AAV vector backbone optimization and use thereof

Abstract

Provided is a recombinant plasmid vector comprising a target gene expression cassette and a stuffer sequence, wherein the amount of plasmid residues in the product can be significantly reduced without affecting the expression of the target gene by inserting a stuffer sequence outside two ITR sequences to enlarge the size of the plasmid backbone. Also provided are a cell and a pharmaceutical composition comprising the recombinant plasmid vector.

Description

AAV VECTOR BACKBONE OPTIMIZATION AND USE THEREOFTECHNICAL FIELD

[0001] The present invention relates to the field of genetic engineering, and more specifically to a recombinant plasmid vector comprising a target gene expression cassette and a stuffer sequence, as well as cells and pharmaceutical compositions comprising the recombinant plasmid vector.BACKGROUND

[0002] The adeno-associated virus (AAV) is a member of the Parvoviridae family. It is an icosahedral virus which is not self-replicable, non-enveloped, and has a diameter of approximately 20-26 nm. Its genome is single-stranded DNA of about 4.7 kb length, encoding Rep and Cap proteins. The recombinant adeno-associated virus (recombinant AAV, rAAV) is an engineered AAV vector, in which all the gene sequences encoding Rep or Cap proteins in the AAV genome are removed while only inverted terminal repeats (i.e., ITRs) at both ends are remained as packaging signals. Since the AAV virus has diverse serotypes, can infect a variety of cell types, and has low immunogenicity, high safety, and a long expression period in vivo, it is widely applied in scientific researches and clinical practice.

[0003] Impurity residues in AAV products mainly include DNA residues, RNA residues, protein residues, etc. The amount of impurity residues outside the virus capsid can be effectively reduced through column purification, ultracentrifugation, nuclease digestion, etc.; however, the impurity residues packaged inside the virus capsid are difficult to be effectively removed during the purification process. The DNA impurity residues inside the virus capsid mainly originate from the incorrect packaging of the backbone sequence of the plasmid (Bernd Hauck et al., Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses, www. moleculartherapy. org, vol. 17 no. 1, 144-152, Jan. 2009) . Thus, mechanically reducing the residues of plasmid backbone sequences through the rational design on the vector is an effective and economical manner to reduce the amount of plasmid residues mispackaged in the viral product.

[0004] Studies have found that the length of the packaged AAV vector genome cannot exceed 5.2 kb, regardless of the size of the plasmid vector or the type of capsid protein (see Zhijian Wu et al., Effect of Genome Size on AAV Vector Packaging, www. moleculartherapy. org, vol. 18 no. 1, 80-86, Jan. 2010) .SUMMARY

[0005] To solve the above problems, the inventors have made modifications on the recombinant plasmid vector (AAV vector) comprising the target gene expression cassette. On one hand, the capacity of the genome comprising the target gene expression cassette is expanded, such that it is as close as possible to the upper packaging limit of 5.2 kb, and thus there is no extra space in the AAV capsid to accommodate impurity residues of the genome or plasmid DNA; on the other hand, the remainder plasmid backbone of the vector other than the above-mentioned genome is enlarged, such that it exceeds the upper packaging limit of 5.2 kb and cannot be packaged into the capsid as the AAV genome. In the present invention, the above-mentioned size expansion is achieved by inserting a stuffer sequence.

[0006] The inventors have found that enlarging the size of a plasmid vector by inserting a stuffer sequence into either a fragment of the plasmid vector comprising the genome comprising the target gene expression cassette (first fragment) or into the remainder of the plasmid vector (second fragment) other than the first fragment can reduce the amount of plasmid residues in the packaged virus product. Especially, compared with inserting into the first fragment, when the stuffer sequence is inserted into the second fragment as above, the amount of plasmid impurities is particularly significantly reduced, and unexpectedly the target protein expression level is significantly better (although the mRNA expression levels of the target gene are similar in both cases) .

[0007] Thus, the first aspect of the present invention relates to a recombinant plasmid vector comprising a target gene expression cassette and a stuffer sequence, wherein the target gene expression cassette is located between two inverted terminal repeat (ITR) sequences of an adeno-associated virus (AAV) , and the stuffer sequence is located outside the two ITR sequences, wherein the recombinant plasmid vector fragment comprising the target gene expression cassette between the two ITR sequences (including ITR sequences at both ends) is named as a first fragment, and the remainder of the recombinant plasmid vector comprising the stuffer sequence other than the first fragment is named as a second fragment, wherein the length of the second fragment is greater than or equal to 5.2 kb. In certain embodiments, due to the insertion of the stuffer sequence, the length of the second fragment is greater than or equal to 5.2 kb, 5.5 kb, 6.0 kb, 6.5 kb, 7.0 kb, 7.5 kb, 8.0 kb, 8.5 kb, 9.0 kb, 9.5 kb, 10.0 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 20 kb or more.

[0008] In certain embodiments, the length of the first fragment is less than or equal to 5.2 kb, and preferably greater than or equal to 3.0 kb, such as 1.0 kb, 1.5 kb, 2.0 kb, 2.5 kb, 3.0 kb, 3.5 kb, 4.0 kb, 4.5 kb, 5.0 kb, 5.2 kb or less.

[0009] In certain embodiments, the stuffer sequence is selected from introns, non-coding gene sequences, or housekeeping gene sequences, which are related or unrelated to the target gene, preferably selected from HPRT intron (SEQ ID NO: 1, 2, 21 or 22) , EF1a intron (SEQ ID NO: 3) , and CYP4V2 intron (SEQ ID NO: 4) , more preferably HPRT intron (SEQ ID NO: 1 or 2) ; and the length of the stuffer sequence is preferably greater than 3.0 kb, more preferably greater than 4.0 kb, further preferably greater than 6.0 kb, for example between 5.0 kb and 10.0 kb.

[0010] In certain embodiments, the target gene encodes a therapeutic protein, preferably CYP4V2 or Cas9.

[0011] In certain embodiments, the recombinant plasmid vector comprises an adeno-associated virus (AAV) vector.

[0012] In certain embodiments, the stuffer sequence is selected from HPRT intron (SEQ ID NO: 1 or 2) , and the protein encoded by the target gene is CYP4V2 (SEQ ID NO: 5) , preferably the nucleotide sequence of the target gene is as shown in SEQ ID NO: 6.

[0013] In certain embodiments, the target gene expression cassette comprises a promoter, an enhancer, a Kozak sequence, a regulatory element, and / or a polyadenylation signal site, which are suitable for expressing the target gene.

[0014] In certain embodiments, the recombinant plasmid vector further comprises a selectable marker and / or a replication origin in the second fragment, preferably the selectable marker is an antibiotic resistance gene, such as a kanamycin resistance gene.

[0015] In certain embodiments, the recombinant plasmid vector comprises a sequence selected from (5’→3’) :

[0016] ITR-F1-KanR-Ori-HPRT-ITR (SEQ ID NO: 7) ;

[0017] ITR-F1-KanR-Ori-HPRT 5.8K-ITR (SEQ ID NO: 8) ;

[0018] ITR-F1-KanR-Ori-HPRT-ITR (11bp repaired) (SEQ ID NO: 9) ; and

[0019] ITR-F1-KanR-Ori-HPRT 5.8K-ITR (11bp repaired) (SEQ ID NO: 10) .

[0020] In certain embodiments, when the promoter is CAG and the target gene is CYP4V2 encoding gene, the recombinant plasmid vector is pAV-CAG-CYP4V2-HPRT-ITRres (SEQ ID NO: 11) or pAV-CAG-CYP4V2-HPRT 5.8K-ITRres (SEQ ID NO: 12) .

[0021] In a second aspect, the present invention relates to a cell comprising the above-mentioned recombinant plasmid vector.

[0022] In certain embodiments, the cell provides AAV Rep and / or Cap proteins.

[0023] The present invention also relates to a viral particle produced by culturing the above-mentioned cell, wherein the AAV is selected from AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 5, AAV2 / 8,  AAV2 / 1, AAV2 / 9, AAV2 / 6, AAV2 / 4, AAV2 / 6, AAV5 / 2, AAV8 / 1, AAV8 / 2, AAV2 / 7, AAV2 / 12, and AAV2 / 10, preferred AAV2 and AAV8, more preferably AAV2 / 8.

[0024] The present invention also relates to a pharmaceutical composition comprising: a) the above-mentioned recombinant plasmid vector, the cell, or the viral particle; and b) a pharmaceutically acceptable adjuvant.

[0025] In certain embodiments, the adjuvant includes stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, preservatives, or any combination thereof.

[0026] By designing the backbone sequence of an AAV main plasmid, the main plasmid backbone is enlarged from 2.5 kb to 6.8 kb, and the amount of plasmid residues in the final AAV product can be as low as 4.7～8.9 pg / 109 vg. Under the same packaging and purification conditions, compared with the amount before plasmid backbone expansion, the amount of plasmid residues can be reduced by 6-40 times, which can effectively reduce the plasmid mispackaging in the AAV product. Moreover, it does not affect the product packaging yield or other key attributes, and can be widely extended to the plasmid packaging construction of other recombinant AAV products.

[0027] Other aspects and advantages of the present application can be readily appreciated by those skilled in the art from the detailed descriptions below. Only exemplary embodiments of the present application are shown and described in the detailed descriptions below. As will be recognized by one of skill in the art, the disclosure of the present application could enable those skilled in the art to make changes to the specific embodiments without departing from the spirit and scope of the invention disclosed in the present application. Accordingly, the accompanying drawings and the descriptions in the specification of the present application are only exemplary and not restrictive in any way.

[0028] DESCRIPTION OF THE DRAWINGS

[0029] The above-mentioned characteristics and advantages of the invention will become more apparent from the detailed descriptions below in conjunction with the accompanying drawings, wherein:

[0030] Fig. 1 shows a conceptual diagram of the AAV main plasmid modification;

[0031] Fig. 2 shows the front-side (first fragment) expansion of the AAV main plasmid;

[0032] Fig. 3 shows the backside (second fragment) expansion of the AAV main plasmid;

[0033] Fig. 4 shows a comparison of plasmid expressions before and after the vector modification, wherein CYP represents the original unmodified plasmid, HPRT represents the backside insertion of 4.1 kb HPRT intron sequence into the backbone, and 5.8 k represents the  backside insertion of 5.8 kb HPRT intron sequence into the backbone, inA represents the insertion of Ef1a intron-A (EF1a-intron A) sequence between CAG promoter and CYP4V2 CDS, and in2 represents the insertion of the second intron of CYP4V2 between original exon 2 and original exon 3 within CYP4V2 CDS region;

[0034] Fig. 5 shows the expression comparison of AAV8-HPRT and AAV8-inA viruses;

[0035] Fig. 6 shows a schematic diagram of the ITR repair modification for AAV main plasmid; and

[0036] Fig. 7 shows a comparison of the expression level after ITR repair of AAV main plasmid.DESCRIPTION OF EMBODIMENTS

[0037] Unless otherwise indicated, the terms used herein have ordinary technical meanings as understood by those skilled in the art. For definitions and terms in the art, the skilled artisan is specifically referred to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Plainsview, New York (1989) ; and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47) , John Wiley & Sons, New York (1999) .

[0038] As used herein, the term “AAV” is the standard abbreviation for adeno-associated virus. The adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells, some functions of which are provided by the co-infection of helper virus. General information and reviews on AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York) .

[0039] As used herein, the term “AAV vector” generally refers to a vector comprising one or more polynucleotides (or transgenes) of interest flanked by AAV inverted terminal repeats (ITRs) . Such AAV vectors can be replicated and packaged into infectious virus particles when present in host cells that have been transfected with vectors encoding and expressing the rep and cap gene products. The term “recombinant AAV virion” or “recombinant AAV virus particle” or “AAV vector particle” refers to a virus particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered into mammalian cells) , it is often referred to as an “AAV vector particle” or simply referred to as “AAV vector. ” Thus, the production of AAV vector particles necessarily includes the production of AAV vectors such that the vectors are contained within the AAV vector particles.

[0040] As used herein, the term “target gene” refers to a gene of interest intended to be expressed by a recombinant AAV (rAAV) . In the recombinant plasmid vector of the present invention, it  usually replaces all the gene sequences encoding Rep or Cap proteins in the wide-type AAV genome while only inverted terminal repeats (i.e., ITRs) at both ends are remained as packaging signals. In a preferred embodiment of the present invention, the target gene encodes a therapeutic protein, for example a functional protein for treating various genetic diseases, preferably CYP4V2 or Cas9.

[0041] As used herein, the term “stuffer sequence” refers to any nucleotide sequence that can be used to expand the backbone of the plasmid vector of the present invention, as long as it does not affect the expression of the target gene of the present invention. Preferably, the stuffer sequence of the present invention and the target gene expression cassette of the present invention are located in different fragments of the recombinant plasmid vector separated by ITR sequences, that is, the stuffer sequence of the present invention and the target gene expression cassette of the present invention do not coexist in the same fragment of the recombinant plasmid vector separated by ITR sequences. Obviously, the insertion position of the stuffer sequence should not affect the function of other functional elements in the plasmid vector (such as origin of replication, selectable marker, etc. ) . As used herein, the recombinant plasmid vector fragment comprising the target gene expression cassette between two ITR sequences (including ITR sequences at both ends) is named as a first fragment, and the remainder of the recombinant plasmid vector comprising the stuffer sequence other than the first fragment is named as a second fragment. The length of the stuffer sequence in the present invention is not particularly limited, as long as it makes the length of the second fragment greater than or equal to 5.2 kb. In an embodiment of the present invention, the length of the stuffer sequence is 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-2,500, 2,500-3,000, 3,000-3,500, 3,500-4,000, 4,000-4,500, 4,500-5,000, 5,500-6,000, 6,000-7,000, 7,000-8,000, 8,000-9,000, 9,000-10,000, 10,000-11,000, 11,000-12,000, 12,000-13,000, 13,000-14,000, 14,000-15,000, 15,000-16,000, 16,000-17,000, 17,000-18,000, 18,000-19,000, 19,000-20,000 bp or more. In a preferred embodiment of the present invention, the length of the stuffer sequence is greater than 3.0 kb, more preferably greater than 4.0 kb, further preferably greater than 6.0 kb, for example between 5.0 kb and 10.0 kb. The type of the stuffer sequence in the present invention is not particularly limited, as long as it does not affect the expression of the target gene of the present invention. In a preferred embodiment of the present invention, the stuffer sequence is selected from introns, non-coding gene sequences, or housekeeping gene sequences, which are related or unrelated to the target gene, and more preferably selected from HPRT intron (SEQ ID NO: 1, 2, 21 or 22) ,  EF1a intron (SEQ ID NO: 3) , and CYP4V2 intron (SEQ ID NO: 4) , further more preferably HPRT intron (SEQ ID NO: 1 or 2) .

[0042] As used herein, the term “front-side” in describing plasmid backbone, means the side or fragment between the two ITRs comprising the target gene region of the plasmid backbone; and the term “backside” in describing plasmid backbone, means the side or fragment between the two ITRs not comprising the target gene region of the plasmid backbone.

[0043] As used herein, the term “housekeeping gene” refers to a type of genes which are stably expressed in all cells and whose products are necessary to maintain the basic vital activities of cells, such as tubulin genes, glycolytic enzyme genes, ribosomal protein genes, etc. The housekeeping gene is a class of genes that always maintain a low level of methylation and are in an active transcription state all the time. In a preferred embodiment of the present invention, the housekeeping gene is selected from HPRT (hypoxanthine phosphoribosyltransferase) . The GC content of this gene is 41%. The number of CpG motifs is relatively low, and it will not cause a reduced expression of the target gene or cause the activation of immune cells, and has a good biological safety. In a preferred embodiment of the present invention, different fragments of HPRT may be selected as stuffer sequences, such as HPRT introns or fragments thereof with a length of from 0.5 to 20 kb, for example, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 kb. In a preferred embodiment of the present invention, the stuffer sequence is selected from a HPRT intron having a length of 4.1 kb or 5.8 kb, respectively (SEQ ID NO: 1 or 2) , or HPRT intron 1 (SEQ ID NO: 21) or HPRT intron 3 (SEQ ID NO: 22) .

[0044] As used herein, the term “intron” refers to a non-coding fragment of a gene or mRNA molecule. Since it is non-coding, the intron can be used herein as “inert” stuffer sequence to expand the backbone (size) of the recombinant plasmid vector. In a preferred embodiment of the present invention, the intron is selected from introns related or unrelated to the target gene. For example, when the target gene is a gene encoding CYP4V2, EF1a intron (SEQ ID NO: 3) or CYP4V2 intron (SEQ ID NO: 4) can be selected.

[0045] As used herein, the term “CYP4V2” generally refers to a protein that is member 2 of subfamily V of cytochrome P450 family 4. The term “cytochrome P450, ” also known as CYP450, usually refers to a family of ferroheme proteins, belonging to a class of monooxygenases, and involved in the metabolism of endogenous substances or exogenous substances comprising drugs and environmental compounds. According to the homology degree of amino acid sequence, the members are divided into three levels: family, subfamily, and individual enzymes. The cytochrome P450 enzyme system may be abbreviated as CYP, wherein the family is represented by Arabic number, the subfamily is represented by English capital letter,  and the individual enzyme is represented by Arabic number, such as CYP4V2 herein. The human CYP4V2 gene (HGNC: 23198) , located at 4q35, has a full length of 19.28 kb with 11 exons, and plays an important role in fatty acid metabolism (Kumar S., Bioinformation, 2011, 7: 360-365) . CYP4V2 is expressed almost in all tissues, but is expressed at a higher level in the retina and retinal pigment epithelium while at a slightly lower level in the cornea tissues. The mutations in the CYP4V2 gene may be associated with Bietti’s crystalline dystrophy and / or retinitis pigmentosa.

[0046] As used herein, the term “promoter” generally refers to a deoxyribonucleic acid (DNA) sequence that enables the transcription of a particular gene. The promoter can be recognized by RNA polymerase, and initiate the transcription and synthesis of RNA. During the synthesis of ribonucleic acid (RNA) , the promoter can interact with the transcription factor for regulating the gene transcription, to control the initiation time and expression degree of the gene expression (transcription) . The promoter comprises the core promoter region and the regulatory region, and is located in the regulatory sequence that controls the gene expression and upstream of the gene transcription initiation site (5’ direction of the DNA antisense strand) , and itself has no translation function.

[0047] As used herein, the term “polyadenylation (PolyA) signal site” generally refers to a base sequence located at 3’ end of messenger RNA (mRNA) that can be recognized by the polyadenylation-related cleavage factor. Usually, it is also a cis-regulatory signal on the mRNA. In general, the process of tailing (i.e., polyadenylation) begins after the termination of transcription, and tens to hundreds of single adenosines are added following 3’ UTR in mRNA by the polyadenylation-related cleavage factor under the regulation of the PolyA signal site. The common tailing signals include SV40, BGH, HSV, TK signals, and the like.

[0048] As used herein, the term “selectable marker” refers to a gene that, when expressed, can confer a selective phenotype to the transformed cell, such as antibiotic resistance (e.g., kanamycin resistance) .

[0049] As used herein, the term “antibiotic resistance gene” refers to a gene encoding the resistance protein that makes the host bacteria or cells resistant to the antibiotic (such as kanamycin, ampicillin, chloramphenicol, etc. ) .

[0050] Examples

[0051] Example 1. Vector construction

[0052] In order to reduce the mispackaged DNA residues in AAV products, we followed two technical concepts for plasmid modification: one is to expand the capacity of the target genome  between the ITRs in the main plasmid, such that its size is as close as possible to the upper packaging limit of 5.2 kb and thus there is no extra space in the AAV capsid to accommodate impurity residues of the genome or plasmid DNA; the other is to enlarge the backbone of the main plasmid such that it exceeds the upper packaging limit of 5.2 kb and could not be packaged into the capsid as the AAV genome.

[0053] Based on the recombinant plasmid vector pAV-CAG-CYP4V2 (see Chinese Patent Application No. 202010520246.7, “AAV vector expressing CYP4V2 and use thereof” ) , the modifications were carried out according to the above concepts. Referring to Fig. 1, to expand the target gene fragment in the plasmid, two processes were adopted. One was to insert EF1a intron-A (EF1a-intron A) sequence (SEQ ID NO: 3) between CAG promoter and CDS of CYP4V2 such that the ITRs on both sides and the target genome sequence in the middle as a whole were expanded from 3.3 kb to 4.2 kb (obtaining the construct ITR-CAG-intron A-CYP4V2-BGH-ITR, namely SEQ ID NO: 13) . The other was to insert the second intron of CYP4V2 (SEQ ID NO: 4) between original exon 2 and original exon 3 within CYP4V2 CDS region, such that the ITRs on both sides and the sequence in the middle as a whole were expanded from 3.3 kb to 4.7 kb (resulting in the construct ITR-CAG-CYP4V2-intron2-BGH-ITR, namely SEQ ID NO: 14) .

[0054] Referring to Fig. 2, for expanding the backbone part of the plasmid, the first intron part of the housekeeping gene HPRT (sequence NG_012329.2) with a length of about 13 kb was inserted. The protein encoded by HPRT gene was a transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate by transferring 5-ribose phosphate group from 5-ribosylphosphate 1-pyrophosphate. The transcription and translation levels of the housekeeping gene are relatively stable, the expression level is less affected by environmental factors, and the continuous expression changes little in almost all tissues at various growth stages of an individual. Thus, it is believed that even if there is a small amount of residues in the final product of AAV, the biological risk will be low and the safety will be relatively better. In addition, the first intron of HPRT is 13 kb long, and has a GC content of 41%, a small number of CpG motifs, and no complex structure. It is suitable for cloning and amplification. At the same time, its insertion into the vector would not result in the problems with plasmid recombination or reduced plasmid yield due to the increased complexity of the plasmid sequence. In conclusion, based on the above reasons, the amplified sequence of the first intron of HPRT was selected as the stuffer sequence for plasmid backbone expansion herein. Two fragments of HPRT (4.1 kb and 5.8 kb, respectively) were selected as stuffer sequences (SEQ ID NO: 1 and SEQ ID NO: 2, respectively) , and inserted into the backbone part  on the backside of the plasmid to generate constructs ITR-F1-KanR-Ori-HPRT-ITR (SEQ ID NO: 7) and ITR-F1-KanR-Ori-HPRT 5.8K-ITR (SEQ ID NO: 8) , thus obtaining two expanded plasmids pAV-CAG-CYP4V2-HPRT and pAV-CAG-CYP4V2-HPRT 5.8K (see Fig. 3) .

[0055] Example 2. Comparison of plasmid expressions before and after vector modification

[0056] Each of the modified plasmids in Example 1 and the original plasmid was transfected into 293T cells (ATCC, CRL-3216) , respectively. After 4 to 8 hours, the cells were harvested and lysed. The expression level of the target gene CYP4V2 was detected by Western Blotting (detection antibody: Anti-CYP4V2, Atlas, HPA029122; ACTB rabbit mAb, ABclonal, AC026) . Referring to Fig. 4, the results showed that after modification, regardless of the expansion of the backbone on the backside of the plasmid or the insertion of the intron into the target gene expression cassette, the cellular protein expression of CYP4V2 was not affected.

[0057] Example 3. Comparison of yield and impurity content of plasmid packaging AAV virus before and after vector modification

[0058] Each of the modified plasmids in Example 1 and the original plasmid was co-transfected into 293T cells (ATCC, CRL-3216) with RC8 plasmid (providing REP2 gene and CAP8 gene for AAV packaging; the plasmid was fully synthesized by General Biol (Anhui) ) and Helper plasmid (providing Ad5 adenovirus E2A gene, E4 gene, and VA RNA gene for AAV packaging; the plasmid was fully synthesized by General Biol (Anhui) ) , respectively. The packaging process followed that disclosed in Chinese Patent application No. 202010520246.7. TaqMan qPCR analysis was performed on the virus titer (primers were designed in the target gene CYP4V2 CDS region) and plasmid impurity content (primers were designed in the kana resistance region) in the purified AAV product. The analysis process can refer to [Cristina Martinez-Fernandez de la Camara et al., Accurate Quantification of AAV Vector Genomes by Quantitative PCR, Genes 2021, 12, 601. https:  / / doi. org / 10.3390 / genes12040601] .

[0059] CYP4V2 primers (viral titer quantification) (5’→3’) :

[0060] Forward Primer        ATTGTGAAGTGGCAGGTTACA (SEQ ID NO: 15)

[0061] Probe                 CATAGGGAATGATGACGGCTT (SEQ ID NO: 16)

[0062] Reverse Primer        GGGAAGTATCTCGGATCTCTG (SEQ ID NO: 17)

[0063] Kan R primers (plasmid residue quantification) (5’→3’) :

[0064] Forward Primer        GCTATCAGGACATAGCGTTGG (SEQ ID NO: 18)

[0065] Probe                 ACCCGTGATATTGCTGAAGAGCTTGG (SEQ ID NO: 19)

[0066] Reverse Primer        GATACCGTAAAGCACGAGGAAG (SEQ ID NO: 20)

[0067] The results were shown in the table below. The data showed that compared with AAV8-CYP4V2 virus (packaged by the original plasmid pAV-CAG-CYP4V2) , both AAV8-HPRT virus (4.1 kb HPRT intron sequence inserted into the backside of the backbone of pAV-CAG-CYP4V2 plasmid) and AAV8-5.8K virus (5.8 kb HPRT intron sequence inserted into the backside of the backbone of pAV-CAG-CYP4V2 plasmid) could significantly reduce the mispackaged plasmid residues in AAV products, and AAV8-inA virus (EF1a intron-Asequence inserted between CAG promoter and CYP4V2 CDS of pAV-CAG-CYP4V2 plasmid) exhibited a small improvement, while AAV8-in2 virus (the second intron of CYP4V2 inserted between original exon 2 and original exon 3 within CYP4V2 CDS region of pAV-CAG-CYP4V2 plasmid) had an increased plasmid residue.

[0068] Table 1: Comparison of yield and impurity content of plasmid-packaged AAV viruses before and after vector modification

[0069] Example 4. Expression comparison of AAV8-HPRT and AAV8-inA viruses

[0070] As shown in Example 3, after modification, the contents of mispackaged impurities in AAV8-HPRT, AAV8-5.8K, and AAV8-inA virus products were all decreased. The infectivity and expression levels of the three viruses were compared. 293T cells were treated via 10 μg / mL mitomycin C (CST, 51854S) for 2 h, and infected with AAV8-HPRT, AAV8-5.8K, and AAV8-inA viruses at MOI=3e5, respectively. After 72 h, the cells were lysed. The expression level of the target gene CYP4V2 was detected by Western Blotting (Anti-CYP4V2, Atlas, HPA029122; ACTB rabbit mAb, ABclonal, AC026) . Referring to Fig. 5, the results showed that after the infection of 293T cells with AAV8-HPRT, AAV8-5.8K, and AAV8-inA, respectively, the mRNA expression levels were consistent, but unexpectedly the protein expression level of the target gene of AAV8-inA was significantly lower than AAV8-HPRT and AAV8-5.8K.

[0071] Example 5. AAV main plasmid ITR sequence repair

[0072] In the original AAV packaging plasmid, the ITR on one side had a complete sequence, and the ITR on the other side lacked the C loop 11bp sequence (the missing part was shown in the dotted box in Fig. 6) . The missing 11 bp was repaired.

[0073] The original AAV packaging plasmid pAV-CAG-CYP4V2 and the pAV-CAG-CYP4V2-HPRT plasmid were repaired for ITRs at both ends, obtaining the repaired plasmids pAV-CAG-CYP4V2-ITRres and pAV-CAG-CYP4V2-HPRT-ITRres (SEQ ID NO: 11) , respectively ( “itrres” or “ITRres” herein means the missing ITR sequence is repaired) . Above plasmids were used for virus packaging to obtain viruses AAV8-CYP4V2, AAV8-HPRT, AAV8-CYP4V2-ITRres, and AAV8-HPRT-ITRres (ZVS101e) , respectively. Virus packaging yield and virus infection activity for each virus were compared.

[0074] Table 2. Comparison of yield and impurity content of plasmid-packaging AAV viruses before and after ITR modification

[0075] The above four viruses were used to infect 293T cells, respectively, and the infection process was the same as that in Example 4. Referring to Fig. 7, the results showed that after the infection of 293T cells with the four viruses, there was no significant difference in terms of the mRNA expression level and protein expression level of the target gene.

[0076] Example 6. Impurity residues in virus packaging using pAV-HPRT-ITR main plasmid backbone for other target genes

[0077] The modified pAV-HPRT-ITR main plasmid backbone (4.1 kb HPRT intron inserted; considering that there was no significant difference in terms of the expression level, packaging yield, and impurity residues for AAV8-HPRT and AAV8-5.8K, pAV-HPRT-ITRres sequence was subsequently used as backbone sequence) (SEQ ID NO: 9, which differed from pAV-CAG-CYP4V2-HPRT in that it did not comprise CAG promoter and CYP4V2 element and ITR was repaired as in Example 5) was used for ZVS101e and ZVS203e main plasmid construction. In the ZVS101e plasmid, CAG promoter and CYP4V2 coding region were inserted into the target gene region between the ITRs at both ends on the front-side of pAV-HPRT-ITR main plasmid backbone, and the genome length was 3.3 kb, that is, pAV-CAG-CYP4V2-HPRT-ITRres (SEQ  ID NO: 11) was obtained. In ZVS203e, CAG promoter and Cas9 coding region (the sequence referring to CN113038972B) were inserted into the target gene region between the ITRs on the front-side of pAV-HPRT-ITR main plasmid backbone, and the genome length was 4.6 kb. The procedures for analyzing the virus packaging and impurity residues were the same as those in Example 3.

[0078] The results in Table 3 showed that the pAV-HPRT-ITR main plasmid backbone was not only suitable for CYP4V2, but also for Cas9. Thus, the empty vector of the present invention (i.e., the vector without target gene) could be extended to the packaging of other target genes, and could significantly reduce the plasmid impurity residues in the virus packaging.

[0079] Table 3. Comparison of yield and impurity content of plasmid-packaging AAV viruses before and after ZVS101e vector modification

[0080] (Note: ZVS101e was the same as in “AAV8-HPRT-ITRres” as above, meaning that the modified vector (pAV-CAG-CYP4V2-HPRT-ITRres) was used for virus packaging, and the virus was produced by the same non-GMP production process as AAV8-CYP4V2 before modification. The difference between “ZVS101e-LOT1 (GMP) , ZVS101e-LOT2 (GMP) and ZVS101e-LOT3 (GMP) ” and ZVS101e lied in the use of GMP production process in the former. The same applied to AAV8-cas9 and “ZVS203e-LOT1 (GMP) , ZVS203e-LOT2 (GMP) ” ) .

[0081] Those skilled in the art should understand that, although the invention is described in details with reference to the above examples, the invention is not limited to these specific Examples. Based on the methods and technical solutions taught by the invention, one skilled artisan can make appropriate modifications or improvements without departing from the spirit of  the invention, and the equivalent embodiments thus obtained are all within the scope of the invention.

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

Claims

1.A recombinant plasmid vector comprising a target gene expression cassette and a stuffer sequence, wherein the target gene expression cassette is located between two inverted terminal repeat (ITR) sequences of an adeno-associated virus (AAV) , and the stuffer sequence is located outside the two ITR sequences, wherein the recombinant plasmid vector fragment comprising the target gene expression cassette between the two ITR sequences (including ITR sequences at both ends) is named as a first fragment, and the remainder of the recombinant plasmid vector comprising the stuffer sequence other than the first fragment is named as a second fragment, wherein the length of the second fragment is greater than or equal to 5.2 kb.2.The recombinant plasmid vector according to claim 1, wherein the length of the first fragment is less than or equal to 5.2 kb and preferably greater than or equal to 3.0 kb.3.The recombinant plasmid vector according to claim 1 or 2, wherein the length of the stuffer sequence is greater than 3.0 kb, more preferably greater than 4.0 kb, further preferably greater than 6.0 kb, for example between 5.0 kb and 10.0 kb; and the stuffer sequence is selected from introns, non-coding gene sequences, or housekeeping gene sequences, which are related or unrelated to the target gene, more preferably selected from HPRT intron (SEQ ID NO: 1, 2, 21 or 22) , EF1a intron (SEQ ID NO: 3) , and CYP4V2 intron (SEQ ID NO: 4) , further more preferably HPRT intron (SEQ ID NO: 1 or 2) .4.The recombinant plasmid vector according to any of claims 1 to 3, wherein the target gene encodes a therapeutic protein, preferably CYP4V2 or Cas9.5.The recombinant plasmid vector according to any of claims 1 to 4, wherein the recombinant plasmid vector comprises an adeno-associated virus (AAV) vector.6.The recombinant plasmid vector according to claim 5, wherein the stuffer sequence is selected from HPRT intron (SEQ ID NO: 1 or 2) , and the protein encoded by the target gene is CYP4V2 (SEQ ID NO: 5) , preferably the nucleotide sequence of the target gene is as shown in SEQ ID NO: 6.7.The recombinant plasmid vector according to any of claims 1 to 6, wherein the target gene expression cassette comprises a promoter, an enhancer, a Kozak sequence, a regulatory element, and / or a polyadenylation (PolyA) signal site for expressing the target gene.8.The recombinant plasmid vector according to any of claims 1 to 7, wherein the recombinant plasmid vector further comprises a selectable marker and / or a replication origin in the second fragment, preferably the selectable marker is an antibiotic resistance gene, such as a kanamycin resistance gene.9.The recombinant plasmid vector according to any of claims 1 to 8, comprising a sequence selected from (5’→3’) :ITR-F1-KanR-Ori-HPRT-ITR (SEQ ID NO: 7) ;ITR-F1-KanR-Ori-HPRT 5.8K-ITR (SEQ ID NO: 8) ;ITR-F1-KanR-Ori-HPRT-ITR (11bp repaired) (SEQ ID NO: 9) ; andITR-F1-KanR-Ori-HPRT 5.8K-ITR (11bp repaired) (SEQ ID NO: 10) .10.The recombinant plasmid vector according to any of claims 1 to 9, which is pAV-CAG-CYP4V2-HPRT-ITRres (ITR 11bp repaired) (SEQ ID NO: 11) or pAV-CAG-CYP4V2-HPRT 5.8K-ITRres (ITR 11bp repaired) (SEQ ID NO: 12) .11.A cell comprising the recombinant plasmid vector according to any of claims 1 to 10.12.The cell according to claim 11, wherein the cell provides AAV Rep and / or Cap proteins.13.A viral particle produced by culturing the cell according to claim 11 or 12, wherein the AAV is selected from AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 9, AAV2 / 6, AAV2 / 4, AAV2 / 6, AAV5 / 2, AAV8 / 1, AAV8 / 2, AAV2 / 7, AAV2 / 12, and AAV2 / 10, preferred AAV2 and AAV8, more preferably AAV2 / 8.14.A pharmaceutical composition comprising: a) the recombinant plasmid vector according to any of claims 1 to 10, the cell according to claim 11 or 12, or the viral particle according to claim 13; and b) a pharmaceutically acceptable adjuvant.15.The pharmaceutical composition according to claim 14, wherein the adjuvant comprises stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, preservatives, or any combination thereof.

Images