Anti-meiob monoclonal antibody, mutation detection primer set, ASO molecule, small molecule drug against meiob proteins, and use thereof

Abstract

Provided are an anti-MEIOB monoclonal antibody, a mutation detection primer set, an ASO molecule, a small molecule drug against MEIOB proteins, and the use thereof. The monoclonal antibody can specifically recognize MEIOB proteins, and has good specificity and a high titer. Compared with a polyclonal antibody, the monoclonal antibody has higher recognition specificity. The mutation detection primer set can detect the discovered hMEIOB gene mutation sites and potential mutation sites in the hMEIOB gene. The ASO molecule can target and bind to the transcription product of the hMEIOB gene so as to inhibit the expression thereof. The full thio-modification of the molecule improves the stability and half-life of the molecule, and the molecule itself is non-toxic and degradable. The small molecule targeting MEIOB proteins can be used for blocking MEIOB functions and spermiogenesis so as to achieve a contraceptive effect, and can be used for reducing the expression level of MEIOB proteins and cell proliferation capacity in tumor cells so as to realize tumor-targeted therapy.

Description

Anti-MEIOB monoclonal antibodies, mutation detection primer sets, ASO molecules, and small molecule drugs targeting MEIOB protein and their applications Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an anti-MEIOB monoclonal antibody, a mutation detection primer set, an ASO molecule, and a small molecule drug targeting the MEIOB protein and applications thereof. Background Art

[0002] Genetic factors (gene mutations) account for a large proportion of gamete (sperm or egg) development disorders. By exploring the genetic mechanism, it was found that the precise completion of meiosis is crucial for the stable transmission of genetic information. During the homologous chromosome synapsis stage, a large number of meiosis-specific genes should be expressed in time and space and perform specific functions. As one of the many genes, as early as 2013, through the meiotic proteomics study of the model animal C57 / 6J mouse, the inventor (Luo Mengcheng) was the first to discover a single-stranded DNA binding protein MEIOB (meiosis specific with OB domain) involved in the synapsis of homologous chromosomes in the early stage of meiosis I. By studying its function, it was found that abnormal mouse MEIOB can cause male sperm development to arrest at the early stage of meiosis I and early apoptosis of female follicles; with the progress of research on human meiosis-related proteins, it was discovered in 2014 that MEIOB was nominated as a new cancer antigen due to its high expression characteristics in cancer and may be used as a target for immunotherapy; in 2016, transcriptome analysis of testicular tissues of 19 testicular cancer patients confirmed that MEIOB belongs to extremely highly expressed testicular cancer-related genes (extremely highly expressed CT genes, EECTGs); in 2017, whole-genome sequencing of members of the same family with azoospermia was performed, and MEIOB mutants were discovered for the first time as genetic pathogenic factors; in 2019, some scholars found that familial primary ovarian insufficiency was associated with human MEIOB abnormalities; in 2020, NGS (next-generation sequencing) was performed on a cohort of 25 people with idiopathic oligospermia or non-obstructive azoospermia. Sequencing analysis revealed that most individuals harbor abnormalities in the hMEIOB gene sequence. In the same year, another study, using exome sequencing of meiosis-related genes in a cohort of 147 individuals with spermatogenesis arrest, revealed that some individuals carry pathogenic variants of the hMEIOB gene. Currently, multiple hMEIOB mutations have been identified, but the uncertainty surrounding these mutations is high, and new mutation patterns will emerge in the future. Furthermore, the role of MEIOB in spermatogenesis remains unclear, and corresponding research strategies are being gradually implemented.

[0003] In summary, detecting the MEIOB gene sequence and protein expression in infertile patients has important practical significance for clarifying the cause of idiopathic infertility and targeted treatment. There is an urgent need to develop a monoclonal antibody against the MEIOB protein with good potency and high specificity. By targeting and inhibiting the MEIOB gene expression or protein function, the spermatogenesis process can be blocked to achieve a contraceptive effect.

[0004] Summary of the Invention

[0005] In order to solve the technical problems, the present invention provides an anti-MEIOB monoclonal antibody, a mutation detection primer set, an ASO molecule, and a small molecule drug targeting the MEIOB protein and their applications. The monoclonal antibody can specifically recognize the MEIOB protein, has good antibody specificity and high titer, and has stronger recognition specificity than a polyclonal antibody; the mutation detection primer set can detect discovered hMEIOB gene mutation sites and potential mutation sites in the hMEIOB gene; an antisense oligonucleotide molecule (ASO molecule) targeting the mRNA of the MEIOB gene transcription product can target and bind to the hMEIOB gene transcription product to inhibit its expression, and its full thiolation modification improves the stability and half-life of the molecule, and the molecule itself is non-toxic and degradable; the small molecule targeting the MEIOB protein can be used to block MEIOB function and spermatogenesis to achieve a contraceptive effect, and can also be used to reduce the expression level of the MEIOB protein and the cell proliferation ability in tumor cells to achieve targeted therapy.

[0006] The present invention provides an anti-MEIOB monoclonal antibody, which can recognize human MEIOB protein and comprises a complete heavy chain and a complete light chain:

[0007] The amino acid sequence of the light chain is shown in SEQ ID NO: 1; the amino acid sequence of the heavy chain is shown in SEQ ID NO: 2.

[0008] Furthermore, the monoclonal antibody further comprises:

[0009] An antibody with the same function obtained by replacing, deleting and / or adding one or more amino acids in the amino acid sequence of the monoclonal antibody;

[0010] or comprising a heavy chain variable region having an amino acid sequence that is at least 80% homologous to the heavy chain variable region; and a light chain variable region having an amino acid sequence that is at least 80% homologous to the light chain variable region;

[0011] Or an antibody obtained by connecting a tag to the N-terminus and / or C-terminus of the monoclonal antibody.

[0012] Furthermore, V H and / or V LThe amino acid sequence may be 85%, 90%, 95%, 96%, 97%, 98% or 99% homologous to the above sequence. H and V L V H and V L Antibodies to these regions can be mutagenized and the encoded altered antibodies tested for retained function using the functional assays described herein.

[0013] The monoclonal antibodies include human antibodies, humanized antibodies or chimeric antibodies.

[0014] Furthermore, the variable region gene can be converted into an scFv gene. Once the V H and V L The fragmented DNA fragments can be further manipulated by standard recombinant DNA technology, for example, the variable region gene is converted into a full-length antibody chain gene, a Fab fragment gene or a scFv gene.

[0015] In these operations, the encoding V L or V H The DNA fragment of the present invention is operably linked to another DNA fragment encoding another protein such as an antibody constant region or a flexible linker. As used herein, the term "operably linked" means that the two DNA fragments are linked together so that the amino acid sequences encoded by the two DNA fragments remain in the reading frame.

[0016] Furthermore, the present invention provides a nucleic acid molecule encoding the monoclonal antibody, wherein the nucleic acid molecule comprises a nucleic acid molecule encoding the heavy chain variable region and a nucleic acid molecule encoding the light chain variable region.

[0017] Furthermore, the present invention provides an expression vector comprising the nucleic acid, wherein the expression vector is capable of expressing the nucleic acid in a prokaryotic or eukaryotic host cell.

[0018] The vector may be a conventional vector; specifically, a plasmid vector, a phage vector, or a viral vector;

[0019] Furthermore, the present invention provides an engineered bacterium or eukaryotic host cell comprising the expression vector.

[0020] Furthermore, the present invention provides use of the monoclonal antibody against the MEIOB protein in preparing a MEIOB protein reagent or kit.

[0021] Furthermore, the present invention provides the use of the monoclonal antibody against the MEIOB protein in preparing a quality control antibody for a MEIOB protein colloidal gold detection kit.

[0022] Furthermore, the present invention provides a colloidal gold rapid detection test strip for MEIOB protein, comprising:

[0023] bottom plate,

[0024] The sample absorption pad, the conjugate pad, the chromatography matrix and the water absorption pad are adhered to the surface of the bottom plate and overlapped in sequence; wherein,

[0025] The surface of the conjugate pad is coated with a colloidal gold complex coated with a monoclonal antibody to the MEIOB protein; a quality control line C is provided on the side of the chromatography matrix close to the conjugate pad, and a detection line T is provided on the side of the chromatography matrix close to the absorbent pad; the quality control line C is coated with an anti-mouse IgG secondary antibody; and the detection line T is coated with a monoclonal antibody to the MEIOB protein.

[0026] Furthermore, the present invention provides the use of the monoclonal antibody against the MEIOB protein in identifying point mutants formed by MEIOB gene mutation.

[0027] Furthermore, the present invention provides the use of the monoclonal antibody against the MEIOB protein in detecting truncations formed by MEIOB gene mutations. Specifically, the monoclonal antibody against the MEIOB protein is used to prepare recognition antibodies for a MEIOB truncated protein detection kit.

[0028] Furthermore, the present invention provides the use of the monoclonal antibody against the MEIOB protein in purifying the MEIOB protein in tissues and cells, and specifically, the use of the monoclonal antibody against the MEIOB protein in preparing affinity antibodies for a MEIOB protein purification kit.

[0029] Furthermore, the present invention provides the use of the monoclonal antibody against MEIOB protein in the enrichment pretreatment of MEIOB protein in samples before mass spectrometry detection, specifically, the use of the monoclonal antibody against MEIOB protein in the preparation of affinity antibodies for a MEIOB protein spectrum detection kit.

[0030] Furthermore, the present invention provides the use of the monoclonal antibody against the MEIOB protein in the enrichment of nucleic acids in the early stage of high-throughput gene sequencing. Specifically, the monoclonal antibody against the MEIOB protein is used to prepare affinity antibodies for a high-throughput gene sequencing detection kit targeting the MEIOB protein.

[0031] Furthermore, the present invention provides a primer set for detecting MEIOB gene mutations, which can detect the discovered hMEIOB (human MEIOB gene) gene mutation sites and potential mutation sites in the hMEIOB gene, including the following primer pairs:

[0032] The nucleotide sequences of the primer set for exon 1 are shown in SEQ ID NO. 3 and SEQ ID NO. 4;

[0033] The nucleotide sequences of the primer set for exon 2 are shown in SEQ ID NO. 5 and SEQ ID NO. 6;

[0034] The nucleotide sequences of the primer set targeting exon 3 are shown in SEQ ID NO. 7 and SEQ ID NO. 8;

[0035] The nucleotide sequences of the primer set for exon 4 are shown in SEQ ID NO. 9 and SEQ ID NO. 10;

[0036] The nucleotide sequences of the primer set targeting exon 5 are shown in SEQ ID NO. 11 and SEQ ID NO. 12;

[0037] The nucleotide sequences of the primer set targeting exon 6 are shown in SEQ ID NO. 13 and SEQ ID NO. 14;

[0038] The nucleotide sequences of the primer set for exon 7 are shown in SEQ ID NO. 15 and SEQ ID NO. 16;

[0039] The nucleotide sequences of the primer sets targeting exons 8 and 9 are shown in SEQ ID NO. 17 and SEQ ID NO. 18;

[0040] The nucleotide sequences of the primer set targeting exon 10 are shown in SEQ ID NO. 19 and SEQ ID NO. 20;

[0041] The nucleotide sequences of the primer set targeting exon 11 are shown in SEQ ID NO. 21 and SEQ ID NO. 22;

[0042] The nucleotide sequences of the primer set targeting exon 12 are shown in SEQ ID NO. 23 and SEQ ID NO. 24;

[0043] The nucleotide sequences of the primer set for exon 13 are shown in SEQ ID NO. 25 and SEQ ID NO. 26.

[0044] Preferably, the primer set can cover the entire exons of the human MEIOB gene and the introns at the ends of the exons.

[0045] The primer set can be used in a PCR reaction to amplify different exon sequences of hMEIOB, and the different sequences can cover the entire exon of the hMEIOB gene and the intron at the end of each exon.

[0046] Furthermore, the present invention provides a kit for detecting human MEIOB gene mutations containing the primer set.

[0047] Specifically, a kit for detecting non-obstructive azoospermia or premature ovarian insufficiency containing the primer set is provided.

[0048] Furthermore, the present invention provides an antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product, which is a single-stranded DNA with a nucleotide sequence of ATTTATCGTGCAGCCCAAAGT, a sequence length of 21 bp, 3 locked nucleic acids at each end, and a fully phosphorothioated modification.

[0049] The antisense oligonucleotide molecules recognize mRNA through base complementarity and inhibit the expression of MEIOB protein.

[0050] Furthermore, the present invention provides an application of the antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product, which is used to reduce the mRNA content of the MEIOB gene in cells by co-incubating the antisense oligonucleotide molecule with the culture medium, or to reduce the mRNA content of the MEIOB gene in the testis by injecting the antisense oligonucleotide molecule into the testicle.

[0051] Specifically, a use of the antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product is provided, and the mRNA content of the hMEIOB gene in cells is reduced by co-incubating the antisense oligonucleotide molecule with culture medium.

[0052] Alternatively, another application of the antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product is provided, and the mRNA content of the mMEIOB gene (mouse MEIOB gene) in the mouse testis is reduced by testicular injection of the antisense oligonucleotide molecule. The administration method is local injection into the scrotum, the dosage is 0.33 nmol / g, and the observation time is 72 hours.

[0053] Specifically, it is used to prepare a product for inhibiting the expression of the MEIOB gene transcription product mRNA or inhibiting the expression of the MEIOB protein.

[0054] Furthermore, the present invention provides a small molecule targeting MEIOB protein and its analogs, at least one of which has a molecular structure as shown below:

[0055] The small molecule targeting the MEIOB protein can inhibit the binding of MEIOB to SPATA22 by binding to the MEIOB protein.

[0056] The binding of the small molecules targeting the MEIOB protein and the analogs thereof to the MEIOB protein is reversible and can be rapidly dissociated from the surface of the MEIOB protein as the concentration decreases.

[0057] Furthermore, the present invention provides an application of the small molecule and its analogs targeting MEIOB protein, which can be taken orally or injected subcutaneously into the scrotum to inhibit sperm production in the testicles.

[0058] Furthermore, the present invention provides an application of the small molecule targeting MEIOB protein and its analogs for preparing a product that inhibits the binding of MEIOB to SPATA22 in cells or inhibits the production of sperm in the testis.

[0059] Furthermore, the present invention provides an application of the small molecule targeting MEIOB protein and its analogs for preparing contraceptive drugs.

[0060] Furthermore, the present invention provides an application of the small molecule targeting MEIOB protein and its analogs for preparing drugs against tumors with high MEIOB expression.

[0061] The present invention has the following advantages and beneficial effects:

[0062] The anti-MEIOB monoclonal antibody of the present invention can specifically recognize the MEIOB protein, and has good antibody specificity and high titer.

[0063] The anti-MEIOB monoclonal antibody provided by the present invention has good recognition specificity for both in vitro purified human MEIOB protein and exogenously expressed MEIOB protein in cells; compared with polyclonal antibodies, the monoclonal antibody has stronger recognition specificity.

[0064] The anti-MEIOB monoclonal antibody of the present invention can specifically recognize the complete MEIOB protein, point mutant protein, and truncated protein, and based on this, enrich the MEIOB protein or the gene nucleic acid sequence bound by MEIOB, and then be used for protein enrichment mass spectrometry detection, genome sequencing, protein function analysis after purification, and crystal structure analysis. The antibody has good specificity and high titer.

[0065] The primer set provided by the present invention can amplify intron sequences containing 100bp bases on both sides of the exon, so it can be used to detect the production of abnormal spliceosomes caused by intron mutations at the ends of exons. In addition to identifying all existing mutation types, it can also be used to detect new unknown mutations.

[0066] The (antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product) ASO molecule provided by the present invention can target and bind to the transcription product of the MEIOB gene to inhibit its expression. Its full thiolation modification improves the stability and half-life of the molecule, and the molecule itself is non-toxic and degradable.

[0067] The MEIOB protein-targeting small molecule provided by the present invention has the ability to inhibit the binding of MEIOB to SPATA22, can prevent sperm production, and achieve a contraceptive effect.

[0068] The MEIOB protein-targeting small molecule provided by the present invention has the ability to inhibit the function of MEIOB in tumor cells, can inhibit the growth of tumor cells with high MEIOB expression, and achieve the purpose of tumor targeted therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0070] FIG1 is a diagram showing the purification of human MEIOB protein used to immunize mice in Example 1;

[0071] Figure 2 shows the results of SDS-PAGE analysis of the purified monoclonal antibody against human MEIOB protein; the amount of antibody loaded increases from left to right;

[0072] Figure 3 shows an ELISA assay for detecting the titer of anti-human MEIOB protein monoclonal antibodies; the horizontal axis represents the antibody dilution ratio, and the vertical axis represents the A450 absorbance;

[0073] Figure 4 shows a Western Blot experiment identifying the specific recognition between the purified anti-human MEIOB protein monoclonal antibody and the MEIOB protein. The sample is a purified His-tagged MEIOB fusion protein. The left figure shows the recognition of the sample by the Anti-human-MEIOB antibody, and the right figure shows the recognition of the sample by the Anti-His tag antibody.

[0074] Figure 5 shows a Western Blot experiment identifying the specific recognition between anti-human MEIOB protein polyclonal antibodies and monoclonal antibodies and MEIOB protein, respectively. The sample is a purified His-tagged MEIOB fusion protein. The left figure shows the recognition of the sample by the anti-human MEIOB protein polyclonal antibody, and the right figure shows the recognition of the sample by the anti-human MEIOB protein monoclonal antibody, respectively.

[0075] Figure 6 shows a human U2OS cell line expressing mCherry fused to human MEIOB overexpression. The left figure shows the purchased Anti-mCherry antibody, and the right figure shows the detection results of Anti-MEIOB polyclonal and monoclonal antibodies.

[0076] FIG7 is the antibody coding sequence identification result;

[0077] FIG8 is a schematic diagram showing the expression and degradation levels of point mutants and truncations of the MEIOB protein detected by antibodies;

[0078] FIG9 is a schematic diagram showing antibody binding to MEIOB protein to promote its dispersion suitable for structural analysis;

[0079] Figure 10 is a schematic diagram showing the application value of antibodies in proteomics and genomics by binding to MEIOB;

[0080] FIG11 is the result of RT-QPCR assay to identify that ASO reduces the level of hMEIOB gene mRNA in cells;

[0081] FIG12 is the result of RT-QPCR assay to identify that ASO reduces the mMEIOB gene mRNA level in mouse testis;

[0082] FIG13 is a live cell fluorescence imaging result showing that small molecules targeting hMEIOB affect the binding between MEIOB and SPATA22;

[0083] FIG14 is the result of HE staining of testicular tissue showing that small molecules targeting mMEIOB affect spermatogenesis in seminiferous tubules.

[0084] Figure 15 shows the sperm count results of the cauda epididymis;

[0085] FIG16 shows the results of Western Blot detection of MEIOB protein levels in HELA, SiHA, C33A, A2780, MD231, and THP-1 cell lines;

[0086] FIG17 is the result of Western Blot identification of small molecules targeting hMEIOB to reduce MEIOB protein levels in C33A cells;

[0087] FIG18 is the grayscale value result of Western Blot identification of small molecules targeting hMEIOB to reduce the level of MEIOB protein in C33A cells;

[0088] FIG19 shows the results of CCK8 identification of small molecules targeting hMEIOB to reduce the proliferation ability of C33A cells;

[0089] FIG20 shows the results of CCK8 identification of the effect of different concentrations of small molecules targeting hMEIOB on the proliferation ability of C33A cells after 72 hours of addition;

[0090] FIG21 shows the results of CCK8 identification of small molecules targeting hMEIOB to reduce the proliferation ability of A2780 cells;

[0091] FIG22 shows the results of CCK8 identification of the effect of different concentrations of small molecules targeting hMEIOB on the proliferation ability of A2780 cells after 72 hours of addition. DETAILED DESCRIPTION

[0092] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0093] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0094] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0095] The monoclonal antibodies of the present application, their preparation methods, and their application effects are described in detail below, with reference to the examples and experimental data. Specific experimental conditions and methods not specified in the following examples are generally based on conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (3rd Edition), edited by J. Sambrook et al., Science Press, 1992; Cell Experiment Guide, edited by D.L. Spector et al., Science Press, 2001, or as recommended by the manufacturer.

[0096] Example 1

[0097] Monoclonal antibodies and preparation methods thereof

[0098] 1. Cloning construction and protein prokaryotic expression

[0099] (1) The MEIOB CDS sequence was cloned into the Pet42b vector to obtain the recombinant vector Pet42b-MEIOB.

[0100] The primer pair sequences used were: forward primer (5'-ATGGCGAACAGCTTCGCAGCACGTATTTTT-3'; SEQ ID NO: 3); reverse primer (5'-CACATGTTTCTGACCACTCAGGTTACGACTCGC-3'; SEQ ID NO: 4), and cloned into the NdeI-XhoI restriction site of the Pet42b vector.

[0101] (2) Protein expression and purification:

[0102] ①Plasmid transformation:

[0103] The constructed MEIOB prokaryotic expression plasmid was transformed into BL21 competent cells and spread on LB plates containing kanamycin resistance. After a single clone grew, the single clone was picked and shaken.

[0104] ② Shake bacteria & express:

[0105] Shake overnight and transfer to a large amount the next morning, dilute 1:100 to 1:50. Shake at 37℃ until OD 600 =0.4-0.8, induced with IPTG (0.1-0.3mM), induced expression at 16-25℃ for 24 hours.

[0106] ③Collecting and splitting bacteria:

[0107] Harvest the induced bacterial suspension using a 4°C centrifuge. Wash once with Milli-Q water. Add an appropriate amount of Lysis Buffer, along with proteasome inhibitors, lysozyme, and PMSF (1:100). Place on ice at 30°C and sonicate. After lysis, centrifuge twice at 4°C for 30 minutes each, reserving the supernatant.

[0108] ④ Combined with Ni NTA beads:

[0109] Wash Ni NTA beads three times with lysis buffer, centrifuging at 2500 rpm for 3 min each time, then add them to the supernatant and allow to bind at 4°C for 4-6 hours.

[0110] ⑤Wash beads and elute protein:

[0111] Centrifuge and remove the supernatant. Wash the Ni NTA beads with lysis buffer for 30 minutes, then wash twice with wash buffer for 30 minutes each. After washing, aspirate the liquid and elute the protein with elution buffer for 4-6 hours.

[0112] ⑥Concentrated & dialyzed protein

[0113] If the protein concentration is low, concentrate it with a concentrator tube and replace the PBS buffer while concentrating; if the protein concentration is high, dialyze directly with PBS.

[0114] ⑦Protein storage

[0115] The dialyzed protein was quantified by Coomassie Brilliant Blue staining, and then 10-20% glycerol was added, quick-frozen in liquid nitrogen, and stored at -80°C.

[0116] (3) Protein purification related reagent formula

[0117] Lysis buffer: Tris-HCl: 100 mM, NaCl: 300 mM, NP-40: 0.05%, pH = 8.0;

[0118] Washing buffer: Tris-HCl: 100 mM, NaCl: 300 mM, Imidazole: 20-50 mM, NP-40: 0.05%, pH = 8.0;

[0119] Elution buffer: Tris-HCl: 100 mM, NaCl: 300 mM, Imidazole: 250 mM, NP-40: 0.05%, pH = 8.0;

[0120] The protein purification diagram is shown in Figure 1.

[0121] 2. Animal immunization

[0122] Purified human MEIOB protein was used as an antigen to immunize three 6-8 week old Balb / C mice. Complete Freund's adjuvant was used for the first primary injection, followed by incomplete Freund's adjuvant for subsequent booster injections. Both were thoroughly mixed with an equal volume of antigen before injection. Immunizations were performed using multiple abdominal injections. The primary dose was 100 μg of antigen per mouse, followed by 50 μg of antigen per mouse for the booster injection.

[0123] The immunization cycle is shown in Table 1 ;

[0124] Table 1

[0125] 3. Antiserum detection

[0126] (1) Take a small amount of blood from the tail vein of the mouse and prepare antiserum.

[0127] (2) ELISA method was used to detect the antiserum titer.

[0128] 4. Cell fusion and subcloning

[0129] (1) Myeloma cell preparation

[0130] One week before fusion, SP2 / 0 cells were revived and cultured normally to the logarithmic phase.

[0131] (2) Preparation of spleen cells

[0132] The mice to be fused were selected and sacrificed by cervical dislocation on the day of fusion. The spleens were removed and spleen cells were collected and counted according to standard procedures.

[0133] (3) Cell fusion

[0134] Myeloma cells and spleen cells were mixed at a ratio of 1:3-1:10 and cell fusion was performed according to standard procedures. Hybridoma cells were then cultured in HAT complete DMEM medium. Hybridoma cells were visible 3 days after fusion. On the 7th day, the medium was replaced with 1 / 2 HAT complete medium, and on the 8th day, the medium was replaced with 1 / 2 HT medium. Screening began approximately 10 days after fusion.

[0135] Cell fusion results: After fusion, the cells were cultured in HAT selective medium and observed under a microscope. Multiple growing hybridoma cells were seen, proving that the fusion operation was successful.

[0136] (4) Fusion screening

[0137] Pipette 100 μL of cell supernatant per well for indirect ELISA testing. Determine the positive wells based on the ELISA results. Use a single-channel pipette to inspect the entire plate for positive wells and perform a second retest to further confirm the positive wells.

[0138] (5) Subcloning

[0139] Two rounds of subcloning are performed on the cells in the rescreened positive wells. Because the cell lines obtained from the positive wells in the first subcloning are not stable and may contain multiple hybridoma cells, it is generally believed that the hybridoma cells after the second subcloning are a single cell line and are confirmed to be positive.

[0140] For the first subclone, cells from the limiting dilution positive wells were transferred to multiple wells and cultured with HT DMEM medium. After about 7 days, the cells were observed under a microscope and the wells with clone growth were detected by indirect ELISA. The wells with high OD values ​​were selected as positive wells. The cells from the positive wells were picked for the second subcloning. Stable positive hybridoma cell lines were detected and used as the cells for the final preparation of monoclonal antibodies. The cells were then expanded and cultured to obtain hybridoma cell lines.

[0141] 5. Ascites Preparation and Antibody Purification

[0142] (1) Ascites preparation

[0143] The positive cells were expanded and cultured and injected into the peritoneal cavity of Balb / C mice (sensitized with incomplete Freund's adjuvant). Generally, abdominal bulges were observed 7-10 days later, indicating the development of ascites. When ascites is evident, the fluid was promptly aspirated.

[0144] (2) Ascites purification

[0145] The ascites of the above cells was purified, and the purity of the purified antibodies was greater than 90%.

[0146] (3) Purification by ammonium octanoate sulfate + DEAE ion column method

[0147] (4) The ascites was centrifuged, and the pale yellow liquid was aspirated and the volume was calculated. The solution was diluted 1:3 with 4 volumes of 60 mM acetate buffer (pH 4.0). Caprylic acid was added dropwise (final concentration was 25 μL / mL diluted ascites), stirred at room temperature for 30 min, and then allowed to stand at 4°C for more than 2 h to allow for complete precipitation.

[0148] (5) 10,000 rpm, 4°C, 20 min. Collect the supernatant and add 1 / 10 volume of 10× PBS (0.1 M, pH 7.4). Add 0.277 g of solid ammonium sulfate (0.291 g / mL for 45% saturated ammonium sulfate at 0°C) per ml of the above mixture and continue to stand for at least 60 min.

[0149] (6) 10,000 rpm, 4°C, 20 min, discard the supernatant, dissolve the precipitate in a small amount of PBS, and dialyze against PBS at 4°C overnight.

[0150] (7) Antibody concentration and purity were determined. The antibody concentration was found to be 1.5 mg / mL. The purity of the purified antibody was determined using Coomassie Brilliant Blue staining. Figure 2 shows heavy and light chain bands with no other contaminants, indicating high antibody purity.

[0151] 6. Antibody light chain and heavy chain sequencing

[0152] (1) Cultivation of hybridoma cells

[0153] After reviving the hybridoma cell line, culture it until the cell number is expanded to about 1×10 7 The cells were collected by centrifugation at 1000 rpm for 5 min.

[0154] (2) Extraction of cellular RNA

[0155] Under a clean bench, add 1 mL of Trizol reagent to the centrifuged cells, let stand for 5 minutes, add 200 μL of chloroform, shake vigorously for 15 seconds, let stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 15 minutes. Pipette the upper aqueous layer into a new EP tube, add 0.5 mL of isopropanol, and let stand at -20°C for 10 minutes. Centrifuge at 12,000 rpm for 10 minutes. Discard the supernatant, add 1 mL of 75% ethanol, and centrifuge at 7,500 rpm for 5 minutes. Dry the pellet and add 50 μL of RNase-free double-distilled water. Assess purity and quantify by agarose gel electrophoresis and store at -80°C until use.

[0156] (3) Reverse transcription to prepare cDNA

[0157] 1 μL of total cell RNA, 6 μL of RNase-Free ddH2O, 0.5 μL of oligo dT Primer, 0.5 μL of PRIME Script RT Enzyme Mix I, 2 μL of 5× Prime Script Buffer, mix well, incubate at 37°C for 15 min, and then at 85°C for 5 s.

[0158] (4) Amplification of cDNA

[0159] Mouse IgG V H 、V L Amplify the above cDNAs using the primer library. Combine 20 μL of 2× PCR mix, 2 μL of cDNA, 2 μL of upstream primer, and 2 μL of downstream primer, and add water to 40 μL. Perform PCR using the following conditions: incubation at 98°C for 5 minutes, denaturation at 98°C for 30 seconds, annealing at 63°C for 20 seconds, and extension at 72°C for 25 seconds. Forty cycles of 5 minutes of extension at 72°C were performed.

[0160] (5) Agarose gel electrophoresis and gel recovery

[0161] The above PCR products were subjected to agarose gel electrophoresis, and the electrophoresis results were observed. The amplified products with molecular weights of 700-800 bp and 1400-1600 bp were sent for sequencing.

[0162] (6) The sequencing results of the antibody light chain are shown in SEQ ID NO: 1.

[0163] (7) The sequencing results of the antibody heavy chain are shown in SEQ ID NO: 2.

[0164] Table 2

[0165] Example 2

[0166] Antibody titer testing

[0167] The titer of the antibody was determined by ELISA. 50 ng of antigen (prokaryotic purified human MEIOB protein) was coated on each well of the plate. The purified monoclonal antibody was diluted according to the ratio shown in Figure 3 , and the A450 absorbance of each well was measured. The results are shown in Table 3 and Figure 3 .

[0168] Table 3

[0169] As shown in Table 3 and Figure 3, the antibody titer can reach 1:3000.

[0170] Example 3

[0171] Antibody specificity testing

[0172] 1. Use in vitro purified human MEIOB protein to test antibody specificity.

[0173] The His-tagged MEIOB protein was purified from prokaryotes in vitro, and the recognition specificity of the purified antibody was detected by Western Blot. As shown in Figure 4, the left and right figures are Western Blot experiments to detect the specificity of the anti-human-MEIOB antibody and the anti-histag antibody, respectively. The results show that the anti-human-MEIOB monoclonal antibody has good recognition specificity for MEIOB.

[0174] 2. Detecting antibody specificity at the cellular level

[0175] A cell line overexpressing the human MEIOB gene was constructed in the human U2OS cell line, and the specificity of the monoclonal antibody was identified by immunoblotting, as shown in Figure 5. The method for constructing the cell line overexpressing the human MEIOB gene in the embodiment of the present invention is as follows: the MEIOB gene sequence is cloned into the PB511B-1 vector (with restriction sites of EcoR I and BamH I), and the cells are transfected together with the PB210PA-1 plasmid encoding the transposase. After puromycin screening, a cell line stably expressing the MEIOB gene is obtained. As shown in Figure 5, the monoclonal antibody (Polyclonal hMEIOB Antibody) can more specifically detect the expression of human MEIOB protein than the polyclonal antibody (Monoclonl hMEIOB Antibody).

[0176] 3. Comparison of specificity between anti-human MEIOB monoclonal antibodies and commercially available antibodies.

[0177] Currently, there are no MEIOB monoclonal antibodies available on the market. We used the tag protein as the detection target and purchased an antibody that recognizes the tag protein (mCherry). We then compared the antigen recognition specificity of three antibodies (anti-human MEIOB polyclonal and monoclonal antibodies and anti-mCherry antibodies). The results are shown in Figure 6. Although both antibodies can recognize the MEIOB protein, the monoclonal antibody we purified has a more single band, indicating its better specificity.

[0178] Example 4

[0179] Antibody coding sequence detection

[0180] 1. Sequence the antibody coding sequence after library construction. Use a plasmid extraction kit (Tiangen, #DP106-02) to extract the plasmid carrying the antibody sequence. Then, use DNA gel electrophoresis to identify the presence of the plasmid and use a gel recovery kit to remove interfering sequences. Use a UV spectrophotometer to measure the purity and concentration of the plasmid DNA. Select an appropriate sequencing primer (pCMV-F) and perform DNA amplification according to Sanger's dideoxy chain termination method. Send the reaction product to a capillary electrophoresis instrument for analysis, and determine the composition of the DNA sequence by detecting different fluorescent colors. Use bioinformatics software such as Snapgene to edit and align the sequencing results to obtain accurate antibody coding sequence information, as shown in Figure 7.

[0181] Example 5

[0182] Antibody detection of MEIOB point mutants and truncations

[0183] 1. Analysis of existing MEIOB protein point mutants and truncations.

[0184] Reports indicate that patients with non-obstructive azoospermia or primary ovarian insufficiency may exhibit single-residue mutations in the MEIOB protein, such as P.N64I, P.S106R, P.S106A, and P.A326T, or partial deletions, such as P.V87fs, P.V177fs, P.V228fs, P.R272fs, P.M358fs, P.S366fs, and P.T406fs. These alterations can result in limited or absent protein function. Analysis has revealed that single-residue mutations can lead to protein conformational instability, resulting in increased degradation and an increase in MEIOB proteolytic fragments in samples. Furthermore, the remaining protein, due to conformational instability, cannot function efficiently, and the amount of MEIOB expressed is reduced compared to that in normal tissues and cells. In the case of truncated proteins, due to the loss of a large functional region, the remaining MEIOB fragment cannot perform its normal function and has a different molecular weight. Furthermore, the fragment loss often occurs near the translation termination region (carboxyl terminus), while the translation initiation region (amino terminus) is relatively intact. Based on this, Western blotting (WB) experiments using monoclonal antibodies that recognize a single site can assess the expression and degradation levels of MEIOB point mutants and truncations, as shown in Figure 8.

[0185] Example 6

[0186] Antibody enrichment of MEIOB for protein function analysis

[0187] 1. Currently, the structure of the MEIOB protein has not been elucidated. Early expression revealed that MEIOB readily aggregates to form inclusion bodies and precipitates. This poor dispersion hinders protein crystallization and subsequent analysis. The large molecular weight of monoclonal antibodies (150 kD) creates significant steric hindrance when mixed with MEIOB, dispersing the MEIOB protein. Furthermore, the monoclonal antibody exhibits a single binding mode with MEIOB, which increases the order of the protein-antibody complex within the crystal lattice, as shown in Figure 9. This promotes the superposition of diffraction values ​​across the complex, ultimately achieving diffraction intensities sufficient for measurement and facilitating protein structure elucidation.

[0188] 2. Monoclonal antibodies are used to explore the functional mechanism of MEIOB. The protein has a large molecular weight (~50kD) and may have potential modification sites on its surface. In particular, during the protein degradation phase after its function is fulfilled, there are no reports on whether it is degraded through ubiquitination modification and which residue mediates the modification. MEIOB protein is a protein specifically expressed in reproductive tissues. Because there is no suitable germ cell line to express this protein, and heterologous expression cannot simulate the microenvironment of meiosis and the protein expressed in time and space, the analysis of its biological function can only be explored by isolating animal tissues. In addition, the method of constructing a model animal expressing a tagged protein is costly and time-consuming. In summary, monoclonal antibodies can be used to quickly enrich MEIOB proteins without tags in reproductive tissues. While enriching MEIOB proteins through antibodies, functional complexes formed with the participation of MEIOB can also be obtained. Therefore, the monoclonal antibody-dependent enrichment of MEIOB facilitates the implementation of the following experiments.

[0189] 3. Monoclonal antibodies for proteomic analysis. Proteins enriched with monoclonal antibodies can be further analyzed by mass spectrometry. This analysis can identify proteins that directly or indirectly interact with MEIOB; the antibodies can then be used in pull-down assays to analyze potential interaction sites. Furthermore, MEIOB protein enriched with antibodies can be used for epigenetic modification analysis to identify potential modification sites on the MEIOB surface and the corresponding modified proteins, thereby elucidating the effects of modifications on protein function and biological processes, as shown in Figure 10.

[0190] 4. Monoclonal antibodies are used for genomic analysis. MEIOB participates in meiosis, specifically by promoting the synapsis of homologous chromosomes through collaboration with interacting proteins. When high-affinity antibodies are used to enrich MEIOB, gene fragments with affinity for the MEIOB protein complex are also captured. By aligning the gene sequence with the genome, information on chromosomal recombination site preferences can be obtained, as shown in Figure 10.

[0191] Example 7

[0192] Identification of gene point mutations:

[0193] 1. Primer Design. Analyze the genomic sequence of the human MEIOB gene, locate each exon and the 100-bp introns on either side, and select the exon containing the flanking introns as the target sequence. Use Snapgene software to generate upstream and downstream primers, ensuring that the annealing temperature of all primers is approximately 63°C (see Table 4).

[0194] Table 4 Primer sequence information

[0195] 2. Peripheral blood genome extraction. Draw 0.5 mL of blood from the subject's vein, add 0.8 mL of normal saline and mix well, centrifuge at 10,000 rpm for 1 min at room temperature; remove the supernatant, retain 0.1 mL of precipitate, add 0.4 mL of TE buffer to resuspend the cells, add 5 μL of 10 mg / mL proteinase K and 50 μL of 10% SDS to lyse the cells, and digest in a 37°C water bath overnight; add 1 / 3 volume of saturated sodium chloride solution, mix thoroughly, let stand for 10 minutes, and centrifuge at 10,000 rpm for 10 minutes; take the supernatant to a new tube, add an equal volume of chloroform and mix thoroughly, centrifuge at 10,000 rpm for 10 minutes; aspirate the upper aqueous phase to a new tube, add 1 / 10 volume of 3M NaAc (pH 5.2) was added and mixed, 0.7 times the volume of isopropanol was added and mixed, and centrifuged at 10,000 rpm for 5 min; the supernatant was removed, 0.5 mL of 70% ethanol was added to wash the isopropanol, the mixture was mixed by inversion, and the supernatant was removed and repeated once; the lid was opened to allow the ethanol to evaporate completely, 50 μL of sterilized double-distilled water was added, and the mixture was fully dissolved at 55°C; the DNA concentration was determined using a Nanodrop instrument, and the sample was stored at -20°C.

[0196] 3. PCR amplification of the target sequence. To a 40 μL reaction system, add 20 μL of 2× Taq polymerase premix, 100 ng of DNA template, 2 μL each of 10 μM upstream and downstream primers, and an appropriate amount of double-distilled water (ddH2O). Mix well and perform PCR amplification using the following parameters: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds, annealing at 63°C for 30 seconds, extension at 72°C for 30 seconds, 30 cycles, followed by continuous extension for 5 minutes after each cycle, and incubation at 12°C.

[0197] 4. Target sequence gene sequencing. Obtain the target sequence using a gel recovery kit, and determine the plasmid DNA purity and concentration using a UV spectrophotometer. Select the respective sequencing primers (default is F) and perform DNA amplification according to Sanger's dideoxy chain termination method. The reaction products are analyzed by capillary electrophoresis, and the composition of the DNA sequence is determined by detecting different fluorescent colors. Use bioinformatics software such as Snapgene to edit and align the sequencing results to obtain accurate coding sequence information.

[0198] 5. DNA sequence comparison. Comparing the sequencing results with standard nucleic acid information and existing mutation information (Table 5) can determine whether the subject's MEIOB gene is normal, whether it matches existing mutations, and whether there are new gene mutation types.

[0199] Table 5 Known mutation information

[0200] Example 8

[0201] ASO molecules reduce the level of hMEIOB gene mRNA in cells:

[0202] 1. Construction of a cell line stably expressing hMEIOB. hMEIOB mRNA was obtained from testes and reverse-transcribed into cDNA. The full-length hMEIOB gene sequence was amplified and constructed into the pcDNA3.1 plasmid. To facilitate observation of gene expression, the green fluorescent protein (GFP) coding sequence was fused to the end of hMEIOB. The sequenced recombinant plasmid was transfected into the U2OS cell line, and cell lines stably expressing hMEIOB were selected using 500 μg / mL G418.

[0203] 2. ASO Synthesis: Based on the hMEIOB mRNA sequence, a 21-nucleotide ASO sequence complementary to it was designed. Using an automated oligonucleotide synthesizer, the ASO chain was constructed by the stepwise addition of single nucleotides. The ASO was treated with a thiolation reagent and then purified to remove unreacted reagents and other impurities. The ASO was purified by high-performance liquid chromatography (HPLC) and characterized by mass spectrometry to ensure its quality and purity met experimental requirements.

[0204] 3. Co-culture of ASOs with cells and RT-QPCR analysis of hMEIOB gene expression. The synthesized ASOs were co-cultured with the hMEIOB stably transfected cell line constructed above at a final concentration of 4 μM for 72 hours. The cells were then harvested, mRNA extracted, and reverse transcribed to generate a PCR template. RT-QPCR was used to measure the relative mRNA levels of hMEIOB in cells after ASO addition, and the differences were statistically analyzed. After ASO addition, the level of hMEIOB mRNA in U2OS cells decreased by 72%, indicating that ASOs can effectively interfere with hMEIOB expression (Figure 11).

[0205] Example 9

[0206] ASO molecules reduce the mMeiob gene mRNA level in mouse testes

[0207] 1. Mouse Preparation: Select 6-8 week old C57BL / 6J male mice, weigh them, and calculate the drug dose (0.33 nmol / g). Anesthetize the mice by intraperitoneal injection.

[0208] 2. Testicular injection of the ASO molecule. Squeeze the mouse's abdomen to retract the testicles into the scrotum. Use a microsyringe to draw up the ASO solution and inject the drug directly into the testicles through the scrotal skin. Return the mouse to its cage and wait for it to regain consciousness. Then, transfer the cage to the animal room and continue housing for 72 hours.

[0209] 3. RT-QPCR Identification of mMeiob Gene Expression. Testicular mRNA was extracted and reverse-transcribed into cDNA. RT-QPCR was performed to measure the relative mRNA levels of mMeiob in the testes of mice after ASO treatment, and statistical analysis was performed. The results showed that the relative mRNA levels of mMeiob decreased in the testes of mice treated with ASO (0.044±0.005 vs. 0.037±0.002) (Figure 12).

[0210] Example 10

[0211] Small molecules targeting MEIOB protein inhibit the interaction between MEIOB and SPATA22 in cells

[0212] 1. Construction of cell lines stably expressing MEIOB and SPATA22. pcDNA3.1 vectors expressing MEIOB fused to green fluorescent protein (GFP) and SPATA22 fused to red fluorescent protein (mCherry) were constructed and co-transfected into the U2OS cell line. Cell lines stably expressing both fluorescent fusion proteins were screened using G418.

[0213] 2. Screening of small molecules targeting MEIOB protein. Candidate small molecules were obtained through virtual screening and further synthesized into small molecule compounds ZJH-I-OMe (CID_10847865), ZJH-I-OGer, ZJH-I-OEt, ZJH-I-OiPr, ZJH-I-OCD3, ZJH-I-OH, ZJH-I-HHG, ZJH-I-103-B, and ZJH-I-103-C.

[0214] Table 6 shows the names and affinity constants of the nine compounds

[0215] The affinity constants (KD) of these nine small molecules were measured using biomembrane interferometry. The results showed that ZJH-I-OMe (CID_10847865) and ZJH-I-HHG had lower KD values, indicating higher affinity for the MEIOB protein (Table 6). ZJH-I-OMe (CID_10847865) was used for validation in the following experiments.

[0216] 3. Co-culture of small molecules with cells: CID_10847865 small molecule at a concentration of 40 μM was added to the culture medium and incubated with U2OS cells in a 37°C CO2 incubator for 48 hours.

[0217] 4. Fluorescence microscopy was used to examine cellular interactions. The distribution of GFP and mCherry proteins was observed under excitation light at 488 nm and 596 nm, respectively. Fluorescence results showed that in U2OS cells cultured without small molecules, both MEIOB and SPATA22 were localized to the nucleus. In contrast, in U2OS cells cultured with small molecules, MEIOB was distributed in the cytoplasm, while SPATA22 was localized solely in the nucleus, suggesting that small molecules affect the binding of the two proteins (Figure 13).

[0218] Example 11

[0219] Small molecules targeting MEIOB protein inhibit spermatogenesis in mouse testes

[0220] 1. Mouse Preparation: Select 6-8 week old C57BL / 6J male mice, weigh them, and calculate the dosage (0.3 mg / 20 g) and frequency (once every two days, for a total of seven doses).

[0221] 2. Small molecule scrotal injection: Use a microsyringe to draw up the small molecule premix (the drug is dissolved in 10 μL of DMSO). Pull up the mouse's scrotal skin to ensure the solution is injected subcutaneously. Return the mouse to its cage and continue feeding.

[0222] 3. Preparation of paraffin sections of testicular tissue and HE staining. Mice were sacrificed by cervical dislocation, and the testes were isolated and fixed. Paraffin sections were prepared and stained with HE. After sealing, the structural changes of the seminiferous tubules were observed under a microscope. After drug administration, cavitated seminiferous tubules appeared in the testes of mice (Figure 14).

[0223] 4. Epididymal tail sperm count. The epididymis of the mouse was isolated and immersed in 1 mL of PBS solution. The tissue was minced to fully release the sperm. 10 μL of the solution was aspirated and diluted with 90 μL of PBS. 10 μL of the dilution was transferred to a cell counting chamber, covered with a coverslip, and heated at 50°C for 5 minutes to stop sperm motility. Sperm count was performed under a microscope. The number of sperm in the epididymis of the mice treated with the drug decreased (Figure 15).

[0224] Example 12

[0225] Small molecules targeting MEIOB protein reduce the proliferation ability of tumor cells with high MEIOB expression

[0226] 1. Screening of tumor cell lines with high MEIOB expression. Whole-cell proteins were collected from cervical cancer cell lines (HELA, SiHA, C33A), breast cancer cell lines (A2780, MD231), and a leukemia cell line (THP-1), and MEIOB protein expression levels were analyzed by Western blot. The results showed high MEIOB expression in the cervical cancer cell line C33A and the breast cancer cell lines A2780 and MD231 (Figure 16).

[0227] 2. Western blot analysis of the effect of small molecules on MEIOB expression in cells. Small molecules at varying concentrations were added to the culture medium and incubated with C33A cells in a 37°C CO2 incubator for 72 hours. MEIOB protein expression in the cells was assessed by Western blot analysis. Western blot analysis revealed that MEIOB protein levels decreased with increasing small molecule concentration, suggesting that small molecules targeting the MEIOB protein inhibited MEIOB protein expression in the C33A cell line (Figures 17 and 18).

[0228] 3. CCK8 assay for cell proliferation. C33A and A2780 cells were seeded in 96-well plates and incubated in a 37°C CO2 incubator. After cell attachment, small molecules at varying concentrations were added to the culture medium and incubated with C33A and A2780 cells, respectively. Cells were removed at 0, 24, 48, 72, and 96 hours, and 10 μL of CCK8 assay reagent was added to each well. After a further 2 hours of incubation, the absorbance at 450 nm was read using a microplate reader. CCK8 assay results showed that the addition of small molecules targeting the MEIOB protein decreased the cell viability of C33A and A2780 cells (Figures 19-22).

[0229] The above description is only a preferred embodiment of the present invention, which certainly cannot be used to limit the scope of rights of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and changes can be made without departing from the principles of the present invention. These improvements and changes are also considered to be within the scope of protection of the present invention.

Claims

1. A monoclonal antibody against MEIOB, characterized in that: The monoclonal antibody can recognize human MEIOB protein, and the monoclonal antibody includes a complete heavy chain and a complete light chain; the amino acid sequence of the light chain is shown in SEQ ID NO: 1; the amino acid sequence of the heavy chain is shown in SEQ ID NO:

2.

2. A monoclonal antibody against MEIOB, characterized in that: The monoclonal antibody is an antibody obtained by connecting a label to the N-terminus and / or C-terminus of the monoclonal antibody according to claim 1.

3. A nucleic acid molecule encoding the anti-MEIOB monoclonal antibody according to claim 1 or 2, characterized in that: The nucleic acid molecules include a nucleic acid molecule encoding the complete heavy chain and a nucleic acid molecule encoding the complete light chain.

4. An expression vector comprising the nucleic acid molecule of claim 3, characterized in that: The expression vector is capable of expressing the nucleic acid in a prokaryotic or eukaryotic host cell.

5. An engineered bacterium or eukaryotic host cell comprising the expression vector according to claim 4.

6. A use of a monoclonal antibody against the MEIOB protein according to claim 1 or 2, characterized in that: Used for preparing MEIOB protein detection reagent or kit.

7. A use of a monoclonal antibody against the MEIOB protein according to claim 1 or 2, characterized in that: Used to prepare quality control antibodies for MEIOB protein colloidal gold detection kit.

8. A colloidal gold rapid test strip for MEIOB protein, characterized in that: include: Bottom plate, A sample absorption pad, a conjugate pad, a chromatography matrix and a water absorption pad are adhered to the surface of the bottom plate and overlapped in sequence; The surface of the conjugate pad is coated with a colloidal gold complex coated with a monoclonal antibody to the MEIOB protein according to claim 1 or 2; a quality control line C is provided on the side of the chromatography matrix close to the conjugate pad, and a detection line T is provided on the side of the chromatography matrix close to the absorbent pad; the quality control line C is coated with an anti-mouse IgG secondary antibody; and the detection line T is coated with a monoclonal antibody to the MEIOB protein according to claim 1 or 2.

9. A use of a monoclonal antibody against the MEIOB protein according to claim 1 or 2, characterized in that: It is used to identify point mutants formed by MEIOB gene mutations, or to detect truncations formed by MEIOB gene mutations, or to purify MEIOB proteins in tissues and cells, or to enrich and pretreat MEIOB proteins in samples in the early stages of mass spectrometry detection, or to enrich nucleic acids in the early stages of high-throughput gene sequencing.

10. A primer set for detecting MEIOB gene mutation, characterized in that: It can detect the discovered hMEIOB gene mutation sites and potential mutation sites in the hMEIOB gene, including the following primer pairs: The nucleotide sequences of the primer set for exon 1 are shown in SEQ ID NO. 3 and SEQ ID NO. 4; The nucleotide sequences of the primer set for exon 2 are shown in SEQ ID NO.5 and SEQ ID NO.6; The nucleotide sequences of the primer set for exon 3 are shown in SEQ ID NO.7 and SEQ ID NO.8; The nucleotide sequences of the primer set for exon 4 are shown in SEQ ID NO.9 and SEQ ID NO.10; The nucleotide sequences of the primer set for exon 5 are shown in SEQ ID NO.11 and SEQ ID NO.12; The nucleotide sequences of the primer set for exon 6 are shown in SEQ ID NO. 13 and SEQ ID NO. 14; The nucleotide sequences of the primer set for exon 7 are shown in SEQ ID NO.15 and SEQ ID NO.16; The nucleotide sequences of the primer sets for exons 8 and 9 are shown in SEQ ID NO. 17 and SEQ ID NO. 18; The nucleotide sequences of the primer set for exon 10 are shown in SEQ ID NO. 19 and SEQ ID NO. 20; The nucleotide sequences of the primer set for exon 11 are shown in SEQ ID NO. 21 and SEQ ID NO. 22; The nucleotide sequences of the primer set for exon 12 are shown in SEQ ID NO. 23 and SEQ ID NO. 24; The nucleotide sequences of the primer set for exon 13 are shown in SEQ ID NO.25 and SEQ ID NO.

26.

11. An application of a primer set for detecting MEIOB gene mutation, characterized in that: Used in the preparation of products for diagnosing non-obstructive azoospermia or premature ovarian insufficiency.

12. An antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product, characterized in that: It is a single-stranded DNA with a nucleotide sequence of ATTTATCGTGCAGCCCAAAGT, a sequence length of 21bp, 3 locked nucleic acids at each end, and a fully thiolated modification.

13. The antisense oligonucleotide molecule targeting the mRNA of the MEIOB gene transcription product according to claim 12, characterized in that: The antisense oligonucleotide molecules recognize mRNA through base complementarity, thereby inhibiting the expression of MEIOB protein or inhibiting the expression of mRNA, a transcription product of MEIOB gene.

14. Use of an antisense oligonucleotide molecule targeting mRNA of a MEIOB gene transcription product according to claim 12 or 13, characterized in that: Used to prepare products for inhibiting the expression of mRNA of MEIOB gene transcription product or inhibiting the expression of MEIOB protein.

15. Use of an antisense oligonucleotide molecule targeting mRNA of a MEIOB gene transcription product according to claim 12 or 13, characterized in that: Used in the preparation of contraceptive drugs.

16. A small molecule targeting MEIOB protein and its analogs, characterized in that: Its molecular structure is at least one of the following:

17. The small molecule targeting MEIOB protein and its analogs according to claim 16, characterized in that: The small molecules and analogs thereof targeting MEIOB protein can inhibit the binding of MEIOB to SPATA22 by binding to MEIOB protein. The binding of the small molecules and analogs thereof targeting MEIOB protein to MEIOB protein is reversible and can be rapidly dissociated from the surface of MEIOB protein as the concentration decreases.

18. A use of a small molecule targeting MEIOB protein and its analogs according to claim 16 or 17, characterized in that: Used to prepare products that inhibit the binding of MEIOB to SPATA22 in cells or inhibit the production of sperm in testicles.

19. A use of a small molecule targeting MEIOB protein and its analogs according to claim 16 or 17, characterized in that: Used in the preparation of contraceptive drugs.

20. A use of a small molecule targeting MEIOB protein and its analogs according to claim 16 or 17, characterized in that: Used to prepare drugs for tumors with high MEIOB expression.

Images