Composition for diagnosis of radioresistance of colorectal cancer or for prognosis of colorectal cancer

Abstract

In the present invention, the mRNA of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes, or the proteins encoded by these genes, exhibit differential expression levels between radioresistant and radiosensitive colorectal cancer cells, and are closely correlated with reduced survival rates in colorectal cancer patients. Therefore, an agent for measuring the expression levels of the mRNA of the genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 or the proteins encoded by the genes according to the present invention effectively diagnoses radio-resistance in colorectal cancer or prognoses radiotherapy for colorectal cancer. This enables the determination of whether to proceed with radiotherapy and the optimal radiation dose, thereby improving the efficiency and outcomes of radiotherapy for colorectal cancer.

Description

Composition for diagnosing radiation resistance of colon cancer or predicting prognosis of colon cancer

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0112012, filed August 25, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a composition for diagnosing radiation resistance of colon cancer and its application.

[0005]

[0006] Cancer treatment methods include surgery, chemotherapy, and radiation therapy, and the importance of radiation therapy has grown significantly in recent years. In cases where surgery is not feasible, cases have been reported where radiation therapy alone effectively cured tumors. Furthermore, radiation-based cancer treatment methods continue to evolve, establishing radiation therapy as an effective treatment for tumors without significant pain or discomfort for patients. Statistically, approximately 30-50% of cancer patients receive radiation therapy at some point during their treatment. As the number of cancer patients receiving radiation therapy continues to increase, the importance of radiation therapy in cancer treatment is also growing.

[0007] Radiation therapy, either alone or in combination with chemotherapy, is commonly used to treat various types of cancer. However, the effectiveness of radiation therapy varies depending on the nature of the cancer, the patient, and whether radiation is combined with other treatments. Cancers for which radiation therapy is commonly administered include cervical, pharyngeal, lung, brain, and breast cancers. Although these cancers are primary targets of radiation therapy, they frequently have poor responses to radiation therapy, necessitating strategies to enhance treatment effectiveness. Furthermore, even if radiation therapy is successful and initial responses are favorable, recurrence is common, making developing countermeasures to prevent recurrence crucial for enhancing the effectiveness of radiation therapy.

[0008] Furthermore, issues such as cancer cell acquisition of radiation resistance and damage to normal tissue during high-dose radiation therapy have been identified as reducing the effectiveness of radiation therapy, necessitating research to improve its effectiveness. Currently, radiation therapy, along with surgery and chemotherapy, is used as an effective cancer treatment, targeting cancerous tissue to kill cancer cells.

[0009] Although there are differences in the sensitivity of cancer cells to radiation therapy, if we develop a technology that can predict individual radiation sensitivity before radiation therapy, we will be able to provide the most appropriate radiation therapy for each individual by adjusting the radiation dose to treat cancer.

[0010] Meanwhile, research is actively underway on companion diagnostics, which are approved diagnostics that can select appropriate targeted anticancer drugs and treatment methods based on systematic analysis of individual patient factors. Companion diagnostics can provide a clear clinical basis for prescribing based on a physician's diagnosis and suggest appropriate treatment options to patients. This not only enhances cancer treatment effectiveness but also contributes to the soundness of national health insurance finances by reducing the misuse of targeted anticancer drugs. The companion diagnostics market is currently growing in areas such as breast cancer, lung cancer, colon cancer, stomach cancer, and melanoma, with breast and lung cancer in particular expected to drive market growth.

[0011] Korean Patent Application No. 10-2018-0143493 discloses a technique for diagnosing radioresistant lung cancer or pancreatic cancer by measuring the expression level of PMVK protein or mRNA, but no data is provided regarding colorectal cancer cell specificity.

[0012] In addition, Korean Patent Application No. 10-2018-0153659 discloses a technique for diagnosing the radiation resistance of cancer cells by measuring the expression level of the ROMO1 gene or protein, but does not present a technique for more accurately diagnosing radiation resistant colon cancer using multiple markers.

[0013] Against this backdrop, the inventors of the present invention conducted research on biomarkers of radiation resistance and discovered a novel biomarker for diagnosing radiation-resistant colon cancer. This biomarker is expected to be useful in the treatment of colon cancer, as it can predict resistance to radiation therapy and the prognosis of radiation therapy.

[0014] [Prior Art Literature]

[0015] [Patent Document]

[0016] Republic of Korea Patent Application No. 10-2018-0143493

[0017] Republic of Korea Patent Application No. 10-2018-0153659

[0018]

[0019] The purpose of the present invention is to provide a composition for diagnosing radiation resistance of colon cancer.

[0020] In addition, the present invention aims to provide a kit for diagnosing radiation resistance of colon cancer.

[0021] In addition, the present invention aims to provide a method for providing information for diagnosing radioresistance of colon cancer.

[0022] In addition, the present invention aims to provide a composition for predicting the prognosis of radiation therapy for colon cancer.

[0023] In addition, the present invention aims to provide a kit for predicting the prognosis of radiation therapy for colon cancer.

[0024] In addition, the present invention aims to provide a method for providing information for predicting the prognosis of radiation therapy for colon cancer.

[0025] In order to achieve the above purpose, one aspect of the present invention provides a composition for diagnosing radiation resistance of colon cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0026] In addition, another aspect of the present invention provides a kit for diagnosing radiation resistance of colon cancer, comprising the composition for diagnosing radiation resistance of colon cancer.

[0027] In addition, another aspect of the present invention provides a method for providing information for diagnosing radioresistance of colon cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0028] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for colon cancer, comprising an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0029] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for colon cancer, comprising a composition for predicting the prognosis of radiation therapy for colon cancer. Another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for colon cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes in a sample isolated from an individual; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0030]

[0031] Hereinafter, the present invention will be described in detail.

[0032]

[0033] 1. Composition for diagnosing radiation resistance of colon cancer or predicting prognosis of radiation therapy for colon cancer

[0034] One aspect of the present invention provides a composition for diagnosing radiation resistance of colon cancer.

[0035] In addition, another aspect of the present invention provides a composition for predicting the prognosis of radiation therapy for colon cancer.

[0036] The composition for diagnosing radiation resistance of colon cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0037] In addition, the composition for predicting the prognosis of radiation therapy for colon cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0038] CXCL5 (CXC motif chemokine ligand 5, NCBI gene ID: 6374) protein is a small cytokine belonging to the CXC chemokine family. It is produced by stimulation with the inflammatory cytokines interleukin-1 and tumor necrosis factor-alpha, and is known to regulate neutrophil homeostasis by inhibiting type II interferon-gamma.

[0039] In the present invention, the CXCL5 protein refers to not only the wild-type CXCL5 protein consisting of the amino acid sequence of SEQ ID NO: 1, but also an equivalent that has a function or activity identical or similar to the wild-type CXCL5 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 1.

[0040] CD68 (Cluster of Differentiation 68, NCBI gene ID: 968) protein is a protein expressed in monocyte lineage cells and macrophages. It is generally known as a scavenger receptor that plays a role in removing cell debris, promoting phagocytosis, and mediating macrophage recruitment and activation.

[0041] In the present invention, the CD68 protein refers to not only the wild-type CD68 protein consisting of the amino acid sequence of SEQ ID NO: 2, but also an equivalent that has a different sequence from the wild-type CD68 protein but has the same or similar function or activity as the wild-type CD68 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 2.

[0042] MATN1 (Matrilin 1, NCBI gene ID: 4146) protein is a cartilage matrix protein that is involved in the formation of filamentous networks in the extracellular matrix of various tissues, and mutations in this gene are known to be associated with various hereditary chondrodysplasias.

[0043] In the present invention, the MATN1 protein refers to not only the wild-type MATN1 protein consisting of the amino acid sequence of SEQ ID NO: 3, but also an equivalent that has a function or activity identical or similar to the wild-type MATN1 protein but has a different sequence from the wild-type MATN1 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 3.

[0044] SERPING1 (Serpin family G member 1, NCBI gene ID: 710) protein is a protease inhibitor belonging to the serpin superfamily, also known as a C1 esterase inhibitor, and is known to regulate physiological pathways including complement activation, blood coagulation, fibrinolysis, and kinin production by inhibiting the activation of the C1 complex.

[0045] In the present invention, the SERPING1 protein refers to not only the wild-type SERPING1 protein consisting of the amino acid sequence of SEQ ID NO: 4, but also an equivalent that has a function or activity identical or similar to the wild-type SERPING1 protein but has a different sequence from it, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 4.

[0046] SNCG (Gamma-synuclein, NCBI gene ID: 6623) protein is a type of synuclein family protein, and is related to the pathogenesis of degenerative brain diseases. Its overexpression is often observed in breast cancer cells, and it is known to have a high correlation with the development of breast cancer.

[0047] In the present invention, the SNCG protein refers to not only the wild-type SNCG protein consisting of the amino acid sequence of SEQ ID NO: 5, but also an equivalent that has a part of the sequence different from the wild-type SNCG protein but has the same or similar function or activity as the wild-type SNCG protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 5.

[0048] VTN (Vitronectin, NCBI gene ID: 7448) protein is a glycoprotein of the hemopexin family synthesized in the liver. It is known to promote cell adhesion and migration by binding to integrin alpha-V beta-3 and connecting cells to the extracellular matrix, and to be involved in hemostasis as a component of platelets.

[0049] In the present invention, the VTN protein refers to not only a wild-type VTN protein having an amino acid sequence of SEQ ID NO: 6, but also an equivalent that has a different sequence from the wild-type VTN protein but has the same or similar function or activity as the wild-type VTN protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 6.

[0050] FBXO4 (F-box protein 4, NCBI gene ID: 26272) is a protein-coding factor characterized by the F-box motif of approximately 40 amino acids, and is known to directly contribute to cell transformation, tumorigenesis, and progression by generating Fbx proteins that contain other protein-protein interaction modules or lack recognizable motifs. In addition, the FBXO4 protein is reported to be a tumor suppressor, and its tumor suppression activity is associated with dysregulation of cyclin D1 protein degradation.

[0051] In the present invention, the FBXO4 protein refers to not only the wild-type FBXO4 protein consisting of the amino acid sequence of SEQ ID NO: 7, but also an equivalent that has a part of the sequence different from the wild-type FBXO4 protein but has the same or similar function or activity as the wild-type FBXO4 protein, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 7.

[0052] SYTL4 (Synaptotagmin like 4, NCBI gene ID: 94121) protein has an N-terminal Rab27 binding domain and a C-terminal tandem C2 domain, which allows it to bind to Rab GTPases and participate in intracellular membrane trafficking, and is known to regulate the release of nucleolar granules into cells or the secretion of pancreatic and pituitary hormones.

[0053] In the present invention, the SYTL4 protein refers to not only the wild-type SYTL4 protein consisting of the amino acid sequence of SEQ ID NO: 8, but also an equivalent that has a function or activity identical or similar to the wild-type SYTL4 protein but differs in some sequences, and the equivalent may include an amino acid sequence having a sequence homology of about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more to the amino acid sequence of SEQ ID NO: 8.

[0054] The composition for diagnosing radiation resistance of colon cancer according to the present invention may include, as an active ingredient, an agent for measuring the expression level of mRNA of two genes, three genes, four genes, five genes, six genes, seven genes, or eight genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes, or proteins encoded by the genes.

[0055] In addition, the composition for predicting the prognosis of radiation therapy for colon cancer according to the present invention may include, as an active ingredient, an agent for measuring the expression level of mRNA of two genes, three genes, four genes, five genes, six genes, seven genes, or eight genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes, or proteins encoded by the genes.

[0056] In a specific embodiment of the present invention, it was confirmed that mRNA of a gene selected from the group consisting of the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by the genes have differential expression levels in radiation-resistant and -sensitive colon cancer cells and have a close correlation with a decrease in the survival rate of colon cancer patients.

[0057] Therefore, the agent for measuring the expression level of mRNA of one or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes of the present invention or a protein encoded by one or more genes can diagnose the radioresistance of colon cancer more effectively than mRNA of other genes and / or proteins encoded by the genes and combinations thereof, and can predict the prognosis of radiation therapy for colon cancer, thereby determining whether to perform radiation therapy and the optimal radiation therapy dose, thereby improving the efficiency and treatment results of radiation therapy for colon cancer.

[0058] Specifically, in colon cancer cells, the expression of the genes CXCL5, CD68, MATN1, SERPING1, SNCG and VTN is upregulated by radiation exposure, and the expression of the genes FBXO4 and SYTL4 is downregulated.

[0059] More specifically, the expression of the CXCL5, CD68 and MATN1 genes is upregulated in radioresistant colon cancer cells, and the expression of the SERPING1, SNCG and VTN genes is upregulated in radiosensitive colon cancer cells.

[0060] Specifically, the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes may be genes whose expression, when upregulated, reduces the survival rate of colon cancer patients.

[0061] Therefore, if the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes or the expression level of proteins encoded by two or more genes is high compared to the normal control group, it can be determined that radioresistance is present, and if it is low, it can be determined that radioresistance is low or radiosensitivity is present. For example, if the mRNA of two to six genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes and / or the two to six proteins encoded by the genes are all highly expressed, radioresistance can be determined to be high, and if the mRNA of two to six genes and / or the two to six proteins encoded by the genes are all low expressed, radioresistance can be determined to be low.

[0062] In addition, if the expression level of the mRNA of the FBXO4 and SYTL4 genes or the protein encoded by the genes is lower than that of the normal control group, it can be determined that radioresistance exists, and if it is higher, it can be determined that radioresistance is low or radiosensitivity exists.

[0063] Meanwhile, if the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes or the expression level of proteins encoded by two or more genes is high compared to the normal control group, the prognosis of radiation therapy for colon cancer can be judged to be negative, and if the expression level is low, the prognosis of radiation therapy for colon cancer can be judged to be positive. For example, if the mRNA of two to six genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes and / or the two to six proteins encoded by the genes are all highly expressed, the prognosis of radiation therapy for colon cancer can be judged to be negative, and if the mRNA of two to six genes and / or the two to six proteins encoded by the genes are all lowly expressed, the prognosis of radiation therapy for colon cancer can be judged to be positive.

[0064] In addition, if the expression level of the mRNA of the FBXO4 and SYTL4 genes or the protein encoded by the genes is lower than that of the normal control group, the prognosis of radiation therapy for colon cancer can be judged to be negative, and if the expression level is higher, the prognosis of radiation therapy for colon cancer can be judged to be positive.

[0065] Meanwhile, the composition for diagnosing radiation resistance of colon cancer and the composition for predicting the prognosis of radiation therapy for colon cancer of the present invention may include an agent for measuring the expression level of mRNA of the SERPING1 or SNCG gene or a protein encoded by the gene.

[0066] In the present invention, "radio-resistance" refers to a state in which cells are not easily affected by radiation exposure and show little change in cell repair or proliferation when exposed to radiation. As the opposite term to radiation resistance, "radio-sensitive" refers to a state in which cells are easily affected by radiation exposure and show changes in cell repair or proliferation when exposed to radiation.

[0067] In the present invention, "radiotherapy" refers to the treatment of cancer through a mechanism that induces cancer cell death by inhibiting cell division through DNA damage by irradiating the cancer cells. The radiation therapy may be performed alone or in combination with surgical treatment, or with anticancer chemotherapy or a radiation sensitizer, for curative, adjuvant, or palliative purposes in solid tumors.

[0068] In the present invention, colon cancer may include colon cancer, rectal cancer, etc.

[0069] In the present invention, “diagnosis” includes determining the susceptibility of an individual to a specific disease or condition, determining whether an individual currently has a specific disease or condition, determining the prognosis of an individual with a specific disease or condition, or therametrics (e.g., monitoring the condition of an individual to provide information about the efficacy of a treatment).

[0070] In the present invention, "prognosis" refers to a prospective or preliminary assessment of the medical outcome of a disease, and includes a positive prognosis (positive prognosis) or a negative prognosis (negative prognosis). The positive prognosis includes improvement or stabilization of the disease, such as a state of no disease, tumor regression, long-term survival possibility, or disease-free survival rate, while the negative prognosis includes progression or mortality of the disease, such as decreased survival rate, recurrence, tumor growth, metastasis, and drug resistance.

[0071] Additionally, in the present invention, “prediction” means to guess in advance about the medical outcome, such as the course of a disease (progression, improvement, recurrence, tumor growth, likelihood of death or survival after drug resistance treatment, etc.) or responsiveness to treatment such as chemotherapy or radiation therapy.

[0072] Specifically, in the present invention, the diagnosis may be a diagnosis of radiation resistance of colon cancer, and the prognosis prediction may be a prognosis prediction of radiation treatment of colon cancer.

[0073] In the present invention, measurement of mRNA expression level means a process of confirming the presence and expression level of mRNA of the gene in a biological sample for the purpose of diagnosing radiation resistance of colon cancer and / or predicting the prognosis of radiation treatment of colon cancer, and a primer, probe, or antisense nucleotide that specifically binds to the gene or mRNA may be used as an agent for measuring the expression level of the mRNA, and the measurement of the expression level of the mRNA may be performed by one or more methods selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip, but is not limited thereto.

[0074] In addition, in the present invention, the measurement of the protein expression level means a process of confirming the presence and expression level of the protein in a biological sample for the purpose of diagnosing the radiation resistance of colon cancer and / or predicting the prognosis of radiation treatment of colon cancer, and a polypeptide, compound, antibody or aptamer that can specifically bind to the protein can be used as an agent for measuring the expression level of the protein, and the measurement of the expression level of the protein can be performed by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, dual luciferase reporter assay, immunoprecipitation assay, complement fixation assay, FACS (Fluorescence activated cell sorter) and protein It may be performed by one or more methods selected from, but not limited to, a group consisting of chips.

[0075] In the present invention, a "sample" may mean a sample derived from an individual receiving radiation therapy (radiation irradiation) or for which a decision on whether to receive radiation therapy is required. For example, it refers to a sample capable of specifying the expression level of mRNA of two or more genes selected from the group consisting of the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes, or a protein encoded by two or more genes, and may include, but is not limited to, cells, tissues, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine of an individual.

[0076] In the present invention, "subject" refers to a subject for which the radiation resistance or progression potential of colorectal cancer is to be determined, or the prognosis of radiation therapy is to be predicted. The subject may be any animal susceptible to colorectal cancer, but is not limited to any species. Specifically, the subject may be a mammal, for example, a human (Homo sapiens).

[0077] In the present invention, "expression level" may be used interchangeably with expression signature and expression profile, and may include the expression level of mRNA of two or more genes selected from the group consisting of the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or the expression level of proteins encoded by two or more genes. The expression level may include increased expression or decreased expression, and the expression level may be measured from cancer cells isolated from an individual before and / or after radiation treatment. Meanwhile, the expression level may be confirmed by measuring the amount of mRNA and / or protein of the gene in the sample.

[0078] In the present invention, a "primer" refers to a nucleic acid sequence having a short free 3'-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. The primer of the present invention can complementarily bind to the biomarker gene or mRNA of the present invention, and can be a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides, and can incorporate additional features that do not change the basic properties of the primer that acts as a starting point for DNA synthesis. Meanwhile, the primer of the present invention can be chemically synthesized using a phosphoramidite solid support method or other well-known methods, and can be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with their analogs, and modifications between nucleotides, such as modification with uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acids may contain one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. In addition, the primers of the present invention may be modified with labels capable of directly or indirectly providing a detectable signal, such as radioisotopes, fluorescent molecules, biotin, etc.

[0079] In the present invention, "probe" refers to a nucleic acid capable of complementary binding to mRNA of several to several hundred bases in length, produced through an enzymatic chemical separation and purification process or synthesis. The probe of the present invention is a probe capable of complementary binding to the biomarker gene or mRNA of the present invention, and can be used by labeling with a radioactive isotope or enzyme to confirm the presence or absence of mRNA. The probe can be designed and modified using a known method.

[0080] In the present invention, the term "antisense nucleotide" refers to DNA, RNA, or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into a protein. The sequence of the antisense nucleotide refers to a DNA or RNA sequence that is complementary to the mRNA of the biomarker gene of the present invention and can bind to the mRNA. This can inhibit essential activities for translation, translocation into the cytoplasm, maturation, or any other overall biological function of the mRNA. The antisense nucleotide can be synthesized in vitro by a conventional method and administered in vivo, or the antisense nucleotide can be synthesized in vivo. The antisense nucleotide that can be used in the present invention can be produced by a method known in the art with reference to the base sequence and / or amino acid sequence of the biomarker gene and / or protein of the present invention.

[0081] In the present invention, "antibody" refers to a globulin-based protein that reacts when a foreign substance, an antigen, invades while circulating in the blood or lymph of the body's immune system, and means a protein that specifically binds to an antigen. For the purpose of the present invention, the antibody means an antibody that specifically binds to the biomarker protein of the present invention, and may include all of polyclonal antibodies, monoclonal antibodies, and recombinant antibodies, and includes not only a complete form having two full-length light chains and two full-length heavy chains, but also a functional fragment of an antibody molecule. A functional fragment of an antibody molecule means a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2, and Fv, etc. The antibody that specifically binds to the biomarker protein of the present invention may be produced by a known method known to those skilled in the art, and may be produced, for example, by injecting the biomarker protein, which is an immunogen, into an external host. External hosts include mammals such as mice, rats, sheep, and rabbits. The immunogen can be administered intramuscularly, intraperitoneally, or subcutaneously, typically with an adjuvant to enhance antigenicity. Blood is then periodically drawn from the external host to collect serum specific for the antigen, allowing antibodies to be isolated.

[0082] In the present invention, "aptamer" refers to a nucleic acid molecule that is a single-stranded oligonucleotide, about 20 to 60 nucleotides in size, and has binding activity to a predetermined target molecule. The aptamer has various three-dimensional structures depending on the sequence, can have high affinity for a specific substance like an antigen-antibody reaction, and can inhibit the activity of a predetermined target molecule by binding to the predetermined target molecule. The aptamer may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and may be linear or cyclic. In the present invention, the aptamer can specifically bind to a protein encoded by the biomarker gene of the present invention, and can be prepared by a person skilled in the art from the base sequence of the biomarker gene of the present invention by a method known in the art.

[0083]

[0084] 2. A kit for diagnosing radioresistance of colon cancer and a kit for predicting the prognosis of radiation therapy for colon cancer.

[0085] Another aspect of the present invention provides a kit for diagnosing radiation resistance of colon cancer.

[0086] In addition, another aspect of the present invention provides a kit for predicting the prognosis of radiation therapy for colon cancer.

[0087] The kit for diagnosing radiation resistance of colon cancer of the present invention comprises, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0088] In addition, the kit for predicting the prognosis of radiation therapy for colon cancer of the present invention includes, as an active ingredient, a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0089] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation resistance of colon cancer or predicting prognosis of radiation therapy of colon cancer', the description is omitted.

[0090] In the present invention, the term "kit" refers to a tool that can diagnose radiation resistance of colon cancer or predict the prognosis of radiation therapy of colon cancer by confirming the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes. The kit of the present invention may include an agent for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes, specifically, a primer, a probe and an antisense nucleotide that specifically bind to the mRNA of the genes, or a polypeptide, a compound, an antibody and an aptamer that specifically bind to the protein, and may include one or more other component compositions, solutions or devices suitable for an analysis method.

[0091] Additionally, the kit may further include a user manual describing optimal reaction performance conditions. The manual may include instructions in the form of a pamphlet or leaflet, a label attached to the kit, and a description on the surface of the package containing the kit, and may include information disclosed or provided through electronic media such as the Internet.

[0092] In the present invention, the kit may be an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit.

[0093]

[0094] 3. Method for providing information for diagnosing radiation resistance of colon cancer and method for providing information for predicting the prognosis of radiation therapy for colon cancer.

[0095] Another aspect of the present invention provides a method for providing information for diagnosing radiation resistance of colon cancer.

[0096] In addition, another aspect of the present invention provides a method for providing information for predicting the prognosis of radiation therapy for colon cancer.

[0097] The method for providing information for diagnosing radiation resistance of colon cancer of the present invention comprises: (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

[0098] In addition, the method for providing information for predicting the prognosis of the radiation treatment of colon cancer of the present invention comprises (a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) a step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

[0099] Since the overlapping description is the same as that described above in '1. Composition for diagnosing radiation resistance of colon cancer or predicting prognosis of radiation therapy of colon cancer', the description is omitted.

[0100] In the information providing method for diagnosing radiation resistance of colon cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the SERPING1 or SNCG gene or a protein encoded by the gene.

[0101] Additionally, in the method for providing information for predicting the prognosis of radiation therapy for colon cancer of the present invention, step (a) may include a step of measuring the expression level of mRNA of the SERPING1 or SNCG gene or a protein encoded by the gene.

[0102] In the method for providing information for diagnosing radiation resistance of colon cancer of the present invention, in step (b), when the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG and VTN genes or the protein encoded by two or more genes is compared with the expression level of mRNA or protein of a normal control group, if the expression level is higher than that of the normal control group, the colon cancer can be determined to have radiation resistance. The above high expression level may include an increase in the expression level of the subject by a similar level or by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% and 1000% or more compared to the expression level of a normal control.

[0103] In addition, in the information providing method for diagnosing radiation resistance of colon cancer of the present invention, when the expression level of the mRNA of the FBXO4 and SYTL4 genes or the protein encoded by the genes is compared with the expression level of the mRNA or protein of a normal control group in the step (b), if the expression level is lower than the expression level of the normal control group, the colon cancer can be determined to have radiation resistance. The low expression level may include that the expression level of the subject is similar to the expression level of the normal control group or is reduced by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% or more.

[0104] Meanwhile, in the method for providing information for predicting the prognosis of radiation therapy for colon cancer of the present invention, in step (b), when the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG and VTN genes or the protein encoded by two or more genes is compared with the expression level of mRNA or protein of a normal control group, if the expression level is higher than that of the normal control group, the prognosis of radiation therapy for colon cancer can be determined to be negative. The above high expression level may include an increase in the expression level of the subject by a similar level or by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900% and 1000% or more compared to the expression level of a normal control.

[0105] In addition, in the method for providing information for predicting the prognosis of radiation therapy for colon cancer of the present invention, when the expression level of the mRNA of the FBXO4 and SYTL4 genes or the protein encoded by the genes is compared with the expression level of the mRNA or protein of the normal control group in the step (b), if the expression level is lower than the expression level of the normal control group, the prognosis of radiation therapy for colon cancer can be determined to be negative. The low expression level may include that the expression level of the subject is similar to the expression level of the normal control group or is reduced by 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% or more.

[0106] Meanwhile, the method for providing information for diagnosing radiation resistance of colon cancer of the present invention may further include: (c-1) a step of determining that colon cancer has radiation resistance when the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes or a protein encoded by two or more genes is high compared to a normal control group; and / or (c-2) a step of determining that colon cancer has radiation resistance when the expression level of mRNA of FBXO4 and SYTL4 genes or a protein encoded by the genes is low compared to a normal control group.

[0107] In addition, the method for providing information for predicting the prognosis of radiation therapy for colon cancer of the present invention may further include: (c-1) a step of determining that the prognosis of radiation therapy for colon cancer is negative when the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN genes or the protein encoded by the two or more genes is high compared to a normal control group; and / or (c-2) a step of determining that the prognosis of radiation therapy for colon cancer is negative when the expression level of mRNA of FBXO4 and SYTL4 genes or the protein encoded by the above genes is low compared to a normal control group.

[0108] In a specific embodiment of the present invention, overall survival (OS) was analyzed in TCGA data to identify genes or combinations with a P-value of 0.05 or less, and the HR (Hazard Ratio) value for each gene or combination was determined. The HR represents risk, and a higher HR value in a group with high expression indicates a lower survival rate for the individual. If the HR is 1.5 or higher, 1.6 or higher, 1.7 or higher, 1.8 or higher, 1.9 or higher, or 2.0 or higher, the prognosis for the individual's colorectal cancer after radiation therapy can be determined to be unfavorable.

[0109]

[0110] Another aspect of the present invention provides a method for diagnosing radioresistance of colon cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0111] Another aspect of the present invention provides a method for predicting the prognosis of radiation therapy for colon cancer, comprising the steps of: (a) measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4 genes in a sample isolated from an individual, or proteins encoded by two or more genes; and (b) comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control.

[0112] Another aspect of the present invention provides a use of a formulation for diagnosing radiation resistance of colon cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0113] Another aspect of the present invention provides a use of a formulation for predicting the prognosis of radiation therapy for colon cancer, the formulation comprising measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

[0114]

[0115] In the present invention, the mRNA of the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or the proteins encoded by the genes have differential expression levels in radioresistant and radiosensitive colon cancer cells, and are closely correlated with a decrease in the survival rate of colon cancer patients. Therefore, the agent for measuring the expression level of the mRNA of the gene selected from the group consisting of the CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes of the present invention or the protein encoded by the gene can effectively diagnose the radioresistance of colon cancer or predict the prognosis of colon cancer radiotherapy, and thereby determine whether to perform radiotherapy and the optimal dose of radiotherapy, thereby improving the efficiency and treatment results of radiotherapy for colon cancer.

[0116] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0117]

[0118] Figure 1 shows the results of radiation sensitivity measurements for human colon cancer cell lines HT29 and HCT116.

[0119] Figure 2 shows the results of analyzing genes whose expression increased or decreased after irradiating human colon cancer cell lines HT29 and HCT116 with 8 Gy of radiation.

[0120] Figure 3 shows the results of analyzing changes in the expression of proteins of radiation-responsive genes in human colon cancer cell lines HT29 and HCT116.

[0121] Figure 4 shows the results of analyzing the expression levels and risk of CXCL5 and CD68 genes using the DESeq2 program in RNAseq results (GSE107422) of 110 patients who relapsed after developing colon cancer.

[0122] Figure 5a shows Kaplan-Meier survival curves for the survival rates of patients with colon cancer according to VTN, SNCG, or SERPING1 expression.

[0123] Figure 5b shows Kaplan-Meier survival curves for the survival rate of patients with colon cancer according to the expression of VTN and MATN1, VTN and SERPING1, SNCG and SYTL4, SNCG and CD68, or SNCG and FBXO4.

[0124] Figure 6a shows the change in cell viability measured after knocking down the expression of radiation resistance genes using siRNA in the human colon cancer cell line HCT116.

[0125] Figure 6b shows the change in cell viability measured after knocking down the expression of radiation resistance genes using siRNA in the human colon cancer cell line HT29.

[0126]

[0127] Hereinafter, the present invention will be described in detail by examples.

[0128] However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0129]

[0130] Example 1. Measurement of radiation sensitivity of colon cancer cell lines

[0131] Human colon cancer cell lines HT29 and HCT116 were purchased from ATCC (American Type Culture Collection, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (10,000 U / ml) at 5% CO2 and 37°C. To measure the radiosensitivity of the colon cancer cells, each cell line was seeded in an appropriate number of cells in a 60 mm dish, and after 24 hours, radiation was irradiated at different doses and cultured for 10-14 days at 5% CO2 and 37°C. The formed cell colonies were then washed with phosphate-buffered saline (PBS) and stained with a 100% methanol mixture containing 1% methylene blue. Stained cell colonies (colonies with more than 50 cells) were counted visually for each dish after drying at room temperature.

[0132] As a result, the survival rate of the HT29 cell line after radiation exposure was measured to be significantly higher than that of the HCT116 cell line, confirming that the HT29 cell line has higher radiation resistance than the HCT116 cell line (Fig. 1).

[0133]

[0134] Example 2. Discovery of radiation-responsive genes in colon cancer

[0135] To identify radiation-responsive genes in colon cancer, genes were selected based on transcriptome analysis from HT29 and HCT116 cell lines, and the radiation responsiveness of each gene was measured using real-time reverse transcription polymerase chain reaction (RT-PCR). The primer information used in this example is shown in Table 1.

[0136] Target SequenceOfficialGene NameProductlengthDir.Sequence (5'->3')NM_002994.5CXCL5111ForwardCAG ACC ACG CAA GGA GTT CAT C(SEQ ID NO: 9)ReverseTTC CTT CCC GTT CTT CAG GGA G(SEQ ID NO: 10)NM_001040059.2CD68136ForwardCGA GCA TCA TTC TTT CAC CAG CT(SEQ ID NO: 11)ReverseATG AGA GGC AGC AAG ATG GAC C(SEQ ID NO: 12)NM_002379.3MATN192ForwardGGC TTC ACT CTG AAC AGC GAC G(SEQ ID NO: 13)ReverseCCG TCA ATG AGG AAG ACC AGG T(SEQ ID NO: 14)NM_012176.3FBXO4143ForwardGTC TTC GGG AAG ACC ATT GTT GG (SEQ ID NO: 15)ReverseGAG TTT CAG CCT CTG TAT CCT GG (SEQ ID NO: 16)NM_000062.3SERPING1157ForwardGCA TCA AAG TGA CGA CCA GCC A (SEQ ID NO: 17)ReverseGTC TCT GTC AGT TCC AGC ACT G (SEQ ID NO: 18)NM_001330120.2SNCG132ForwardTGT GGT GAG CAG CGT CAA CAC T (SEQ ID NO: 19)ReverseTTG GAT GCC ACA CCC TCC TGT T (SEQ ID NO: 20)NM_000638.4VTN154ForwardTGG CTG TCC TTG TTC TCC AGT G (SEQ ID NO: 21) ReverseGTG TGC GAA GAT TGA CTC GGT AG (SEQ ID NO: 22)NM_001129896.3SYTL494ForwardGGA GAC AGA AGC AAA TCC GTC C (SEQ ID NO: 23)ReverseGGC GAT GTA ACT TCA CTA GGT GG (SEQ ID NO: 24)NM_022551.3RPS18107ForwardCAC GCC AGT ACA AGA TCC CA (SEQ ID NO: 25)ReverseTTC ACG GAG CTT GTT GTC CA (SEQ ID NO: 26).

[0137] Afterwards, the HT29 and HCT116 cell lines were irradiated with 0 or 8 Gy of radiation, and then the expression of each gene was measured. As a result, the expression of CXCL5, CD68, MATN1, SERPING1, SNCG, and VTN was increased in both cell lines by radiation irradiation, while the expression of FBXO4 and SYTL4 was decreased in both cell lines by radiation irradiation (Fig. 2). In addition, the expression of CXCL5, CD68, and MATN1 was high in the relatively radioresistant HT29 cell line, the expression of SERPING1, SNCG, and VTN was high in the relatively radiosensitive HCT116 cell line, and the expression of FBXO4 and SYTL4 was similar in the two cell lines.

[0138]

[0139] Example 3. Confirmation of changes in protein expression of radiation response factors.

[0140] To confirm the protein expression patterns of the radiation-responsive genes derived from Example 2 above in response to radiation exposure, HT29 and HCT116 cell lines were subjected to 8 Gy radiation exposure, and 24 hours later, proteins were extracted and subjected to Western blotting analysis. Information on the antibodies used in this example is provided in Table 2 below.

[0141] Primary Antibody Manufacturer Cat. No Host Size (kD) CXCL5 Invitrogen 700 656 Rabbit 8 CD68 Santa Cruz sc-200 60 Mouse 75 100 MATN1 Santa Cruz sc-144 28 Goat 120 SERPING1 Invitrogen PA5-315 41 Rabbit 100 SNCGS Santa Cruz sc-659 79 Mouse 80 90 VTNS Santa Cruz sc-744 84 Mouse 75 FBXO4 Santa Cruz sc-376 372 Mouse 44 SYTL4 Invitrogen PA5-359 92 Rabbit 80 90 ACTBSigma A5 316 Mouse 42

[0142] As a result, CXCL5 was highly expressed in the relatively radioresistant HT29 cell line, and SNCG was highly expressed in the relatively radiosensitive HCT116 cell line. In addition, VTN protein was found to significantly increase due to radiation exposure, while FBXO4 protein was found to decrease (Fig. 3). Meanwhile, CD68, CXCL5, SNCG, and SERPING1 are all secreted proteins known to be closely related to the activation of immune cells around tumors, and thus, the decrease in the Western blot may mean that their secretion into the medium was increased.

[0143]

[0144] Example 4. Analysis of risk and survival curves according to the expression of a panel of radiation-responsive genes in patients with colon cancer.

[0145] To confirm the expression patterns of the radiation-responsive genes identified in Example 2 in actual colon cancer patients, data from 110 patients with recurrent colon cancer (GSE107422) were downloaded and analyzed using the DESeq2 program. As a result, as shown in Table 3 below, the expression of CXCL5 and CD68 was significantly increased by 3.946-fold and 1.46-fold, respectively.

[0146] SymbolFC(fold change)P-valueCXCL53.9460.000006CD681.4640.00007

[0147] In addition, as a result of analyzing the overall survival period of cancer patients according to the expression of CXCL5 and CD68, it was found that as the expression of CXCL5 increased, the overall survival period significantly decreased, and the risk was 1.51, and as the expression of CD68 also increased, the overall survival period significantly decreased, and the risk was found to increase to 2.01 (Figure 4).

[0148] Thereafter, in order to analyze the effect of the expression of the radiation response genes derived from the above Example 2 on the survival rate of colon cancer patients, the overall survival (OS) was analyzed with GEPIA2 using the publicly available genomic database data, The Cancer Genome Atlas (TCGA), and genes or combinations with a P-value of 0.05 or less were identified, and the results are shown in Table 4 below. In Table 4 below, HR (Hazard Ratio) represents the risk level, and a higher HR value in a group with high gene expression means a worse survival rate for the patient. In addition, the survival rate of colon cancer patients according to the expression of the genes or combinations was analyzed and visualized using a Kaplan-Meier survival curve (Figs. 5a and 5b).

[0149] CombinationHRP-valueVTNmatn11.50.0084VTNSNCGfbxo41.70.039VTNSNCGfbxo4CD681.70.038VTNSERPING11.70.033SERPING11.70.034SNCG1.70.042SN CGSYTL41.70.029SNCGCD681.70.028SNCGCD68Matn11.80.024SNCGCD68Matn1VTN1.80.02SNCGCD68fbxo41.80.018SNCGCD68VTN1.80.017SNCGfbxo420.0053

[0150] As a result of the analysis, the risk of survival in patients with colon cancer due to increased SNCG expression and the risk due to increased SERPING1 expression were both 1.7, indicating that increased expression of SNCG and SERPING1 alone can be confirmed to increase risk and decrease survival, and can be classified as a radioresistance factor. In addition, in the case of SNCG, the risk was found to increase further when co-expression was increased with CD68, SYTL4, or FBXO4. On the other hand, the risk of increased expression of VTN alone was 1.4, which was not statistically significant, and increased co-expression of VTN / MATN1 or VTN / SERPING1 showed a significant decrease in overall survival rate with risks of 1.5 and 1.7, respectively.

[0151] In addition, since FBXO4 and SYTL4 have a decreased expression due to radiation exposure, and when their co-expression increases with other gene panels, the overall survival of patients with colorectal cancer decreases, patients with colorectal cancer with high expression of FBXO4 and SYTL4 can be considered as candidates for radiation therapy and have a positive prognosis for radiation therapy. On the other hand, since CD68, CXCL5, MATN1, SERPING1, SNCG, and VTN have an increased expression due to radiation exposure, and when their expression increases, they are directly linked to a decreased survival rate of patients with colorectal cancer, these genes have radiation resistance, and patients with colorectal cancer with high expression of these genes can be considered as excluded from radiation therapy and have a negative prognosis for radiation therapy.

[0152]

[0153] Example 5. Analysis of cell viability by knockdown of radiation-responsive genes in human colon cancer cells.

[0154] In order to confirm the change in the survival rate of colon cancer cells when the expression of the radiation resistance genes derived in Example 2 above is knocked down, the expression of the radiation resistance genes was knocked down with siRNA, and then the change in the survival rate of colon cancer cell lines HT29 and HCT116 was measured.

[0155] Specifically, each siRNA was transfected into colon cancer cell lines using Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher scientific, USA) in a 96-well plate, and then irradiated with 8 Gy of radiation. After 48 hours, cell viability was measured by treating with CCK-8 (DOJINDO, Japan) reagent. Information on the siRNAs used in this example is shown in Table 5 below.

[0156] OfficialGene NameNCBI Gene IDDirectionSequence (5'->3')Scramble RNASenseCCUCGUGCCGUUCCAUCAGGUAG(SEQ ID NO: 27)Anti-senseCUACCUGAUGGAACGGCACGAGG(SEQ ID NO: 28)SNCG6623SenseGACCAAGGAGAAUGUUGUACA(SEQ ID NO: 29)Anti-senseUGUACAACAUUCUCCUUGGUC(SEQ ID NO: 30)SYTL494121SenseGAUGAGGGUGAGAUGAUAUUU(SEQ ID NO: 31)Anti-senseAAAUAUCAUCUCACCCUCAUC(SEQ ID NO: 32)CD68968SenseGCUUAUUGCUUUCUGCAUCAU(SEQ ID NO: 33)Anti-senseAUGAUGCAGAAAGCAAUAAGC(SEQ ID NO: 34) VTN7448 Sense GUAGUCAGUACUGGCGCUUUG (SEQ ID NO: 35) Anti-sense CAAAGCGCCAGUACUGACUAC (SEQ ID NO: 36) SERPING1710 Sense GCCAAGUGGAAGACAACAUUU (SEQ ID NO: 37) Anti-sense AAAUGUUGUCUUCCACUUGGC (SEQ ID NO: 38)

[0157] As a result, when each gene was knocked down compared to the control group with a non-specific sequence of scrambled RNA treatment (scRNA), a significant decrease in cell viability was observed in the HCT116 cell line due to the knockdown of CD68, SERPING1, and VTN alone, and among them, the effect of SERPING1 was the highest. In addition, in the HCT116 cell line, cell death was found to increase when the co-gene knockdown of SNCG / SYTL4, SNCG / CD68, and SNCG / CD68 / VTN was performed compared to the knockdown of SNCG alone (Fig. 6a). On the other hand, in the HT29 cell line, no gene was found to significantly induce cell death when knocked down alone, but the co-knockdown of SNCG / SYTL4, SNCG / CD68, and SNCG / CD68 / VTN showed a significant cell death effect compared to the control. In addition, SNCG / CD68 / VTN co-knockdown compared to SNCG knockdown alone, SNCG / CD68 co-knockdown compared to CD68 knockdown alone, and SNCG / CD68 / VTN co-knockdown compared to SNCG / CD68 co-knockdown were found to further increase cell death (Fig. 6b).

[0158]

[0159] Through the above experiments, we confirmed that the presence or absence of radiotherapy resistance and the prognosis of radiotherapy can be effectively predicted by measuring the expression of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4, and SYTL4. Therefore, it is expected that cancer can be treated more effectively when the activity of the above radioresistance gene panel is confirmed and combined with radiotherapy.

[0160]

[0161] Although representative embodiments of the present invention have been described above as examples, the scope of the present invention is not limited to the specific embodiments described above, and those skilled in the art will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A composition for diagnosing radiation resistance of colon cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

2. In claim 1, A composition for diagnosing radiation resistance of colon cancer, comprising a preparation for measuring the expression level of mRNA of SERPING1, CD68 or SNCG gene or a protein encoded by said gene.

3. In claim 1, A composition for diagnosing radiation resistance of colon cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to mRNA of the gene.

4. In claim 1, A composition for diagnosing radiation resistance of colon cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of a polypeptide, a compound, an antibody, and an aptamer that specifically binds to the protein.

5. A kit for diagnosing radiation resistance of colon cancer, comprising a composition according to any one of claims 1 to 4.

6. In claim 5, The above kit is a kit for diagnosing radiation resistance of colon cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit. 7.(a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for diagnosing radioresistance of colon cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

8. In claim 7, A method for providing information for diagnosing radiation resistance of colon cancer, wherein the step (a) comprises a step of measuring the expression level of mRNA of SERPING1, CD68 or SNCG gene or a protein encoded by the gene.

9. A composition for predicting the prognosis of radiation therapy for colon cancer, comprising a preparation for measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes.

10. In claim 9, A composition for predicting the prognosis of radiation therapy for colon cancer, comprising a preparation for measuring the expression level of mRNA of SERPING1, CD68 or SNCG gene or a protein encoded by said gene.

11. In claim 9, A composition for predicting the prognosis of radiation therapy for colon cancer, wherein the agent for measuring the expression level of mRNA of the gene is at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that specifically bind to the mRNA of the gene.

12. In claim 9, A composition for predicting the prognosis of radiation therapy for colon cancer, wherein the agent for measuring the expression level of the protein is at least one selected from the group consisting of antibodies and aptamers that specifically bind to the protein.

13. A kit for predicting the prognosis of radiation therapy for colon cancer, comprising a composition according to any one of claims 9 to 12.

14. In claim 13, The above kit is a kit for predicting the prognosis of radiation therapy for colon cancer, which is an RT-PCR kit, a microarray chip kit, a DNA kit, an ELISA kit, a protein chip kit, or a rapid kit. 15.(a) a step of measuring the expression level of mRNA of two or more genes selected from the group consisting of CXCL5, CD68, MATN1, SERPING1, SNCG, VTN, FBXO4 and SYTL4 genes or proteins encoded by two or more genes in a sample isolated from an individual; and (b) A method for providing information for predicting the prognosis of radiation therapy for colon cancer, comprising the step of comparing the expression level of the mRNA or protein with the expression level of the mRNA or protein of a normal control group.

16. In claim 15, A method for providing information for predicting the prognosis of radiation therapy for colon cancer, wherein the step (a) comprises a step of measuring the expression level of mRNA of the SERPING1, CD68 or SNCG gene or a protein encoded by the gene.

Images