Compositions comprising nanoparticles for targeted delivery and methods of using the same

Abstract

Disclosed herein are compositions comprising nanoparticles designed for CRISPR / Cas13 RNA targeting systems, specifically aimed at targeting poorly druggable, disease-driving genes in prostate cancer and COVID-19, and methods of use thereof.

Description

COMPOSITIONS COMPRISING NANOPARTICLES FOR TARGETED DELIVERY AND METHODS OF USING THE SAME I. CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 579,001 filed 26 August 2023, which is incorporated herein in its entirety. II. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under CA014236 and CA275922 awarded by the National Institute of Health and PC220217 awarded by the US Army Medical Research and Development Command. The government has certain rights in this invention. III. REFERENCE TO THE SEQUENCE LISTING

[0003] This application is being filed electronically via Patent Center and includes an electronically submitted Sequence Listing in .xml format. The .xml file contains a sequence listing titled "20-1068-WO2-Sequence_Listing.xml" created on 24 August 2024 and is 197 kilobytes in size. The Sequence Listing contained in this .xml file is part of the specification and is hereby incorporated by reference herein in its entirety. IV. BACKGROUND

[0004] Metastatic cancer, the leading cause of cancer mortality, is propelled by numerous oncoproteins. Among these, transcription factors (TFs) arguably play a more critical role than conventional signaling oncoproteins, as TFs serve as focal points in the deregulated signaling pathways and are the master regulators of many signaling proteins. Indeed, cancer cells frequently develop a marked dependency on certain TFs, a phenomenon known as 'transcriptional addiction' in cancer. Unfortunately, apart from nuclear hormone receptors, most TFs are considered 'undruggable' due to conformational variability and the lack of distinct small-molecule binding sites. Thus, there remains an urgent need for the development of a technology that targets undruggable TFs to treat, prevent, and / or cure cancer. The compositions and methods disclosed herein meet this need. V. BRIEF DESCRIPTION OF THE FIGURES

[0005] FIG. 1A-FIG. 1B illustrate the evaluation of the CRISPR / Cas13d-mediated gene knockdown system. FIG. 1A shows a graph illustrating mRNA knockdown through CasRx targeting of four endogenous transcripts. Each transcript is targeted with two guides and a non- targeting (NT) guide in 293FT cells (transcript levels are relative to NT guide control). FIG.1B shows a graph representing mRNA knockdown through CasRx targeting of two additional genes,NF2 and HRAS, in 22RV1 (castration resistant prostate cancer (CRPC)) cells. Transcript levels are relative to NT guide control.

[0006] FIG.2A-FIG.2B shows graphs representing mRNA knockdown through CasRx targeting of HoxB13 using four guide RNAs and pre-guide RNAs in 293FT cells. Transcript levels are relative to NT guide control. FIG. 2B shows a graph representing mRNA knockdown through CasRx targeting of HoxB13 using a single gRNA in 22RV1 cells.

[0007] FIG.3A-FIG.3B illustrates the construction and use of an all-in-one plasmid comprising CasRx and pre-gRNAs. FIG.3A shows a diagram of an all-in-one hU6-pregRNAs-EF1α-CasRx- 2AEGFP that can express CasRx and pre-gRNAs. FIG. 3B shows a graph representing mRNA knockdown through CasRx targeting of HoxB13 in 22RV1 cells using arrays of three pre-gRNAs. Transcript levels are relative to NT guide control.

[0008] FIG.4 shows a graph of HoxB13 mRNA expression measured after transfection of CasRx mRNA and pre-gRNA oligo targeting the HoxB13 gene at various weight ratios in 22Rv1 cells. Transcript levels are relative to NT guide control.

[0009] FIG. 5 is a schematic representation of a synthesis of nanoparticles (NPs) and plasmid encapsulation strategy. Positively charged TAT and CasRx plasmid and gRNA / pre-gRNA targeting a transcription factor ("TF") plasmid self-assemble with PLGA in DMF. Polymer cores are then coated with lipid-PEG-COOH. NPs can optionally be conjugated to Alexa Fluor 647- amine-functionalized aptamers by carbodiimide coupling chemistry. In this schematic, an Alexa Fluor labeled aptamer that specifically binds PSMA is used.

[0010] FIG. 6A-FIG. 6B show the characterization of nanoparticle size distribution with TAT (FIG.6A) or without TAT (FIG.6B).

[0011] FIG.7 shows a graph of HoxB13 mRNA expression measured after incubation of CasRx mRNA-HoxB13 pre-gRNA-LNPs with 22RV1 cells at a weight ratio of 1:1.5 (CasRx:pre-gRNA). Transcript levels are relative to NT guide control.

[0012] FIG. 8 shows an immunohistochemical (IHC) analysis of HoxB13 in normal prostate, ADPC and CRPC patient tissues.

[0013] FIG.9 shows a box plot that compares H-scores of HoxB13 nuclear staining in 234 tissue samples as shown in FIG. 8 showing increased abundance of HoxB13 during prostate cancer progression from ADPC to CRPC.

[0014] FIG. 10A-FIG. 10B illustrate Assays for Transposase Accessible Chromatin by sequencing (ATAC-seq) results in two CRPC patient tissues and correlated chromatin accessibility with HoxB13 genomic binding in the same tissue from the same patients. FIG.10A shows UCSC Genome Browser views of representative HoxB13 binding sites and ATAC-seqpeaks, showing strong correlation between the two. FIG. 10B shows a correlation plot between HoxB13 binding signals and ATAC-seq signal.

[0015] FIG.11A-FIG.11F illustrate Cas13d-mediated mRNA knockdown of human and mouse transcripts for mediating SARS-CoV-2 cell entry. FIG. 11A shows graphs representing mRNA knockdown of human TMPRSS2 mRNA with four different pre-gRNAs, with preg2 showing the most effective knockdown. FIG.11B shows graphs representing mRNA knockdown of murine Tmprss2 with four different pre-gRNAs, with preg4 showing the most effective knockdown. FIG. 11C shows graphs representing mRNA knockdown of human mRNA with four different pre- gRNAs, with preg4 showing the most effective knockdown CTSL. FIG. 11D shows graphs representing mRNA knockdown of murine Ctsl mRNA with four different pre-gRNAs, with preg3 showing the most effective knockdown. FIG.11E shows graphs representing mRNA knockdown of human FURIN mRNA with four different pre-gRNAs, with preg3 showing the most effective knockdown. FIG. 11F shows graphs representing mRNA knockdown of murine Furin mRNA with four different pre-gRNAs, with preg4 showing the most effective knockdown. Transcript levels, for both figures, are relative to NT guide control.

[0016] FIG. 12A-FIG. 12E shows that LNP-CasRx-pre-gHoxB13-E3 is effective in knocking down HoxB13 in liver mCRPC tissues. FIG. 12A is a representative image of bioluminescent (luciferase) analysis. Six weeks after hemi-spleen injection of 0.5 million LNCaP95 CRPC cells stably expressing a luciferase (LNCaP95-Luc), mouse major organs were isolated and imaged 5 minutes after intraperitoneally injection with the substrate D-luciferin (150 mg / kg). The bioluminescent cells were visible in the liver, with the heart, lung, spleen and kidney exhibiting background luminescence only. FIG.12B is a Hematoxylin and Eosin staining of the liver cross- section, showing the tumor boundary. FIG. 12C is a graph showing the relative mRNA expression of HoxB13. FIG.12D is a Western blot analysis using HoxB13 antibodies, of liver mCRPC tissue from mice injected with LNP-CasRx-pre-gHoxB13-E3 or control LNP-CasRx-pre- gControl-E3. Calnexin is used as the loading control. FIG. 12E provides a bar graph with the quantitation for the Western blot.

[0017] FIG. 13A-FIG. 13B shows selective targeting of liver metastatic CRPC cells with LNP- mCherry-E3 delivery over normal liver tissues. FIG. 13A provides representative mCherry expression images taken 2 hr after injection of LNP-mCherry-E3 (Upper panels), while the luciferase images are shown to indicate the distributions of metastatic LNCaP95-Luc CRPC cells in the livers (Lower panels). FIG.13B provides cumulative mCherry counts in metastatic CRPC tumors and the surrounding liver tissues (n = 3). ***p < 0.001.

[0018] FIG. 14A-FIG. 14B illustrates that LNP-CasRx-pre-gHoxB13-E3 treatment suppresses AR+CRPC visceral metastasis. One-week post hemi-spleen injection of LNCaP95 cells stably expressing luciferase into NSG mice, DPBS, empty LNP-E3(eLNP-E3), LNP-CasRx-pre- gControl-E3 or LNP-CasRx-pre-gHoxB13-E3 was administered through tail-vein injections. Mice (n = 4-6) were dosed twice per week for 6.5 weeks. FIG.14A provides representative images of bioluminescent (luciferase) analysis. FIG. 14B provides cumulative luciferase counts (as semi quantification of metastatic size). **p < 0.01.

[0019] FIG. 15A-FIG. 15B illustrates that LNP-CasRx-pre-gHoxB13-E3 treatment suppresses AR- CRPC visceral metastasis. Three days post hemi-spleen injection of PC3-red-Fluc cells into NSG mice, LNP-CasRx-pre-gControl-E3 or LNP-CasRx-pre-gHoxB13-E3 was administered through tail-vein injections. Mice (n = 4-6) were dosed twice per week for 3 weeks. FIG. 15A provides representative images of bioluminescent (luciferase) analysis. FIG. 15B provides cumulative luciferase counts (as semi quantification of metastatic size). ***p < 0.001.

[0020] FIG. 16A-FIG. 16B provides Kaplan-Meyer survival curves demonstrating that LNP- CasRx-pre-gHoxB13-E3 treatment improves survival of the mice with CRPC visceral metastasis. The dosing schedules were as described in FIG.14A-FIG.14B (AR+, LNCaP95 model) and FIG. 15A-FIG.15B (AR-, PC3 model). FIG.16A provides survival data as was observed for LNCaP95 model FIG.16B provides survival data as was observed for PC3 model. P values were determined by log-rank (Mantel-Cox) test. **p < 0.01.

[0021] FIG. 17A-FIG. 17C illustrates that long-term administration of liver-targeting LNPs are well tolerated in vivo. Male CD-1 mice were IV treated with DPBS, eLNP-E3, LNP-CasRx-pre- gControl-E3 or LNP-CasRx-pre-gHoxB13-E3 twice a week for 7 weeks (n = 8 per group). FIG. 17A provides change of body weight (%) with treatment progression in days. FIG.17B provides analysis of collected plasma for hepatic (ALT and AST) function. FIG.17C provides analysis of collected plasma for renal function (BUN and CREAT) analysis. No statistical significance was detected between groups.

[0022] FIG. 18A-FIG. 18B shows data for screening of pre-gRNAs for potent knockdown of MYCN mRNA (encoding N-Myc) by CasRx system. FIG.18A provides a bar graph showing the relative expression on MYCN mRNA in cells treated with four N-Myc guide RNAs (pre-gMYCN- 1, pre-gMYCN-2, pre-gMYCN-3 and pre-gMYCN-4) respectively with respect to cells treated with the Control gRNA. FIG.18B provides a Western blot analysis of cells treated with pre-gMYCN- 2 for N-Myc protein expression. GAPDH was used as a loading control.

[0023] FIG.19A-FIG.19D provide data to show that LNP-CasRx mRNA / pre-gMYCN treatment decreases NEPC cell growth in vitro. FIG.19A provides MYCN mRNA expression in LASCPC-01 cells treated with LNP-CasRx-pre-gControl or LNP-CasRx-pre-gMYCN. FIG. 19B provides cell proliferation data for LASCPC-01 cells treated with LNP-CasRx-pre-gControl or LNP- CasRx-pre-gMYCN. FIG.19C provides MYCN mRNA expression in MSKCC-EF1 cells treated with LNP-CasRx-pre-gControl or LNP-CasRx-pre-gMYCN. FIG.19D provides cell proliferation data for MSKCC-EF1 cells treated with LNP-CasRx-pre-gControl or LNP-CasRx-pre-gMYCN. MYCN mRNA expression and cell proliferation were measured by qRT-PCR and luminescent cell viability assay (CellTiter-Glo, Promega), respectively. ***p < 0.001, ****p < 0.0001.

[0024] FIG. 20A-FIG. 20C illustrates that liver- and lung-targeting LNP-CasRx-pre-gMYCN treatment suppresses NEPC visceral metastasis. FIG. 20A provides a schematic illustration of the experimental design. One-week post engraftment of LASCPC-01 cells that stably express luciferase into NSG mice, DPBS, empty LNP, LNP-CasRx-pre-gControl or LNP-CasRx-pre- gMYCN was administered through tail-vein injections. Mice (n = 4-6) were dosed twice per week for 5 weeks. FIG. 20B provides representative images of bioluminescent (luciferase) analysis. FIG.20C provides cumulative luciferase counts (as semi quantification of metastatic size). *p < 0.05, **p < 0.01.

[0025] FIG. 21 provides Kaplan-Meyer survival curves demonstrating that liver- and lung- targeting LNP-CasRx-pre-gMYCN treatment improves survival of the mice with NEPC visceral metastasis. One-week post LASCPC-01cell injection into NSG mice, DPBS, empty LNP, LNP- CasRx-pre-gControl or LNP-CasRx-pre-gMYCN was administered through tail-vein. Mice (n = 4-6) were dosed twice per week for 5 weeks and observed for survival until 11 weeks post cell engraftment. P values were determined by log-rank (Mantel-Cox) test. **p < 0.01.

[0026] FIG. 22 provides LNP-CasRx-pre-gMYCN sensitize LASCPC-01 NEPC cells to cisplatin / docetaxel. LASCPC-01 cells were treated for 72 hr and subjected to cell viability assay. As shown, dose-response curve of cisplatin is shifted to left by docetaxel, which is further left- shifted by LNP-CasRx-pre-gMYCN.

[0027] FIG. 23A-FIG. 23B shows that MED31 protein expression increases during prostate cancer progression to CRPC. FIG. 23A provides representative MED31 immunoreactivity in normal prostate, ADPC and CRPC tissues. MED31 showed nuclear staining. FIG.23B provides a violin plot comparing H-scores of MED31 nuclear staining in 168 prostate tissues.

[0028] FIG.24A-FIG.24F demonstrates that high expression of the MED31 recycling complex is correlated with poor prognosis of advanced CRPC patients within CRPC tumors from the East Coast SU2C dataset. FIG. 24A provides time on first-line AR signaling inhibitor (ARSI) treatment, compared between the highest and lowest co-expression of MED31 recycling complex within CRPC tumors from the East Coast SU2C dataset. FIG.24B provides time on first-line ARsignaling inhibitor (ARSI) treatment, compared between the highest and lowest co-expression of MED17 nonrecycling complex within CRPC tumors from the East Coast SU2C dataset. FIG. 24C provides time on first-line AR signaling inhibitor (ARSI) treatment, compared between the highest and lowest co-expression of MED26 nonrecycling complex within CRPC tumors from the East Coast SU2C dataset. FIG. 24D provides overall survival compared between highest and lowest co-expression of MED31 recycling complex within CRPC tumors from the West Coast SU2C dataset. FIG. 24E provides overall survival, compared between highest and lowest co- expression of MED17 nonrecycling complex within CRPC tumors from the West Coast SU2C dataset. FIG.24F provides overall survival, compared between highest and lowest co-expression of MED26 nonrecycling complex within CRPC tumors from the West Coast SU2C dataset. P- values were calculated by Log-rank (Mantel-Cox) test.

[0029] FIG.25A-FIG.25F demonstrates that MED31 is both sufficient and necessary for prostate cancer castration-resistant growth and invasion. FIG. 25A shows the effect of stable MED31 overexpression on proliferation of LNCaP95 cells cultured in phenol-red free RPMI1640 medium supplemented with 5% charcoal-stripped FBS. FIG. 25B shows cell proliferation of indicated CRPC cell line or BPH1 measured 4 days after cells were transfected with Dharmacon ON- TARGETplus siRNA SMARTpool. FIG. 25C provides SI (selective index) of siMED31- mediated cell growth inhibition, which was calculated as a ratio of IC50of siMED31 in BPH1 cells divided by IC50 of siMED31 in CRPC cell lines. FIG.25D shows data for the effect of MED31 knockdown on cell invasiveness of LNCaP95 cell line. FIG. 25E shows data for the effect of MED31 knockdown on cell invasiveness of 22Rv1 cell line. FIG.25F shows data for the effect of MED31 knockdown on cell invasiveness of PC3 cell line. The invasion results were normalized by cell proliferation under the same treatment conditions. ***p < 0.001, ****p < 0.0001, n.s. not significant. An independent MED31 siRNA yields similar results.

[0030] FIG. 26A-FIG. 26B provides screening data of pre-gRNAs for potent CasRx-based knockdown of MED31. FIG.26A provides evaluation of knockdown efficiency using qRT-PCR following 293FT cell co-transfection with plasmids expressing CasRx and four candidate pre- gRNAs targeting MED31. FIG.26B provides evaluation of knockdown efficiency using western blotting following 293FT cell co-transfection with plasmids expressing CasRx and four candidate pre-gRNAs targeting MED31.

[0031] FIG. 27A-FIG. 27D shows that LNP-CasRx-pre-gMED31 treatment decreased MED31 expression and LNCaP95 CRPC growth in vivo. FIG. 27A shows photographs of tumors from each group as indicated. FIG. 27B provides tumor weight and statistical analysis of LNCaP95 xenografts from each group (n = 6). FIG. 27C provides MED31 mRNA expression for each ofthe treatment groups by qRT-PCR. FIG. 27D provides MED31 protein level in LNCaP95 xenograft samples (n = 6) by western blotting. **p < 0.01, ****p < 0.0001, n.s. not significant.

[0032] FIG. 28A shows ChIP-seq signal intensity of MED31 binding sites in LNCaP95 (left panel) and PC3(right panel) cells, shown within a window of 2 Kb around the peak center. FIG. 28B shows the averaged plot of MED31 binding intensity in LNCaP95 (upper panel) and PC3 (bottom panel) cells, centered with a 2 Kb window.

[0033] FIG.29A-FIG.29B show the volcano plot of gene expression changes between siMED31 and siControl transfected LNCaP95 cells (FIG. 29A) and PC3 cells (FIG. 29B). RNA-seq was performed in biological triplicates, and significantly upregulated and downregulated genes were highlighted in red or blue color, respectively (FC > 1.5, P adj < 0.05).

[0034] FIG. 30A-FIG. 30B show the cistrome-GO pathway analysis through the integration of MED31 binding sites and MED31-regulated genes. Enriched KEGG pathways from LNCaP95 cells are in FIG.30A and from PC3 cells in FIG.30B.

[0035] FIG. 31A shows a schematic diagram of GST-tagged MED31 and its truncated forms. FIG.31B shows an SDS-PAGE gel analysis of in vitro expressed GST-tagged full-length MED31 as well as various GST-tagged MED31 truncated mutants. The recombinant proteins were stained with SimplyBlue stain for size visualization. The indicated protein bands were marked with black arrows.

[0036] FIG. 32A shows ChIP-seq signal intensity of N-Myc binding sites in LASCPC-01 cells, presented within a window of 10 Kb around the peak center. FIG.32B shows the averaged plot of N-Myc binding intensity in LASCPC-01 cells, centered with a 10 Kb window. FIG.32C shows the genomic distributions of N-Myc binding peaks in LASCPC-01 cells.

[0037] FIG. 33A-FIG. 33B show Cistrome-GO pathway analysis through the integration of N- Myc binding sites and N-Myc-regulated genes. Enriched KEGG pathways (FIG. 33A) and biological processes (FIG. 33B) from genes upregulated and downregulated upon CasRx- mediated MYCN knockdown are shown.

[0038] FIG. 34A shows the architecture of the PepMLM model. Based on the fine-tuning of ESM-2, the model incorporates the target protein sequence along with a masked binder regions during training phase. The model can accept target protein sequences and mask tokens to facilitate the creation of peptides of specified lengths. FIG. 34B shows the perplexity distribution comparison. The perplexity values were calculated for test and generated peptides. FIG. 34C shows the density distribution visualization of the log perplexity values for target-peptide pairs. FIG.34D shows AlphaFold-Multimer co-folding examples of specified target proteins from thePDB and sampled peptide binders generated via PepMLM-650M, with the pLDDT values serving as the determinant for color coding. ipTM scores indicate binding stability.

[0039] FIG. 35 shows the binding interaction evaluation of CD19-binding scFV under various concentration of doxycycline.

[0040] FIG. 36A-FIG. 36D shows ELISA binding assays for 4 different NCAM1-targeting peptides (FIG. 36A (pMLM_3), FIG. 36B (pMLM_4), FIG. 36C (pMLM_6), and FIG. 36D (pMLM_8)). NCAM1 was immobilized on the surface 96-well plates (MaxiSorp; Nunc Nalgene). Peptides integrated into the Sso7d scaffold were purified and biotinylated. At different concentrations of binder, HRP-conjugated streptavidin was added, and absorbance was measured at a wavelength of 450 nm using a FilterMax F5 microplate spectrophotometer. VI. BRIEF SUMMARY

[0041] Disclosed herein is a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0042] Disclosed herein is a plasmid comprising a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0043] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences.

[0044] Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0045] Disclosed herein is a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules. Disclosed herein is a pharmaceutical formulation comprising one or moredisclosed plasmids. Disclosed herein is a pharmaceutical formulation comprising one or more disclosed nanoparticles. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acidsequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0046] Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nucleic acid molecules. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed plasmids. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nanoparticles. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations.

[0047] Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nucleic acid molecules. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed plasmids. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nanoparticles. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations.VII. DETAILED DESCRIPTION

[0048] The present disclosure describes formulations, compounded compositions, kits, capsules, containers, and / or methods thereof. It is to be understood that the inventive aspects of which are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. A. Definitions

[0049] Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.

[0050] This disclosure describes inventive concepts with reference to specific examples. However, the intent is to cover all modifications, equivalents, and alternatives of the inventive concepts that are consistent with this disclosure.

[0051] As used in the specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0052] The phrase "consisting essentially of" limits the scope of a claim to the recited components in a composition or the recited steps in a method as well as those that do not materially affect the basic and novel characteristic or characteristics of the claimed composition or claimed method. The phrase "consisting of" excludes any component, step, or element that is not recited in the claim. The phrase "comprising" is synonymous with "including", "containing", or "characterized by", and is inclusive or open-ended. "Comprising" does not exclude additional, unrecited components or steps.

[0053] In an aspect, when referring to any numerical value, the term "about" means a value falling within a range that is ± 10% of the stated value. In an aspect, "about" is used to provide flexibility to a numerical range endpoint by providing that a given value may be "slightly above" or "slightly below" the endpoint without affecting the desired result.

[0054] Ranges can be expressed herein as from "about" one particular value, and / or to "about" another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0055] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.

[0056] In an aspect, the terms "optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. In an aspect, a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.

[0057] In an aspect, the term "subject" refers to the target of administration, e.g., a human being. The term "subject" also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). Thus, the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Alternatively, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex, and thus, adult and child subjects, as well as fetuses, whether male or female, are intended to be covered. In an aspect, a subject canbe a human patient. In an aspect, a subject can have cancer, be suspected of having cancer, or be at risk of developing cancer. In an aspect, a subject can have COVID-19, be suspected of having COVID-19, or be at risk of developing COVID-19.

[0058] In an aspect, the term "diagnosed" means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by one or more of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or more of the disclosed methods. For example, "diagnosed with a disease or disorder" means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as cancer (prostate / metastatic prostate) or COVID-19) that can be treated by one or more of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or more of the disclosed methods. For example, "suspected of having a disease or disorder" can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as cancer (prostate / metastatic prostate) or COVID-19) that can likely be treated by one or more of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or more of the disclosed methods. In an aspect, an examination can be physical, can involve various tests (e.g., blood tests, genotyping, biopsies, etc.), scans (e.g., CT scans, PET scans, etc.), and assays (e.g., enzymatic assay), or a combination thereof.

[0059] A "patient" refers to a subject afflicted with a disease or disorder (e.g., cancer (prostate / metastatic prostate) or COVID-19). In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder (such as a cancer (prostate / metastatic prostate) or COVID-19) and is seeking treatment or receiving treatment.

[0060] In an aspect, the phrase "identified to be in need of treatment for a disease or disorder," or the like, refers to selection of a subject based upon need for treatment of the disease or disorder. For example, a subject can be identified as having a need for treatment of a disease or disorder (e.g., cancer (prostate / metastatic prostate) or COVID-19) based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for cancer (prostate / metastatic prostate) or COVID-19. In an aspect, the identification can be performed by a person different from the personmaking the diagnosis. In an aspect, the administration can be performed by one who performed the diagnosis.

[0061] In an aspect, "inhibit," "inhibiting", and "inhibition" mean to diminish or decrease an activity, level, response, condition, severity, disease, or other biological parameter. This can include, but is not limited to, the complete ablation of the activity, level, response, condition, severity, disease, or other biological parameter. This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease, or other biological parameter as compared to the native or control level (e.g., a subject not receiving one or more of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof). Thus, in an aspect, the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels. In an aspect, the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to a native or control level (e.g., a subject not receiving one or more of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof). In an aspect, the inhibition or reduction can be 0-25%, 25-50%, 50-75%, or 75-100% as compared to native or control levels. In an aspect, a native or control level can be a pre-disease or pre-disorder level (such as a pre-cancer state or a pre-COVID-19 state).

[0062] The words "treat" or "treating" or "treatment" include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. In an aspect, the terms cover any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the undesired physiological change, disease, pathological condition, or disorder from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the physiological change, disease, pathological condition, or disorder, i.e., arresting its development; or (iii) relieving the physiological change, disease, pathological condition, or disorder, i.e., causing regression of the disease. For example, in an aspect, treating a disease or disorder can reduce the severity of an established a disease ordisorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having cancer or not having COVID-19). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of a disease or disorder (such as cancer). For example, treating a disease or disorder can reduce one or more symptoms of a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having cancer or not having COVID-19). In an aspect, treating can refer to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% reduction of one or more symptoms of an established a disease or disorder. It is understood that treatment does not necessarily refer to a cure or complete ablation or eradication of a disease or disorder. However, in an aspect, treatment can refer to a cure or complete ablation or eradication of a disease or disorder (such as cancer (prostate / metastatic prostate) or COVID-19).

[0063] In an aspect, the term "prevent" or "preventing" or "prevention" refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an aspect, preventing a disease or disorder having chromatin deregulation and / or chromatin dysregulation is intended. The words "prevent", "preventing", and "prevention" also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having a given a disease or disorder (such as cancer (prostate / metastatic prostate) or COVID- 19) or related complication from progressing to that complication. In an aspect, preventing metastasis is intended.

[0064] In an aspect, the terms "administering" and "administration" refer to any method of providing one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, the following: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intratumoral administration, intrahepatic administration, intravaginal administration, ophthalmic administration, intraaural administration, otic administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can also include hepatic intra-arterial administration or administration through the hepatic portalvein (HPV). Administration of a disclosed nucleic acid molecule, a disclosed plasmid, a nanoparticle, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof can comprise administration directly into the CNS or the PNS or any organ or any tissue. Administration can be continuous or intermittent. Administration can comprise a combination of one or more routes.

[0065] In an aspect, the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof to treat or prevent a disease or disorder (such as cancer (prostate / metastatic prostate) or COVID-19). In an aspect, the skilled person can also alter, change, or modify an aspect of an administering step to improve efficacy of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof.

[0066] By "determining the amount" is meant both an absolute quantification of a particular analyte (e.g., biomarker for cancer (prostate / metastatic prostate) or COVID-19, for example) or a determination of the relative abundance of a particular analyte (e.g., a cancer (prostate / metastatic prostate) or COVID-19 biomarker). The phrase includes both direct or indirect measurements of abundance or both.

[0067] In an aspect, "modifying the method" can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. In an aspect, a method can be altered by changing the amount of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof administered to a subject, or by changing the frequency of administration of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof to a subject, by changing the duration of time that a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof is administered to a subject, or by substituting for one or more of the disclosed components and / or reagents with a similar or equivalent component and / or reagent.The same applies to all disclosed nucleic acid molecules, disclosed plasmids, disclosed nanoparticles, disclosed pharmaceutical formulations, disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed small molecules, disclosed endonucleases, disclosed oligonucleotides, disclosed RNA therapeutics, or any combination thereof.

[0068] In an aspect, "concurrently" means (1) simultaneously in time, or (2) at different times during the course of a common treatment schedule.

[0069] In an aspect, the term "contacting" refers to bringing a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof together with a target area or intended target area in such a manner that a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof can exert an effect on the intended target or targeted area either directly or indirectly. A target area or intended target area can be one or more of a subject's organs (e.g., lungs, heart, liver, kidney, brain, etc.) hosting cancerous cells or cells infected with COVID- 19. In an aspect, a target area or intended target area can be any cell or any organ infected by a disease or disorder (such as cancer (prostate / metastatic prostate) or COVID-19). In an aspect, a target area or intended target area can be any organ, tissue, or cells that are affected by a disease or disorder (such as cancer (prostate / metastatic prostate) or COVID-19).

[0070] In an aspect, "determining" can refer to measuring or ascertaining the presence and severity of a disease or disorder, such as, for example, cancer (prostate / metastatic prostate) or COVID-19. Methods and techniques used to determine the presence and / or severity of a disease or disorder are typically known to the medical arts. For example, the art is familiar with the ways to identify and / or diagnose the presence, severity, or both of a disease or disorder (such as, for example, cancer (prostate / metastatic prostate) or COVID-19).

[0071] In an aspect, "effective amount" and "amount effective" can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and / or prevention of a disease or disorder (e.g., a cancer (prostate / metastatic prostate) or COVID-19) or a suspected disease or disorder. In an aspect, the terms "effective amount" and "amount effective" can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., a cancer (prostate / metastatic prostate) or COVID-19). For example, a "therapeutically effective amount" refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects.

[0072] In an aspect, "therapeutically effective amount" means an amount of the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof that (i) treats the particular disease, condition, or disorder (e.g., cancer (prostate / metastatic prostate) or COVID-19), (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder e.g., cancer (prostate / metastatic prostate) or COVID-19), or (iii) delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein (e.g., cancer (prostate / metastatic prostate) or COVID-19). The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti- cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti- cancer agent, the disclosed chemotherapeutic agent, or the combination thereof at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, then the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature forappropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a "prophylactically effective amount"; that is, an amount effective for prevention of a disease or condition, such as, for example, a disease or disorder due to a missing, deficient, and / or mutant protein or enzyme.

[0073] "Endogenous" with reference to a gene, protein, and / or nucleic acid refers to the natural presence of that gene, protein, and / or nucleic acid in a cell, such as an immune cell.

[0074] "Exogenous" refers to an introduced agent, such as a nucleic acid, gene, or protein, into a cell, for example from an outside source. A nucleic acid introduced into a cell is exogenous even if it encodes a protein which is naturally found in the cell. Such exogenous introduction of a nucleic acid encoding a protein can be used to increase the expression of the protein over the level that would naturally be found in the cell under similar conditions, e.g., without introduction of the exogenous nucleic acid.

[0075] The term "immunotherapy" refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response. Examples of immunotherapy can include, but are not limited to, NK cells and T cell therapies. T cell therapy can include adoptive T cell therapy, tumor-infiltrating lymphocyte (TIL) immunotherapy, autologous cell therapy, engineered autologous cell therapy (eACTTM), and allogeneic T cell transplantation. However, one of skill in the art would recognize that the conditioning methods disclosed herein would enhance the effectiveness of any transplanted T cell therapy.

[0076] In an aspect, "RNA therapeutics" can refer to the use of oligonucleotides to target RNA. RNA therapeutics can offer the promise of uniquely targeting the precise nucleic acids involved in a particular disease with greater specificity, improved potency, and decreased toxicity. This could be particularly powerful for genetic diseases where it is most advantageous to aim for the RNA as opposed to the protein. In an aspect, a therapeutic RNA can comprise one or more expression sequences. As known to the art, expression sequences can comprise an RNAi, shRNA, mRNA, non-coding RNA (ncRNA), an antisense such as an antisense RNA, miRNA, morpholino oligonucleotide, peptide-nucleic acid (PNA) or ssDNA (with natural, and modified nucleotides, including but not limited to, LNA, BNA, 2'-O-Me-RNA, 2'-MEO-RNA, 2'-F-RNA), or analog or conjugate thereof. In an aspect, a disclosed therapeutic RNA can comprise one or more long non- coding RNA (lncRNA), such as, for example, a long intergenic non-coding RNA (lincRNA), pre- transcript, pre-miRNA, pre-mRNA, competing endogenous RNA (ceRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), pseudo-gene, rRNA, or tRNA. In an aspect, ncRNA can be piwi-interacting RNA (piRNA), primary miRNA (pri-miRNA), or premature miRNA (pre-miRNA). In an aspect, a disclosed therapeutic RNA or an RNA therapeutic can comprise antisense oligonucleotides (ASOs) that inhibit mRNA translation, oligonucleotides that function via RNA interference (RNAi) pathway, RNA molecules that behave like enzymes (ribozymes), RNA oligonucleotides that bind to proteins and other cellular molecules, and ASOs that bind to mRNA and form a structure that is recognized by RNase H resulting in cleavage of the mRNA target. In an aspect, RNA therapeutics can comprise RNAi and ASOs that inhibit mRNA translation. Generally speaking, as known to the art, RNAi operates sequence specifically and post- transcriptionally by activating ribonucleases which, along with other enzymes and complexes, coordinately degrade the RNA after the original RNA target has been cut into smaller pieces while antisense oligonucleotides bind to their target nucleic acid via Watson-Crick base pairing, and inhibit or alter gene expression via steric hindrance, splicing alterations, initiation of target degradation, or other events.

[0077] In an aspect, Type VI CRISPR enzymes are programmable RNA-guided, RNA-targeting Cas proteins with nuclease activity that allow for target gene knock-down without altering the genome. In addition to target RNA knock-down, Cas13 proteins (as described infra) can be used for viral RNA detection, site-directed RNA editing, demethylation of m6A-modified transcripts, RNA live-imaging, and modulation of splice site choice as well as cleavage and polyadenylation site usage. Cas13 proteins are guided to their target RNAs by a single CRISPR RNA (crRNA) composed of a direct repeat (DR) stem loop and a spacer sequence (target specific guide RNA (gRNA)) that mediates target recognition by RNA-RNA hybridization. To date, three Cas13 effector proteins (PguCas13b, PspCas13b, RfxCas13d) have been reported to show high RNA knock-down efficacy with minimal off-target activity.

[0078] In an aspect, the terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer. In an aspect, cancer can comprise prostate cancer or metastatic prostate cancer. In an aspect, prostate cancer is a castration resistant prostate cancer (CRPC) or a neuroendocrine prostate cancer (NEPC).

[0079] The terms "proliferative disorder" and "proliferative disease" refer to disorders associated with abnormal cell proliferation such as cancer. In an aspect, "tumor" and "neoplasm" refer to any mass of tissue that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions. In an aspect, "metastasis" refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location. A "metastatic" or "metastasizing" cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.

[0080] The terms "cancer cell" or "tumor cell" and grammatical equivalents refer to the total population of cells derived from a tumor including both non-tumorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic stem cells (cancer stem cells).

[0081] In an aspect "tumorigenic" refers to the functional features of a solid tumor stem cell including the properties of self-renewal (giving rise to additional tumorigenic cancer stem cells) and proliferation to generate all other tumor cells (giving rise to differentiated and thus non- tumorigenic tumor cells) that allow solid tumor stem cells to form a tumor.

[0082] "Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as "substantially identical" or "essentially similar" when they are optimally aligned. For example, sequence similarity or identity can be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences can have "substantial sequence identity" if the percentage sequence identity is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, preferably 90%, 95%, 98%, 99% or more. Such sequences are also referred to as "variants" herein, e.g., other variants of a missing, deficient, and / or mutant protein or enzyme. Sequences with substantial sequence identity do not necessarily have the same length and may differ in length. For example, sequences that have the same nucleotide sequence, but of which one has additional nucleotides on the 3'- and / or 5'-side, are 100% identical.

[0083] In an aspect, "immune-modulating" refers to the ability of a disclosed isolated nucleic acid molecules, a disclosed vector, a disclosed pharmaceutical formulation, or a disclosed agent to alter (modulate) one or more aspects of the immune system. The immune system functions to protect the organism from infection and from foreign antigens by cellular and humoral mechanisms involving lymphocytes, macrophages, and other antigen-presenting cells that regulate each otherby means of multiple cell-cell interactions and by elaborating soluble factors, including lymphokines and antibodies, that have autocrine, paracrine, and endocrine effects on immune cells.

[0084] In an aspect, a disclosed pharmaceutically acceptable carrier can refer to sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. In an aspect, examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. In an aspect, a pharmaceutical carrier employed can be a solid, liquid, or gas. In an aspect, examples of solid carriers can include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. In an aspect, examples of liquid carriers can include sugar syrup, peanut oil, olive oil, and water. In an aspect, examples of gaseous carriers can include carbon dioxide and nitrogen. In preparing a disclosed composition for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations arealso prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.

[0085] In an aspect, the term "excipient" refers to an inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent, and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.). See, also, for reference, Remington's Pharmaceutical Sciences, (1990) Mack Publishing Co., Easton, Pa., which is hereby incorporated by reference in its entirety.

[0086] In an aspect, the term "package insert" is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and / or warnings concerning the use of such therapeutic products.

[0087] In an aspect, the term "in combination" in the context of the administration of other therapies (e.g., other agents) includes the use of more than one therapy (e.g., drug therapy). Administration "in combination with" one or more further therapeutic agents includes simultaneous (e.g., concurrent) and consecutive administration in any order. The use of the term "in combination" does not restrict the order in which therapies are administered to a subject. By way of non-limiting example, a first therapy (e.g., the disclosed nanoparticle, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof) can be administered prior to (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks), concurrently, or after (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks or longer) theadministration of a second therapy to a subject having or diagnosed with cancer (prostate / metastatic prostate) or COVID-19.

[0088] Disclosed are the components to be used to prepare a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B- F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific aspect or combination aspects of the methods of the invention. B. Compositions for Use in the Disclosed Methods 1. Nucleic Acid Molecules

[0089] Disclosed herein is a nucleic acid sequence encoding a Cas13d. Disclosed herein is a nucleic acid sequence encoding a CasRx. Disclosed herein is a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein.Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0090] Disclosed herein is a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences.

[0091] In an aspect, the disclosed DR sequences can flank the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs. In an aspect, each encoded pre-gRNA can be flanked by a DR sequence. In an aspect, each encoded gRNA can be flanked by a 5' DR sequence. Or, in an aspect, a DR sequence can be located 5' of an encoded gRNA. In an aspect, a disclosed DR sequence (gRNA) can comprise the sequence of AACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO:30). In an aspect, a disclosed DR sequence (pre-gRNA) can comprise the sequence CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO:31).

[0092] In an aspect, two distinct guide RNA structures are disclosed. In an aspect, a first guide RNA structure can comprise about a 30 nt spacer (a pre-gRNA) flanked by two direct repeat sequences to mimic an unprocessed guide RNA (pre-gRNA). In an aspect, a second guide RNA structure can comprise about a 30 nt direct repeat with 22 nt spacer (a gRNA) predicted to mimic mature guide RNAs. In an aspect, a first guide RNA structure can comprise about a 30 nt spacer (e.g., any one of SEQ ID NO:01-SEQ ID NO:12, SEQ ID NO:17-SEQ ID NO:28, or SEQ ID NO:44-SEQ ID NO:47) flanked by two direct repeat sequences (e.g., SEQ ID NO:31) to mimican unprocessed guide RNA. In an aspect, a second guide RNA structure can comprise about a 30 nt direct repeat (e.g., SEQ ID NO:30) with 22 nt spacer (e.g., any one of SEQ ID NO:13-SEQ ID NO:16) predicted to mimic mature guide RNAs.

[0093] In an aspect, a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) sequences can comprise a direct repeat (DR) sequence 5' for each gRNA. In an aspect, a disclosed nucleic acid sequence encoding one or more pre-guide RNA (pre-gRNA) sequences can comprise a direct repeat (DR) sequence flanking each gRNA.

[0094] In an aspect, a disclosed Cas13d can be that of Ruminococcus flavefaciens (CasRx). In an aspect of a disclosed nucleic acid sequence, a disclosed CasRx can comprise the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55. In an aspect of a disclosed nucleic acid sequence, a disclosed CasRx can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55.

[0095] In an aspect, disclosed gRNAs or pre-gRNAs can target a prostate cancer (PC) associated transcription factor (TF). In an aspect, a disclosed PC associated TF is of AR (Gene ID 367 / NP_000035.2), AR-V7 (aka AR3 / NP_001334990.1), HoxB13 (Gene ID 10481 / NP_006352.2), FoxA1 (Gene ID 3169 / NP_004487.2), FoxA2 (Gene ID 3170 / NP_068556.2), or GATA2 (Gene ID 2624 / NP_001139133.1).

[0096] In an aspect of a disclosed nucleic acid sequence, one or more disclosed gRNAs or pre- gRNAs can target HoxB13. In an aspect, one or more disclosed gRNAs targeting HoxB13 can comprise the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16. In an aspect, one or more disclosed gRNAs targeting HoxB13 can comprise the sequence set forth in SEQ ID NO:44. In an aspect, one or more disclosed pre-gRNAs targeting HoxB13 can comprise the sequence set forth in any one of SEQ ID NO:01-SEQ ID NO:04. In an aspect, one or more disclosed gRNAs targeting HoxB13 can be 5' flanked by a disclosed DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting HoxB13 can be flanked by a disclosed DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more gRNAs comprising the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16, and one or more 5' DR sequences comprising the sequence set forth in SEQ ID NO:30. In an aspect, a disclosed nucleic acid sequence can comprise one or more gRNAs comprising the sequence set forth in SEQ ID NO:44, and one or more 5' DR sequences comprising the sequence set forth in SEQ ID NO:30. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:01-SEQ ID NO:04, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0097] In an aspect, HOXB13 refers to Homeobox B13. HOXB13 is identified and characterized in HGNC (5112), NCBI Gene (10481), Ensembl (ENSG0000015918), OMIM (604607), and UniProtKB / Swiss-Prot (604607). This is a protein coding gene and the encoded transcription factor belongs to the homeobox gene family. HOXB13 is part of gene family that is highly conserved among vertebrates and essential for vertebrate embryonic development.

[0098] In an aspect of a disclosed nucleic acid sequence, one or more disclosed gRNAs or pre- gRNAs can target MYCN. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08 can be flanked by a disclosed DR. In an aspect, one or more disclosed gRNAs targeting MYCN can be 5' flanked by a DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs targeting MYCN comprising the sequence set forth in any one SEQ ID NO:05-SEQ ID NO:08, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0099] In an aspect, MYCN refers to MYCN Proto-Oncogene, BHLH Transcription Factor. MYNC (f / k / a N-MYC) is identified and characterized in HGNC (7559), NCBI Gene (4613), Ensembl (ENSG00000134323), OMIM (164840), and UniProtKB / Swiss-Prot (P04198). This is a protein coding gene and the protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of MYCN is associated with tumors.

[0100] In an aspect of a disclosed nucleic acid sequence, one or more disclosed gRNAs or pre- gRNAs can target MED31. In an aspect, one or more disclosed pre-gRNAs targeting MED31 can comprise the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12. In an aspect, one or more disclosed gRNAs targeting MED31 can be 5' flanked by a DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting MED31 can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12, and one or more flanking DR sequence comprising the sequence set forth in SEQ ID NO:31.

[0101] In an aspect, MED31 refers to Mediator Complex Subunit 31. MED31 is identified and characterized in HGNC (24260), NCBI Gene (51003), Ensembl (ENSG00000108590), OMIM (620492), and UniProtKB / Swiss-Prot (Q9Y3C7). MED31 is a protein coding gene enables transcription coregulator activity and ubiquitin protein ligase activity; is involved in regulation oftranscription by RNA polymerase II; acts upstream of or within limb development and negative regulation of fibroblast proliferation; and is located in the nucleoplasm; is part of core mediator complex and mediator complex.

[0102] In an aspect of a disclosed nucleic acid sequence, one or more disclosed gRNAs or pre- gRNAs can target a COVID-19 associated protein. In an aspect, a disclosed targeted COVID-19 associated protein can be Transmembrane serine protease 2 (TMPRSS2), Cathepsin L (CTSL), Furin, or any combination thereof.

[0103] In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in SEQ ID NO:45. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:17SEQ ID NO:20, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:45, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed nucleic acid sequence, a disclosed targeted COVID-19 associated protein can be TMPRSS2. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in any one of SEQ ID NO:32-SEQ ID NO:35. In an aspect, one or more disclosed pre- gRNAs targeting TMPRSS2 can comprise the sequence set forth in SEQ ID NO:49. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:32-SEQ ID NO:35, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:49, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0104] In an aspect, TMPRSS2 (Transmembrane Serine Protease 2) is a Protein Coding gene. TMPRSS2 is identified and characterized in HGNC (11876), NCBI Gene (7113), Ensembl (ENSG00000184012), OMIM (602060), and UniProtKB / Swiss-Prot (O15393). TMPRSS2 is a protein coding gene. This protein also facilitates entry of viruses into host cells by proteolytically cleaving and activating viral envelope glycoproteins.

[0105] In an aspect of a disclosed nucleic acid sequence, a disclosed targeted COVID-19 associated protein can be Cathepsin L. In an aspect, one or more disclosed pre-gRNAs targetingCathepsin L can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:46. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:46 and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed nucleic acid sequence, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in any one of SEQ ID NO:36-SEQ ID NO:39. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:50. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can be flanked by a disclosed DR sequence comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:36-SEQ ID NO:39, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:50 and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:52. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:52, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0106] In an aspect, CTSL refers to Cathepsin L. CTSL is identified and characterized in HGNC (2537), NCBI Gene (1514), Ensembl (ENSG00000135047), OMIM (116880), and UniProtKB / Swiss-Prot (P07711). This is a protein coding gene and the protein is a thiol protease important for the overall degradation of proteins in lysosomes (Probable). Cathepsin L plays a critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling.

[0107] In an aspect of a disclosed nucleic acid sequence, a disclosed targeted COVID-19 associated protein can be Furin. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAscomprising the sequence set forth in SEQ ID NO:47. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:47, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:40-SEQ ID NO:43. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:51. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:40-SEQ ID NO:43, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:51, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0108] In an aspect, FURIN refers to Furin, Paired Basic Amino Acid Cleaving Enzyme. FURIN is identified and characterized in HGNC (8568), NCBI Gene (5045), Ensembl (ENSG00000140564), OMIM (136950), and UniProtKB / Swiss-Prot (P09958). This is a protein coding gene that is a subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. FURIN undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired.

[0109] In an aspect, a region having low secondary structure can be an ideal target for a disclosed gRNA or a disclosed pre-gRNA. In an aspect, a disclosed nucleic acid molecule can comprise the sequence for one or more regulatory elements For example, in an aspect, disclosed regulatory elements can comprise promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulator Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element). Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences-lung cells, liver cells, spleen cells, etc.).

[0110] In an aspect, a disclosed nucleic acid molecule can be encapsulated in a disclosed nanoparticle or in a disclosed plasmid.

[0111] In an aspect, a disclosed gRNA spacer sequence can be identified by its RNA sequence or by a DNA sequence that corresponds to the guide RNA target sequence on the genome. In an aspect, a disclosed sequence identifier for a gRNA sequence can represent the DNA sequence of the genomic target (i.e., a PC TF or COVID-19 associated protein), while the gRNA or sgRNA spacer sequence can be the RNA version of the DNA sequence.

[0112] In an aspect, a disclosed nucleic acid molecule can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed nucleic acid molecule can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed nucleic acid molecule can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed nucleic acid molecule can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed nucleic acid molecule can reduce and / or decrease the risk of metastases. In an aspect, a disclosed nucleic acid molecule can be used in RNA-based editing system. In an aspect, a disclosed nucleic acid molecule can be used in RNA-based editing system comprising a bi- targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system.

[0113] In an aspect a disclosed nucleic acid molecule can be used in one or more disclosed methods. In an aspect, a disclosed nucleic acid molecule can be used in one or more disclosed methods of treating a subject.

[0114] In an aspect, a disclosed nucleic acid molecule can be used in a disclosed method of treating cancer. In an aspect, a disclosed nucleic acid molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject, such as, for example, a subject having cancer. In an aspect, a disclosed interfering molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject having cancer. In an aspect, metabolic dysregulation can be associated with cancer. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and / or ameliorating autophagy); (iii) improving, enhancing,restoring, and / or preserving mitochondrial functionality and / or structural integrity; (iv) improving, enhancing, restoring, and / or preserving organelle functionality and / or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of the multi-systemic manifestations of cancer; (vii) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of cancer; or (viii) any combination thereof. In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and / or preserving one or more aspects of cellular structural and / or functional integrity. In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and / or functionality is similar to that of a wild-type or control level.

[0115] In an aspect, a disclosed nucleic acid molecule can be used in a disclosed method of treating COVID-19. In an aspect, a disclosed nucleic acid molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject, such as, for example, a subject having COVID-19. In an aspect, a disclosed interfering molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject having COVID-19. In an aspect, metabolic dysregulation can be associated with COVID-19. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and / or ameliorating autophagy); (iii) improving, enhancing, restoring, and / or preserving mitochondrial functionality and / or structural integrity; (iv) improving, enhancing, restoring, and / or preserving organelle functionality and / or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of the multi-systemic manifestations of COVID-19; (vii) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of COVID-19; or (viii) any combination thereof. In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and / or preserving one or more aspects of cellular structural and / or functional integrity. In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and / or functionality is similar to that of a wild-type or control level. 2. Plasmids

[0116] Disclosed herein is a plasmid comprising a disclosed nucleic acid sequence. Disclosed herein is a plasmid comprising a sequence disclosed in Table 2. Disclosed herein is a plasmidcomprising a nucleic acid sequence encoding a Cas13d. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding a CasRx. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof.

[0117] Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0118] Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a plasmid comprising a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences.

[0119] In an aspect of a disclosed plasmid, the disclosed DR sequences can flank the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs. In an aspect, each encoded pre-gRNA can be flanked by a DR sequence. In an aspect, each encoded gRNA can be flanked by a 5' DR sequence. Or, in an aspect, a DR sequence can be located 5' of an encoded gRNA. In an aspect of a disclosed plasmid, a disclosed DR sequence (gRNA) can comprise the sequence of AACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO:30). In an aspect, a disclosed DR sequence (pre-gRNA) can comprise the sequence CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO:31). In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) sequences can comprise a direct repeat (DR) sequence 5' for each gRNA. In an aspect, a disclosed nucleic acid sequence encoding one or more pre-guide RNA (pre-gRNA) sequences can comprise a direct repeat (DR) sequence flanking each gRNA.

[0120] In an aspect of a disclosed plasmid, a disclosed Cas13d can be that of Ruminococcus flavefaciens (CasRx). In an aspect of a disclosed nucleic acid sequence, a disclosed CasRx can comprise the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55. In an aspect of a disclosed nucleic acid sequence, a disclosed CasRx can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55.

[0121] In an aspect of a disclosed plasmid, disclosed gRNAs or pre-gRNAs can target a prostate cancer (PC) associated transcription factor (TF). In an aspect, a disclosed PC associated TF is of AR (Gene ID 367 / NP_000035.2), AR-V7 (aka AR3 / NP_001334990.1), HoxB13 (Gene ID 10481 / NP_006352.2), FoxA1 (Gene ID 3169 / NP_004487.2), FoxA2 (Gene ID 3170 / NP_068556.2), or GATA2 (Gene ID 2624 / NP_001139133.1).

[0122] In an aspect of a disclosed plasmid, one or more disclosed gRNAs or pre-gRNAs can target HoxB13. In an aspect, one or more disclosed gRNAs targeting HoxB13 can comprise the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16. In an aspect, one or more disclosed gRNAs targeting HoxB13 can comprise the sequence set forth in SEQ ID NO:44. In an aspect, one or more disclosed pre-gRNAs targeting HoxB13 can comprise the sequence set forth in any one of SEQ ID NO:01-SEQ ID NO:04. In an aspect, one or more disclosed gRNAs targeting HoxB13 can be 5' flanked by a disclosed DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting HoxB13 can be flanked by a disclosed DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more gRNAs comprising the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16, and one or more 5' DR sequences comprising the sequenceset forth in SEQ ID NO:30. In an aspect, a disclosed nucleic acid sequence can comprise one or more gRNAs comprising the sequence set forth in SEQ ID NO:44, and one or more 5' DR sequences comprising the sequence set forth in SEQ ID NO:30. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:01-SEQ ID NO:04, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0123] In an aspect of a disclosed plasmid, one or more disclosed gRNAs or pre-gRNAs can target MYCN. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08 can be flanked by a disclosed DR. In an aspect, one or more disclosed gRNAs targeting MYCN can be 5' flanked by a DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting MYCN can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs targeting MYCN comprising the sequence set forth in any one SEQ ID NO:05-SEQ ID NO:08, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0124] In an aspect of a disclosed plasmid, one or more disclosed gRNAs or pre-gRNAs can target MED31. In an aspect, one or more disclosed pre-gRNAs targeting MED31 can comprise the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12. In an aspect, one or more disclosed gRNAs targeting MED31 can be 5' flanked by a DR comprising the sequence set forth in SEQ ID NO:30. In an aspect, one or more disclosed pre-gRNAs targeting MED31 can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12, and one or more flanking DR sequence comprising the sequence set forth in SEQ ID NO:31.

[0125] In an aspect of a disclosed plasmid, one or more disclosed gRNAs or pre-gRNAs can target a COVID-19 associated protein. In an aspect, a disclosed targeted COVID-19 associated protein can be Transmembrane serine protease 2 (TMPRSS2), Cathepsin L (CTSL), Furin, or any combination thereof. In an aspect of a disclosed plasmid, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in SEQ ID NO:45. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In anaspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:45, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed nucleic acid sequence, a disclosed targeted COVID-19 associated protein can be TMPRSS2.

[0126] In an aspect of a disclosed plasmid, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in any one of SEQ ID NO:32-SEQ ID NO:35. In an aspect, one or more disclosed pre-gRNAs targeting TMPRSS2 can comprise the sequence set forth in SEQ ID NO:49. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre- gRNAs comprising the sequence set forth in any one of SEQ ID NO:32-SEQ ID NO:35, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:49, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0127] In an aspect of a disclosed plasmid, a disclosed targeted COVID-19 associated protein can be Cathepsin L. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:46. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can be flanked by a DR comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:46 and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0128] In an aspect of a disclosed plasmid, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in any one of SEQ ID NO:36-SEQ ID NO:39. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:50. In an aspect, one or more disclosed pre-gRNAs targeting Cathepsin L can be flanked by a disclosed DR sequence comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:36-SEQ ID NO:39, and one or more flanking DRsequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:50 and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed plasmid, one or more disclosed pre-gRNAs targeting Cathepsin L can comprise the sequence set forth in SEQ ID NO:52. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:52, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0129] In an aspect of a disclosed plasmid, a disclosed targeted COVID-19 associated protein can be Furin. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:47. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:47, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0130] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:40-SEQ ID NO:43. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in SEQ ID NO:51. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre-gRNAs comprising the sequence set forth in any one of SEQ ID NO:40- SEQ ID NO:43, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence can comprise one or more pre- gRNAs comprising the sequence set forth in SEQ ID NO:51, and one or more flanking DR sequences comprising the sequence set forth in SEQ ID NO:31.

[0131] In an aspect of a disclosed plasmid, a disclosed nucleic acid molecule can comprise the sequence for one or more regulatory elements. For example, in an aspect, disclosed regulatory elements can comprise promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulator Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element). Regulatory elements can include those that direct constitutive expression of anucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences-lung cells, liver cells, spleen cells, etc.).

[0132] In an aspect, a disclosed promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the expression desired. A promoter can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. In an aspect, a disclosed promoter can be a promoter / enhancer. In an aspect, a disclosed promoter for the disclosed nucleic acid molecule can be an endogenous promoter. In an aspect, a disclosed endogenous promoter can be an endogenous promoter / enhancer. In an aspect, a disclosed endogenous promoter or a disclosed endogenous promoter / enhancer can generally be obtained from a non-coding region upstream of a transcription initiation site of a gene of interest. In an aspect, a disclosed endogenous promoter or a disclosed endogenous promoter / enhancer can be used for constitutive expression of a disclosed gene.

[0133] Tissue-specific promoters are known to the art and include, but are not limited to, neuron- specific promoters, muscle-specific promoters, liver-specific promoters, skeletal muscle-specific promoters, lung-specific promoters, spleen-specific promoters, and heart-specific promoters. Ubiquitous / constitutive promoters are known to the art and include, but are not limited to, a CMV major immediate-early enhancer / chicken beta-actin promoter, a cytomegalovirus (CMV) major immediate-early promoter, an Elongation Factor 1-α (EF1-α) promoter, a simian vacuolating virus 40 (SV40) promoter, an AmpR promoter, a PγK promoter, a human ubiquitin C gene (Ubc) promoter, a MFG promoter, a human beta actin promoter, a CAG promoter, a EGR1 promoter, a FerH promoter, a FerL promoter, a GRP78 promoter, a GRP94 promoter, a HSP70 promoter, a β- kin promoter, a murine phosphoglycerate kinase (mPGK) or human PGK (hPGK) promoter, a ROSA promoter, human Ubiquitin B promoter, a Rous sarcoma virus promoter, or any other natural or synthetic ubiquitous / constitutive promoters.

[0134] In an aspect, a disclosed regulatory element can be operably linked to a sequence to be expressed (e.g., a nucleic acid sequence encoding a Cas13d, a CasRx, one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences, one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF), one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) targeting a COVID-19 associated protein, etc.). In an aspect, a disclosed sequence to be express can be any disclosed nucleic acid sequence encoding one or more gRNAs or pre-gRNAs.In an aspect, a disclosed sequence to be express can be any disclosed nucleic acid sequence encoding a Cas13d or a CasRx.

[0135] In an aspect, "operably linked" refers to a juxtaposition where the components described are in a relationship permitting them to function in their intended manner. For example, a control element or regulatory element "operably linked" to a functional element is associated in such a way that expression and / or activity of the functional element is achieved under conditions compatible with the control element. In an aspect, a promotor can be operably linked to a disclosed nucleic acid.

[0136] In an aspect, a disclosed plasmid can be encapsulated in a disclosed nanoparticle. In an aspect, one or more disclosed plasmids can be encapsulated in a disclosed nanoparticle.

[0137] In an aspect, a disclosed plasmid can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed plasmid can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed plasmid can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed plasmid can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non- specific gene targeting or off-targeting effects. In an aspect, a disclosed plasmid can reduce and / or decrease the risk of metastases. In an aspect, a disclosed plasmid can be used in RNA-based editing system. In an aspect, a disclosed plasmid can be used in RNA-based editing system comprising a bi-targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system. In an aspect, a disclosed plasmid can be used in one or more disclosed methods. In an aspect, a disclosed plasmid can be used in one or more disclosed methods of treating a subject.

[0138] In an aspect, a disclosed plasmid can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed plasmid can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed plasmid can be used to prevent or inhibit metastasis.

[0139] In an aspect, a disclosed plasmid can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject's quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii)extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof. 3. Nanoparticles

[0140] Disclosed herein is a nanoparticle comprising one or more disclosed plasmids. Disclosed herein is a nanoparticle comprising two or more disclosed plasmids.

[0141] Disclosed herein is a nanoparticle comprising (i) a plasmid comprising a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof, and (ii) a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences.

[0142] In an aspect, the pre-gRNA can comprise the sequence of any one of SEQ ID NO:01-SEQ ID NO:12 and a DR having the sequence of SEQ ID NO:31. In an aspect, the pre-gRNA can comprise the sequence of SEQ ID NO:44 and a DR having the sequence of SEQ ID NO:31. In an aspect, the gRNA can comprise the sequence of any one of SEQ ID NO:13-SEQ ID NO:16 and a DR having the sequence of SEQ ID NO:30. In an aspect, the pre-gRNA can comprise the sequence of any one of SEQ ID NO:17-SEQ ID NO:20 and a DR having the sequence of SEQ ID NO:31. In an aspect, the pre-gRNA can comprise the sequence of any one of SEQ ID NO:21- SEQ ID NO:24 and a DR having the sequence of SEQ ID NO:31. In an aspect, the pre-gRNA can comprise the sequence of any one of SEQ ID NO:25-SEQ ID NO:28 and a DR having the sequence of SEQ ID NO:31. In an aspect, the pre-gRNA can comprise the sequence of any one of SEQ ID NO:45-SEQ ID NO:47 and a DR having the sequence of SEQ ID NO:31.

[0143] Disclosed herein is a nanoparticle comprising (i) a plasmid comprising a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof, and (ii) a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle comprising (i) a plasmid comprising a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof, and (ii) a plasmid comprising a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0144] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0145] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences.

[0146] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleicacid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences.

[0147] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF). Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0148] Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences. Disclosed herein is a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences.

[0149] In an aspect, a disclosed NP carrier can comprise a polymer-lipid, a lipid, or gold. In an aspect, a disclosed NP carrier can comprise a lipid. In an aspect, a disclosed NP can furthercomprise a cationic cell penetrating peptide (cpp). In an aspect, a cpp can be used to stably condense one or more disclosed plasmids or one or more disclosed nucleic acid molecules (e.g., to subsequently deliver to a nucleus). In an aspect, a disclosed cpp can be transactivation of transcription peptide (TAT) or can be a nuclear localization sequence (NLS). In an aspect, a disclosed TAT can comprise the sequence set forth in SEQ ID NO:29. In an aspect, a disclosed NLS can comprise the sequence set forth in SEQ ID NO:57.

[0150] As used herein, "a nanoparticle carrier" is any composition comprising one or more materials that can be formulated into nanoparticles that are capable of encapsulating or otherwise retaining (e.g., by adsorption or otherwise) the first and the one or more additional nucleic acid sequences.

[0151] In an aspect, a disclose NP can comprise a cationic cell penetrating peptide (cpp), examples of which include the transactivator of transcription peptide (TAT) and nuclear localization sequences (NLS). In vivo delivery of plasmid DNA, for example, can be hindered by systemic instability due to excessive size and negative charge. Accordingly, these cpps are used to stably condense plasmids or nucleic acids and deliver them into the nucleus.

[0152] In an aspect, a disclosed NP can further comprise a nucleic acid aptamer (Apt) immobilized on the surface of the NP. In an aspect, a disclosed NP can further comprise a nucleic acid aptamer (Apt) immobilized on the shell of the NP. In an aspect, a disclosed NP can be surface- functionalized with one or more aptamers. In an aspect, a disclosed NP can be surface- functionalized with one or more nucleic acid ligand aptamers. In an aspect, a disclosed NP can further comprise an immobilized Apt and a cpp. In an aspect, a disclosed Apt can target castration- resistant prostate cancer (CRPC) cells. In an aspect, a disclosed Apt can be a prostate-specific membrane antigen (PSMA) aptamer. In an aspect, a disclosed Apt can target neuroendocrine prostate cancer (NEPC) cells. In an aspect, a disclosed Apt can be a neural cell adhesion molecule 1 (NCAM1) aptamer, a chromogranin A (CHGA) aptamer, a synaptophysin (SYP) aptamer, a synaptosome associated protein 25 (SNAP25) aptamer, or a carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) aptamer. In an aspect, a disclosed aptamer can achieve cell- specific targeting by recognized / binding to a membrane marker on the cell surface. In an aspect, a disclosed aptamer can be used to target a nanoparticle to a specific cell. In an aspect, a disclosed PSMA aptamer can recognize or can be used to target PSMA positive CRPC cells. In an aspect, a disclosed E3 aptamer can recognize or can be used to target both AR-positive and -negative CRPC cells. In an aspect, a disclosed NCAM1 aptamer, a disclosed CHGA aptamer, a disclosed SYP aptamer, a disclosed SNAP25 aptamer, or a disclosed CEACAM5 aptamer can recognize or can be used to target NEPC cells.

[0153] In an aspect, a disclosed nanoparticle carrier can comprise (i) a core encapsulating the nucleic acid sequences and (ii) a shell surrounding the core. In an aspect, a disclosed core can comprise polylactic-co-glycolic acid (PLGA). In an aspect, a disclosed shell can comprise polyethyleneglycol (PEG). In an aspect, a disclosed core can comprise polylactic-co-glycolic acid (PLGA) and a disclosed shell can comprise polyethyleneglycol (PEG). In an aspect, a disclosed PEG can be a carboxy modified PEG or a lipid-PEG-COOH. In an aspect, a disclosed lipid-PEG- COOH can be m-PEG-DSPE. In an aspect of a disclosed NP, the nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences.

[0154] In an aspect of a disclosed NP, the nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid.

[0155] In an aspect of a disclosed NP, the nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences. In an aspect of a disclosed NP, the nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid.

[0156] In an aspect of a disclosed NP, the DR sequences can flank the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs. In an aspect, each encoded pre-gRNA can be flanked by a DR sequence. In an aspect, each encoded gRNA can be flanked by a 5' DR sequence. In an aspect, a disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect, a disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) sequences can comprise a direct repeat (DR) sequence 5' for each gRNA. In an aspect, a disclosed nucleic acid sequence encoding one or more pre-guide RNA (pre-gRNA) sequences can comprise a direct repeat (DR) sequence flanking each gRNA.

[0157] In an aspect of a disclosed NP, the ratio of the nucleic acid sequence encoding the Cas13d to the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can between 1:0.5 and 1:3. In an aspect of a disclosed NP, the ratio of the nucleic acid sequence encoding the Cas13d to the nucleic acid sequence encoding one or more gRNAs or pre- gRNAs and one or more DR sequences can be between 1:1 and 1:2. In an aspect of a disclosed NP, the ratio of the nucleic acid sequence encoding the Cas13d to the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be about 1:1.5

[0158] In an aspect, a disclosed NP can comprise a cpp to plasmid or RNA weight ratio of about 0.1 to about 20. In an aspect, a disclosed NP can comprise a cpp to plasmid or RNA weight ratio of about 1:20, about 1:19, about 1:18, about 1:17, about 1:16, about 1:15, about 1:14, about 1:13, about 1:12, about 1:11, about 1:10, about 1:9, about 1:8, about 1:7, about 1:6, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 1:0.5, or about 0.5:1. In an aspect, a disclosed NP can comprise a cpp to plasmid or RNA weight ratio of about 1:18, about 3:16, or about 5:15.6.

[0159] In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences, and a shell surrounding the core.

[0160] In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid, and a shell surrounding the core. In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences, and a shell surrounding the core. In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid, and a shell surrounding the core.

[0161] In an aspect, a disclosed NP can have a size of about 10 nm to 1000 nm. In an aspect, a disclosed NP can have a size of about 10 nm to about 50 nm, about 50 to about 100 nm, about 100 nm to about 200 nm, about 200 nm to about 300 nm, about 300 nm to about 400 nm, about 400 nm to about 500 nm, about 500 nm to about 600 nm, about 600 nm to about 700 nm, about 700 nm to about 800 nm, about 800 nm to about 900 nm, or about 900 nm to about 1000 nm. In an aspect a disclosed population of NPs can have an average size of about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm.

[0162] In an aspect, a disclosed NP can have a zeta potential of about 2.0 mV, about 2.25 mV, about 2.5 mV, about 2.75 mV, or about 3.0 mV.

[0163] In an aspect of a disclosed NP, a disclosed Cas13d can be that of Ruminococcus flavefaciens (CasRx). In an aspect, a disclosed CasRx can comprise the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55. In an aspect of a disclosed nucleic acid sequence, a disclosed CasRx can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:54 or SEQ ID NO:55.

[0164] In an aspect of a disclosed NP, the gRNAs or pre-gRNAs can target a prostate cancer (PC) associated transcription factor (TF).

[0165] In an aspect, a disclosed PC associated TF is of AR (Gene ID 367 / NP_000035.2), AR- V7 (aka AR3 / NP_001334990.1), HoxB13 (Gene ID 10481 / NP_006352.2), FoxA1 (Gene ID 3169 / NP_004487.2), FoxA2 (Gene ID 3170 / NP_068556.2), or GATA2 (Gene ID 2624 / NP_001139133.1).

[0166] In an aspect of a disclosed NP, the PC associated TF can be HoxB13. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more gRNAs can comprise the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:44. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:01- SEQ ID NO:04. In an aspect of a disclosed NP, the PC associated TF can be HoxB13, and the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the PC associated TF can be HoxB13, and the disclosed DR (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more gRNAs can comprise the sequence set forth in any one of SEQ ID NO:13-SEQ ID NO:16, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:44, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the PC associated TF can be HoxB13 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:01- SEQ ID NO:04, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30.

[0167] In an aspect of a disclosed NP, the PC associated TF can be MYCN. In an aspect of a disclosed NP, the PC associated TF can be MYCN and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08. In an aspect of a disclosed NP, the PC associated TF can be MYCN, and wherein the disclosed DR sequence (gRNA) cancomprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the PC associated TF can be MYCN, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0168] In an aspect of a disclosed NP, the PC associated TF can be MYCN and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:08, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0169] In an aspect of a disclosed NP, the PC associated TF can be MED31. In an aspect of a disclosed NP, the PC associated TF can be MED31 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12. In an aspect of a disclosed NP, the PC associated TF can be MED31, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the PC associated TF can be MED31, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the PC associated TF can be MED31 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:12, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the gRNAs or pre-gRNAs can target a COVID-19 associated protein.

[0170] In an aspect, the COVID-19 associated protein can be Transmembrane serine protease 2 (TMPRSS2), Cathepsin L (CTSL), Furin, or any combination thereof.

[0171] In an aspect of a disclosed NP, the gRNAs can target a COVID-19 associated protein, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the pre-gRNAs can target a COVID-19 associated protein, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:45. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:45, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0172] In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:32- SEQ ID NO:35. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:49. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:32-SEQ ID NO:35, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:49, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0173] In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:46. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre- gRNAs can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:46, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0174] In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:36- SEQ ID NO:39. In an aspect of a disclosed NP, the COVID-19 associated protein can beCathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:50. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:36- SEQ ID NO:39, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:50, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:52. In an aspect of a disclosed NP, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:52, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0175] In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:47. In an aspect of a disclosed NP, the COVID- 19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28, and wherein the disclosed DR sequence (pre- gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:47, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0176] In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:40-SEQ ID NO:43. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:51. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:40-SEQ ID NO:43, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect of a disclosed NP, the COVID-19 associated protein can be Furin and the one or more pre- gRNAs can comprise the sequence set forth in SEQ ID NO:51, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0177] In an aspect, a disclosed NP can be prepared or generated by any process known to the skilled person in the art. For example, in an aspect, a disclosed NP can be prepared or generated using self-assembled nano-precipitation. In an aspect of preparing or generating a disclosed NP, a disclosed apt can be immobilized on the NP surface using carbodiimide coupling chemistry (e.g., between the –COOH group of carboxy modified PEG and the amino group at the end of the PSMA Apt). In an aspect, nano-precipitation time and weight ratio of cpp to plasmid / nucleic acid can be optimized to minimize any batch-to-batch variability.

[0178] In an aspect, a disclosed NP carrier can be formulated with selective organ targeting (SORT) technology to be lung-selective, spleen-selective, liver-selective, or any combination thereof. SORT technology is known to the skilled person (see, e.g., Cheng Q, et al. (2020) Nat. Nanotechnol. 15(4):313-320). In an aspect, disclosed NPs formulated using SORT can be selectively targeted to the lungs, spleen, and / or liver of a subject. Briefly, while lipid NPs (LNPs) typically comprise ionizable cationic lipids, amphipathic phospholipids, cholesterol and PEG lipids, the addition of charge-modifying agents can result in targeted delivery of the LNPs to specific organs.

[0179] In an aspect, disclosed NP can be formulated with SORT technology to be lung-selective. In an aspect, a disclosed lung-selective NP can be formulated with 1,2-dioleoyl-3- trimethylammonium-propane (DOTAP), dimethyldioctadecylammonium (DDAB), or 1,2- dimyristoyl-sn-glycero-3-ethylphosphocholine (EPC). In an aspect, a disclosed lung-selective NP can comprise DLin-MC3-DMA, DSPC, cholesterol, DMG-PEG2000, and DOTAP at final molar ratio of 25 / 5 / 19.3 / 0.8 / 50. In an aspect, lung-specific SORT LNPs (50% DOTAP) can comprise 5A2-SC8 / DOPE / Chol / DMG-PEG / DOTAP = 11.9 / 11.9 / 23.8 / 2.4 / 50 (mol / mol). In an aspect, a disclosed lung-selective NP can comprise DLin-MC3-DMA, DSPC, cholesterol, DMG-PEG2000 and DOTAP in a 25 / 5 / 19.3 / 0.5 / 50 ratio.

[0180] In an aspect, disclosed NP can be formulated with SORT technology to be liver-selective. In an aspect, disclosed liver-selective NP can be formulated with 1,2-dioleoyl-3- dimethylammonium-propane (DODAP) or 5A2-SC8. In an aspect, disclosed liver-selective NP can comprise a base mDLNP formulation comprising 5A2-SC8, 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), cholesterol, DMG-PEG (15 / 15 / 30 / 3, mol / mol), and mRNA (5A2- SC8 / mRNA, 20 / 1, wt / wt). In an aspect, a disclosed liver-selected NP (20% DODAP) can be prepared as follows. A solution of lipids in ethanol was prepared consisting of 7.59 mM 5A2- SC8, 7.59 mM DOPE, 15.18 mM Cholesterol, 1.52 mM DMG-PEG2000, and 7.97 mM DODAP to make the final molar ratio of 19.05 / 19.05 / 38.1 / 3.81 / 20. To reach a final 40 / 1 (wt / wt) of total lipids to total RNAs ratio, 1.16 μL lipid solution could be used per μg RNA. For example, tomake a final 5 μg RNA formulation, 5.8 μL lipid mixture and 9.2 μL ethanol were mixed first (total 15 μL), then 45 μL mRNA solution was prepared consisting of 5 μg RNA in citrate buffer (10 mM, pH 4.0). The 45 μL mRNA solution was rapidly combined into 15 μL of the ethanol lipid solution to form 20% DODAP SORT LNPs. In an aspect, liver-specific SORT LNPs (20% DODAP) 5A2-SC8 / DOPE / Chol / DMG-PEG / DODAP = 19 / 19 / 38 / 3.8 / 20 (mol / mol).

[0181] In an aspect, a disclosed NP carrier can be formulated with SORT technology to be spleen- selective. In an aspect, a disclosed spleen-selective NP can be formulated with 1,2-dioleoyl-sn- glycero-3-phosphate (18PA), 1,2-dimyristoyl-snglycero-3-phosphate (14PA), or sn-(3-oleoyl-2- hydroxy)-glycerol-1-phospho-sn-3'-(1',2'-dioleoyl)-glycerol (18BMP). In an aspect, spleen- specific SORT LNPs (30% 18PA) 5A2-SC8 / DOPE / Chol / DMG-PEG / 18PA = 16.7 / 16.7 / 33.3 / 3.3 / 30 (mol / mol).

[0182] In an aspect, a disclosed organ-selective NP can be formulated in a manner consistent with Table 1. Table 1 provides the details of DDAB, EPC, 14PA, 18BMP, DODAP, C12-200, 5A2- SC8, DSPC, and DOCPe modified mDLNP formulations (SORT LNPs), including molar ratio and percentage of each component, weight ratios of total lipids to mRNA, size, and PDI.

[0183] Table 1-Details of Organ-Selective NP Formulations Molar Ratios Molar Percentage (%) Lipids / Name mRNA Size PDI14 1313 21231414 15 17 32 18 18 17 19 28Molar Ratios Molar Percentage (%) Lipids / me Si 5A2-DMG-a5A2- DMG- mRNA ze a (wt / wt(nm)PDIDOPE Chol X DOPE Chol X) 131012132111181513 741119 16 2100 141310121019 29 67 991520 2136

[0184] In an aspect, a disclosed nanoparticle can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed nanoparticle can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non- specific gene targeting or off-targeting effects. In an aspect, a disclosed nanoparticle can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed nanoparticle can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non- specific gene targeting or off-targeting effects. In an aspect, a disclosed nanoparticle can reduce and / or decrease the risk of metastases. In an aspect, a disclosed nanoparticle can be used in RNA- based editing system. In an aspect, a disclosed nanoparticle can be used in RNA-based editing system comprising a bi-targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system.

[0185] In an aspect, a disclosed nanoparticle can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed nanoparticle can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed nanoparticle can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0186] In an aspect, a disclosed nanoparticle can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject's quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0187] In an aspect, a disclosed nanoparticle can be used in one or more disclosed methods. In an aspect, a disclosed nanoparticle can be used in one or more disclosed methods of treating a subject.

[0188] In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences, and a shell surrounding the core. In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid, and a shell surrounding the core. In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be a plasmid, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be mRNA sequences, and a shell surrounding the core. In an aspect, a disclosed NP carrier can comprise a core encapsulating a nucleic acid sequence encoding Cas13d can be an mRNA sequence, and the nucleic acid sequence encoding one or more gRNAs or pre-gRNAs and one or more DR sequences can be a plasmid, and a shell surrounding the core. 4. Pharmaceutical Formulations

[0189] Disclosed herein is a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules. Nucleic acid molecules are discussed supra. Disclosed herein is a pharmaceutical formulation comprising one or more disclosed plasmids. Plasmids are discussed supra. Disclosed herein is a pharmaceutical formulation comprising one or more disclosed nanoparticles. Nanoparticles are discussed supra.

[0190] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequencestargeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences.

[0191] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences.

[0192] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof.

[0193] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences.

[0194] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF).

[0195] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein. Disclosedherein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences. Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences.

[0196] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences.

[0197] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences.

[0198] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences.

[0199] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences.

[0200] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences.

[0201] Disclosed herein is a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences.

[0202] In an aspect, a disclosed pharmaceutical formulation can further comprise (i) one or more active agents, (ii) biologically active agents, (iii) one or more pharmaceutically active agents, (iv)one or more immune-based therapeutic agents, (v) one or more clinically approved agents, or (vi) a combination thereof.

[0203] In an aspect, a disclosed pharmaceutical formulation can further comprise one or more anti-inflammatory agents. Anti-inflammatory agents or drugs include, but are not limited to, steroids and glucocorticoids (including betamethasone, budesonide, dexamethasone, hydrocortisone acetate, hydrocortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone), nonsteroidal anti-inflammatory drugs (NSAIDS) including aspirin, ibuprofen, naproxen, methotrexate, sulfasalazine, leflunomide, anti-TNF medications, cyclophosphamide and mycophenolate.

[0204] In an aspect, NSAIDs can comprise ibuprofen, naproxen, naproxen sodium, Cox-2 inhibitors such as rofecoxib and celecoxib, sialylates, or any combination thereof. In an aspect, analgesics can comprise acetaminophen, oxycodone, tramadol, proporxyphene hydrochloride, or any combination thereof. In an aspect, glucocorticoids can comprise cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, prednisone, or any combination thereof. Exemplary biological response modifiers include molecules directed against cell surface markers (e.g., CD4, CD5, etc.), cytokine inhibitors, such as the TNF antagonists (e.g., etanercept, adalimumab, and infliximab, chemokine inhibitors and adhesion molecule inhibitors. In an aspect, biological response modifiers can comprise monoclonal antibodies as well as recombinant forms of molecules. In an aspect, exemplary disease-modifying anti-rheumatic drugs (DMARDs) can comprise include azathioprine, cyclophosphamide, cyclosporine, methotrexate, penicillamine, leflunomide, sulfasalazine, hydroxychloroquine, Gold (oral (auranofin) and intramuscular), minocycline, or any combination thereof.

[0205] In an aspect, a disclosed chemotherapeutic agent in a disclosed pharmaceutical formulation can comprise an anthracycline, a vinca alkaloid, an alkylating agent, an immune cell antibody, an antimetabolite, a TNFR glucocorticoid induced TNFR related protein (GITR) agonist, a proteasome inhibitor, an immunomodulator, or any combination thereof. In an aspect, a disclosed chemotherapeutic agent can comprise 5-fluorouracil (Adrucil, Efudex), 6-mercaptopurine (Purinethol), 6-thioguanine, aclarubicin or aclacinomycin A, alemtuzamab (Lemtrada), anastrozole (Arimidex), bicalutamide (Casodex), bleomycin sulfate (Blenoxane), bortezomib (Velcade), busulfan (Myleran), busulfan injection (Busulfex), capecitabine (Xeloda), carboplatin (Paraplatin), carmustine (BiCNU), chlorambucil (Leukeran), cisplatin (Platinol), cladribine (Leustatin), Cosmegan, cyclophosphamide (Cytoxan or Neosar), cyclophosphamide, cytarabine liposome injection (DepoCyt), cytarabine, cytosine arabinoside (Cytosar-U), dacarbazine (DTIC- Dome), dactinomycin (Cosmegen), daunorubicin citrate liposome injection (DaunoXome),daunorubicin hydrochloride (Cerubidine), dexamethasone, docetaxel (Taxotere), doxorubicin hydrochloride (Adriamycin, Rubex), etoposide (Vepesid), fludarabine phosphate (Fludara), flutamide (Eulexin), folic acid antagonists, gemcitabine (difluorodeoxycitidine), gemtuzumab, gliotoxin, hydroxyurea (Hydrea), Idarubicin (Idamycin), ifosfamide (IFEX), ifosfamide, irinotecan (Camptosar), L-asparaginase (ELSPAR), lenalidomide), leucovorin calcium, melphalan (Alkeran), melphalan, methotrexate (Folex), mitoxantrone (Novantrone), mylotarg, N4-pentoxycarbonyl-5 deoxy-5-fluorocytidine, nab-paclitaxel (Abraxane), paclitaxel (Taxol), pentostatin, phoenix (Yttrium90 / MX-DTPA), polifeprosan 20 with carmustine implant (Gliadel), purine analogs and adenosine deaminase inhibitors (fludarabine), pyrimidine analogs, rituximab, tamoxifen citrate (Nolvadex), temozolomide), teniposide (Vumon), tezacitibine, thalidomide or a thalidomide derivative, thiotepa, tirapazamine (Tirazone), topotecan hydrochloride for injection (Hycamptin), tositumomab), vinblastine (Velban), vinblastine, vincristine (Oncovin), vindesine, vinorelbine (Navelbine), or any combination thereof.

[0206] In an aspect, a disclosed pharmaceutical formulation can comprise an anti-chemokine therapy that enhances the resident memory T cell formations in tumor-free tissues. In an aspect, a disclosed anti-chemokine therapy can comprise one or more antibodies against CCL1, CCL2, CCL4, CCL17, CCL19, CCL21, CCL22, CCL25, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CCR2, CCR5, CCR7, CCR8, CCR9, CXCR3, CXCR4, CXCR5, CX3CL1, CX3CR1, or any combination thereof.

[0207] In an aspect, a disclosed pharmaceutical formulation can further comprise abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomabm bavituximab, bectumomab, bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, citatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab, farietuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab, imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab, milatuzumab, minretumomab, mitumomab, moxetumomab, namatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab, onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, simtuzumab, solitomab, tacatuzumab, taplitumomab, tenatumomab,teprotumumab, tigatuzumab, tositumomab, trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, 3F8, or any combination thereof.

[0208] In an aspect, a disclosed pharmaceutical formulation can be prepared for systemic or direct administration. In an aspect, a disclosed pharmaceutical formulation can be prepared for oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, a disclosed pharmaceutical formulation can be prepared for any method of administration disclosed herein. In an aspect, a disclosed pharmaceutical formulation can be prepared for administration via multiple routes either concurrently or sequentially. For example, in an aspect, a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered intravenously. In an aspect, a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered orally. A skilled clinical can determine the best route of administration for a subject at a given time.

[0209] In an aspect, a disclosed pharmaceutical formulation can comprise one or more immune modulators. In an aspect, a disclosed pharmaceutical formulation can comprise one or more proteasome inhibitors. In an aspect, a disclosed pharmaceutical formulation can comprise one or more immunosuppressives or immunosuppressive agents. In an aspect, an immunosuppressive agent can be anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), or a combination thereof. In an aspect, a disclosed pharmaceutical formulation can comprise an anaplerotic agent (such as, for example, C7 compounds like triheptanoin or MCT).

[0210] In an aspect, a disclosed pharmaceutically acceptable carrier can comprise any disclosed carrier and / or any disclosed excipient.

[0211] In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor. In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off- targeting effects. In an aspect, a disclosed pharmaceutical formulation can reduce and / or decrease the risk of metastases. In an aspect, a disclosed pharmaceutical formulation can be used in RNA- based editing system. In an aspect, a disclosed pharmaceutical formulation can be used in RNA-based editing system comprising a bi-targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system. In an aspect, a disclosed pharmaceutical formulation can be used in one or more disclosed methods. In an aspect, a disclosed pharmaceutical formulation can be used in one or more disclosed methods of treating a subject.

[0212] In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0213] In an aspect, a disclosed pharmaceutical formulation can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject's quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof. C. Methods of Treating Cancer

[0214] Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nucleic acid molecules. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed plasmids. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nanoparticles. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations.

[0215] In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 1 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg to about 10 mg / kg of total RNA, about 10 mg / kg to about 20 mg / kg of total RNA, about 20 mg / kg to about 30 mg / kg of total RNA, about 30 mg / kg to about 40 mg / kg of total RNA, about 40 mg / kg to about 50 mg / kg of total RNA, about 50 mg / kg to about 60 mg / kg of total RNA, about 60 mg / kg to about 70 mg / kg of total RNA, about 70 mg / kg to about 80 mg / kg of total RNA, about 80 mg / kg to about 90 mg / kg of total RNA, or about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg of total RNA.

[0216] In an aspect, a therapeutically effective amount of total RNA can comprise any one of SEQ ID NO:01-SEQ ID NO:12 and a DR having the sequence of SEQ ID NO:31. In an aspect, a therapeutically effective amount of total RNA can comprise SEQ ID NO:44 and a DR having the sequence of SEQ ID NO:31. In an aspect, a therapeutically effective amount of total RNA can comprise any one of SEQ ID NO:13-SEQ ID NO:16 and a DR having the sequence of SEQ ID NO:30.

[0217] In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre- gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt).

[0218] In an aspect, a subject has cancer or metastatic cancer. In an aspect, a subject has prostate cancer or metastatic prostate cancer. In an aspect, prostate cancer can be neuroendocrine prostate cancer (NEPC). NEPC is an aggressive variant of prostate cancer that may arise de novo or inpatients previously treated with hormonal therapies for prostate adenocarcinoma as a mechanism of resistance. The clinical features of NEPC are poorly defined.

[0219] In an aspect of a disclosed method, the administering step can comprise daily, weekly, monthly, and / or yearly administration. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per day. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per week. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per month. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, 5, or more times per year. In an aspect of a disclosed method, the administering step can be performed at multiple points in the subject's treatment and / or in the subject's life.

[0220] In an aspect, a disclosed method of treating cancer can further comprise collecting one or more blood and / or biological samples from a subject at the same time or at different times. For example, in an aspect, a blood sample and / or a biological sample can be collected from a subject at a pre-determined interval. In an aspect, a pre-determined interval can be once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, or at a longer interval. In an aspect, a pre-determined interval can be once a month, once every 2 months, once every 3 months, once every 5 months, once every 5 months, once every 6 months, or at a longer interval. In an aspect, a blood sample and / or a biological sample can be collected from a subject prior to treatment, during treatment, after treatment, or any combination thereof. In an aspect, a blood and / or a biological sample can be collected from a subject at any time deemed medically and / or clinically appropriate by the skilled clinician.

[0221] In an aspect, a therapeutically effective amount of a disclosed nanoparticle. In an aspect, a therapeutically effective amount of a disclosed pharmaceutical formulation. In an aspect of a disclosed method, a therapeutically effective amount can be titrated during a treatment regiment.

[0222] In an aspect, a therapeutically effective amount or effective dose or effective amount or therapeutically effective dosage of a disclosed nanoparticle or a disclosed pharmaceutical formulation can protect a subject against the onset of a disease and / or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0223] In an aspect, administering a disclosed nanoparticle or a disclosed pharmaceutical formulation can comprise systemic or direct administration. In an aspect, administering can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be administered by any method of administration disclosed herein. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be administered via multiple routes either concurrently or sequentially.

[0224] For example, in an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered intravenously. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be first administered intravenously and then be administered intratumorally. A skilled clinician can determine the best route of administration for a subject at a given time.

[0225] In an aspect, local administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation can comprise delivery to one or more of the subject's body systems having cancerous cells or tumorous growth. In an aspect, the subject's one or more body systems having cancerous cells or tumorous growth can comprise the subject's cardiovascular system, the subject's digestive system, the subject's endocrine system, the subject lymphatic system, the subject's muscular system, the subject's nervous system, the subject's reproductive system, the subject's respiratory system, the subject's skeletal system, the subject's urinary system, the subject's integumentary system, or any combination thereof.

[0226] In an aspect, a disclosed method of treating cancer can further comprise repeating the administering a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0227] In an aspect, a disclosed method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed method of treating cancer can comprise preventing or inhibiting metastasis.

[0228] In an aspect, a disclosed method can comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, a disclosed method can comprise continuing to treat the subject. In an aspect, continuing to treat the subject can comprise continuing to administer a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, in the presence of adverse effects, a disclosed method can comprise modifying one or more steps of the method. In an aspect, modifying one or more steps of a disclosed method can comprise modifying the administering step. In an aspect, modifying the administering step can comprise changing the amount of a disclosed nanoparticle or a disclosed pharmaceutical formulationadministered to the subject, changing the frequency of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, changing the duration of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, changing the route of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, or any combination thereof.

[0229] In an aspect, a disclosed method of treating cancer can comprise administering to the subject one or more additional anti-cancer therapies. Anti-cancer therapies are known to the art. In an aspect, a disclosed anti-cancer therapy can comprise endocrine therapy, radiotherapy, hormone therapy, gene therapy, thermal therapy, ultrasound therapy, or any combination thereof. In an aspect, a disclosed anti-cancer therapy can comprise one or more chemotherapeutic agents. In an aspect, a disclosed chemotherapeutic agent can comprise an anthracycline, a vinca alkaloid, an alkylating agent, an immune cell antibody, an antimetabolite, a TNFR glucocorticoid induced TNFR related protein (GITR) agonist, a proteasome inhibitor, an immunomodulator, or any combination thereof. In an aspect, a disclosed chemotherapeutic agent can comprise 5- fluorouracil (Adrucil, Efudex), 6-mercaptopurine (Purinethol), 6-thioguanine, aclarubicin or aclacinomycin A, alemtuzamab (Lemtrada), anastrozole (Arimidex), axitinib (Inlyta), bevacizumab (Avastin), bicalutamide (Casodex), bleomycin sulfate (Blenoxane), bortezomib (Velcade), busulfan (Myleran), busulfan injection (Busulfex), capecitabine (Xeloda), carboplatin (Paraplatin), carmustine (BiCNU), chlorambucil (Leukeran), cisplatin (Platinol), cladribine (Leustatin), Cosmegan, cyclophosphamide (Cytoxan or Neosar), cyclophosphamide, cytarabine liposome injection (DepoCyt), cytarabine, cytosine arabinoside (Cytosar-U), dacarbazine (DTIC- Dome), dactinomycin (Cosmegen), daunorubicin citrate liposome injection (DaunoXome), daunorubicin hydrochloride (Cerubidine), dexamethasone, docetaxel (Taxotere), doxorubicin hydrochloride (Adriamycin, Rubex), etoposide (Vepesid), fludarabine phosphate (Fludara), flutamide (Eulexin), folic acid antagonists, gemcitabine (difluorodeoxycitidine), gemtuzumab, gliotoxin, hydroxyurea (Hydrea), Idarubicin (Idamycin), ifosfamide (IFEX), ifosfamide, irinotecan (Camptosar), L-asparaginase (ELSPAR), lenalidomide), leucovorin calcium, melphalan (Alkeran), melphalan, methotrexate (Folex), mitoxantrone (Novantrone), mylotarg, N4-pentoxycarbonyl-5 deoxy-5-fluorocytidine, nab-paclitaxel (Abraxane), paclitaxel (Taxol), pentostatin, phoenix (Yttrium90 / MX-DTPA), polifeprosan 20 with carmustine implant (Gliadel), purine analogs and adenosine deaminase inhibitors (fludarabine), pyrimidine analogs, rituximab, tamoxifen citrate (Nolvadex), temozolomide), teniposide (Vumon), tezacitibine, thalidomide or a thalidomide derivative, thiotepa, tirapazamine (Tirazone), topotecan hydrochloride for injection (Hycamptin), tositumomab), vinblastine (Velban), vinblastine, vincristine (Oncovin), vindesine, vinorelbine (Navelbine), or any combination thereof.

[0230] In an aspect, a disclosed method of treating cancer can comprise administering to the subject an anti-chemokine therapy. In an aspect, a disclosed anti-chemokine therapy can comprise one or more antibodies against CCL1, CCL2, CCL4, CCL17, CCL19, CCL21, CCL22, CCL25, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CCR2, CCR5, CCR7, CCR8, CCR9, CXCR3, CXCR4, CXCR5, CX3CL1, CX3CR1, or any combination thereof.

[0231] In an aspect, a disclosed method of treating cancer can comprise administering to the subject one or more immune modulators. In an aspect, a disclosed immune modulator can comprise aspirin, azathioprine, belimumab, betamethasone dipropionate, betamethasone valerate, bortezomib, bredinin, cyazathioprine, cyclophosphamide, cyclosporine, deoxyspergualin, didemnin B, fluocinolone acetonide, folinic acid, ibuprofen, IL6 inhibitors (such as sarilumab) indomethacin, inebilizumab, intravenous gamma globulin (IVIG), methotrexate, methylprednisolone, mycophenolate mofetil, naproxen, prednisolone, prednisone, prednisolone indomethacin, rapamycin, rituximab, sirolimus, sulindac, synthetic vaccine particles containing rapamycin (SVP-Rapamycin or ImmTOR), thalidomide, tocilizumab, tolmetin, triamcinolone acetonide, anti-CD3 antibodies, anti-CD4 antibodies, anti-CD19 antibodies, anti-CD20 antibodies, anti-CD22 antibodies, anti-CD40 antibodies, anti-FcRN antibodies, anti-IL6 antibodies, anti-IGF1R antibodies, an IL2 mutein, a BTK inhibitor, or a combination thereof. In an aspect, a disclosed immune modulator can comprise one or more Treg (regulatory T cells) infusions (e.g., antigen specific Treg cells to AAV). In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, an immune modulator can be administered by any suitable route of administration.

[0232] In an aspect, a disclosed method of treating cancer can comprise administering an oligonucleotide therapeutic agent. A disclosed oligonucleotide therapeutic agent can comprise a single-stranded or double-stranded DNA, iRNA, shRNA, siRNA, mRNA, non-coding RNA (ncRNA), an antisense molecule, miRNA, a morpholino, a peptide-nucleic acid (PNA), or an analog or conjugate thereof. In an aspect, a disclosed oligonucleotide therapeutic agent can be an ASO or an RNAi. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise one or more modifications at any position applicable. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise a CRISPR-based endonuclease. In an aspect, a disclosed endonuclease can be Cas9. CRISPR / Cas9 systems and methods are known to the art.

[0233] In an aspect, a disclosed method of treating cancer can further comprise preventing or inhibiting metastasis of cancer cells. In an aspect, a disclosed method can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of decrease or reduction in the risk of and / or actual metastasis of cancer cells when compared to a control subject (such as, forexample, a subject that has not received a disclosed treatment (e.g., a disclosed nanoparticle or a disclosed pharmaceutical formulation). In an aspect, preventing or inhibiting metastasis of cancer cells can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of decrease or reduction in the risk of and / or actual metastasis of cancer cells when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., a disclosed nanoparticle or a disclosed pharmaceutical formulation) or a pharmaceutical formulation thereof).

[0234] In an aspect, a disclosed method of treating cancer can comprise surgically resecting the tumor and / or cancer cells from the subject. In an aspect, following resecting the tumor and / or cancer cells from the subject, a disclosed method of treating cancer can comprise continuing to administer to the subject a therapeutically effective amount of a disclosed anti-cancer agent, a disclosed anti-chemokine therapy, a disclosed chemotherapeutic agent, any disclosed therapeutic agent, or any combination thereof.

[0235] In an aspect, a disclosed method of treating cancer can further comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery. In an aspect, a subject can be diagnosed with prostate cancer or metastatic cancer. In an aspect, a subject can be diagnosed with CRPC or NEPC.

[0236] In an aspect, a disclosed method of treating cancer can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject, such as, for example, a subject having cancer or cancerous cells. In an aspect, a disclosed interfering molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject having cancer. In an aspect, metabolic dysregulation can be associated with cancer or cancerous cells. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and / or ameliorating autophagy); (iii) improving, enhancing, restoring, and / or preserving mitochondrial functionality and / or structural integrity; (iv) improving, enhancing, restoring, and / or preserving organelle functionality and / or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of the multi-systemic manifestationsof a cancer; (vii) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of a cancer, or (viii) any combination thereof. In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and / or preserving one or more aspects of cellular structural and / or functional integrity. In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and / or functionality is similar to that of a wild-type or control level. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise preventing or inhibiting metastasis of cancer cells in the subject.

[0237] In an aspect, following the administering step, (i) the risk of developing metastases can be prevented and / or decreased; (ii) the survival of the subject can be prolonged; (iii) the subject's quality of life can be enhanced and / or improved; (iv) the likelihood of surgical intervention can be reduced and / or minimized; (v) preventing and / or delaying recurrence of the cancer; (vi) the size of one or more tumors in the subject can be reduced and / or decreased; (vii) one or more tumors in the subject can be eliminated; (viii) extending and / or prolonging disease-free or tumor- free survival time; (ix) increasing and / or lengthening overall survival time; (x) reducing and / or minimizing the frequency of treatment; (xi) relieving and / or ameliorating one or more symptoms of the cancer; (xii) reducing and / or decreasing tumor burden, (ix) preventing and / or facilitating surgical intervention; (xiii) normal metabolism of one or more organ systems in the subject can be improved and / or restored, (xiv) one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation can be restored and / or improved, or (xv) any combination thereof.

[0238] In an aspect of a disclosed method of treating cancer, techniques to monitor, measure, and / or assess the restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are provided below. Regulated Variable Sensor )Regulated Variable Sensor f adisclosed targeted therapy, a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or to identify an effective dose eliciting only mild adverse and / or side effects.

[0240] In an aspect, a disclosed method of treating cancer can comprise titrating the dose of a disclosed treatment regimen in a specific or disclosed subject. In an aspect, a disclosed method of treating and / or preventing cancer can comprise titrating the dose of a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or to identify an effective dose eliciting only mild adverse and / or side effects for a specific or disclosed subject.

[0241] In an aspect, administering to a subject a disclosed nanoparticle or a disclosed pharmaceutical formulation can be done prior to, concurrent with, or after the administering of any other therapeutic agent and / or targeted therapy can change during a treatment regimen. In an aspect, the order of administering a disclosed nanoparticle or a disclosed pharmaceutical formulation) and the administering of any other therapeutic agent and / or targeted therapy can change during a treatment regimen.

[0242] In an aspect, a disclosed method of treating and / or preventing cancer can further comprise obtaining a biological sample from the subject prior to administering a disclosed treatment regimen. In an aspect, a disclosed method of treating and / or preventing cancer can further comprise obtaining a biological sample from the subject after administering a disclosed treatment regimen. In an aspect, a disclosed method of treating and / or preventing cancer can further comprise subjecting the biological sample to a cell-free DNA (cfDNA) analysis. cfDNA analyses are known to the skilled person in the art. In an aspect, a disclosed cfDNA analysis can be repeated one or more times. In an aspect, a disclosed obtaining step can be repeated one or more times.

[0243] In an aspect of a disclosed method of treating and / or preventing cancer, a disclosed cfDNA analysis can comprise next generation sequencing. In an aspect, next generation sequencing (NGS) can comprise using one or more commercially available platforms. Commercially available NGS sequencing platforms can comprise, for example, Guardant360 CDx (Guardant Health, Inc.), FoundationOne CDx (F1CDx) (Foundation Medicine, Inc.), or Tempus xT (Tempus).

[0244] In an aspect of a disclosed method of treating cancer, next generation sequencing can comprise sequencing one or more cancer related genes. In an aspect of a disclosed method of treating and / or preventing cancer, sequencing one or more cancer related genes can comprise identifying one or more genomic aberrations. In an aspect, one or more genomic aberrations can comprise somatic genomic aberrations. In an aspect, the disclosed one or more somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, or any combination thereof.

[0245] In an aspect of a disclosed method, one or more genomic aberrations in the biological sample can be detected. In an aspect, a disclosed method can further comprise detecting one or more genomic aberrations in the biological sample. In an aspect, a disclosed method can further comprise identifying one or more genomic aberrations in a panel of genes. In an aspect, disclosed genomic aberrations can be identified in a panel of genes. In an aspect, a disclosed panel of genes can comprise at least one gene, at least two genes, 3 or more genes, 5 or more genes, 7 or more genes, or 10 or more genes. In an aspect, a disclosed panel of genes can comprise 2 or more genes, 3 or more genes, 4 or more genes, 5 or more genes, 6 or more genes, 7 or more genes, 8 or more genes, 9 or more genes, or 10 or more genes. In an aspect, a disclosed panel of genes can comprise any combination of disclosed genes or disclosed cancer-related genes.

[0246] In an aspect, a disclosed panel of genes can comprise one or more prostate cancer (PC) associated transcription factors (TF). In an aspect, a disclosed PC associated TF is of AR (Gene ID 367 / NP_000035.2), AR-V7 (aka AR3 / NP_001334990.1), HoxB13 (Gene ID 10481 / NP_006352.2), FoxA1 (Gene ID 3169 / NP_004487.2), FoxA2 (Gene ID 3170 / NP_068556.2), or GATA2 (Gene ID 2624 / NP_001139133.1.

[0247] In an aspect, a disclosed method can comprise detecting the expression of one or more disclosed genes and / or one or more disclosed gene aberrations. In an aspect, a disclosed method can comprise generating a control sample and / or a pooled control sample. In an aspect, a disclosed method can comprise generating a reference sample and / or a pooled reference sample. In an aspect, a disclosed method can comprise generating a range of a control samples and / or a pooledcontrol sample. In an aspect, a disclosed method can comprise generating a range of reference samples and / or a pooled reference sample.

[0248] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a pre-treatment sample, then a disclosed method of treating cancer can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post- treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a prior post-treatment sample, then a disclosed method of treating and / or preventing cancer of treating and / or preventing cancer can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0249] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more prostate cancer (PC) associated transcription factors (TF) in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more prostate cancer (PC) associated transcription factors (TF) in a pre-treatment sample, then a disclosed method of treating cancer can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or more prostate cancer (PC) associated transcription factors (TF) in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more prostate cancer (PC) associated transcription factors (TF) in a prior post-treatment sample, then a disclosed method of treating and / or preventing cancer of treating and / or preventing cancer can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0250] In an aspect, a disclosed method of treating cancer can further comprise measuring the subject's tumor response to the administering of a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a subject's tumor response can comprise a partial response or a complete response. In an aspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one or more tumors by 25% or more when compared to the size of the same tumor or the same one or more tumors prior to the treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one or more tumors by 50% or more when compared to the size of the same tumor or the same one or more tumors prior to treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation. In anaspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one more tumors by about 100% or more when compared to the size of the same tumor or the same one or more tumors prior to treatment.

[0251] In an aspect, a complete response can be defined as complete disappearance of all tumors with no recurrence of tumors for at least four weeks. In an aspect, a partial response can be defined as a 50% reduction in total tumor size with such reduction lasting at least four weeks. In an aspect, stable disease can be defined as less than 50% reduction in size but no more than 25% increase in size of the tumor mass lasting for at least twelve weeks.

[0252] In an aspect, a disclosed method of treating cancer can further comprise measuring the subject's molecular response to a disclosed treatment regimen. In an aspect, a disclosed molecular response can comprise a decrease in the number of somatic genomic aberrations in a disclosed biological sample obtained from the subject. In an aspect, disclosed somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, fusions, or any combination thereof.

[0253] In an aspect, a subject can be a human patient. In an aspect a subject can be any age (e.g., geriatric, adult, young adult, teenager, tween, adolescent, child, toddler, baby, or infant), can be male or female, can be any nationality, can be of any ethnicity, and / or can be of any race. In an aspect, a subject can have a terminal cancer. In an aspect, a subject can have metastatic cancer. In an aspect, a subject can have recurrent cancer.

[0254] In an aspect, a disclosed targeted therapy can comprise one or more monoclonal antibodies. In an aspect, a disclosed monoclonal antibody can comprise an angiogenesis inhibitor (e.g., bevacizumab), a HER-2 targeted agent (e.g., trastuzumab, pertuzumab, etc.), an anti-CD20 monoclonal antibody (e.g., rituximab, obinutuzumab, etc.), or any combination thereof. In an aspect, a disclosed targeted therapy can comprise one or more small molecule inhibitors. In an aspect, a disclosed small molecule inhibitor can comprise a tyrosine kinase inhibitor (e.g., erlotinib, sunitinib, imatinib, dasatinib, etc.), a mTOR inhibitor (e.g., everolimus), a PARP inhibitor (e.g., olaparib), a CDK inhibitor (e.g., palbociclib, ribociclib, abermaciclib, etc.), a CD4 and / or CD6 inhibitor, or any combination thereof.

[0255] In an aspect, a disclosed targeted therapy can comprise abagovomab, abciximab, abituzumab, abrilumab, actoxumab, adalimumab, adecatumumab, aducanumab, afelimomab, afutuzumab, alacizumab pegol, alemtuzumab, alirocumab, altumomab pentetate, amatuximab, anatumomab mafenatox, anetumab ravtansine, anifrolumab, anrukinzumab, apolizumab, arcitumomab, ascrinvacumab, aselizumab, atezolizumab, atinumab, atlizumab (tocilizumab), atorolimumab, bapineuzumab, basiliximab, bavituximab, bectumomab, begelomab, belimumab,benralizumab, bertilimumab, besilesomab, bevacizumab, bezlotoxumab, biciromab, bimagrumab, bimekizumab, bivatuzumab mertansine, blinatumomab, blosozumab, bococizumab, brentuxim abvedotin, briakinumab, brodalumab, brolucizumab, brontictuzumab, canakinumab, cantuzumab mertansine, cantuzumab ravtansine, caplacizumab, capromab pendetide, carlumab, catumaxomab, cbr96-doxorubicin immunoconjugate, cedelizumab, certolizumab pegol, cetuximab, citatuzumab bogatox, cixutumumab, clazakizumab, clenoliximab, clivatuzumab tetraxetan, codrituzumab, coltuximab ravtansine, conatumumab, concizumab, crenezumab, dacetuzumab, daclizumab, dalotuzumab, dapirolizumab pegol, daratumumab, dectrekumab, demcizumab, denintuzumab mafodotin, denosumab, derlotuximab biotin, detumomab, dinutuximab, diridavumab, dorlimomab aritox, drozitumab, duligotumab, dupilumab, durvalumab, dusigitumab, ecromeximab, eculizumab, edobacomab, edrecolomab, efalizumab, efungumab, eldelumab, elgemtumab, elotuzumab, elsilimomab, emactuzumab, emibetuzumab, enavatuzumab, enfortumab vedotin, enlimomab pegol, enoblituzumab, enokizumab, enoticumab, ensituximab, epitumomab cituxetan, epratuzumab, erlizumab, ertumaxomab, etanercept, etaracizumab, etrolizumab, evinacumab, evolocumab, exbivirumab, fanolesomab, faralimomab, farletuzumab, fasinumab, felvizumab, fezakinumab, ficlatuzumab, figitumumab, firivumab, flanvotumab, fletikumab, fontolizumab, foralumab, foravirumab, fresolimumab, fulranumab, futuximab, galiximab, ganitumab, gantenerumab, gavilimomab, gemtuzumab ozogamicin, gevokizumab, girentuximab, glembatumumab vedotin, golimumab, gomiliximab, guselkumab, ibalizumab, ibritumomab tiuxetan, icrucumab, idarucizumab, igovomab, imalumab, imciromab, imgatuzumab, inclacumab, indatuximab ravtansine, indusatumab vedotin, infliximab, inolimomab, inotuzumab ozogamicin, intetumumab, ipilimumab, iratumumab, isatuximab, itolizumab, ixekizumab, keliximab, labetuzumab, lambrolizumab, lampalizumab, lebrikizumab, lemalesomab, lenzilumab, lerdelimumab, lexatumumab, libivirumab, lifastuzumab vedotin, ligelizumab, lilotomab satetraxetan, lintuzumab, lirilumab, lodelcizumab, lokivetmab, lorvotuzumab mertansine, lucatumumab, lulizumab pegol, lumiliximab, lumretuzumab, mapatumumab, margetuximab, maslimomab, matuzumab, mavrilimumab, mepolizumab, metelimumab, milatuzumab, minretumomab, mirvetuximab soravtansine, mitumomab, mogamulizumab, morolimumab, motavizumab, moxetumomab pasudotox, muromonab-cd3, nacolomab tafenatox, namilumab, naptumomab estafenatox, narnatumab, natalizumab, nebacumab, necitumumab, nemolizumab, nerelimomab, nesvacumab, nimotuzumab, nivolumab, nofetumomab merpentan, obiltoxaximab, obinutuzumab, ocaratuzumab, ocrelizumab, odulimomab, ofatumumab, olaratumab, olokizumab, omalizumab, onartuzumab, ontuxizumab, opicinumab, oportuzumab monatox, oregovomab, orticumab, otelixizumab, otlertuzumab,oxelumab, ozanezumab, ozoralizumab, pagibaximab, palivizumab, panitumumab, pankomab, panobacumab, parsatuzumab, pascolizumab, pasotuxizumab, pateclizumab, patritumab, pembrolizumab, pemtumomab, perakizumab, pertuzumab, pexelizumab, pidilizumab, pinatuzumab vedotin, pintumomab, placulumab, polatuzumab vedotin, ponezumab, priliximab, pritoxaximab, pritumumab, quilizumab, racotumomab, radretumab, rafivirumab, ralpancizumab, ramucirumab, ranibizumab, raxibacumab, refanezumab, regavirumab, reslizumab, rilotumumab, rinucumab, rituximab, robatumumab, roledumab, romosozumab, rontalizumab, rovelizumab, ruplizumab, sacituzumab govitecan, samalizumab, sarilumab, satumomab pendetide, secukinumab, seribantumab, setoxaximab, sevirumab, sibrotuzumab, sifalimumab, siltuximab, simtuzumab, siplizumab, sirukumab, sofituzumab vedotin, solanezumab, solitomab, sonepcizumab, sontuzumab, stamulumab, sulesomab, suvizumab, tabalumab, tacatuzumab tetraxetan, tadocizumab, talizumab, tanezumab, taplitumomab paptox, tarextumab, tefibazumab, telimomab aritox, tenatumomab, teneliximab, teplizumab, teprotumumab, tesidolumab, tetulomab, ticilimumab, tigatuzumab, tildrakizumab, tocilizumab, toralizumab, tosatoxumab, tositumomab, tovetumab, tralokinumab, trastuzumab, tregalizumab, tremelimumab, trevogrumab, tucotuzumab celmoleukin, tuvirumab, ublituximab, ulocuplumab, urelumab, urtoxazumab, ustekinumab, vandortuzumab vedotin, vantictumab, vanucizumab, vapaliximab, varlilumab, vatelizumab, vedolizumab, veltuzumab, vepalimomab, vesencumab, visilizumab, volociximab, vorsetuzumab mafodotin, votumumab, zalutumumab, zanolimumab, zatuximab, ziralimumab, zolimomab aritox, or any combination thereof.

[0256] In an aspect, a disclosed targeted therapy can comprise abemaciclib, ado-trastuzumab emtansine, afatinib, alectinib, alemtuzumab, alpelisib, atezolizumab, avelumab, axitinib, bevacizumab, binimetinib, blinatumomab, bosutinib, brentuximab, brigatinib, cabozantinib, carfilzomib, cemiplimab, ceritinib, cetuximab, gilteritinib, cobimetinib, copanlisib, crizotinib, dabrafenib, dacomitinib, daratumumab, dasatinib, denosumab, dinutuximab, durvalumab, duvelisib, elotuzumab, encorafenib, entrectinib, erdafitinib, erlotinib, fam-trastuzumab deruxtecan-nxki, gefitinib, gemtuzumab, ibritumomab tiuxetan, ibrutinib, imatinib, inotuzumab, ipilumumab, ivosidenib, lapatinib, larotrectinib, Lenvatinib, lorlatinib, margetuximab-cmkb, necitumumab, neratinib, nilotinib, niraparib, nivolumab, obinutuzumab, ofatumumab, olaparib, olaratumab, osimertinib, palbociclib, panitumumab, pazopanib, pembrolizumab, pertuzumab, ponatinib, ramucirumab, regorafenib, ribociclib, rituximab, rucaparib, sorafenib, sunitinib, talazoparib, tivozanib, tositumomab, trametinib, trastuzumab, tucatinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0257] In an aspect, a disclosed targeted therapy for oral administration can comprise abemaciclib, afatinib, alectinib, alpelisib, axitinib, binimetinib, bosutinib, brigatinib, cabozantinib, cobimetinib, crizotinib, dabrafenib, dacomitinib, dasatinib, duvelisib, encorafenib, entrectinib, erdafitinib, erlotinib, gefitinib, gilteritinib, ibrutinib, imatinib mesylate, ivosidenib, lapatinib, larotrectinib, lorlatinib, lenvatinb, neratinib, nilotinib, niraparib, olaparib, osimertinib palbociclib, pazopanib, ponatinib, regorafenib, ribociclib, rucaparib, sorafenib, sunitinib malate, talazoparib, tivozanib, trametinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0258] In an aspect, a disclosed targeted therapy for intravenous administration can comprise ado- trastuzumab emtansine, alemtuzumab, atezolizumab, avelumab, bevacizumab, blinatumomab, brentuximab vedotin, carfilzomib, cetuximab, cemiplimab-rwlc, certinib, copanlisib, daratumumab, dinutuximab, durvalumab, elotuzumab, fam-trastuzumab deruxtecan-nxki, gemtuzumab ozogamicin, ibritumomab tiuxetan, inotuzumab ozogamicin, ipilimumab, margetuximab-cmkb, necitumumab, nivolumab, obinutuzumab, olaratumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, rituximab, tositumomab and iodine I131 tositumomab, trastuzumab, ublituximab-xiiy, or any combination thereof.

[0259] In an aspect, a disclosed targeted therapy for subcutaneous administration can comprise denosumab, ofatumumab, or any combination thereof.

[0260] In an aspect, a disclosed method of treating cancer can comprise administering to the subject a therapeutically effective amount of a targeted immunotherapy agent (e.g., fam- trastuzumab-deruxtecan-nxki; trastuzumab; Herceptin Hylecta (injectable Herceptin); Herceptin biosimilars (e.g., Herzuma, Kanjinti, Ogivri, Ontruzant, and Trazimera); ado-trastuzumab emtansine; margetuximab-cmkb; pertuzumab, trastuzumab, and hyaluronidase-zzxf; pertuzumab; sacituzumab govitecan-hziy; or any combination thereof).

[0261] In an aspect, a disclosed method can be modified. In an aspect, one or more steps of a disclosed method can be modified. In an aspect, a disclosed method of treating cancer and / or metastatic cancer can comprise modifying or changing one or more features or aspects of one or more steps. In an aspect, a method can be altered by changing the amount of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof administered to a subject, or by changing the frequency of administration of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agents, or a combination thereof to a subject, by changing the duration of time that a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosedplasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof is administered to a subject, or by substituting for one or more of the disclosed components and / or reagents with a similar or equivalent component and / or reagent. The same applies to all disclosed treatment regimens, disclosed nanoparticle, disclosed pharmaceutical formulations, disclosed targeted therapies, disclosed pharmaceutical formulations, disclosed anti-chemokines, disclosed anti-cancer agents, disclosed chemotherapeutic agents, or combinations thereof. D. Methods of Treating COVID-19

[0262] Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nucleic acid molecules. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed plasmids. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed nanoparticles. Disclosed herein is a method of treating COVID-19, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations.

[0263] In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 1 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg to about 10 mg / kg of total RNA, about 10 mg / kg to about 20 mg / kg of total RNA, about 20 mg / kg to about 30 mg / kg of total RNA, about 30 mg / kg to about 40 mg / kg of total RNA, about 40 mg / kg to about 50 mg / kg of total RNA, about 50 mg / kg to about 60 mg / kg of total RNA, about 60 mg / kg to about 70 mg / kg of total RNA, about 70 mg / kg to about 80 mg / kg of total RNA, about 80 mg / kg to about 90 mg / kg of total RNA, or about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg of total RNA.

[0264] In an aspect, a therapeutically effective amount of total RNA can comprise any one of SEQ ID NO:17-SEQ ID NO:20 and a DR having the sequence of SEQ ID NO:31. In an aspect, a therapeutically effective amount of total RNA can comprise any one of SEQ ID NO:21-SEQ ID NO:24 and a DR having the sequence of SEQ ID NO:31. In an aspect, a therapeutically effective amount of total RNA can comprise any one of SEQ ID NO:25-SEQ ID NO:28 and a DR having the sequence of SEQ ID NO:31. In an aspect, a therapeutically effective amount of total RNAcan comprise any one of SEQ ID NO:45-SEQ ID NO:47 and a DR having the sequence of SEQ ID NO:31.

[0265] In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of CasRx mRNA:pre-gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of CasRx mRNA:pre- gRNA (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt).

[0266] In an aspect of a disclosed method, the administering step can comprise daily, weekly, monthly, and / or yearly administration. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per day. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per week. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per month. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, 5, or more times per year. In an aspect of a disclosed method, the administering step can be performed at multiple points in the subject's treatment and / or in the subject's life.

[0267] In an aspect, a disclosed method of treating COVID-19 can further comprise collecting one or more blood and / or biological samples from a subject at the same time or at different times. For example, in an aspect, a blood sample and / or a biological sample can be collected from a subject at a pre-determined interval. In an aspect, a pre-determined interval can be once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, or at a longer interval. In an aspect, a pre- determined interval can be once a month, once every 2 months, once every 3 months, once every 5 months, once every 5 months, once every 6 months, or at a longer interval. In an aspect, a bloodsample and / or a biological sample can be collected from a subject prior to treatment, during treatment, after treatment, or any combination thereof. In an aspect, a blood and / or a biological sample can be collected from a subject at any time deemed medically and / or clinically appropriate by the skilled clinician.

[0268] In an aspect, a therapeutically effective amount of a disclosed nanoparticle. In an aspect, a therapeutically effective amount of a disclosed pharmaceutical formulation. In an aspect of a disclosed method, a therapeutically effective amount can be titrated.

[0269] In an aspect, a therapeutically effective amount or effective dose or effective amount or therapeutically effective dosage of a disclosed nanoparticle or a disclosed pharmaceutical formulation can protect a subject against the onset of a disease and / or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0270] In an aspect, administering a disclosed nanoparticle or a disclosed pharmaceutical formulation can comprise systemic or direct administration. In an aspect, administering can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be administered by any method of administration disclosed herein. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be administered via multiple routes either concurrently or sequentially.

[0271] For example, in an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered intravenously. In an aspect, a disclosed nanoparticle or a disclosed pharmaceutical formulation can be first administered intravenously and then be administered intratumorally. A skilled clinician can determine the best route of administration for a subject at a given time.

[0272] In an aspect, local administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation can comprise delivery to one or more of the subject's body systems affected by COVID-19. In an aspect, the subject's one or more body systems affected by COVID-19 can comprise the subject's cardiovascular system, the subject's digestive system, the subject's endocrine system, the subject lymphatic system, the subject's muscular system, the subject's nervous system, the subject's reproductive system, the subject's respiratory system, the subject'sskeletal system, the subject's urinary system, the subject's integumentary system, or any combination thereof.

[0273] In an aspect, a disclosed method of treating COVID-19 can further comprise repeating the administering a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0274] In an aspect, a disclosed method can comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, a disclosed method can comprise continuing to treat the subject. In an aspect, continuing to treat the subject can comprise continuing to administer a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, in the presence of adverse effects, a disclosed method can comprise modifying one or more steps of the method. In an aspect, modifying one or more steps of a disclosed method can comprise modifying the administering step. In an aspect, modifying the administering step can comprise changing the amount of a disclosed nanoparticle or a disclosed pharmaceutical formulation administered to the subject, changing the frequency of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, changing the duration of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, changing the route of administration of a disclosed nanoparticle or a disclosed pharmaceutical formulation, or any combination thereof.

[0275] In an aspect, a disclosed method of treating COVID-19 can comprise administering to the subject one or more additional treatment therapies. Treatment therapies are known to the art. In an aspect, a disclosed therapy can comprise endocrine therapy, radiotherapy, hormone therapy, gene therapy, small molecule therapy, anti-viral therapy, thermal therapy, ultrasound therapy, or any combination thereof.

[0276] In an aspect, a disclosed method of treating COVID-19 can comprise administering to the subject an anti-chemokine therapy. In an aspect, a disclosed anti-chemokine therapy can comprise one or more antibodies against CCL1, CCL2, CCL4, CCL17, CCL19, CCL21, CCL22, CCL25, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CCR2, CCR5, CCR7, CCR8, CCR9, CXCR3, CXCR4, CXCR5, CX3CL1, CX3CR1, or any combination thereof.

[0277] In an aspect, a disclosed method of treating COVID-19 can comprise administering to the subject one or more immune modulators. In an aspect, a disclosed immune modulator can comprise aspirin, azathioprine, belimumab, betamethasone dipropionate, betamethasone valerate, bortezomib, bredinin, cyazathioprine, cyclophosphamide, cyclosporine, deoxyspergualin, didemnin B, fluocinolone acetonide, folinic acid, ibuprofen, IL6 inhibitors (such as sarilumab) indomethacin, inebilizumab, intravenous gamma globulin (IVIG), methotrexate, methylprednisolone, mycophenolate mofetil, naproxen, prednisolone, prednisone, prednisolone indomethacin, rapamycin, rituximab, sirolimus, sulindac, synthetic vaccine particles containingrapamycin (SVP-Rapamycin or ImmTOR), thalidomide, tocilizumab, tolmetin, triamcinolone acetonide, anti-CD3 antibodies, anti-CD4 antibodies, anti-CD19 antibodies, anti-CD20 antibodies, anti-CD22 antibodies, anti-CD40 antibodies, anti-FcRN antibodies, anti-IL6 antibodies, anti-IGF1R antibodies, an IL2 mutein, a BTK inhibitor, or a combination thereof. In an aspect, a disclosed immune modulator can comprise one or more Treg (regulatory T cells) infusions (e.g., antigen specific Treg cells to AAV). In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, an immune modulator can be administered by any suitable route of administration.

[0278] In an aspect, a disclosed method of treating COVID-19 can comprise administering an oligonucleotide therapeutic agent. A disclosed oligonucleotide therapeutic agent can comprise a single-stranded or double-stranded DNA, iRNA, shRNA, siRNA, mRNA, non-coding RNA (ncRNA), an antisense molecule, miRNA, a morpholino, a peptide-nucleic acid (PNA), or an analog or conjugate thereof. In an aspect, a disclosed oligonucleotide therapeutic agent can be an ASO or an RNAi. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise one or more modifications at any position applicable. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise a CRISPR-based endonuclease. In an aspect, a disclosed endonuclease can be Cas9. CRISPR / Cas9 systems and methods are known to the art.

[0279] In an aspect, a disclosed method of treating COVID-19 can further comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery. In an aspect, a subject can be diagnosed with COVID-19.

[0280] In an aspect, a disclosed method of treating COVID-19 can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject, such as, for example, a subject having COVID-19. In an aspect, a disclosed interfering molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject having COVID-19. In an aspect, metabolic dysregulation can be associated with COVID-19. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and / or ameliorating autophagy); (iii) improving, enhancing, restoring, and / or preserving mitochondrial functionality and / or structural integrity; (iv)improving, enhancing, restoring, and / or preserving organelle functionality and / or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of the multi-systemic manifestations of COVID-19; (vii) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of COVID- 19, or (viii) any combination thereof. In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and / or preserving one or more aspects of cellular structural and / or functional integrity. In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and / or functionality is similar to that of a wild-type or control level.

[0281] In an aspect, following the administering step, (i) the survival of the subject can be prolonged; (ii) the subject's quality of life can be enhanced and / or improved; (iii) the likelihood of surgical intervention can be reduced and / or minimized; (iv) increasing and / or lengthening overall survival time; (v) reducing and / or minimizing the frequency of treatment; (vi) relieving and / or ameliorating one or more symptoms of COVID-19; (vii) preventing and / or facilitating surgical intervention and / or ventilator intervention; (viii) normal metabolism of one or more organ systems in the subject can be improved and / or restored, (ix) one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation can be restored and / or improved, or (x) any combination thereof.

[0282] In an aspect of a disclosed method of treating COVID-19, techniques to monitor, measure, and / or assess the restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. For example, representative regulated variables and sensors relating to systemic homeostasis are discussed supra in Section VII(C).

[0283] In an aspect, a disclosed method of treating COVID-19 can comprise titrating the dose of a disclosed plasmid, a disclosed nanoparticle, a disclosed targeted therapy, a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or to identify an effective dose eliciting only mild adverse and / or side effects.

[0284] In an aspect, a disclosed method of treating COVID-19 can comprise titrating the dose of a disclosed treatment regimen in a specific or disclosed subject. In an aspect, a disclosed method of treating and / or preventing COVID-19 can comprise titrating the dose of a disclosedcomposition, a disclosed nanoparticle, a disclosed plasmid, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or an effective dose eliciting only mild adverse and / or side effects for a specific or disclosed subject.

[0285] In an aspect, administering to a subject a disclosed nanoparticle or a disclosed pharmaceutical formulation can be done prior to, concurrent with, or after the administering of any other therapeutic agent and / or targeted therapy can change during a treatment regimen. In an aspect, the order of administering a disclosed nanoparticle or a disclosed pharmaceutical formulation) and the administering of any other therapeutic agent and / or targeted therapy can change during a treatment regimen.

[0286] In an aspect, a disclosed method of treating COVID-19 can further comprise obtaining a biological sample from the subject prior to administering a disclosed treatment regimen. In an aspect, a disclosed method of treating COVID-19 can further comprise obtaining a biological sample from the subject after administering a disclosed treatment regimen. In an aspect, a disclosed method of treating COVID-19 can further comprise subjecting the biological sample to a cell-free DNA (cfDNA) analysis. cfDNA analyses are known to the skilled person in the art. In an aspect, a disclosed cfDNA analysis can be repeated one or more times. In an aspect, a disclosed obtaining step can be repeated one or more times.

[0287] In an aspect of a disclosed method of treating COVID-19, a disclosed cfDNA analysis can comprise next generation sequencing. In an aspect, next generation sequencing (NGS) can comprise using one or more commercially available platforms. Commercially available NGS sequencing platforms can comprise, for example, Guardant360 CDx (Guardant Health, Inc.), FoundationOne CDx (F1CDx) (Foundation Medicine, Inc.), or Tempus xT (Tempus).

[0288] In an aspect of a disclosed method of treating COVID-19, next generation sequencing can comprise sequencing one or more COVID-19 related genes. In an aspect of a disclosed method of treating and / or preventing COVID-19, sequencing one or more COVID-19 related genes can comprise identifying one or more genomic aberrations. In an aspect, one or more genomic aberrations can comprise somatic genomic aberrations. In an aspect, the disclosed one or more somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, or any combination thereof.

[0289] In an aspect of a disclosed method, one or more genomic aberrations in the biological sample can be detected. In an aspect, a disclosed method can further comprise detecting one or more genomic aberrations in the biological sample. In an aspect, a disclosed method can furthercomprise identifying one or more genomic aberrations in a panel of genes. In an aspect, disclosed genomic aberrations can be identified in a panel of genes. In an aspect, a disclosed panel of genes can comprise at least one gene, at least two genes, 3 or more genes, 5 or more genes, 7 or more genes, or 10 or more genes. In an aspect, a disclosed panel of genes can comprise 2 or more genes, 3 or more genes, 4 or more genes, 5 or more genes, 6 or more genes, 7 or more genes, 8 or more genes, 9 or more genes, or 10 or more genes. In an aspect, a disclosed panel of genes can comprise any combination of disclosed genes or disclosed COVID-19-related genes.

[0290] In an aspect, a disclosed panel of gene can comprise one or more COVID-19 associated proteins. In an aspect, a disclosed targeted COVID-19 associated protein can be Transmembrane serine protease 2 (TMPRSS2), Cathepsin L (CTSL), Furin, or any combination thereof.

[0291] In an aspect, a disclosed method can comprise detecting the expression of one or more disclosed genes and / or one or more disclosed gene aberrations. In an aspect, a disclosed method can comprise generating a control sample and / or a pooled control sample. In an aspect, a disclosed method can comprise generating a reference sample and / or a pooled reference sample. In an aspect, a disclosed method can comprise generating a range of a control samples and / or a pooled control sample. In an aspect, a disclosed method can comprise generating a range of reference samples and / or a pooled reference sample.

[0292] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a pre-treatment sample, then a disclosed method of treating COVID-19 can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a prior post-treatment sample, then a disclosed method of treating and / or preventing COVID-19 of treating and / or preventing COVID-19 can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0293] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more COVID-19 associated proteins in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more COVID-19 associated proteins in a pre-treatment sample, then a disclosed method of treating COVID-19 can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or moreCOVID-19 associated proteins in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more COVID-19 associated proteins in a prior post-treatment sample, then a disclosed method of treating and / or preventing COVID- 19 can comprise continuing to administer to the subject a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0294] In an aspect, a disclosed method of treating COVID-19 can further comprise measuring the subject's response to the administering of a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a subject's response can comprise a partial response or a complete response. In an aspect, a disclosed partial response can comprise an increase in lung or respiratory function by 25% or more when compared to the lung or respiratory function prior to the treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise an increase in lung or respiratory function by 50% or more when compared to the lung or respiratory function prior to the treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise an increase in lung or respiratory function by 75% or more when compared to the lung or respiratory function prior to the treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise an increase in lung or respiratory function by 100% or more when compared to the lung or respiratory function prior to the treatment with a disclosed nanoparticle or a disclosed pharmaceutical formulation.

[0295] In an aspect, a disclosed method of treating COVID-19 can further comprise measuring the subject's molecular response to a disclosed treatment regimen. In an aspect, a disclosed molecular response can comprise a decrease in the number of somatic genomic aberrations in a disclosed biological sample obtained from the subject. In an aspect, disclosed somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, fusions, or any combination thereof.

[0296] In an aspect, a subject can be a human patient. In an aspect a subject can be any age (e.g., geriatric, adult, young adult, teenager, tween, adolescent, child, toddler, baby, or infant), can be male or female, can be any nationality, can be of any ethnicity, and / or can be of any race. In an aspect, a subject can have COVID-19 including, but not limited to variants such as Alpha, Beta, Delta, and Omicron.

[0297] In an aspect, a disclosed targeted therapy can comprise one or more monoclonal antibodies. In an aspect, a disclosed monoclonal antibody can comprise an angiogenesis inhibitor (e.g., bevacizumab), a HER-2 targeted agent (e.g., trastuzumab, pertuzumab, etc.), an anti-CD20monoclonal antibody (e.g., rituximab, obinutuzumab, etc.), or any combination thereof. In an aspect, a disclosed targeted therapy can comprise one or more small molecule inhibitors. In an aspect, a disclosed small molecule inhibitor can comprise a tyrosine kinase inhibitor (e.g., erlotinib, sunitinib, imatinib, dasatinib, etc.), a mTOR inhibitor (e.g., everolimus), a PARP inhibitor (e.g., olaparib), a CDK inhibitor (e.g., palbociclib, ribociclib, abermaciclib, etc.), a CD4 and / or CD6 inhibitor, or any combination thereof.

[0298] In an aspect, a disclosed targeted therapy can comprise abagovomab, abciximab, abituzumab, abrilumab, actoxumab, adalimumab, adecatumumab, aducanumab, afelimomab, afutuzumab, alacizumab pegol, alemtuzumab, alirocumab, altumomab pentetate, amatuximab, anatumomab mafenatox, anetumab ravtansine, anifrolumab, anrukinzumab, apolizumab, arcitumomab, ascrinvacumab, aselizumab, atezolizumab, atinumab, atlizumab (tocilizumab), atorolimumab, bapineuzumab, basiliximab, bavituximab, bectumomab, begelomab, belimumab, benralizumab, bertilimumab, besilesomab, bevacizumab, bezlotoxumab, biciromab, bimagrumab, bimekizumab, bivatuzumab mertansine, blinatumomab, blosozumab, bococizumab, brentuxim abvedotin, briakinumab, brodalumab, brolucizumab, brontictuzumab, canakinumab, cantuzumab mertansine, cantuzumab ravtansine, caplacizumab, capromab pendetide, carlumab, catumaxomab, cbr96-doxorubicin immunoconjugate, cedelizumab, certolizumab pegol, cetuximab, citatuzumab bogatox, cixutumumab, clazakizumab, clenoliximab, clivatuzumab tetraxetan, codrituzumab, coltuximab ravtansine, conatumumab, concizumab, crenezumab, dacetuzumab, daclizumab, dalotuzumab, dapirolizumab pegol, daratumumab, dectrekumab, demcizumab, denintuzumab mafodotin, denosumab, derlotuximab biotin, detumomab, dinutuximab, diridavumab, dorlimomab aritox, drozitumab, duligotumab, dupilumab, durvalumab, dusigitumab, ecromeximab, eculizumab, edobacomab, edrecolomab, efalizumab, efungumab, eldelumab, elgemtumab, elotuzumab, elsilimomab, emactuzumab, emibetuzumab, enavatuzumab, enfortumab vedotin, enlimomab pegol, enoblituzumab, enokizumab, enoticumab, ensituximab, epitumomab cituxetan, epratuzumab, erlizumab, ertumaxomab, etanercept, etaracizumab, etrolizumab, evinacumab, evolocumab, exbivirumab, fanolesomab, faralimomab, farletuzumab, fasinumab, felvizumab, fezakinumab, ficlatuzumab, figitumumab, firivumab, flanvotumab, fletikumab, fontolizumab, foralumab, foravirumab, fresolimumab, fulranumab, futuximab, galiximab, ganitumab, gantenerumab, gavilimomab, gemtuzumab ozogamicin, gevokizumab, girentuximab, glembatumumab vedotin, golimumab, gomiliximab, guselkumab, ibalizumab, ibritumomab tiuxetan, icrucumab, idarucizumab, igovomab, imalumab, imciromab, imgatuzumab, inclacumab, indatuximab ravtansine, indusatumab vedotin, infliximab, inolimomab, inotuzumab ozogamicin, intetumumab, ipilimumab, iratumumab, isatuximab,itolizumab, ixekizumab, keliximab, labetuzumab, lambrolizumab, lampalizumab, lebrikizumab, lemalesomab, lenzilumab, lerdelimumab, lexatumumab, libivirumab, lifastuzumab vedotin, ligelizumab, lilotomab satetraxetan, lintuzumab, lirilumab, lodelcizumab, lokivetmab, lorvotuzumab mertansine, lucatumumab, lulizumab pegol, lumiliximab, lumretuzumab, mapatumumab, margetuximab, maslimomab, matuzumab, mavrilimumab, mepolizumab, metelimumab, milatuzumab, minretumomab, mirvetuximab soravtansine, mitumomab, mogamulizumab, morolimumab, motavizumab, moxetumomab pasudotox, muromonab-cd3, nacolomab tafenatox, namilumab, naptumomab estafenatox, narnatumab, natalizumab, nebacumab, necitumumab, nemolizumab, nerelimomab, nesvacumab, nimotuzumab, nivolumab, nofetumomab merpentan, obiltoxaximab, obinutuzumab, ocaratuzumab, ocrelizumab, odulimomab, ofatumumab, olaratumab, olokizumab, omalizumab, onartuzumab, ontuxizumab, opicinumab, oportuzumab monatox, oregovomab, orticumab, otelixizumab, otlertuzumab, oxelumab, ozanezumab, ozoralizumab, pagibaximab, palivizumab, panitumumab, pankomab, panobacumab, parsatuzumab, pascolizumab, pasotuxizumab, pateclizumab, patritumab, pembrolizumab, pemtumomab, perakizumab, pertuzumab, pexelizumab, pidilizumab, pinatuzumab vedotin, pintumomab, placulumab, polatuzumab vedotin, ponezumab, priliximab, pritoxaximab, pritumumab, quilizumab, racotumomab, radretumab, rafivirumab, ralpancizumab, ramucirumab, ranibizumab, raxibacumab, refanezumab, regavirumab, reslizumab, rilotumumab, rinucumab, rituximab, robatumumab, roledumab, romosozumab, rontalizumab, rovelizumab, ruplizumab, sacituzumab govitecan, samalizumab, sarilumab, satumomab pendetide, secukinumab, seribantumab, setoxaximab, sevirumab, sibrotuzumab, sifalimumab, siltuximab, simtuzumab, siplizumab, sirukumab, sofituzumab vedotin, solanezumab, solitomab, sonepcizumab, sontuzumab, stamulumab, sulesomab, suvizumab, tabalumab, tacatuzumab tetraxetan, tadocizumab, talizumab, tanezumab, taplitumomab paptox, tarextumab, tefibazumab, telimomab aritox, tenatumomab, teneliximab, teplizumab, teprotumumab, tesidolumab, tetulomab, ticilimumab, tigatuzumab, tildrakizumab, tocilizumab, toralizumab, tosatoxumab, tositumomab, tovetumab, tralokinumab, trastuzumab, tregalizumab, tremelimumab, trevogrumab, tucotuzumab celmoleukin, tuvirumab, ublituximab, ulocuplumab, urelumab, urtoxazumab, ustekinumab, vandortuzumab vedotin, vantictumab, vanucizumab, vapaliximab, varlilumab, vatelizumab, vedolizumab, veltuzumab, vepalimomab, vesencumab, visilizumab, volociximab, vorsetuzumab mafodotin, votumumab, zalutumumab, zanolimumab, zatuximab, ziralimumab, zolimomab aritox, or any combination thereof.

[0299] In an aspect, a disclosed targeted therapy can comprise abemaciclib, ado-trastuzumab emtansine, afatinib, alectinib, alemtuzumab, alpelisib, atezolizumab, avelumab, axitinib,bevacizumab, binimetinib, blinatumomab, bosutinib, brentuximab, brigatinib, cabozantinib, carfilzomib, cemiplimab, ceritinib, cetuximab, gilteritinib, cobimetinib, copanlisib, crizotinib, dabrafenib, dacomitinib, daratumumab, dasatinib, denosumab, dinutuximab, durvalumab, duvelisib, elotuzumab, encorafenib, entrectinib, erdafitinib, erlotinib, fam-trastuzumab deruxtecan-nxki, gefitinib, gemtuzumab, ibritumomab tiuxetan, ibrutinib, imatinib, inotuzumab, ipilumumab, ivosidenib, lapatinib, larotrectinib, Lenvatinib, lorlatinib, margetuximab-cmkb, necitumumab, neratinib, nilotinib, niraparib, nivolumab, obinutuzumab, ofatumumab, olaparib, olaratumab, osimertinib, palbociclib, panitumumab, pazopanib, pembrolizumab, pertuzumab, ponatinib, ramucirumab, regorafenib, ribociclib, rituximab, rucaparib, sorafenib, sunitinib, talazoparib, tivozanib, tositumomab, trametinib, trastuzumab, tucatinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0300] In an aspect, a disclosed targeted therapy for oral administration can comprise abemaciclib, afatinib, alectinib, alpelisib, axitinib, binimetinib, bosutinib, brigatinib, cabozantinib, cobimetinib, crizotinib, dabrafenib, dacomitinib, dasatinib, duvelisib, encorafenib, entrectinib, erdafitinib, erlotinib, gefitinib, gilteritinib, ibrutinib, imatinib mesylate, ivosidenib, lapatinib, larotrectinib, lorlatinib, lenvatinb, neratinib, nilotinib, niraparib, olaparib, osimertinib palbociclib, pazopanib, ponatinib, regorafenib, ribociclib, rucaparib, sorafenib, sunitinib malate, talazoparib, tivozanib, trametinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0301] In an aspect, a disclosed targeted therapy for intravenous administration can comprise ado- trastuzumab emtansine, alemtuzumab, atezolizumab, avelumab, bevacizumab, blinatumomab, brentuximab vedotin, carfilzomib, cetuximab, cemiplimab-rwlc, certinib, copanlisib, daratumumab, dinutuximab, durvalumab, elotuzumab, fam-trastuzumab deruxtecan-nxki, gemtuzumab ozogamicin, ibritumomab tiuxetan, inotuzumab ozogamicin, ipilimumab, margetuximab-cmkb, necitumumab, nivolumab, obinutuzumab, olaratumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, rituximab, tositumomab and iodine I131 tositumomab, trastuzumab, ublituximab-xiiy, or any combination thereof. In an aspect, a disclosed targeted therapy for subcutaneous administration can comprise denosumab, ofatumumab, or any combination thereof.

[0302] In an aspect, a disclosed method of treating COVID-19 can comprise administering to the subject a therapeutically effective amount of a targeted immunotherapy agent (e.g., fam- trastuzumab-deruxtecan-nxki; trastuzumab; Herceptin Hylecta (injectable Herceptin); Herceptin biosimilars (e.g., Herzuma, Kanjinti, Ogivri, Ontruzant, and Trazimera); ado-trastuzumab emtansine; margetuximab-cmkb; pertuzumab, trastuzumab, and hyaluronidase-zzxf; pertuzumab; sacituzumab govitecan-hziy; or any combination thereof).

[0303] In an aspect, a disclosed method can be modified. In an aspect, one or more steps of a disclosed method can be modified. In an aspect, a disclosed method of treating COVID-19 can comprise modifying or changing one or more features or aspects of one or more steps. In an aspect, a method can be altered by changing the amount of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-viral agent, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof administered to a subject, or by changing the frequency of administration of a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- viral agent, a disclosed anti-cancer agent, a disclosed chemotherapeutic agents, or a combination thereof to a subject, by changing the duration of time that a disclosed nanoparticle, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-viral agent, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof is administered to a subject, or by substituting for one or more of the disclosed components and / or reagents with a similar or equivalent component and / or reagent. The same applies to all disclosed treatment regimens, disclosed nanoparticle, disclosed pharmaceutical formulations, disclosed plasmids, disclosed targeted therapies, disclosed pharmaceutical formulations, disclosed anti-viral agents disclosed anti- chemokines, disclosed anti-cancer agents, disclosed chemotherapeutic agents, or combinations thereof.

[0304] In an aspect, as it relates to a disclosed method, the COVID-19 associated protein can be TMPRSS2. In an aspect, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:17-SEQ ID NO:20. In an aspect, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:45. In an aspect, the COVID-19 associated protein can be TMPRSS2, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect, the COVID-19 associated protein can be TMPRSS2, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:17- SEQ ID NO:20, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, the COVID-19 associated protein can be TMPRSS2 and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:45, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0305] In an aspect, as it relates to a disclosed method, the COVID-19 associated protein can be Cathepsin L. In an aspect, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24. In an aspect, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:46. In an aspect, the COVID-19 associated protein can be Cathepsin L, and wherein the disclosed DR sequence (gRNA) can comprise the sequence set forth in SEQ ID NO:30. In an aspect, the COVID-19 associated protein can be Cathepsin L, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:21-SEQ ID NO:24, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, the COVID-19 associated protein can be Cathepsin L and the one or more pre-gRNAs can comprise the sequence set forth in SEQ ID NO:46, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31.

[0306] In an aspect, as it relates to a disclosed method, the COVID-19 associated protein can be Furin. In an aspect, the COVID-19 associated protein can be Furin and the one or more pre- gRNAs can comprise the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28. In an aspect, the COVID-19 associated protein can be Furin and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:47. In an aspect, the COVID-19 associated protein can be Furin and the one or more pre-gRNAs can comprise the sequence set forth in any one of SEQ ID NO:25-SEQ ID NO:28, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. In an aspect, the COVID-19 associated protein can be Furin and the one or more gRNAs can comprise the sequence set forth in SEQ ID NO:47, and wherein the disclosed DR sequence (pre-gRNA) can comprise the sequence set forth in SEQ ID NO:31. E. Uses

[0307] Disclosed herein is a use of a disclosed pharmaceutical formulation to treat a subject having cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules to treat a subject having cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed plasmids to treat a subject having cancer. Plasmids are discussed supra. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nanoparticles to treat a subject having cancer. Nanoparticles are discussed supra.

[0308] Disclosed herein is a use of a disclosed pharmaceutical formulation to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed plasmids to treat a subject having COVID-19. Plasmids are discussed supra. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nanoparticles to treat a subject having COVID-19. Nanoparticles are discussed supra.

[0309] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0310] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0311] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer.

[0312] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer.

[0313] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0314] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0315] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0316] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0317] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) to treat a subject having cancer.

[0318] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein to treat a subject having COVID-19.

[0319] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or moreguide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer.

[0320] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer.

[0321] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer.

[0322] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0323] Disclosed herein is a use of disclosed pharmaceutical formulation in the manufacture of a medicament to treat a subject having cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules in the manufacture of a medicament to treat a subject having cancer.

[0324] Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed plasmids in the manufacture of a medicament to treat a subject having cancer. Plasmids are discussed supra.

[0325] Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nanoparticles in the manufacture of a medicament to treat a subject having cancer. Nanoparticles are discussed supra.

[0326] Disclosed herein is a use of disclosed pharmaceutical formulation in the manufacture of a medicament to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules in the manufacture of a medicament to treat a subject having COVID-19.

[0327] Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed plasmids in the manufacture of a medicament to treat a subject having COVID-19. Plasmids are discussed supra. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nanoparticles in the manufacture of a medicament to treat a subject having COVID-19. Nanoparticles are discussed supra.

[0328] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0329] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0330] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0331] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0332] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0333] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre- guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0334] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0335] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0336] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0337] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx ora fragment or a variant thereof in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0338] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0339] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) in the manufacture of a medicament to treat a subject having cancer.

[0340] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein in the manufacture of a medicament to treat a subject having COVID-19.

[0341] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0342] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0343] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0344] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0345] Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19. Disclosed herein is a use of a pharmaceutical formulation comprising one or more nanoparticles comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19. Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0346] Disclosed herein is a use of a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19.

[0347] Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer. Disclosed herein is a use of a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and anucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer.

[0348] Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0349] Use of a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0350] Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d to treat a subject having cancer or COVID-19. Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx to treat a subject having cancer or COVID-19. Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof to treat a subject having cancer or COVID-19.

[0351] Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof to treat a subject having cancer or COVID-19. Disclosed herein is a use of a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) to treat a subject having cancer. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) targeting a COVID-19 associated protein to treat a subject having COVID-19.

[0352] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0353] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences to treat a subject having cancer. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences to treat a subject having COVID-19.

[0354] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences to treat a subject having COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticlecarrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID- 19.

[0355] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences to treat a subject having cancer. Disclosed herein is a use a nanoparticle (NP) for targeted delivery of an RNA-editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0356] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19. Disclosed herein is a use a nanoparticle (NP) for targeted delivery of an RNA- editing system comprising a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0357] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier; a disclosed nucleic acid sequence encoding a Cas13d; and a disclosed nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID- 19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0358] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a Cas13d or a fragment or a variant thereof in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use ananoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding a CasRx or a fragment or a variant thereof in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0359] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19. Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) in the manufacture of a medicament to treat a subject having cancer.

[0360] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein in the manufacture of a medicament to treat a subject having cancer.

[0361] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0362] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) targeting a COVID-19 associated protein and one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0363] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0364] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer or COVID-19.

[0365] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF),and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0366] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and is a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a prostate cancer (PC) associated transcription factor (TF), and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having cancer.

[0367] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a Cas13d, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0368] Disclosed herein is a use a nanoparticle (NP) comprising a nanoparticle carrier and a nucleic acid sequence encoding (i) a CasRx, (ii) one or more guide RNA (gRNA) or pre-guide RNA (pre-gRNA) sequences targeting a COVID-19 associated protein, and (iii) one or more direct repeat (DR) sequences in the manufacture of a medicament to treat a subject having COVID-19.

[0369] Disclosed herein is a use a disclosed pharmaceutical formulation to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor. Disclosed herein is a use a disclosed pharmaceutical formulation to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects.

[0370] Disclosed herein is a use a disclosed pharmaceutical formulation to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor.

[0371] Disclosed herein is a use a disclosed pharmaceutical formulation to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects.

[0372] Disclosed herein is a use a disclosed pharmaceutical formulation to reduce and / or decrease the risk of metastases. Disclosed herein is a use a disclosed pharmaceutical formulation in a RNA- based editing system. Disclosed herein is a use a disclosed pharmaceutical formulation in a RNA- based editing system comprising a bi-targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system.

[0373] Disclosed herein is a use a disclosed pharmaceutical formulation in a method of treating cancer can comprise protecting the subject from metastasis. Disclosed herein is a use a disclosed pharmaceutical formulation in a method of treating cancer can comprise reducing the risk ofdeveloping metastasis. Disclosed herein is a use a disclosed pharmaceutical formulation in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0374] Disclosed herein is a use a disclosed pharmaceutical formulation to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject's quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0375] Disclosed herein is a use a disclosed nanoparticle to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor.

[0376] Disclosed herein is a use a disclosed nanoparticle to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects. Disclosed herein is a use a disclosed nanoparticle to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor. Disclosed herein is a use a disclosed nanoparticle to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor and can mitigate and / or non-specific gene targeting or off-targeting effects.

[0377] Disclosed herein is a use a disclosed nanoparticle to reduce and / or decrease the risk of metastases.

[0378] Disclosed herein is a use a disclosed nanoparticle in a RNA-based editing system.

[0379] Disclosed herein is a use a disclosed nanoparticle in a RNA-based editing system comprising a bi-targeting strategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system.

[0380] Disclosed herein is a use a disclosed nanoparticle in a method of treating cancer can comprise protecting the subject from metastasis. Disclosed herein is a use a disclosed nanoparticle in a method of treating cancer can comprise reducing the risk of developing metastasis. Disclosed herein is a use a disclosed nanoparticle in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0381] Disclosed herein is a use a disclosed nanoparticle to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject's quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof. F. Kits

[0382] Disclosed herein is a kit comprising one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof.

[0383] In an aspect, a disclosed kit can comprise one or more additional active agents and / or therapeutic agents (such as, for example, a disclosed anti-cancer agent). In an aspect, the one or more agents can treat, prevent, inhibit, and / or ameliorate one or more comorbidities in a subject. In an aspect, one or more active agents can treat, inhibit, prevent, and / or ameliorate cellular and / or metabolic complications related to cancer or cancer cells or cancerous cells.

[0384] In an aspect, a disclosed kit can comprise one or more additional active agents and / or therapeutic agents (such as, for example, a disclosed anti-viral agent). In an aspect, the one or more agents can treat, prevent, inhibit, and / or ameliorate one or more comorbidities in a subject. In an aspect, one or more active agents can treat, inhibit, prevent, and / or ameliorate cellular and / or metabolic complications related to COVID-19.

[0385] In an aspect, a disclosed kit can comprise at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose (such as, for example, treating a subject diagnosed with or suspected of having a disease or disorder such as cancer). Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on a computer readable memory device or downloaded from an internet website, or as recordedpresentation. In an aspect, a kit for use in a disclosed method can comprise one or more containers holding one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof, and a label or package insert with instructions for use. In an aspect, suitable containers include, for example, bottles, vials, syringes, blister pack, etc. The containers can be formed from a variety of materials such as glass or plastic. The container can hold one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, ...

Claims

IX. CLAIMS What is claimed is:

1. A nanoparticle (NP), comprising: a nanoparticle carrier; a nucleic acid sequence encoding a Cas13d; and a nucleic acid sequence encoding one or more guide RNA (gRNA) or pre-guide RNA (pre- gRNA) sequences targeting MED31 or MYCN and one or more direct repeat (DR) sequences.

2. The NP of Claim 1, wherein the pre-gRNAs targeting MYCN comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:

08.

3. The NP of Claim 1, wherein the pre-gRNAs targeting MED31 comprise the sequence set forth in any one of SEQ ID NO:09-SEQ ID NO:

12.

4. The NP of any one of Claims 1-3, wherein the DR sequence comprises the sequence set forth in SEQ ID NO:

31.

5. The NP of any one of Claims 1-4, wherein the NP carrier comprises a polymer-lipid, a lipid, or gold.

6. The NP of any one of Claims 1-5, wherein the nanoparticle carrier comprises a core encapsulating the nucleic acid sequences, and a shell surrounding the core.

7. The NP of Claim 6, further comprising a nucleic acid aptamer (Apt) immobilized on the shell of the NP.

8. The NP of Claim 7, wherein the Apt targets castration-resistant prostate cancer (CRPC) cells.

9. The NP of Claim 8, wherein the Apt is a prostate-specific membrane antigen (PSMA) aptamer.

10. The NP of Claim 7, wherein the Apt targets neuroendocrine prostate cancer (NEPC) cells.

11. The NP of Claim 10, wherein the Apt is a neural cell adhesion molecule 1 (NCAM1) aptamer, a chromogranin A (CHGA) aptamer, a synaptophysin (SYP) aptamer, a synaptosome associated protein 25 (SNAP25) aptamer, or a carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) aptamer.

12. The NP of Claim 6, wherein the core comprises polylactic-co-glycolic acid (PLGA) and the shell comprises polyethyleneglycol (PEG).

13. The NP of any one of Claims 1-12, wherein the Cas13d is CasRx.

14. The NP of Claim 13, wherein CasRx comprises the sequence set forth in SEQ ID NO:54 or SEQ ID NO:

55.

15. The NP of any one of Claims 1-14, wherein the NP carrier is lung-selective, spleen-selective, or liver-selective.

16. A pharmaceutical formulation, comprising: the NP of any one of claims 1-15 and a pharmaceutically acceptable carrier or excipient.

17. A method of treating a subject, the method comprising: administering to a subject having prostate cancer a therapeutically effective amount of the pharmaceutical formulation of Claim 16.

18. The method of Claim 17, wherein the prostate cancer is a castration resistant prostate cancer (CRPC) or a neuroendocrine prostate cancer (NEPC).

19. A method of treating a subject, the method comprising: administering to a subject having prostate cancer that has metastasized to the lungs and / or the liver a therapeutically effective amount of the pharmaceutical formulation of Claim 16.

20. The method of Claim 17-19, further comprising administering to the subject one or more additional anti-cancer therapies.

21. The method of Claim 20, wherein the one or more anti-cancer therapies comprise endocrine therapy, radiotherapy, hormone therapy, gene therapy, thermal therapy, ultrasound therapy, or any combination thereof.

22. The method of any one of Claims 17-21, further comprising repeating the administering of the pharmaceutical formulation.

23. The method of any one of Claims 17-22, wherein, following the administering of the pharmaceutical formulation, (i) the risk of developing metastases is prevented and / or decreased; (ii) the survival of the subject is prolonged; (iii) the subject's quality of life is be enhanced and / or improved; (iv) the likelihood of surgical intervention is reduced and / or minimized; (v) the recurrence of the cancer is prevented and / or delayed; (vi) the size of one or more tumors in the subject is reduced and / or decreased; (vii) one or more tumors in the subject are eliminated; (viii) the disease-free or tumor-free survival time is increased and / or prolonged; (ix) the subject's overall survival time is increased and / or prolonged; (x) the frequency of treatment is minimized and / or reduced; (xi) one or more symptoms of the cancer are reduced and / or eliminated; (xii) the tumor burden is reduced and / or decreased; or (xiii) any combination thereof.

Images