7.4), but, for some applications, they may be more suitably formulated as a sterile aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water. The liquid compositions containing the PLpro inhibitors for parenteral administration may be a solution, a suspension, or an emulsion. The liquid pharmaceutically acceptable carrier forming the parenteral composition containing the PLpro inhibitors can include one or more physiologically compatible buffers, such as a phosphate buffers. One skilled in the art can readily determine a suitable saline content and pH for an aqueous carrier for administration (e.g., from about pH 6.5 to about pH 8.0, from about pH 6.5 to about pH 7.4, from about pH 6.5 to about pH 7.0, from about pH 7.0 to pH 8.0, or from about pH 7.0 to about pH 7.4). Liquid compositions containing the PLpro inhibitors for parenteral administration may include one or more suspending agents, such as cellulose derivatives, sodium alginate, polyvinylpyrrolidone, gum tragacanth, or lecithin. The liquid compositions may also include one or more preservatives, such as ethyl or n-propyl p-hydroxybenzoate. Optionally, the liquid composition containing the PLpro inhibitors contains one or more solvents that are low toxicity organic (i.e., nonaqueous) class 3 residual solvents, such as ethanol, acetone, ethyl acetate, tetrahydofuran, ethyl ether, and propanol, and a combination thereof. Any such solvents included in the liquid formulation should not detrimentally react with the PLpro inhibitors or any additional active agents in the liquid composition. Solvents such as freon, alcohol, glycol, polyglycol, or fatty acid, can also be included in the liquid composition containing the PLpro inhibitors as desired to increase the volatility of the solution or suspension. Liquid compositions containing the PLpro inhibitors for parenteral administration may also contain minor amounts of polymers, surfactants, or other pharmaceutically acceptable excipients known to those in the art. In this context, "minor amounts" means an amount that is sufficiently small to avoid adversely affecting uptake of the PLpro inhibitors by the targeted cells, such as pituitary gonadotrophs. The preparation of parenteral compositions containing the PLpro inhibitors is typically under sterile conditions, for example, by lyophilisation, which can be accomplished using standard pharmaceutical techniques known to those skilled in the art. Compositions for parenteral administration containing the PLpro inhibitors may be formulated to provide immediate and / or modified release of the active agent. Modified release formulations include delayed, sustained, pulsed, controlled, targeted and programmed release formulations. d. Amount of PLpro Inhibitors Pharmaceutical compositions typically contain an effective amount of the PLpro inhibitors and one or more pharmaceutically acceptable carriers and / or excipients. As used herein, the term “effective amount” means any amount of the PLpro inhibitors that is sufficient to achieve the desired therapeutic, prophylactic, and / or diagnostic effect on a biological sample or in a subject to which it is administered. Depending on the condition to be treated and / or the route of administration, such an effective amount of the PLpro inhibitors can be from about 0.01 mg / kg to about 250 mg / kg body weight, from about 0.1 mg / kg to about 250 mg / kg body weight, from about 0.01 mg / kg to about 200 mg / kg body weight, from about 0.1 mg / kg to about 200 mg / kg body weight, from about 0.01 mg / kg to about 150 mg / kg body weight, from about 0.1 mg / kg to about 150 mg / kg body weight, from about 0.01 mg / kg to about 100 mg / kg body weight, from about 0.1 mg / kg to about 100 mg / kg body weight, from about 0.01 mg / kg to about 50 mg / kg body weight, from about 0.1 mg / kg to about 50 mg / kg body weight, from about 0.01 mg / kg to about 10 mg / kg body weight, from about 0.1 mg / kg to about 10 mg / kg body weight, or from about 0.5 mg / kg to about 50 mg / kg body weight, of the subject per day, which can be administered as a single daily dose, divided over one or more daily doses. For example, the effective amount of the PLpro inhibitors is from about 0.1 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 60 mg / kg, about 70 mg / kg, about 80 mg / kg, about 90 mg / kg, about 100 mg / kg, about 110 mg / kg, about 120 mg / kg, about 130 mg / kg, about 140 mg / kg, about 150 mg / kg, about 160 mg / kg, about 170 mg / kg, about 180 mg / kg, about 190 mg / kg, about 200 mg / kg, about 210 mg / kg, about 220 mg / kg, about 230 mg / kg, about 240 mg / kg, or about 250 mg / kg, of the subject per day, which can be administered as a single daily dose, divided over one or more daily doses. The amount of the PLpro inhibitors administered, the route of administration, and the further treatment regimen can be determined by the treating clinician or testing technologies, depending on factors such as the age, gender and general condition of the subject, the nature and severity of the disease / symptoms being prevented, treated, or diagnosed, and / or the samples being tested. In some forms, the pharmaceutical composition is in a unit dosage form, and can be suitably packaged, for example in a box, blister, vial, bottle, sachet, ampoule or in any other suitable single-dose or multi-dose holder or container (which can be properly labeled); optionally with one or more leaflets containing product information and / or instructions for use. Generally, such unit dosages can contain between 0.1 and 1000 mg, and usually between 0.1 and 500 mg, between 5 and 500 mg, between 0.1 and 100 mg, or between 1 and 100 mg, of the disclosed PLpro inhibitors, e.g., about 0.1, 1, 5, 10, 25, 50, 100, 200, 300 or 400 mg per unit dosage. e. Additional Active Agents In some forms, the pharmaceutical composition containing the PLpro inhibitors also contains one or more additional active agent, such as an anti-inflammatory agent, an antioxidant, antiviral agent, an antimalaria agent, or a biologic agent, or a combination thereof. For example, one or more additional active agents is formulated into the same pharmaceutical composition containing one or more of the PLpro inhibitors described herein as a single dosage unit or as multiple dosage units for coordinated, combination, or concomitant administration, or into separate pharmaceutical compositions for combinational therapy. Alternatively, the one or more additional active agents may be formulated as separate pharmaceutical compositions, for example, as a single dosage unit or as multiple dosage units, for co-administration with the pharmaceutical composition containing one or more of the PLpro inhibitors described herein. Examples of anti-inflammatory agents that can be formulated in the pharmaceutical composition containing the disclosed PLpro inhibitors or in a separate pharmaceutical composition include, but are not limited to, steroids, such as clobetasol, halobetasol, halcinonide, amcinonide, betamethasone, desoximetasone, diflucortolone, fluocinolone, fluocinonide, mometasone, clobetasone, desonide, hydrocortisone, prednicarbate, and triamcinolone, salts thereof, and combinations thereof; non-steroidal anti-inflammatory drugs, such as aceclofenac, aspirin, celecoxib, clonixin, dexibupáfen, dexketoprofen, diclofenac, diflunisal, droxicam, etodolac, etoricoxib, fenoprofen, flufenamic acid, flurbiprofen, ibuprofen, indomethacin, isoxicam, ketoprofen, ketorolac, licofelone, lornoxicam, loxoprofen, lumiracoxib, meclofenamic acid, mefenamic acid, meloxicam, nabumetone, naproxen, nimesulide, oxaprozin, parecoxib, phenylbutazone, piroxicam, rofecoxib, salsalate, sulindac, tenoxicam, tolfenamic acid, tolmetin, and valdecoxib, and combinations thereof. Examples of antioxidants that can be formulated in the pharmaceutical composition containing the disclosed PLpro inhibitors or in a separate pharmaceutical composition include, but are not limited to, vitamin C, vitamin E, beta-carotene, carotenoids, and minerals, such as selenium and manganese, and combinations thereof. Examples of antiviral agents that can be formulated in the pharmaceutical composition containing the disclosed PLpro inhibitors or in a separate pharmaceutical composition include, but are not limited to, remdesivir (e.g., Veklury®), favipiravir (e.g., Avigan®), lopinavir / ritonavir (e.g., Kaletra®, Aluvia®), nitazoxanide (e.g., Alinia®), danoprevir (e.g., Ganovo®), ASC-09, umifenovir (e.g., Arbidol®), nafamostat, brequinar, AT-527, ABX464, merimepodib, molnupiravir, opaganib (e.g., Yeliva®), ivermectin (e.g., Soolantra®, Stromectol®, Sklice®), and hydroxychloroquine, and combinations thereof. Examples of antimalaria agents that can be formulated in the pharmaceutical composition containing the disclosed PLpro inhibitors or in a separate pharmaceutical composition include, but are not limited to, hydroxychloroquine and chloroquine. Examples of biologic agents that can be formulated in the pharmaceutical composition containing the disclosed PLpro inhibitors or in a separate pharmaceutical composition include, but are not limited to, antibodies, for example, an antibody recognizing at least a portion of the SARS-CoV-2 coronavirus, such as an epitope on a spike protein; and vaccine, for example, a vaccine against the SARS-CoV-2 coronavirus. In some forms, the vaccine can be BNT162b2 (Pfizer / BioNTech), mRNA-1273 (Moderna), AZD1222 / ChAdOxl (AstraZeneca / Oxford Univ), Ad5-vectored COVID-19 vaccine (CanSino Biologies), CoronaVac (Sinovac), and / or NVX-CoV2373 (Novavax). When formulated into a pharmaceutical composition that is separated from the pharmaceutical composition containing the disclosed PLpro inhibitors, the one or more additional active agents may be formulated in various formulations, for example, injectable formulations, lyophilized formulations, liquid formulations, or oral formulations. The formulation can be selected based upon the suitable administration route. C. Devices and Kits Delivery devices and kits including one or more of the PLpro inhibitors are also disclosed. 1. Delivery Device The PLpro inhibitors disclosed herein, typically formulated into a pharmaceutical formulation, can be delivered in any suitable container. Suitable containers for use in the delivery device can provide one or more single dosage or multi-dosages of a pharmaceutical formulation containing the PLpro inhibitors contained therein for the desired application. In some forms, the pharmaceutical formulation containing the PLpro inhibitors is in a liquid form, such as an emulsion or aqueous suspension, that can be delivered in a suitable container. Such suitable container can deliver the emulsion or aqueous suspension intranasally or via inhalation, such as dropper and spray bottles and any suitable unpressurized spray device or pressurized spray device, such as an inhaler or nebulizer. Nasal delivery devices, such as sprays, nose droppers or needle-less syringes, may be employed to target the agent to different regions of the nasal cavity. OptiMist™ is a breath actuated device that targets liquid or powder nasal formulations to the nasal cavity, including the olfactory region, without deposition in the lungs or esophagus (Djupesland et al., Laryngoscope, 116:466 (2006)). The ViaNase™ device can also be used to target a nasal spray to the olfactory and respiratory epithelia of the nasal cavity. Nasal drops tend to deposit on the nasal floor and are subjected to rapid mucociliary clearance, while nasal sprays are distributed to the middle meatus of the nasal mucosa (Scheibe et al., Arch. Otolaryngol. Head Neck Surg., 134:643 (2008)). See also Djupesland, Drug Delivery and Translational Research volume 3, pages 42–62 (2013), which is specifically incorporated by reference herein in its entirety. An exemplary delivery device includes a pressurized metered dose inhaler, having the pharmaceutical formulation contained therein. Such a metered dose inhaler can deliver a unit dosage of the pharmaceutical formulation per puff, which can be adjusted based on subject-dependent variables (e.g., age, immune system health, etc.), the disease or disorder being treated, as well as the pharmacokinetics of the agent being administered. For example, each puff of the pressurized metered dose inhaler is configured to deliver a unit dosage of the pharmaceutical formulation, which contains the PLpro inhibitors in an amount ranging from about 0.01 mg to about 20 mg, from about 0.01 mg to about 10 mg, from about 0.05 mg to about 20 mg, from about 0.05 mg to about 10 mg, from about 0.1 mg to about 20 mg, from about 0.1 mg to about 10 mg, from about 0.1 mg to about 5 mg, from about 0.5 mg to about 20 mg, from about 0.5 mg to about 10 mg, from about 0.5 mg to about 5 mg, from about 1 mg to about 20 mg, or from about 1 mg to about 10 mg. 2. Kit The PLpro inhibitors disclosed herein, typically formulated into a pharmaceutical formulation, may be included in a kit, along with a suitable application tool for applying the pharmaceutical formulation intranasally by an end user. The application tool may be packaged together or separately with the pharmaceutical formulation containing the PLpro inhibitors in the kit. The kits may also include instructions in a tangible medium. An exemplary kit includes one or more nasal swabs and the pharmaceutical formulation containing the PLpro inhibitors, such as an emulsion or aqueous suspension. The one or more nasal swabs are typically sterile. The nasal swab(s) and the pharmaceutical formulation may be packaged separately. For example, the pharmaceutical formulation is packaged in a suitable container and the nasal swab(s) are packaged in a pouch. Alternatively, the nasal swab may be impregnated or saturated with the pharmaceutical formulation. The impregnated / saturated nasal swab is packaged in a sealed pouch prior to use. In some forms, the kits further include one or more additional active agents such as any one of those described above, or pharmaceutical formulations thereof. In these forms, the PLpro inhibitors and the additional active agents may be present in a single composition or in separate compositions in the kit. III. Methods of Use The PLpro inhibitors have high potency, e.g., an IC50value ranging from 0.4 nM to about 300 nM. Such a potency of the disclosed PLpro inhibitors is at least 10 times higher than the non-covalent PLpro inhibitors as described in WO2022 / 169891 (see, e.g., Figures 1A-1I). Thus, the disclosed PLpro inhibitors are particular useful for preventing and / or treating diseases or disorders caused by a virus. The virus can be any respiratory virus that contains PLpro, preferably a coronavirus, such as SARS-CoV-1 or SARS-CoV-2. It will be appreciated the disclosed methods can be methods of treatment of the symptoms and conditions described herein. “Treatment” refers to the medical management of a patient with the intent to cure, ameliorate, or stabilize, a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. Any of the methods can include administering an effective amount of a disclosed formulation to the subject. An effective amount or therapeutically effective amount means a dosage and / or other element (e.g., amount of time) sufficient to treat, inhibit, or alleviate one or more symptoms of a disease state being treated or to otherwise provide a desired pharmacologic and / or physiologic effect. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc.), the disease, and the treatment being administered. A. Preventing Symptoms of Viral Infection In some forms, the disclosed PLpro inhibitors or pharmaceutical composition containing the PLpro inhibitors can be used for preventing diseases or disorders caused by a coronavirus, such as SARS-CoV-1 or SARS-CoV-2, which includes but is not limited to variants of the original isolate (e.g., B.1.617.2 (Delta) and / or B.1.1.529 (Omicron)). In these forms, the method general includes administering the pharmaceutical composition to a subject in need thereof. The pharmaceutical composition can be administered by any suitable routes, such as by mucosal administration (e.g., intranasal administration), oral administration, intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. The administration step can be performed once or repeated one or more times. For example, the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. Typically, following the administration or all of the administrations of the disclosed pharmaceutical formulation, an effective amount of the PLpro inhibitor is administered to the subject to prevent or reduce symptoms associated with a disease or disorder caused by the virus, such as a SARS-CoV-2. For example, following the administration or all of the administrations of the disclosed pharmaceutical formulation, the subject shows no symptom or less symptoms associated with a disease or disorder caused by the virus, such as headache, persistent loss of smell, persistent loss of taste, memory loss, brain fog (difficulty concentrating, sense of confusion or disorientation), dizziness, anxiety, depression, earache, hearing loss, ringing in ears (tinnitus), fatigue, or gastrointestinal issues, or a combination thereof, compared to a control. The control is a subject administered with the pharmaceutical formulation without the PLpro inhibitors, such as a normal saline nasal formulation. In these forms, the administration step is performed before and / or after an expected exposure of the subject to the virus. For example, the subject was in close contact with an individual infected by the virus, as indicated by having a positive test result of the virus or having one or more symptoms of the viral infection, such as fever, cough, shortness of breath, diarrhea, sneezing, runny nose, and / or sore throat. The term “in close contact” can be, for example, being 6 feet of less away from an infected person for a total of 15 minutes or more over a 24-hour period, providing care at home to someone who is infected, having direct physical contact with the person (hugged or kissed them) who is infected, sharing eating or drinking utensils with an infected person, having been sneezed on, coughed on, or otherwise by contacted by respiratory droplets from an infected person. For example, the administration step is performed within 24 hours, within 18 hours, within 12 hours, within 6 hours, within 4 hours, within 2 hours, or within 1 hour before the subject is expected to be exposed to a virus. For example, the administration step is performed within 24 hours, within 18 hours, within 12 hours, within 6 hours, within 4 hours, within 2 hours, or within 1 hour after the subject is tested positive for a viral infection (counting from the time point that positive test result is received by the subject). In these forms, administration of the pharmaceutical composition containing the disclosed PLpro inhibitors may protect the subject from getting infected by the virus after exposure. Alternatively, the subject may become asymptomatically infected (i.e., having a positive test result for the virus without any symptoms) or show minor symptoms of a viral infection. For example, the subject may be infected by the virus, as indicated by a positive test result for the virus, while showing no symptom or less symptoms associated with diseases and / or disorders caused by the virus, such as headache, persistent loss of smell, persistent loss of taste, memory loss, brain fog (difficulty concentrating, sense of confusion or disorientation), dizziness, anxiety, depression, earache, hearing loss, ringing in ears (tinnitus), fatigue, or gastrointestinal issues, or a combination thereof, compared to a control. In some forms, the method further includes administering an additional active agent prior to, during, and / or subsequent to step (i), the administration step. The active agent can be any one of those described above, such as an antiviral agent or anti- inflammatory agent, or a combination thereof. B. Treating Viral Infection In some forms, the disclosed PLpro inhibitors or pharmaceutical composition containing the PLpro inhibitors can be used for treating diseases or disorders caused by a coronavirus, such as SARS-CoV-1 or SARS-CoV-2, which includes but is not limited to variants of the original isolate (e.g., B.1.617.2 (Delta) and / or B.1.1.529 (Omicron)). In these forms, the method general includes administering the pharmaceutical composition to a subject in need thereof. The pharmaceutical composition can be administered by any suitable routes, such as by mucosal administration (e.g., intranasal administration), oral administration, intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. The administration step can be performed once or repeated one or more times. For example, the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. In these forms, the administration step is typically performed after the subject is infected with the coronavirus. For example, the subject shows one or more symptoms associated with the disease or disorder caused by the coronavirus. Typically, following the administration or all of the administrations of the disclosed pharmaceutical formulation, an effective amount of the PLpro inhibitor is administered to the subject to relief or reduce symptoms associated with the disease or disorder caused by the virus, such as a SARS-CoV-2. For example, following the administration or all of the administrations of the disclosed pharmaceutical formulation, the subject (while still tested positive for the virus or after recovered from the infection as indicated by a negative positive for the virus) shows no symptom or less symptoms associated with a disease or disorder caused by the virus, such as headache, persistent loss of smell, persistent loss of taste, memory loss, brain fog (difficulty concentrating, sense of confusion or disorientation), dizziness, anxiety, depression, earache, hearing loss, ringing in ears (tinnitus), fatigue, or gastrointestinal issues, or a combination thereof, compared to the subject prior to the administration or first administration. In some forms, the relief or reduction of the symptoms occurs within an hour, within 3 hours, within 6 hours, within 12 hours, within one day, within two days, or within 3 days following the administration of all of the administration of the pharmaceutical composition. In some forms, the method further includes administering an additional active agent prior to, during, and / or subsequent to step (i), the administration step. The active agent can be any one of those described above, such as an antiviral agent or anti- inflammatory agent, or a combination thereof. The disclosed compositions and methods can be further understood through the following enumerated paragraphs. 1. A compound having a structure of: Formula I or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3 are independently —N or —CR’, and R’ is H or halogen; Ar is aryl, polyaryl, heteroaryl, heteropolyaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Ar group can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; R1 and R2 are independently —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl, or —C1-C6haloalkyl. 2. The compound of paragraph 1, having a structure of: Formula II or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3 cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y6 are independently —N or —CR’, and R’ is H or halogen; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R3is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which can be optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R4, R5, and R6are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1- C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’, or R4 and R5 together or R5 and R6 together with the carbon atoms to which they are attached form an aryl, a heteroaryl, a heterocyclyl, a cycloalkyl, or a cycloalkenyl; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 3. The compound of paragraph 1 or 2, having a structure of: Formula IIIa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y4-Y10are independently—N or —CH; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 4. The compound of paragraph 1 or 2, having a structure of: Formula IIIb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3are independently —N or —CR’, and R’ is H or halogen; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which can be optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R8and R9are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’, each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 5. The compound of any one of paragraphs 1-3, having a structure of: Formula IVa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 6. The compound of any one of paragraphs 1, 2, and 4, having a structure of:

[0006] Formula IVb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which can be optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 7. The compound of any one of paragraphs 1, 2, 4, and 6, having a structure of: or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R9and R10are independently —H, halogen, —(C1-C6alkylenyl)NRaRb, —ORa, — (C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl can be optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup can be optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, — C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6alkylenyl)- C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 8. The compound of paragraph 7, wherein R9 and R10 are independently —H, halogen, or —(C1-C6alkylenyl)Rc, and Rcis a heteroaryl or heterocyclyl. 9. The compound of any one of paragraphs 1-8, wherein R1 is —H, halide, —NRaRb, —ORa, —C1-C6alkyl, and each occurrence of Raand Rbis independently —H, —C1-C6haloalkyl, or heterocyclyl, optionally wherein the heterocyclyl is azetidinyl, which can be optionally substituted with —C1-C6haloalkyl. 10. The compound of any one of paragraphs 1-9, wherein R2 is —C1-C6alkyl, —C1-C5alkyl, —C1-C4alkyl, —C1-C3alkyl, or —C1-C2alkyl, such as methyl. 11. The compound of any one of paragraphs 1-10, wherein X is and wherein: n1 is an integer from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2;

[0007] , X’ is a heterocyclyl, n2-n5 are independently an integer from 0 to 6, from 0 to 5, from o to 4, from 0 to 3, or from 0 to 2; and Z’ is a carboxyl, an ester, an amide, or a heterocyclyl. 12. The compound of paragraph 11, wherein X’ is ; J1-J10are independently carbon, oxygen, sulfur, or nitrogen; R’4, R’5, R’6, R’8, and R’9 are independently absent, hydrogen, oxygen, or sulfur. 13. The compound of paragraph 11 or 12, wherein L1is wherein Q1-Q3 are independently carbon, oxygen, sulfur, or nitrogen, and W is oxygen or sulfur. 14. The compound of any one of paragraphs 11-13, wherein Z’ is a heterocyclyl or ; R11is -OR12, -NR13R14, or a heterocyclyl; and R12-R14are independently hydrogen or C1-C6alkyl optionally substituted with hydroxyl or halogen. 15. The compound of any one of paragraphs 1-14, wherein X is 16. The compound of any one of paragraphs 1-14, having any one of the following structures:

[0008] 17. A pharmaceutical composition comprising the compound of any one of paragraphs 1-16, and optionally one or more pharmaceutically acceptable excipients. 18. The pharmaceutical composition of paragraph 17, further comprising a second active agent, optionally wherein the second active agent is anti-inflammatory agent, an antioxidant, or antiviral agent, or a combination thereof. 19. A method for preventing a disease or disorder caused by a coronavirus using the pharmaceutical composition of any one of paragraphs 17 or 18 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. 20. The method of paragraph 19, wherein the pharmaceutical composition is administered by intranasal administration, oral administration, intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. 21. The method of paragraph 19 or 20, wherein the subject is exposed to or is expected to be exposed to an individual having one or more symptoms of a viral infection, such as with fever, cough, shortness of breath, diarrhea, sneezing, runny nose, and / or sore throat. 22. The method of any one of paragraphs 19-21, wherein the administration is performed before and / or after the subject is exposed to the coronavirus. 23. The method of paragraph 22, wherein the administration is performed within 24 hours, within 18 hours, within 12 hours, within 6 hours, within 4 hours, within 2 hours, or within 1 hour after the subject is tested positive for a viral infection (counting from the time point that positive test result is received by the subject). 24. The method of any one of paragraphs 19-23, wherein the method comprises repeating step (i), and optionally wherein the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. 25. The method of any one of paragraphs 19-24, wherein following the administration or all of the administrations, the subject shows no or less symptoms associated with disease or disorder caused by the coronavirus, compared to a control. 26. The method of any one of paragraphs 19-25, wherein the coronavirus is a respiratory virus such as SARS-CoV-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). 27. The method of any one of paragraphs 19-26, further comprising administering an active agent prior to, during, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent or anti-inflammatory agent, or a combination thereof. 28. A method for treating a disease or disorder caused by a coronavirus using the pharmaceutical composition of paragraphs 17 or 18 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. 29. The method of paragraph 28, wherein the subject is infected with the coronavirus, optionally wherein the subject shows one or more symptoms associated with the disease or disorder caused by the coronavirus. 30. The method of paragraph 28 or 29, wherein the coronavirus is a respiratory virus such as a SARS-CoV-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). 31. The method of any one of paragraphs 28-30, wherein the method comprises repeating step (i), and optionally wherein the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. 32. The method of any one of paragraphs 28-31, wherein following the administration or all of the administrations, the subject shows less or none of the symptoms associated with the disease or disorder caused by the coronavirus, compared to the subject prior to the administration or first administration, optionally wherein the relief of the symptoms occurs within an hour, within 3 hours, within 6 hours, within 12 hours, within one day, within two days, or within 3 days following the administration of all of the administration of the pharmaceutical composition. 33. The method of any one of paragraphs 28-32, further comprising administering an active agent prior to, during, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent or anti-inflammatory agent, or a combination thereof. The disclosed compositions and methods can be further understood through the following enumerated paragraphs. 1. A compound having a structure of: Formula I or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3are independently —N or —CR’, and R’ is H or halogen; Ar is aryl, polyaryl, heteroaryl, heteropolyaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Ar group is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; R1and R2are independently —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, -halogen, -CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl, or —C1-C6haloalkyl. 2. The compound of paragraph 1, having a structure of: Formula II or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y6 are independently —N or —CR’, and R’ is H or halogen; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R3and R5is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R4and R6are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups;—C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, -halogen, -CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 3. The compound of paragraph 1 or 2, having a structure of: Formula VIa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, X1, X2, and X3 are independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1is an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1, Z2, and Z3are each independently selected from the group consisting of C, O, S, N, NH, CH2, where the substituent(s)s, when present on Z1, is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with a substituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 4. The compound of paragraph 1, having a structure of: Formula VIb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, X1, X2, and X3 are independently—C1-C6alkyl, —(C1-C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1is an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Y is independently keto (C=O), NH, CH2or S(O)2; Z1, Z2, and Z3 are each independently selected from the group of C, O, S, N, NH, CH2; the substituent(s), when present on Z1, is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 5. The compound of paragraph 1, having a structure of: Formula IIIa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y4-Y10are independently—N or —CH; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 6. The compound of paragraph 1, having a structure of: Formula IIIb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3 are independently —N or —CR’, and R’ is H or halogen; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R8and R9are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’, each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 7. The compound of paragraph 1 or 5, having a structure of: Formula IVa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6 alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 8. The compound of any one of paragraphs 1, 2, and 6, having a structure of: Formula IVb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3 substituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — N(Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 9. The compound of any one of paragraphs 1, 2, 6, and 8, having a structure of:

[0009] Formula V or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1- C6alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —— C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, — C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, where the — C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, — S(O)2NReRf, and —Rc; R9and R10are independently —H, halogen, —(C1-C6alkylenyl)NRaRb, —ORa, — (C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionally substituted with a substituent selected from the group consisting of — ORe, —NReRf, —C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein each heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6alkenyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —C(O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)- ORe, —(C1-C6alkylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)- N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. 10. The compound of paragraph 9, wherein R9 and R10 are independently —H, halogen, or —(C1-C6alkylenyl)Rc, and Rcis a heteroaryl or heterocyclyl. 11. The compound of any one of paragraphs 1-10, wherein R1 is —H, halide, — NRaRb, —ORa, —C1-C6alkyl, and each occurrence of Raand Rbis independently —H, — C1-C6haloalkyl, or heterocyclyl, optionally wherein the heterocyclyl is azetidinyl, which is optionally substituted with —C1-C6haloalkyl. 12. The compound of any one of paragraphs 1-11, wherein R2 is —C1-C6alkyl, —C1- C5alkyl, —C1-C4alkyl, —C1-C3alkyl, or —C1-C2alkyl, such as methyl. 13. The compound of any one of paragraphs 1-12, wherein X is and wherein: n1 is an integer from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2; X’ is a heterocyclyl, n2-n5 are independently an integer from 0 to 6, from 0 to 5, from o to 4, from 0 to 3, or from 0 to 2; and Z’ is a carboxyl, an ester, an amide, or a heterocyclyl. 14. The compound of paragraph 13, wherein X’ is J1-J10 are independently carbon, oxygen, sulfur, or nitrogen; R’4, R’5, R’6, R’8, and R’9are independently absent, hydrogen, oxygen, or sulfur. 15. The compound of paragraph 13 or 14, wherein L1is wherein Q1-Q3are independently carbon, oxygen, sulfur, or nitrogen, and W is oxygen or sulfur. 16. The compound of any one of paragraphs 13-15, wherein Z’ is a heterocyclyl or R11is -OR12, -NR13R14, or a heterocyclyl; and R12-R14are independently hydrogen or C1-C6alkyl optionally substituted with hydroxyl or halogen. 17. The compound of any one of paragraphs 1-16, wherein X is

[0010] 18. The compound of any one of paragraphs 1-16, having any one of the following structures:

[0011]

[0012] 19. A pharmaceutical composition comprising the compound of any one of paragraphs 1-18, and optionally one or more pharmaceutically acceptable excipients. 20. The pharmaceutical composition of paragraph 19, further comprising a second active agent, optionally wherein the second active agent is anti-inflammatory agent, an antioxidant, or antiviral agent, or a combination thereof. 21. A method for preventing a disease or disorder caused by a coronavirus using the pharmaceutical composition of any one of paragraphs 19 or 20 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. 22. The method of paragraph 21, wherein the pharmaceutical composition is administered by intranasal administration, oral administration, intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. 23. The method of paragraph 21 or 22, wherein the subject is exposed to or is expected to be exposed to an individual having one or more symptoms of a viral infection, such as with fever, cough, shortness of breath, diarrhea, sneezing, runny nose, and / or sore throat. 24. The method of any one of paragraphs 21-23, wherein the administration is performed before and / or after the subject is exposed to the coronavirus. 25. The method of paragraph 24, wherein the administration is performed within 24 hours, within 18 hours, within 12 hours, within 6 hours, within 4 hours, within 2 hours, or within 1 hour after the subject is tested positive for a viral infection (counting from the time point that positive test result is received by the subject). 26. The method of any one of paragraphs 21-25, wherein the method comprises repeating step (i), and optionally wherein the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. 27. The method of any one of paragraphs 21-26, wherein following the administration or all of the administrations, the subject shows no or less symptoms associated with disease or disorder caused by the coronavirus, compared to a control. 29. The method of any one of paragraphs 21-27, wherein the coronavirus is a respiratory virus such as SARS-CoV-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). 29. The method of any one of paragraphs 21-28, further comprising administering an active agent prior to, during, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent or anti-inflammatory agent, or a combination thereof. 30. A method for treating a disease or disorder caused by a coronavirus using the pharmaceutical composition of paragraphs 19 or 20 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. 31. The method of paragraph 30, wherein the subject is infected with the coronavirus, optionally wherein the subject shows one or more symptoms associated with the disease or disorder caused by the coronavirus. 32. The method of paragraph 30 or 31, wherein the coronavirus is a respiratory virus such as a SARS-CoV-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). 33. The method of any one of paragraphs 30-32, wherein the method comprises repeating step (i), and optionally wherein the administration step is repeated once, twice, or three times, per day, for a period of one day, three days, one week, two weeks, one month, three months, six months, or one year. 34. The method of any one of paragraphs 30-33, wherein following the administration or all of the administrations, the subject shows less or none of the symptoms associated with the disease or disorder caused by the coronavirus, compared to the subject prior to the administration or first administration, optionally wherein the relief of the symptoms occurs within an hour, within 3 hours, within 6 hours, within 12 hours, within one day, within two days, or within 3 days following the administration of all of the administration of the pharmaceutical composition. 35. The method of any one of paragraphs 30-34, further comprising administering an active agent prior to, during, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent or anti-inflammatory agent, or a combination thereof. The present invention will be further understood by reference to the following non-limiting examples. Examples Example 1. SARS-CoV-2 PLpro inhibitors show superior PLpro inhibition activity Exemplary PLpro inhibitors are synthesized and characterized. The exemplary PLpro demonstrated surprisingly high potency of the disclosed PLpro inhibitors for PLpro (i.e., an IC50value ranging from 0.4 nM to about 300 nM). Such a potency of the disclosed PLpro inhibitors is at least 10 times higher than the non-covalent PLpro inhibitors disclosed in WO2022 / 169891 (see, e.g., Figures 1A-1I). The data below also demonstrated the antiviral activity of the disclosed PLpro inhibitors against coronaviruses and their effectiveness in treating viral infection. Materials and Methods Cell Culture Human alveolar epithelial cell line (A549-hACE2 / TMRSS2) that express hACE2 was used. They were grown in RPMI-1640 supplemented with 10% fetal bovine serum (Gibco) and 100 ug / mL streptomycin (Gibco). All cells were grown at 37 C and 5% CO2. Low passage A549 cells (40,000 cells / well) were seeded in 24-well plates and incubated at 37 C and 5% CO2 for 24 hours prior to a 48h treatment. All compounds were dissolved in DMSO and final DMSO concentrations did not exceeded 1%. PLpro Primary Assay The PLpro primary assay, which measures protease activity with the short peptide substrate Z-RLRGG-AMC (Bachem), was performed in black, flat-bottom 384-well plates containing a final reaction volume of 50 μL. The assays were assembled at room temperature as follows: 40 µL of 50 nM PLpro in Buffer B (50 mM HEPES, pH 7.5, 0.1 mg / mL BSA, 0.01% Triton-X 100, and 5 mM DTT) was dispensed into wells containing 0.1-1 µL of inhibitor in DMSO or appropriate controls. The enzyme was incubated with inhibitor for 3, 6, 30, or 60 mins prior to substrate addition. Reactions were initiated with 10 µL of 62.5 μM RLRGG-AMC in Buffer B. Plates were shaken vigorously for 30 s, and fluorescence from the release of AMC from peptide was monitored continuously for 15 min on a Tecan Infinite M200 Pro plate reader (λexcitation=360 nm; λemission=460 nm). Slopes from the linear portions of each progress curve were recorded and normalized to plate- based controls. Positive control wells, representing 100% inhibition, included 10 µM GRL0617; negative control wells, representing 0% inhibition, included vehicle. Antiviral Activity Assay A549-hACE2 / TMRSS2 cells were seeded 40,000 cell / well in RPMI-1640 complete into 24-well plates and then incubated for 24h at 37 C and 5% CO2. Cells were dosed with the compounds and infected using a clinical isolate of SARS-CoV-2 (WA1 strain) with a MOI= 0.01. After the addition of the compounds and virus, the plates were incubated for 48h at 37 C and 5% CO2, cell material was harvested and processed for RT- qPCR. RNA Extraction and RT-qPCR 1mL of TRIzolTM LS Reagent (Thermo Fisher Scientific) was added to each well after the extraction of the supernatant. Plates were lightly shaken for 5mins before addition of TRIzol and cell material was harvested. RNA samples were purified following phase separation by chloroform as recommended by the manufacturer. RNA in the aqueous phase was collected and further purified using Purelink RNA Mini kit (Invitrogen) according to manufacturer’s protocol. Viral RNA was quantified by reverse-transcription using VILO script Master Mix (Invitrogen). Quantitative PCR (RT-qPCR) using a Quant Studio3 using SYBR Green Master Mix (Applied Bio-systems) SARS-CoV-2 gene DNA was amplified using forward (5’-AGATTCGAAGACCCAGTCCCTAC) and reverse (5’- CTTCAAGGTCCATAAGAAAAGGCTGAGAG) primers. For mammalian cell comparison gene GADH, forward (5’-CATCTGCCACCCAGAAGACTG) and reverse (5’-ATGCCAGTGAGGTCCCGTTCAG) primers were used. Samples were compared using delta CT using the QuantStudio3 software and graphed in PRISM. All samples were normalized to the total amount of virus present in control samples of DMSO and virus. Results Exemplary compounds and their LC-MS characterization are shown in Table 1.

[0013] Table 1. Exemplary compounds and chemical characterization

[0014] Figures 1A-1H and the data in Table 2 demonstrate the potency of the exemplary compounds for inhibition of PLpro from SARS-CoV-2. Figure 1I shows the inhibition data of known compound GRL0617. Compared to GRL0617, the compounds disclosed herein showed significantly higher potency. Table 2. Exemplary PLpro Inhibition Data

[0015] The antiviral activity data of the exemplary compounds, in comparison with previously reported non-covalent PLpro inhibitor XR8-23 (see WO2022 / 169891) and a known antiviral drug nirmatrelvir, are shown in Figures 2 and 3. The comparison of nirmatrelvir with ZN5-175 and ZN5-190 shown in Figure 2 was normalized to viral infection with SARS-CoV-2 in the vehicle treated cell cultures using a relative fold infection of 1.0. When treated with the SARS-CoV-2 Mpro inhibitor, nirmatrelivir (the active component of Paxlovid) or ZN5-175 (both at 10 µM), no virus was detected in SARS-CoV-2 infected cell cultures. When cells were treated with ZN5-190 (10 µM), a weaker inhibitor of PLpro than ZN-5-175, a very low level of viral infection was observed. In a separate experiment, ZN-5-175 was compared with nirmatrelivir and the previously reported PLpro inhibitor XR8-23. In this experiment, 100% response was defined as the level of viral protection to infection by SARS-CoV-2 provided by nirmatrelvir and 0% as the response to infection provided by vehicle. The results of this experiment showed improved antiviral response of ZN-5-175, when compared to the previously disclosed PLpro inhibitor XR8-23 (Figure 3). References: WO2022 / 169891 1. Baez-Santos, Y. M., et al., “The SARS-coronavirus papain-like protease: structure, function and inhibition by designed antiviral compounds”, Antiviral research, 115: 21- 38, (2015). 2. Baez-Santos, Y. M., et al., “X-ray Structural and Biological Evaluation of a Series of Potent and Highly Selective Inhibitors of Human Coronavirus Papain-like Proteases”, Journal of Medicinal Chemistry, 57: 2393-2412, (2014). 3. Barretto, N., et al., “The Papain-Like Protease of Severe Acute Respiratory Syndrome Coronavirus Has Deubiquitinating Activity”, Journal of Virology 79, 15189-15198, (2005). 4. Beigel, J. H., et al., “Remdesivir for the Treatment of Covid-19 - Final Report”, New England Journal of Medicine, 383: 1813-1826, (2020). 5. Boras, B., et al., “Discovery of a Novel Inhibitor of Coronavirus 3CL Protease as a Clinical Candidate for the Potential Treatment of COVID-19”, bioRxiv, (2020). 6. Chen, N., et al., “Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study”, The Lancet, 395: 507-513, (2020). 7. Chen, X., et al., “SARS coronavirus papain-like protease inhibits the type I interferon signaling pathway through interaction with the STING-TRAF3-TBK1 complex”, Protein & Cell, 5: 369-381, (2014). 8. Chu, H., et al., “Comparative Replication and Immune Activation Profiles of SARS- CoV-2 and SARS-CoV in Human Lungs: An Ex Vivo Study With Implications for the Pathogenesis of COVI D-19”, Clin Infect Dis, 71: 1400-1409, (2020). 9. Cui, J., et al., “Origin and evolution of pathogenic coronaviruses”, Nature Reviews Microbiology”, 17: 181-192, (2019). 10. De Rosa, M. F., et al., “Role of multiple drug resistance protein 1 in neutral but not acidic glycosphingolipid biosynthesis”, The Journal of biological chemistry, 279: 7867-7876, (2004). 11. Del Ser, T., et al., “Residence, Clinical Features, and Genetic Risk Factors Associated with Symptoms of COVID-19 in a Cohort of Older People in Madrid”, Gerontology, 1-9, (2021). 12. Del Valle, D. M., et al., “An inflammatory cytokine signature predicts COVID-19 severity and survival”, Nature Medicine, 26: 1636-1643, (2020). 13. Dong, E., Du, H. & Gardner, L., “An interactive web-based dashboard to track COVID-19 in real time”, The Lancet Infectious Diseases, 20: 533-534, (2020). 14. Dyall, J., et al., “Repurposing of clinically developed drugs for treatment of Middle East respiratory syndrome coronavirus infection”, Antimicrobial agents and chemotherapy, 58: 4885-4893, (2014). 15. Ebner, P., et al., “Ubiquitin enzymes in the regulation of immune responses”, Grit Rev Biochem Mo / Biol, 52: 425-460, (2017). 16. Emsley, P., et al., “Features and development of Coot”, Acta Crystallogr D Biol Crystallogr, 66: 486-501, (2010). 17. Freitas, B. T., et al., “Characterization and Noncovalent Inhibition of the Deubiquitinase and delSGylase Activity of SARS-CoV-2 Papain-Like Protease”, ACS Infectious Diseases, 6: 2099-2109, (2020). 18. Frieman, M., “Severe Acute Respiratory Syndrome Coronavirus Papain-Like Protease Ubiquitin-Like Domain and Catalytic Domain Regulate Antagonism of IRF3 and NF- KB Signaling”, Journal of Virology, 83: 6689-6705, (2009). 19. Fu, Z., et al., “The complex structure of GRL0617 and SARS-CoV-2 Plpro reveals a hot spot for antiviral drug discovery”, Nature communications, 12: 488, (2021). 20. Ghosh, A. K., “Drug Development and Medicinal Chemistry Efforts toward SARS- Coronavirus and Covid-19 Therapeutics”, ChemMedChem, 15: 907-932, (2020). 21. Ghosh, A. K., et al., “Severe Acute Respiratory Syndrome Coronavirus Papainlike Novel Protease Inhibitors: Design, Synthesis, Protein-Ligand X-ray Structure and Biological Evaluation”, Journal of Medicinal Chemistry, 53: 4968-4979, (2010). 22. Ghosh, A. K., et al., “Structure-Based Design, Synthesis, and Biological Evaluation of a Series of Novel and Reversible Inhibitors for the Severe Acute Respiratory Syndrome-Coronavirus Papain-Like Protease”, Journal of Medicinal Chemistry, 52: 5228-5240, (2009). 23. Hoffman, R. L., et al., “Discovery of Ketone-Based Covalent Inhibitors of Coronavirus 3CL Proteases for the Potential Therapeutic Treatment of COVID-19”, J Med Chem 63: 12725-12747, (2020). 24. Hoffmann, M., et al., “SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitoir”, Cell, 181: 271-280, (2020). 25. Kabsch, W. “Integration, scaling, space-group assignment and postrefinement”, Acta Crystallogr D Biol Crystallogr, 66: 133-144, (2010). 26. Klemm, T., et al., “Mechanism and inhibition of the papain-like protease, Plpro, of SARS-CoV-2”, EMBO J, 39: 18, (2020). 27. Kouznetsova, V. L., et al., “Potential COVI D-19 papain-like protease Plpro inhibitors: repurposing FDA-approved drugs”, Peer J, 8: e9965, (2020). 28. Kruse, R. L., “Therapeutic strategies in an outbreak scenario to treat the novel coronavirus originating in Wuhan, China”, F1000Res, 9: 72 (2020). 29. Lei, J., et al., “Nsp3 of coronaviruses: Structures and functions of a large multi-domain protein”, Antiviral Research, 149: 58-74, (2018). 30. Lindner, H. A., et al., “The Papain-Like Protease from the Severe Acute Respiratory Syndrome Coronavirus Is a Deubiquitinating Enzyme”, Journal of Virology, 79: 15199-15208, (2005). 31. Mohamud, Y., et al., “The papain-like protease of coronaviruses cleaves ULK1 to disrupt host autophagy”, Biochemical and Biophysical Research Communications, 540: 75-82, (2021). 32. Murshudov, G. N., et al., “Refinement of macromolecular structures by the maximum- likelihood method”, Acta Crystallogr D Biol Crystallogr, 53: 240-255, (1997). 33. Osipiuk, J., et al., “Structure of papain-like protease from SARS-CoV-2 and its complexes with non-covalent inhibitors”, Nature communications, 12: 743, (2021). 34. Ratia, K., et al., “A noncovalent class of papain-like protease / deubiquitinaseinhibitors blocks SARS virus replication”, Proceedings of the National Academy of Sciences, 105: 16119-16124, (2008). 35. Ratia, K., et al., “Severe acute respiratory syndrome coronavirus papain-like protease: Structure of a viral deubiquitinating enzyme”, Proceedings of the National Academy of Sciences, 103: 5717-5722, (2006). 36. Ratia, K., et al., “A Structural Basis for the Ubiquitin-Linkage Specificity and delSGylating Activity of SARS-CoV Papain-Like Protease”, PLOS Pathogens, 10: e1004113, (2014). 37. Rut, W., et al., “Activity profiling and crystal structures of inhibitor-bound SARSCoV-2 papain-like protease: A framework for anti-COVI D-19 drug design”, Science Advances, 6: 42, (2020). 38. Sabino, E. C., et al., “Resurgence of COVID-19 in Manaus, Brazil, despite high seroprevalence”, The Lancet, 397: 452-455, (2021). 39. Sacco, M. D., et al., “Structure and inhibition of the SARS-CoV-2 main protease reveals strategy for developing dual inhibitors against M(pro) and cathepsin L”, Science Advances, 6: 50, (2020). 40. Shin, D., et al., “Papain-like protease regulates SARS-CoV-2 viral spread and innate immunity”, Nature, 587: 657-662, (2020). 41. Siklos, M., et al., “Cysteine proteases as therapeutic targets: does selectivity matter? A systematic review of calpain and cathepsin inhibitors”, Acta Pharm Sin B, 5: 506-519, (2015). 42. Smith, E., et al., “High-Throughput Screening for Drugs That Inhibit Papain-Like Protease in SARS-CoV-2”, SLAS DISCOVERY: Advancing the Science of Drug Discovery, 25: 1152-1161, (2020). 43. Strong, M., et al., “Toward the structural genomics of complexes: crystal structure of a PE / PPE protein complex from Mycobacterium tuberculosis”, Proc Natl Acad Sci USA 103: 8060-8065, (2006). 44. Studier, F. W., “Protein production by auto-induction in high density shaking cultures”, Protein expression and purification, 41: 207-234, (2005). 45. Thiel, V., et al., “Mechanisms and enzymes involved in SARS coronavirus genome expression”, Journal of General Virology, 84: 2305-2315, (2003). 46. Vabret, N., et al., “Immunology of COVID-19: Current State of the Science”, Immunity, 52: 910-941, (2020). 47. Vagin, A. & Teplyakov, A., “Molecular replacement with MOLREP”, Acta Crystallogr D Biol Crystallogr, 66: 22-25, (2010). 48. V'kovski, P., et al., “Coronavirus biology and replication: implications for SARS- CoV-2”, Nature Reviews Microbiology, 19: 155-170, (2020). 49. Wan, Y., et al., “Receptor Recognition by the Novel Coronavirus from Wuhan: an Analysis Based on Decade-Long Structural Studies of SARS Coronavirus”, J Viral, 94, (2020). 50. Wang, C., et al., “ApoE-lsoform-Dependent SARS-CoV-2 Neurotropism and Cellular Response”, Cell Stem Cell, (2021). 51. Wrapp, D. et al., “Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation”, Science, 367: 1260-1263, (2020). 52. Wu, C., et al., “Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods”, Acta Pharm Sin B, (2020). 53. Wu, F., et al., “A new coronavirus associated with human respiratory disease in China”, Nature, 579: 265-269, (2020). 54. Zhou, P., et al., “A pneumonia outbreak associated with a new coronavirus of probable bat origin”, Nature, 579: 270-273, (2020). 55. Zhou, Y., et al., “Network-based drug repurposing for novel coronavirus 2019- nCoV / SARS-CoV-2”, Cell Discov, 6: 14, (2020).

Claims

CLAIMS We claim:

1. A compound having a structure of: Formula I or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6 alkyl, —(C1-C6 alkylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —C(O)NRaRb, — N(Ra)C(O)Rb, —NRaRb,—(C1-C6 alkylenyl)Rc, —(C1-C3 cycloalkylenyl)Rc, or —(C1-C6 alkylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, ketoheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl group; Y1-Y3 are independently —N or —CR’, and R’ is H or halogen; Ar is aryl, polyaryl, heteroaryl, heteropolyaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Ar group is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; R1and R2are independently —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, — ORa, —(C1-C6 alkylenyl)NC(O)Ra, —(C1-C6 alkylenyl) C(O)NRa, —N(Ra)S(O)2Rb, — S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6 alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6 haloalkyl, —Rc, heterocyclyl, or —C1-C6 alkyl, wherein the —C1-C6 alkyl is optionally substituted with a substituent selected from the group consisting of —ORe, —NReRf, — C(O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, or cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups;each occurrence of Rdis independently—C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, -halogen, -CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl, or —C1-C6haloalkyl. The compound of claim 1, having a structure of:Formula II or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, —C(O)NRaRb, —Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or —(C1-C6ylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl,oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; Y1-Y6are independently —N or —CR’, and R’ is H or halogen; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl,ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — R3 and R5 is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, a nitrogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3bstituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —Ra, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R4, and R6 are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, —O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently—C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups;—C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, -halogen, -CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl.The compound of claim 1, having a structure of:Formula VIa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, X1, X2, X3are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1 is an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; R1is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, ionally the — C1-C6alkyl is substituted with a substituent selected from the group consisting —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7 is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a rogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3bstituents independently selected from the group consisting of —C1-C6alkyl, —(C1-C6ylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, — Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6ylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Z1-Z2, and Z3are each independently selected from the group consisting of C, O, S, N,H, CH2, where the substituent(s)s, when present on Z1, is —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with abstituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —O)2NReRf, and —Rc; each occurrence of Reand Rfis independently—H, halogen, —CN, — C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 1, having a structure of: Formula VIb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, X1, X2, X3are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1 is an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, ionally the — C1-C6alkyl is substituted with a substituent selected from the group consisting —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; R7is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or arogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3bstituents independently selected from the group consisting of —C1-C6alkyl, —(C1-C6ylenyl)NRaRb, —ORa, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —Ra)S(O)2Rb, —S(O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6ylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; Y is independently keto (C=O), NH, CH2or S(O)2; Z1, Z2, and Z3are each independently selected from the group consisting of C, O, S, N,H, CH2, where the substituent(s)s, when present on Z1, is —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, or —C1-C6alkyl, optionally the — C1-C6alkyl is substituted with abstituent selected from —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —O)2NReRf, and —Rc; each occurrence of Reand Rfis independently—H, halogen, —CN, — C6alkyl, —C1-C6cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 1 , having a structure of: Formula IIIa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; Y4-Y10 are independently—N or —CH; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’;R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, —O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 1, having a structure of: Formula IIIb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; Y1-Y3are independently —N or —CR’, and R’ is H or halogen; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — R7 is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a rogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3bstituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —Ra, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; R8 and R9 are independently —H, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’, each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, —O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 1, having a structure of: Formula IVa or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl, oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl, ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, —O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc;each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 1, having a structure of: Formula IVb or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1an oxirane group, and Z2is a hydrogen, alkyl, alkenyl, aryl, heteroaryl,oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2 is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl,ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — R7 is —H, aryl, a sulfur-containing heteroaryl, an oxygen-containing heteroaryl, or a rogen-containing heteroaryl, each of which is optionally substituted with 1, 2, or 3bstituents independently selected from the group consisting of —(C1-C6alkylenyl)NRaRb, —Ra, —(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —O)2NRaRb, —C(O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cloalkylenyl)Rc, and —(C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl, —Rc, heterocyclyl, or —C1-C6alkyl, wherein the —C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, —O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is is optionally substituted with 1, 2, 3, 4, or 5 Rdups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, —O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl.The compound of claim 1, having a structure of: Formula V or a pharmaceutically acceptable salt thereof, wherein: X is X1-X2-X3-Z1-Z2, wherein X1, X2, X3 are independently—C1-C6alkyl, —(C1-C6ylenyl)NRaRb,—(C1-C6alkylenyl)NC(O)Ra, —(C1-C6alkylenyl) C(O)NRa, ——C(O)NRaRb,N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, and —(C1-C6ylenyl)RcRc’; Z1 an oxirane group, and Z2 is a hydrogen, alkyl, alkenyl, aryl, heteroaryl,oheterocyclyl, heterocyclyl, cycloalkyl, cycloalkenyl, carboxyl, ester, amide, or sulfonyl up; R1 is —H, halide, —C1-C6alkyl, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb, —(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; R2is —C1-C6alkenyl, —C1-C6alkynyl, —C1-C6haloalkyl, —Rc, or —C1-C6alkyl,ere the — C1-C6alkyl is optionally substituted with a substituent selected from the groupnsisting of —ORe, —NReRf, —C(O)ORe, — C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and — R9and R10are independently —H, halogen, —(C1-C6alkylenyl)NRaRb, —ORa, —(C1-C6ylenyl)NC(O)Ra, —(C1-C6alkylenyl)C(O)NRa, —N(Ra)S(O)2Rb, —S(O)2NRaRb, —O)NRaRb, —N(Ra)C(O)Rb, —NRaRb,—(C1-C6alkylenyl)Rc, —(C1-C3cycloalkylenyl)Rc, or C1-C6alkylenyl)RcRc’; each occurrence of Raand Rbis independently —H, —C1-C6alkenyl, —C1-C6alkynyl,C1-C6haloalkyl Rcheterocyclyl or C C alkyl wherein the C1-C6alkyl is optionallybstituted with a substituent selected from the group consisting of —ORe, —NReRf, — O)ORe, —C(O)NReRf, —S(O)2Re, —S(O)2NReRf, and —Rc; each occurrence of Rcand Rc’is independently aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, wherein each Rcgroup is optionally substituted with 1, 2, 3, 4, or 5 Rdgroups; each occurrence of Rdis independently —C1-C6heteroaryl, —CO heteroaryl, wherein h heteroaryl is optionally substituted with 1, 2, 3, 4, or 5 Regroups; —C1-C6alkyl, —C2-C6enyl, —C2-C6alkynyl, halogen, C1-C6haloalkyl, —CN, —NO2, —ORe, —S(O)2NReRf, — O)Re, —C(O)NReRf, —NReRf, —N(Re)C(O)Rf, —(C1-C6alkylenyl)-ORe, —(C1-C6ylenyl)-C(O)NReRf, —(C1-C6alkylenyl)-NReRf, or —(C1-C6alkylenyl)-N(Re)C(O)Rf; and each occurrence of Reand Rfis independently—H, halogen, —CN, —C1-C6alkyl, —C1- cycloalkyl, aryl, heteroaryl or —C1-C6haloalkyl. The compound of claim 9, wherein R9and R10are independently —H, halogen, or — -C6alkylenyl)Rc, and Rcis a heteroaryl or heterocyclyl. The compound of claim 1, wherein R1is —H, halide, —NRaRb, —ORa, —C1-C6alkyl, d each occurrence of Raand Rbis independently —H, —C1-C6haloalkyl, or heterocyclyl, ionally wherein the heterocyclyl is azetidinyl, which is optionally substituted with —C1-C6oalkyl. The compound of claim 1, wherein R2is —C1-C6alkyl, —C1-C5alkyl, —C1-C4alkyl, — C3alkyl, or —C1-C2alkyl, such as methyl. The compound of claim 1, wherein X is , and wherein:n1 is an integer from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, or from 1 to 2;, , X’ is a heterocyclyl, n2-n5 are independently an integer from 0 to 6, from 0 to 5, from o to 4, from 0 to 3, or from 0 to 2; and Z’ is a carboxyl, an ester, an amide, or a heterocyclyl. The compound of claim 13, wherein X’ isJ1-J10are independently carbon, oxygen, sulfur,or nitrogen; R’4, R’5, R’6, R’8, and R’9 are independently absent, hydrogen, oxygen, or sulfur.

15. The compound of claim 13, wherein L1 is , wherein Q1-Q3 areindependently carbon, oxygen, sulfur, or nitrogen, and W is oxygen or sulfur. The compound of claim 13, wherein Z’ is a heterocyclyl or; R11 is -OR12, - R13R14, or a heterocyclyl; and R12-R14are independently hydrogen or C1-C6alkyl optionally bstituted with hydroxyl or halogenThe compound of claim 1, wherein X isThe compound of claim 1, having any one of the following structures:

19. A pharmaceutical composition comprising the compound of any one of claims 1-18, and ionally one or more pharmaceutically acceptable excipients. The pharmaceutical composition of claim 19, further comprising a second active agent, ionally wherein the second active agent is anti-inflammatory agent, an antioxidant, or iviral agent, or a combination thereof. A method for preventing a disease or disorder caused by a coronavirus using the armaceutical composition of claim 19 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. The method of claim 21, wherein the pharmaceutical composition is administered by ranasal administration, oral administration, intramuscular administration, intravenous ministration, intraperitoneal administration, or subcutaneous administration, or a combination reof.The method of claim 21, wherein the subject is exposed to or is expected to be exposed an individual having one or more symptoms of a viral infection, such as with fever, cough,ortness of breath, diarrhea, sneezing, runny nose, and / or sore throat. The method of claim 21, wherein the administration is performed before and / or after thebject is exposed to the coronavirus. The method of claim 21, wherein the administration is performed within 24 hours, within hours, within 12 hours, within 6 hours, within 4 hours, within 2 hours, or within 1 hour after subject is tested positive for a viral infection (counting from the time point that positive testult is received by the subject). The method of claim 21, wherein the method comprises repeating step (i), and optionally erein the administration step is repeated once, twice, or three times, per day, for a period ofe day, three days, one week, two weeks, one month, three months, six months, or one year. The method of claim 21, wherein following the administration or all of theministrations, the subject shows no or less symptoms associated with disease or disorder sed by the coronavirus, compared to a control. The method of claim 21, wherein the coronavirus is a respiratory virus such as SARS-V-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). The method of claim 21, further comprising administering an active agent prior to, ing, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent or i-inflammatory agent, or a combination thereof. A method for treating a disease or disorder caused by a coronavirus using thearmaceutical composition of claim 19 comprising: (i) administering the pharmaceutical composition to a subject in need thereof. The method of claim 30, wherein the subject is infected with the coronavirus, optionally erein the subject shows one or more symptoms associated with the disease or disorder caused the coronavirus. The method of claim 30, wherein the coronavirus is a respiratory virus such as a SARS-V-2, optionally B.1.617.2 (Delta) and / or B.1.1.529 (Omicron). The method of claim 30, wherein the method comprises repeating step (i), and optionally erein the administration step is repeated once, twice, or three times, per day, for a period ofe day, three days, one week, two weeks, one month, three months, six months, or one year.The method of claim 30, wherein following the administration or all of theministrations, the subject shows less or none of the symptoms associated with the disease ororder caused by the coronavirus, compared to the subject prior to the administration or firstministration, optionally wherein the relief of the symptoms occurs within an hour, within 3urs, within 6 hours, within 12 hours, within one day, within two days, or within 3 dayslowing the administration of all of the administration of the pharmaceutical composition. The method of claim 30, further comprising administering an active agent prior to, ing, and / or subsequent to step (i), optionally wherein the active agent is an antiviral agent ori-inflammatory agent, or a combination thereof.

Images