Rep promoters for AAV production

Abstract

Polynucleotides, vectors, vector systems, cells, and methods for expressing AAV Rep proteins are provided. In certain aspects, these polynucleotides, vectors, vector systems, cells, and methods may be used to produce higher levels of small Rep transcripts as compared to large Rep transcripts. In certain aspects, these polynucleotides, vector systems, cells, and methods may be used to produce higher levels of small Rep proteins as compared to large Rep proteins. In certain aspects, these polynucleotides, vectors, vector systems, cells, and methods may be used to produce recombinant AAV (rAAV). Increased expression of small Rep as compared to large Rep is useful in many aspects, such as, increasing total virions and increasing packaged virions during the production of rAAV.

Description

REP PROMOTERS FOR AAV PRODUCTIONCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 642,588, filed May 3, 2024; U.S. Provisional Application No. 63 / 640,791, filed April 30, 2024; U.S. Provisional Application No. 63 / 625,118, filed January 21, 2024; U.S. Provisional Application No. 63 / 613,613, filed December 21, 2023; U.S. Provisional Application No. 63 / 542,479, filed October 4, 2023; and U.S. Provisional Application No. 2024; 63 / 536,904, filed September 6, 2023. The contents of each of the above-referenced applications are incorporated by reference in their entireties.INTRODUCTION

[0002] Adeno-associated virus (AAV) belongs to the Parvoviridae family and Dependovirus genus, of which some members require co-infection with a helper virus such as adenovirus to promote replication. AAV establishes a latent infection in the absence of a helper virus. AAV virions are composed of a 25 nm icosahedral capsid encompassing a 4.7 kb single-stranded DNA genome with two open reading frames: rep and cap. The non- structural rep gene encodes four AAV Rep proteins that are regulatory proteins essential for viral replication, whereas cap encodes three structural AAV Capsid proteins (Virion proteins 1-3 “VP1-3”) that assemble into a 60-mer capsid shell. This viral capsid mediates the ability of AAV vectors to overcome many of the biological barriers of viral transduction, including cell surface receptor binding, endocytosis, intracellular trafficking, and unpackaging in the nucleus.

[0003] There is a need in the art for better methods of recombinant AAV (rAAV) production that enhance AAV packaging efficiency to provide for delivery of a payload of interest by a rAAV virion to a cell.SUMMARY

[0004] Vectors, vector systems, cells, and methods for expressing AAV Rep proteins are provided. In certain aspects, these vectors, vector systems, cells, and methods may be used to produce higher levels of small Rep as compared to large Rep. In certain aspects, these vectors, vector systems, cells, and methods may be used to produce rAAV. Modulating expression of small Rep as compared to large Rep is useful in many contexts. For example, increased expression of small Rep as compared to large Rep can increase both total virions and packaged virions during the production of recombinant AAV.BRIEF DESCRIPTION OF THE DRAWINGS

[0005] FIG. 1A. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence. The pl 9 (“Pl 9”) promoter is not modified.

[0006] FIG. IB. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. The schematic further depicts that the p5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl 9 promoter is mutated.

[0007] FIG. 2A. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence. The p 19 (“Pl 9”) promoter is not modified.

[0008] FIG. 2B. Schematic of a polynucleotide for expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl9 (“P 19”) promoter is mutated.

[0009] FIG. 3. Schematic showing mRNA Transcripts 1-3 that can be produced from the polynucleotides depicted in FIGs. 2A-2B. The spliced-out intron is depicted with discontinuous lines. While not depicted in FIG. 3, Transcript 1 is capable of generating two types of mature mRNAs produced by alternative splicing, in which the two types of mature RNAs are (i) a mature RNA encoding the large Rep protein, Rep78; and ii) a mature RNA encoding the large Rep protein, Rep68. Transcript 2 is produced by transcription driven by the heterologous promoter positioned in the intron. Transcript 3 is produced by transcription driven by the pl 9 promoter andinitially includes the intron (shown by discontinuous lines) which is spliced out. While not depicted in FIG. 3, Transcript 2 and Transcript 3 are each capable of generating two types of mature mRNAs produced by alternative splicing of the shown a mRNA, in which the two types of mature RNAs are (i) a mature RNA encoding the small Rep protein, Rep52; and ii) a mature RNA encoding the small Rep protein, Rep40.

[0010] FIG. 4. Western blot for flag tag to detect expression of flag-tagged large Rep proteins and small Rep proteins in cells transiently transfected with a plasmid comprising the polynucleotide depicted in FIG. 2B having combinations of different promoters.

[0011] FIG. 5. Schematic of a polynucleotide for inducible expression of AAV large Rep transcripts and AAV small Rep transcripts for expressing large Rep proteins and small Rep proteins, respectively. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep proteins. A heterologous promoter is inserted into the intron. A Conditional by Deletion (CODE) module is included in the coding sequence common to large Rep proteins and small Rep proteins. The CODE module includes a sequence comprising a stop codon and lox sites (denoted by two triangles) that flank the sequence comprising the stop codon. Upon expression of a recombinase, the lox sites are recombined, resulting in excision of the sequence comprising the stop codon. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated.

[0012] FIG. 6. Schematic showing mRNA Transcripts 1-3 that can be produced from the polynucleotide depicted in FIG. 5. The spliced-out intron is depicted with discontinuous lines. Transcript 1 is capable of being alternatively spliced to produce two different mRNAs, one encoding a truncated large Rep protein, Rep78, and the other encoding a truncated large Rep protein, Rep68, wherein the truncations occur at the stop codon within the CODE module. Transcripts 2 and 3 are each capable of being alternatively spliced to produce two different mRNAs, one encoding a truncated small Rep protein, Rep52, and the other encoding a truncated small Rep protein, Rep40, wherein the truncations occur at the stop codon within the CODE module. The truncated large Rep proteins and the truncated small Rep proteins are non- functional and therefore also non-toxic.

[0013] FIG. 7. Western blot for flag tag to detect expression of flag-tagged Rep proteins in cells transiently transfected with a vector comprising the polynucleotide having combinations of different heterologous promoters (PGK+CAG or UBC+CAG). Some of the flag-tagged Rep proteins were transfected with a vector as depicted in FIG. 5 (CODE or Lox). As noted with FIG. 5, in the presence of the CODE module truncates the Rep proteins (e.g., Rep78 and Rep52), thusnot producing the flag tag (encoded near 3’ end of transcript). By expressing a recombinase or exogenously adding a (e.g., Cre recombinase), the CODE module is excised (e.g., at Lox sites) allowing expression of full-length, flag-tagged Rep proteins.

[0014] FIG. 8A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted. In absence of first and second triggering agents, the system is in an off state.

[0015] FIG. 8B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 8A is shown in the on-state, after induction by the first and second triggering agents.

[0016] FIG. 9A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted. Compared to the system depicted in FIGS. 8A-8B, this system includes an additional polynucleotide for expressing the Cap protein. In absence of first and second triggering agents, the system is in an off state.

[0017] FIG. 9B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 9A is shown in the on-state, after induction by the first and second triggering agents.

[0018] FIG. 10. A polynucleotide for expression of Rep proteins and Cap proteins, wherein the coding sequences and promoters for the Rep proteins are separated from the coding sequence and promoter for the Cap proteins by a transcription blocking element (TBE) is depicted. An intron is inserted in the coding sequence for large Rep proteins, upstream of the small Rep coding sequence. A heterologous promoter is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated. The TBE separates the Rep coding sequence from the Cap coding sequence. Expression of Cap is under the control of an inducible promoter (e.g., Tet-on promoter) and includes a polyadenylation signal sequence (Poly A) downstream of the sequence encoding the Cap proteins (Capsid). An exemplary polyadenylation signal sequence is an SV40 polyadenylation sequence. The polynucleotide also includes a selectable marker (e.g., antibiotic resistance gene) expressed under the control of a constitutive promoter (e.g., EF- 1 alpha promoter). In this example, the EF-1 alpha promoter includes a mutated TATA box which reduces its activity resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic).

[0019] FIG. 11A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted using the polynucleotide described in FIG. 10. In absence of first and second triggering agents, the system is in an off state.

[0020] FIG. 11B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 11A is shown in the on-state, after induction by the first and second triggering agents.

[0021] FIG. 12A. An exemplary system of polynucleotides for inducibly producing rAAV is depicted using the polynucleotide described in FIG. 10. Compared to the system depicted in FIGS. 11A-11B, this system includes an additional polynucleotide for expressing the Cap protein. In absence of first and second triggering agents, the system is in an off state.

[0022] FIG. 12B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 12A is shown in the on-state, after induction by the first and second triggering agents.

[0023] FIG. 13A. An exemplary schematic of constructs of a vl.O system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927 ; the disclosures of which are incorporated by reference in their entireties for all purposes.

[0024] FIG. 13B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 13A is shown in the post-triggered state, in which rAAV is produced after induction by the first triggering agent and the second triggering agent. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927 ; the disclosures of which are incorporated by reference in their entireties for all purposes.

[0025] FIG. 14A. An exemplary schematic of constructs of a vl.2 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927 ; the disclosures of which are incorporated by reference in their entireties for all purposes.

[0026] FIG. 14B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 14A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent. A full description of a vl.O system is provided in US Pat. No. 12,054,738 and PCT Pub. No. WO 2022 / 026927 ; the disclosures of which are incorporated by reference in their entireties for all purposes.

[0027] FIG. 15A. An exemplary schematic of constructs of a vl.3 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.

[0028] FIG. 15B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 15A is shown in the post-triggered state, in which rAAV is produced after induction by the first triggering agent and the second triggering agent.

[0029] FIG. 16A. An exemplary schematic of constructs of a vl.4 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced.

[0030] FIG. 16B. The system of polynucleotides for inducibly producing rAAV depicted in FIG. 16A is shown in the post-triggered state, where rAAV is produced after induction by the first triggering agent and the second triggering agent.

[0031] FIG. 17. Exemplary data for a comparison of rAAV production systems from pools of vl.0, vl.2, vl.3, and vl.4.

[0032] FIG. 18. Exemplary AEX chromatogram data to determine rAAV encapsidated genomes produced by a pool of vl.4 cells.

[0033] FIGs. 19A-19B. Exemplary data for cell viability percent, viable cell density, and titer level for pools of vl.3 and vl.4 cells as measured as days post-induction by the first triggering agent and the second triggering agent.

[0034] FIG. 20. Exemplary data of absorbance at 260 nm and 280 nm for pools of vl.3 and vl.4 cells as a measurement of titer level.

[0035] FIG. 21. Exemplary data showing affinity exchange high performance liquid chromatography as an estimate of fill percentage of pools of vl.3 and vl.4 cells.

[0036] FIG. 22. Exemplary data comparing affinity exchange high performance liquid chromatography of vl.4 cell pools after production for 3 days and 7 days.

[0037] FIG. 23. Exemplary data of high temperature size exclusion chromatography to measure fill percentage of a vl.4 cell pool.

[0038] FIG. 24A. Exemplary data of insert production and IC50 for as vl.4 cell pool as compared to a triply transfected control SVEC0935.

[0039] FIG. 24B. Exemplary AEX chromatogram data to determine rAAV encapsidated genomes produced by a triply transfected control SVEC0935.

[0040] FIG. 25. Exemplary data of reverse phase HPLC to characterize relative amount of each capsid protein from a vl.4 cell pool as compared to a triply transfected control SVEC0935.

[0041] FIG. 26. Exemplary data of sequencing reads that align to various targets from rAAV particles produced by a vl.4 cell pool.

[0042] FIG. 27. Exemplary data of digital droplet PCR identifying inserted nucleic acids obtained from vl.3 and vl.4 cell pools.

[0043] FIG. 28. Exemplary gel electrophoresis data showing insert size and type of inserts (e.g., self-complementary or single stranded) from vl.3 and vl.4 cell pools.

[0044] FIG. 29. Exemplary data of scatter plots showing consistent titer levels of capsid proteins and viral genomes produced from multiple replicates and production runs from vl.3 and vl.4 cell pools.

[0045] FIG. 30. Exemplary AEX chromatogram and absorbance data to determine rAAV encapsidated genomes produced by a pool of vl.4 cells after AEX purification.

[0046] FIGs. 31A-31B. Exemplary data of titer levels (vg / mL and vp / mL) produced from cell banks created over two months of passaging from pools of vl .3 and vl .4 cells.

[0047] FIGs. 32A-32B. Exemplary data of a bar graph (FIG. 32A) and a table (FIG. 32B) showing increased purity produced by vl.3 and vl.4 cell pools as compared to a v 1.0 cell pool, a vl.O monoclonal line, and triply transfected cells.

[0048] FIG. 33. Exemplary data showing production levels and efficiency of rAAV production from cells that are transiently transfected with vl.4 constructs or cells with stably integrated vl.4 constructs.

[0049] FIGs. 34A-34C. Exemplary data of vg titer (FIG. 34A), percent of filled capsids (FIG. 34B), and effectiveness curve (FIG. 34C) showing improved yield, quality, and performance of rAAV produced from cells with stably integrated vl.4 constructs over cells that are transiently transfected with vl.4 constructs.

[0050] FIGs. 35A-35D. Exemplary data of a chromatograms (FIGs. 35A-35B), gel electrophoresis (FIG. 35C) and a table (FIG. 35D) showing similar properties between rAAV produced from cells that are transiently transfected with vl .4 constructs and rAAV produced from cells with stably integrated vl.4 constructs.

[0051] FIGs. 36A-36B. Exemplary data of titer levels (vg / mL and vp / mL) from cells containing either a triple enhancer (e.g., hTERT, SV40, and CMV) or a double enhancer (e.g., SV40 and CMV) as measured at 3 days and 7 days post-induction.DETAILED DESCRIPTION

[0052] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for expressing AAV Rep proteins are provided. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce higher levels of small Rep RNA transcripts as compared to large Rep RNA transcripts. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce higher levels of small Rep proteins as compared to large Rep proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methodsmay be used to produce lower levels of large Rep RNA transcripts as compared to small Rep RNA transcripts. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce lower levels of large Rep proteins as compared to small Rep proteins. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Increased expression of small Rep protein as compared to large Rep protein is useful in increasing total virions. Increased expression of small Rep protein as compared to large Rep protein is useful in increasing packaged virions during the production of recombinant AAV. Increased expression of small Rep protein as compared to large Rep protein is useful in increasing both total virions and packaged virions during the production of recombinant AAV.

[0053] Before the present polynucleotides, vectors, systems, cells, and methods are described, it is to be understood that this invention is not limited to particular methods or components described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0054] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0055] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction.

[0056] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method may be carried out in the order of events recited or in any other order which is logically possible.

[0057] ft must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the vector" includes reference to one or more vectors and equivalents thereof, such as viral vectors, plasmids, constructs, and the like, known to those skilled in the art, and so forth.

[0058] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.Definitions

[0059] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which the invention pertains.

[0060] The term "about", particularly in reference to a given quantity, is meant to encompass deviations of up to plus or minus five percent.

[0061] "AAV" is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The components of the AAV DNA genome consists of two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). Rep gene encodes multiple distinct proteins including Rep78, Rep68, Rep52, and Rep40. These proteins are also referred to herein as Rep proteins or Rep and may encompass one or more of Rep78, Rep68, Rep52, and Rep40 and functional variants thereof and homologs thereof. Rep78 and Rep68 and functional variants thereof and homologs thereof are referred to herein as large Rep. Rep52, and Rep40 and functional variants thereof and homologs thereof are referred to herein as small Rep. Rep proteins from an AAV of a particular serotype may also be referred to as Repl, Rep2, etc. where the Rep protein is derived from an AAV1 or an AAV2serotype, respectively. Cap gene encodes capsid proteins VP1, VP2, and VP3 required for production of rAAV capsids. These proteins are also referred to herein as Cap proteins or Cap and may encompass one or more of VP1, VP2, and VP3 and functional variants thereof and homologs thereof. Cap proteins from an AAV of a particular serotype may also be referred to as Capl, Cap2, Cap4, etc. where the Rep protein is derived from an AA1, an AAV2, or an AAV5 serotype, respectively. In addition to Rep and Cap, AAV requires a helper plasmid containing genes from a helper virus such as adenovirus, including El a, Elb, E4, E2a, and VA genes for AAV replication.

[0062] "Recombinant virus" is meant to describe a virus that has been genetically altered, e.g., by the addition or insertion of a heterologous nucleic acid construct into the virus.

[0063] The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector"). The term “AAV” includes any AAV serotype as well as AAV vectors based on the combination of different serotypes (also referred to as "hybrid AAV vectors" or "pseudotype AAV vectors"). AAV serotype may be AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV-10), AAV type 1 1 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, AAV-7m8, AAV-6.2, AAV- Dj, AAV-DJ / 8, AAV2-retro, AAV2-QuadYF and AAV2.7m8, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.eS, evolved capsids that are less immunogenic to mice and humans, and variants thereof and combinations thereof. “Primate AAV” refers to AAV isolated from a primate, “non-primate AAV” refers to AAV isolated from a non- primate mammal, “bovine AAV” refers to AAV isolated from a bovine mammal (e.g., a cow), etc. An "rAAV vector" comprises a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a polynucleotide sequence of interest for introducing into a target cell. In general, the heterologous polynucleotide is flanked by at least one, and usually by two AAV inverted terminal repeat sequences (ITRs). The heterologous polynucleotide can also be referred to as a polynucleotide payload. The term rAAV vector encompasses both rAAV virions and rAAV vector plasmids.

[0064] An "AAV virus" or "AAV viral particle" or "rAAV vector particle" or “rAAV particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector". Thus, production of a rAAV particlenecessarily includes production of a rAAV vector, as such a vector contained within an rAAV particle.

[0065] "Packaging" refers to a series of intracellular events that result in the assembly, encapsidation, and production of an AAV particle.

[0066] AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and capsid proteins of adeno- associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."

[0067] By "AAV Rep coding region" or “sequence encoding one or more Rep proteins” or “Rep encoding sequence” and grammatical equivalents thereof is meant the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are required to replicate the viral genome and / or a payload flanked by ITRs. The rep coding region, as used herein, may be derived from any viral serotype, such as those described above. The region need not include all of the wild-type genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the rep genes provide for expression Rep proteins. Rep coding sequences are further described below.

[0068] By "AAV cap coding region" or “sequence encoding one or more cap proteins,” or “Cap encoding sequence” and grammatical equivalents thereof it is meant the art-recognized region of the AAV genome which encodes the coat proteins of the virus which are required for the capsid that viral genome or a payload is packaged into by the Rep proteins. For a further description of the cap coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol, and Immunol. 158, 97-129; Kotin, R. M. (1994) Human Gene Therapy 5, 793-801. The AAV cap coding region, as used herein, may be derived from any AAV serotype, as described above. The region need not include all of the wild-type cap genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the genes provide for sufficient packaging functions. Cap coding sequences are further described below.

[0069] By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art- recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the viral genome. The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin, R. M. (1994) Human Gene Therapy 5, 793-801; Berns, K. I. "Parvoviridae and their Replication" in Fundamental Virology, 2d ed., (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 ITRs sequence. As used herein, an "AAV ITR" need not have a wild-type nucleotide sequence, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. The AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, etc.Furthermore, 5' and 3’ ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate. The ITRs may be single stranded (ssITRs) or self-complementary (scITRs).

[0070] A "helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.

[0071] "Helper virus function(s)" refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, "helper virus function" may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.

[0072] An "infectious" virus or viral particle is one that comprises a polynucleotide component which it is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an “infectious” virus or viral particle is one that may access a target cell, may infect a target cell, and may express a heterologous nucleic acid in a target cell. Thus, “infectivity” refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity may refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles may be expressed as the number of viral genome (vg) copies. The ability of a viral particle to express a heterologous nucleic acid in a cell may be referred to as “transduction.” The ability of a viral particle to express a heterologous nucleic acid in a cell may be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA). Viral infectivity may be expressed as the ratio of infectious viral particles to total viralparticles. Methods of determining the ratio of infectious viral particle to total viral particle are known in the art. See, e.g., Grainger et al. (2005) Mol. Ther. 11 :S337 (describing a TCID50 infectious titer assay); and Zolotukhin et al. (1999) Gene Ther. 6:973.

[0073] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. Tf present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.

[0074] As used herein, the term “polynucleotide construct” refers to a DNA segment of any size that includes one or more sequences encoding an RNA or protein and at least one promoter for driving expression from the one or more sequences. A polynucleotide construct may be a circular DNA or a linear DNA. A polynucleotide construct may be single stranded or double stranded. As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which may transfer gene sequences into and between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. The use of the term "vector" throughout this specification encompasses plasmid or viral vectors, which permit the desired components to be transferred to the host cell via transfection or infection. For example, an adeno-associated viral (AAV) vector is a plasmid comprising a recombinant AAV genome. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A vector may be linear or circular, single stranded or double stranded, DNA or RNA. In certain aspects, the vector may be circular, double stranded DNA.

[0075] As used herein, the term “vector system” refers to two or more vectors that are used together, e.g., by simultaneous or sequential introduction into a cell, to provide at least two different components into the cell. The two different components may then work together in the cell.

[0076] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. The term percent “sequence identity,” inthe context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “sequence identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0077] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the reference sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:[(Number of Identical Positions) / (Total Number of Positions in the Test Sequence)] x 100%

[0078] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scoresfor nucleic acids can be scored by set match / mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when using the BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:Percent Sequence Identity = (“Percent Identity” output value) x (“Query Coverage” output value)

[0079] The following non-limiting examples illustrate the calculation of percent identity between two nucleic acids sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 1 : AAAAAGGGGG (length = 10 nucleotides) to reference sequence 2: AAAAAAAAAA (length = 10 nucleotides). The percent identity between test sequence 1 and reference sequence 2 would be [(5) / (10)] xl00% = 50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides) to reference sequence 4: GGGGGGGGGG (length = 10 nucleotides). The percent identity between test sequence 3 and reference sequence 4 would be [(10) / (20)] xl00% = 50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated to compare test sequence 5: GGGGGGGGGG (length = 10 nucleotides) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides). The percent identity between test sequence 5 and reference sequence 6 would be [(10) / (10)] xl00% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.

[0080] The following non-limiting examples illustrate the calculation of percent identity between two protein sequences. The percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)] x 100%. Percent identity is calculated to compare test sequence 7: FFFFFYYYYY (length = 10 amino acids) to reference sequence 8: YYYYYYYYYY (length = 10 amino acids). The percent identity between test sequence 7 and reference sequence 8 would be [(5) / ( 10)] xl00% = 50%. Test sequence 7 has 50%sequence identity to reference sequence 8. In another example, percent identity is calculated to compare test sequence 9: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids) to reference sequence 10: FFFFFYYYYY (length = 10 amino acids). The percent identity between test sequence 9 and reference sequence 10 would be [(10) / (20)] xl00% = 50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated to compare test sequence 11 : FFFFFYYYYY (length = 10 amino acids) to reference sequence 12: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids). The percent identity between test sequence 11 and reference sequence 12 would be [(10) / (10)] xl00% = 100%. Test sequence 11 has 100% sequence identity to reference sequence 12.

[0081] For purposes herein, reference to a polynucleotide sequence (e.g., a DNA sequence or an RNA sequence) also encompasses the reverse complement of the polynucleotide sequence. For example, a sequence of AAAAAGGGGG also encompasses a sequence of CCCCCTTTTT.

[0082] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.

[0083] The term "host cell" denotes, for example, microorganisms, yeast cells, insect cells, and mammalian cells, that may be, or have been, used as recipients of an AAV vector system as described herein, or other transfer DNA. The term includes the progeny of the original cell which has been transfected. Thus, a "host cell" as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.

[0084] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.

[0085] The term "cell culture," refers to cells grown adherent or in suspension, bioreactors, roller bottles, hyperstacks, microspheres, macrospheres, flasks and the like, as well as the components of the supernatant or suspension itself, including but not limited to rAAV particles, cells, cell debris, cellular contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids, and lipids, and flocculants. Large scale approaches, such as bioreactors, including suspension cultures and adherent cells growing attached to microcarriers or macrocarriers instirred bioreactors, are also encompassed by the term "cell culture." Cell culture procedures for both large and small-scale production of proteins are encompassed by the present disclosure.

[0086] The encapsidation ratio of a population of rAAV virions may be measured as the ratio of rAAV viral particle (VP) to viral genome (VG). The rAAV viral particle includes empty capsids, partially full capsids (e.g., comprising a partial viral genome), and full capsids (e.g., comprising a full viral genome).

[0087] The F:E ratio of a population of rAAV virions may be measured as the ratio of rAAV full capsids to empty capsids. The rAAV full capsid particle includes partially full capsids (e.g., comprising a partial viral genome) and full capsids (e.g., comprising a full viral genome). The empty capsids lack a viral genome.

[0088] The potency or infectivity of a population of rAAV virions may be measured as the percentage of target cells infected by the rAAV virions at a multiplicity of infection (MOI; viral genomes / target cell). Exemplary MOI values are 1 x 101, 1 x 102, 2 x 103, 5 x 104, or 1 x 105vg / target cell. An MOI may be a value chosen from the range of 1 x 101to 1 x 105vg / target cell.

[0089] The term “auxotrophic” or “auxotrophic selection marker” as used herein refers to the usage of a medium lacking a supplement, such as a medium lacking an essential nutrient such as the purine precursors hypoxanthine and thymidine (HT), or the like, for selection of a functional enzyme which allows for growth in the medium lacking the essential nutrient, e.g., a functional dihydrofolate reductase or the like.

[0090] The terms “tetracycline” is used generically herein to refer to all antibiotics that are structurally and functionally related to tetracycline, including tetracycline, doxycycline, demeclocycline, minocycline, sarecycline, oxytetracycline, omadacycline, or eravacycline.

[0091] The terms “constitutive” or “constitutive expression” are used interchangeably herein. They refer to genes that are transcribed in an ongoing manner. Such gene are driven by a constitutive promoter. In some embodiments, the terms refer to the expression of a therapeutic payload or a nucleic acid sequence that is not conditioned on addition of an expression triggering agent to the cell culture medium. A constitutive promoter is capable of directing continuous gene expression in a cell. Constitutive promoters regulate expression of basal genes, like housekeeping genes. In contrast, an inducible promoter directs gene expression in the presence of particular transcription activator(s) or absence of a transcription repressor(s). Thus, an inducible promoter can be controlled by controlling the level of the transcription activator(s) or transcription repressor(s).

[0092] As used herein, the term “polynucleotide payload” refers to a polynucleotide sequence that is packaged into a rAAV virion for delivery by the rAAV virion into a cell. A polynucleotidepayload is flanked by AAV inverted terminal repeats (ITRs). Upon delivery to a cell, the polynucleotide payload may be available to the cell as a DNA (e.g., a homology region for homology-directed repair), transcribed into an RNA (e.g., a guide RNA (gRNA), a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, an antisense oligonucleotide (ASO)), or transcribed and translated into a polypeptide (e.g., an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, or a DNAzyme.

[0093] "Recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.

[0094] A "control element" or "control sequence" is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter. A promoter is usually upstream of a gene whose expression is controlled by the promoter.

[0095] "Operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.

[0096] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous payload is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-typeAAV, and the encoded heterologous payload is a payload not normally encoded by a naturally- occurring, wild-type AAV. As another example, a large Rep coding sequence operatively linked to a heterologous promoter refers to a large Rep coding sequence operatively linked to a nonnative promoter.

[0097] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell. For example, a gene integrated into the nuclear genome of the cell and is available to perform its function during extended culture of the cell in vitro. A gene integrated into the nuclear genome of the cell is inheritable by progeny of the cell.

[0098] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti- angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a payload to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti- angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a payload to a mammalian subject (which may be referred to as "transgenes" to be delivered to a recipient cell), include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.

[0099] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment may be measured on an absolute basis, such as weight per volume of solution, or it may be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some cases purified, e.g., from about 80% to about 90% pure, at leastabout 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.

[0100] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. The term “treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and / or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom(s) but has not yet been diagnosed as having it; (b) inhibiting the disease and / or symptom(s), i.e., arresting development of a disease and / or the associated symptoms; or (c) relieving the disease and the associated symptom(s), i.e., causing regression of the disease and / or symptom(s). Those in need of treatment may include those already afflicted (e.g., those with a neurological disorder) as well as those in which prevention is desired (e.g., those with increased susceptibility to a neurological disorder; those suspected of having a neurological disorder; those having one or more risk factors for a neurological disorder, etc.).

[0101] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, is sufficient, in combination with another agent, or alone in one or more doses, to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.

[0102] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses, camels, etc.); mammalian farm animals (e.g., sheep, goats, cows, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some cases, the individual is a human.

[0103] The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson Crick base pairing.

[0104] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. Forexample, a single-stranded nucleic acid molecule may have two homologous regions which are capable of hybridizing to each other. Thus, the term "homologous region" includes nucleic acid segments with complementary sequences. Homologous regions may vary in length, but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).

[0105] As used herein, the terms "complementary" or "complementarity" refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands may base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when a uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. "Complementarity" may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be "complementary" and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered "perfectly complementary" or " 100% complementary" even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other. "Less than perfect" complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.

[0106] As used herein, the term “recombination site” denotes a region of a nucleic acid molecule comprising a binding site or sequence-specific motif recognized by a site-specific recombinase that binds at the target site and catalyzes recombination of specific sequences of DNA at the target site. Site-specific recombinases catalyze recombination between two such target sites. The relative orientation of the target sites determines the outcome of recombination. Forexample, translocation occurs if the recombination sites are on separate DNA molecules. DNA between two recombination sites oriented in the same direction on the same DNA molecule will be excised as a circular loop of DNA. DNA between two recombination sites that are orientated in the opposite direction on the same DNA molecule will be inverted.

[0107] As used herein, the term “enhancer” refers to a non-translated nucleic acid sequence that is contiguous with the coding sequence (in cis) and functions to increase expression of the transcript and / or protein from the coding sequence. Enhancers can include transcriptional enhancers or translational enhancers. Transcriptional enhancers are DNA sequences and influence the rate at which a nearby gene is transcribed into messenger RNA (mRNA) and, ultimately, translated into a functional protein. A translational enhancer is a specific sequence or structural element in messenger RNA (mRNA) that plays a role in regulating the process of translation. Translational enhancers can be involved in modulating the efficiency or specificity of translation.

[0108] The terms "antibody" and “immunoglobulin” include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fc fragments, chimeric antibodies, humanized antibodies, singlechain antibodies, including antibodies comprising only heavy chains (e.g. VHH camelid antibodies), bispecific antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein.Polynucleotides for Large Rep proteins and Small Rep Proteins Expression

[0109] The large Rep coding sequence partially overlaps with the small Rep coding sequence such that the small Rep coding sequence is common within a portion of the large Rep coding sequence. The large Rep coding sequence encodes two large Rep proteins, Rep78 and Rep68. The large Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the large Rep protein, Rep78 and the other mature mRNA encodes the large Rep protein, Rep68. The small Rep coding sequence encodes two small Rep proteins, Rep52 and Rep40. The small Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the small Rep protein, Rep52 and the other mature mRNA encodes the small Rep protein, Rep40.

[0110] A polynucleotide is provided that includes a first promoter operably linked to a large Rep coding sequence. In some embodiments, the first promoter is heterologous to the large Rep coding sequence. The large Rep coding sequence includes a small Rep coding sequence. In someembodiments, a promoter operably is linked to the small Rep coding sequence. The promoter operably linked to the small Rep coding sequence has higher promoter activity as compared to the first promoter. In some embodiments, the large Rep coding sequence includes an intron and a small Rep coding sequence. The intron includes a second promoter operably linked to the small Rep coding sequence. The second promoter has higher promoter activity as compared to the first promoter. In some embodiments, the second promoter is heterologous to the small Rep coding sequence and the second promoter has higher promoter activity as compared to the first promoter.

[0111]

[0112] In certain aspects, the large Rep coding sequence comprises (i) a functional pl9 promoter operably linked to the small Rep coding sequence and (ii) the intron comprising the second promoter. In this aspect, the polynucleotide expresses two small Rep coding transcripts, one expressed under the control of the pl9 promoter and the other expressed under the control of the second promoter. Both transcripts encode the two small Rep proteins, Rep58 and Rep 40 when alternatively spliced. In certain aspects, the intron and hence the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.

[0113] In other aspects, the pl9 promoter is mutated to substantially reduce promoter activity. In some embodiments, the TATA box of the pl9 promoter is mutated. In certain aspects, the mutated pl9 promoter results in a reduction of expression of the small Rep to a level that is at least 30% less, at least 40% less, at least 50% less, at least 60% less, at least 70% less, at least 80% less, at least 90% less, or is undetectable as compared to the expression level of the small Rep under the control of the native pl9 promoter. In some aspects, the polynucleotide lacks a functional pl9 promoter.

[0114] In certain aspects, the first promoter operably linked to the large Rep coding sequence is the native p5 promoter and the expression from the large Rep coding sequence is controlled by the p5 promoter.

[0115] In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the native p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0116] In certain aspects, the p5 promoter present upstream of the AAV large Rep coding sequence is mutated to substantially reduce promoter activity. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the mutated p5 promoter and both the first promoter and the p5 promoter controlexpression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0117] In other aspects, the polynucleotide lacks a functional p5 promoter. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the first promoter and lacks a p5 promoter for controlling expression from the large Rep coding sequence. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is removed. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is replaced with the first promoter. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.

[0118] In certain aspects, one or both of the first and second promoters for driving the expression of the large Rep proteins and small Rep proteins, respectively, are independently selected from constitutive promoters and / or inducible promoters. In certain aspects, the first promoter and the second promoter may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Rous sarcoma virus long terminal repeat (RSV) promoter, chicken beta actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken beta actin (CAG) promoter, ribosomal protein L13a (RPL13a) promoter, elongation factor 1-alpha (EFla or EFl alpha) promoter, simian virus 40 (SV40) early promoter, phosphoglycerate kinase (PGK) promoter, hypoxanthine-guanine phosphoribosyltransferase (Hprt) promoter, glyceraldehyde-3- phosphate dehydrogenase (GAPDH) promoter, albumin promoter (ALB), muscle creatine kinase (MSC) promoter, sialophorin promoter (CD43), histone H4 promoter, prostaglandin synthase 2 (PGS2) promoter, activated leukocyte cell adhesion molecule (ALCAM) promoter, fragile X mental retardation 1 (FMRI) promoter, CD68 promoter keratin 14 (K14) promoter, Thyl promoter, pax6 paired box (P2) promoter, elongation factor 2 (EF2) promoter, platelet-derived growth factor beta (PDGF-B) promoter, vascular endothelial growth factor receptor 2 (Flk-1) promoter, glucocorticoid receptor promoter (GRP), Lek promoter, myosin light chain 2 (MLC-2) promoter, chromobox homolog 3 (Cbx3) promoter, Nanog promoter, pancreatic and duodenal homeobox 1 (PDX1) promoter, neuron- specific enolase (NSE) promoter, CCAAT / enhancer binding protein alpha (C / EBPa) promoter, Vavl promoter, Rosa26 promoter, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (hPGCla) promoter, cytokeratin 19 (Ckl9) promoter, myeloperoxidase (MPO) promoter, fatty acid binding protein 4 (FABP4) promoter, TATA box promoter, endothelial nitric oxide synthase (eNOS) promoter, vivmentin promoter, glial fibrillary acidic protein (GFAP) promoter, calcium / calmodulin-dependent protein kinase II alpha (CaMKII ) promoter, y-actin promoter, plasminogen activator inhibitor- 1 (PAI-1) promoter, and stromal cell-derived factor 1 (SDF-1) promoter. . In certain aspects, the firstpromoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter, or (v) the first promoter is a herpes simplex virus (HSV) thymidine kinase (TK) HSVtk promoter and the second promoter is a murine leukemia virus-derived (MND) promoter.

[0119] In certain aspects, the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing the Rep proteins. The intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce the large Rep proteins, Rep78 and Rep68.

[0120] In certain aspects, the polynucleotide includes an excisable element that controls expression of large and small Rep proteins. The excisable element is positioned in the small Rep coding sequence since the small Rep coding sequence is common with the large Rep coding sequence such that expression of both small and large Rep proteins can be controlled. The excisable element includes a sequence comprising a stop codon which prevents translation of the full-length Rep proteins, resulting in expression of truncated Rep proteins that are non-functional and lack toxicity associated with the full-length Rep proteins. The excisable element includes a first recombination site and a second recombination site flanking the sequence comprising the stop codon. The first recombination site and the second recombination site are oriented in the same direction and recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon allowing expression of full-length large Rep proteins and full-length small Rep proteins.

[0121] In certain aspects, the small Rep coding sequence may include a first spacer segment and a second spacer segment flanking the excisable element, wherein the first spacer segment comprises a 5’ splice site (5’SS) at the 5’ end of the first spacer segment followed by a first intron and the second spacer segment comprises a second intron followed by a first 3 ’ end of the second spacer segment, wherein the excisable element comprises from 5’ end to 3’ end: the first recombination site, a second 3’ splice site (3’SS), the stop signaling sequence (e.g., a stop codon), and the second recombination site.

[0122] In certain aspects, the excisable element is flanked by a split intron to prevent read- through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAVRep coding sequence, a 5’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3 ’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in the same direction, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins.

[0123] In certain aspects, the excisable element is flanked by a split intron to prevent read- through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5’ splice site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in opposite directions, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins.

[0124] In certain aspects, the excisable element includes a sequence encoding a marker protein (e.g., a detectable marker) in frame with the stop codon such that the marker protein is expressed when the excisable element is present. For example, detectable markers contemplated hereininclude luminescent markers, fluorescent markers, or radiolabels. Fluorescent markers include, but are not limited to, EGFP, GFP, BFP, RFP, or any combination thereof. In certain aspects, the 5’ splice site is a rabbit beta globin 5’ splice site. In certain aspects, both of the first and second 3’ splice sites are rabbit beta globin 3’ splice sites. In certain aspects, the vector may include an excisable element as described in US20220145328A1, e.g., paragraphs 10, 30, and 31, which are incorporated herein by reference.

[0125] In certain aspects, the polynucleotide includes a tag encoding sequence present in frame with the large Rep coding sequence and the small Rep coding sequence such that the large Rep and the small Rep each are expressed as a fusion protein comprising the tag. Any suitable tag may be used. In certain aspects, the tag is a purification tag and / or a detectable tag. In certain aspects, the tag may be a poly-Histidine tag, a Flag tag, a MYC tag, a GST tag, a MBP tag, a strep tag, etc.

[0126] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a vector not having the first promoter. In certain aspects, the vector is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a vector not having the first promoter. In certain aspects, the vector is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep proteins.

[0127] In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a vector not having the second promoter. In certain aspects, the vector is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a vector having a pl9 promoter. In certain aspects, the second promoter is stronger than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl9 promoter. In certain aspects, the second promoter is weaker than the pl 9 promoter and strongerT1than the first promoter driving expression of the large Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a vector not having the second promoter. In certain aspects, the vector is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a vector having a pl9 promoter. In certain aspects, the second promoter is stronger than the p!9 promoter. In certain aspects, the second promoter is weaker than the p!9 promoter. In certain aspects, the second promoter is weaker than the pl 9 promoter and stronger than the first promoter driving expression of the large Rep proteins.

[0128] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the small Rep proteins. In certain aspects, the first promoter is weaker than the second promoter.

[0129] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts using the vector is higher than the ratio of the small Rep transcripts to large Rep transcripts ratio produced using a vector that includes a p5 promoter instead of the first promoter for driving large Rep transcripts expression and includes a pl9 promoter instead of the second promoter for driving small Rep transcripts expression. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins using the vector is higher than the ratio of the small Rep proteins to large Rep proteins ratio produced using a vector that includes a p5 promoter instead of the first promoter for driving large Rep proteins expression and includes a pl 9 promoter instead of the second promoter for driving small Rep proteins expression.

[0130] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts ranges from 1.5:1 to 10,000: 1, including 1.5:1 ; 1.8:1 ; 2:1; 2.3:1 ; 2.5:1; 2.8: 1 ; 3: 1; 3.5: 1; 4:1 ; 4.5:1; 5:1; 5.5:1; 6:1 ; 6.5:1; 7: 1; 7.5:1; 8: 1; 8.5:1; 9:1; 9.5:1 ; 10:1; 50:1 ; 100:1 ; 300:1 ; 500: 1 ; 1000: 1; 3000: 1; 5000: 1 ; or 10,000: 1. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1 ; 2.3:1 ; 2.5:1; 2.8: 1 ; 3: 1; 3.5:1 ; 4:1; 4.5: 1 ; 5:1; 5.5: 1; 6:1; 6.5: 1; 7:1; 7.5:1; 8: 1 ; 8.5:1; 9: 1; 9.5: 1 ; 10: 1 ; 50: 1; 100:1; 300:1 ; 500:1; 1000:1; 3000: 1 ; 5000:1; or 10,000: 1.

[0131] In certain aspects, the large Rep coding sequence encodes transcripts that include the intron. When expressed in a suitable cell, the intron is excised to generate processed transcriptsthat can be translated into Rep78 and Rep68. In certain aspects, the large Rep coding sequence also includes the excisable element. When present in a suitable cell that also includes a recombinase (e.g., an inducible recombinase) that recombines the first and second recombination sites, the excisable element is removed and the large Rep coding sequence is transcribed into transcripts that include the intron, which intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68.

[0132] Tn certain aspects, the open reading frame of sequence encoding the small Rep proteins is present within the large Rep coding sequence and the second promoter drives the expression of transcripts that are translated into Rep52 and Rep40. In certain embodiments, the second promoter is located within an intron.

[0133] FIG. 1A depicts a schematic of a polynucleotide according to one embodiment described herein. The polynucleotide includes an upstream heterologous promoter (e.g., a first promoter) that replaces the native p5 (“P5”) promoter for AAV large Rep. In this example, the native pl9 (“P19”) promoter is mutated to reduce expression of the small Rep (e.g., comprises a TATA box mutation). The open reading frame (ORF) of the large Rep partially overlaps with the ORF for the small Rep since large and small Rep genes share the same ORF in the 3 ’-end. Upstream half of Rep in this schematic refers to the portion of the large Rep coding sequence that encodes the large Rep sequences that do not overlap with the small Rep coding sequence. Downstream half of Rep in this schematic refers to the small Rep coding sequence which also includes the ORF that is part of the 3 ’end of the large Rep coding sequence. The custom intron of the schematic is an intron that is inserted in between the upstream half and downstream half of Rep and upstream of the small Rep coding sequence. However, in certain aspects, the intron may be positioned further downstream within the small Rep coding sequence with respect to the transcription start site for the small Rep, closer to the start site. In certain aspects, the intron may be positioned further upstream with respect to the transcription start site for the small Rep, closer to the pl9 promoter (e.g., within 10 nucleotides (nt), within 25 nt, within 50 nt, within 100 nt, within 250 nt, or within 500 nt). By placing the split intron and excisable element configuration proximally to the native p 19 promoter or heterologous promoter minimizes the transcript length, and potentially the associated polypeptide, which may further minimize the likelihood of a functional polypeptide. The intron may include a multiple cloning site to facilitate introduction of the second promoter for driving expression of the small Rep. The second promoter may be heterologous to the small Rep coding sequence. The polynucleotide construct also may include an optional ORF encoding a tag that is in-frame with the large Rep and small Rep ORFs which results in production of tagged large and small Rep proteins. The pl9 (“P19”) promoter may not includeany mutations that decrease promoter activity. Additionally, the 5’ splice site and 3 ’splice sites should be in an intron-exon context, such as one or more of: CAG-G, CAG-A, AAG-G, or AAG- A, where the hyphen denotes site of insertion.

[0134] FIG. IB. Schematic of a polynucleotide for expression of AAV large Rep transcripts and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Rep coding sequence and the TATA box of the pl9 (“P19”) promoter is mutated to decrease promoter activity.

[0135] FIG. 2A depicts a schematic of a polynucleotide shown in FIG. 1A for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter (e.g., a second promoter) is introduced into the intron for driving transcription from the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence. The pl9 (“P19”) promoter is not modified to decrease promoter activity.

[0136] FIG. 2B depicts a schematic of a polynucleotide shown in FIG. 2A for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts. An intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter (e.g., a second promoter) is inserted into the intron and operably connected to the small Rep coding sequence. The schematic further depicts that the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated to decrease promoter activity.

[0137] FIG. 3 illustrates three types of transcripts produced from the polynucleotide shown in FIG. 2B. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron. Upon splicing out of the intron, large Rep proteins are translated from the processed transcripts. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is translated into small Rep proteins. Transcript 3 is produced under the control of the p 19 promoter and is similar to Transcript 2.

[0138] FIG. 5 depicts a schematic of a polynucleotide shown in FIG. 2B with an excisable element inserted at a position that encodes a sequence common to large and small Rep proteins. The excisable element includes a stop codon flanked by recombination sites. Presence of this excisable element prevents expression of both full-length large Rep proteins and full-length small Rep proteins. In the presence of a recombinase, the recombination sites are joined and the stop codon is removed, allowing for expression of full-length large Rep proteins and full-length small Rep proteins.

[0139] FIG. 6 illustrates three types of transcripts produced from the polynucleotide shown in FIG. 5. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron and is not translated into large Rep proteins due the presence of the stop codon in the excisable element. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is not translated into small Rep proteins due the presence of the stop codon in the excisable element. Transcript 3 is produced under the control of the p 19 promoter and initially includes the intron and is not translated due the presence of the stop codon in the excisable element. In particular embodiments, the encoded Rep proteins, are large and small Rep proteins from AAV serotypes AAV-1, AAV-2, AAV-3, AAV- 4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof. In particular embodiments, the encoded Rep proteins are large Rep proteins and small Rep proteins from AAV serotype 2.

[0140] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004).

[0141] In some embodiments, the Rep polypeptide is a wildtype Rep polypeptide. In other embodiments, the Rep polypeptide is a mutant Rep polypeptide. In some embodiments, the Cap polypeptide is a wildtype Cap polypeptide. In other embodiments, the Cap polypeptide is a mutantCap polypeptide. Wild type Rep polypeptides can be selected from one or more of SEQ ID NOs: 139-148, while wild type Cap polypeptides can be selected from one or more of SEQ ID NOs: 149-164. The table below provides a summary of which polypeptide sequences correlate to whichAAV serotypes.Polynucleotides Comprising an Enhancer for Rep Protein Expression

[0142] In certain embodiments, a polynucleotide comprising an AAV Rep coding sequence operably linked to native Rep promoters, a PolyA signal sequence; and an enhancer downstream of the PolyA signal sequence is provided. A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer. The enhancer increases the expression of the Rep proteins as compared to expression from a polynucleotide lacking the enhancer.

[0143] A suitable polyA signal sequence may be a signal sequence that increases the length of poly A added to Rep mRNAs and / or the amount of Rep mRNAs with a long polyA as compared to a coding sequence not including the PolyA signal sequence. In certain cases, the polyA signal sequence may be an AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a native AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than AAV Rep polyA signal sequence. In certain embodiments, a polyA signal sequence that is stronger than AAV Rep polyA signal sequence may be bGH-polyA signal sequence or a SV40 polyA signal sequence as described herein. Additional suitable polyA signal sequences are described below in a section titled “PolyA signal sequences”.

[0144] In a particular embodiment, a polynucleotide comprising the AAV Rep coding sequence operably linked to native Rep promoters, the bGH-PolyA signal sequence downstreamof the AAV Rep coding sequence; and an enhancer downstream of the bGH-PolyA signal sequence is provided.

[0145] A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer.Suitable enhancers are described below is a section titled “Enhancers.”_ PolyA Signal Sequence

[0146] In certain cases, the polyA signal sequence may be a AAV Rep polyA signal sequence and include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 1.

[0147] In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than a AAV Rep polyA signal sequence, wherein the native AAV Rep polyA signal sequence includes a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 1. A PolyA signal sequence that is stronger than AAV Rep PolyA signal sequence provides for an expression level of the Rep proteins that is higher than the expression level of the Rep proteins using the AAV Rep PolyA signal sequence, e.g., at least 5%, 10%, 20%, 30%, 40%, 50% higher, or more.

[0148] In various instances, the polyadenylation signal sequence comprises one or more of a bovine growth hormone poly adenylation (bGH-PolyA), a human growth hormone polyadenylation (hGH-PolyA), and / or a Chinese hamster growth hormone polyadenylation (chGH-PolyA).

[0149] The bGH-PolyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2.

[0150] The hGH-polyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 3.

[0151] The chGH-polyA signal may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 4.

[0152] Additional details regarding PolyA signal sequences are disclosed in US Pat. Nos. 11,793,180, 11,752,181, 10,912,826, 8,975,391, 7,557,197, and 5,122,458; US Pat. Pub. Nos. 2023 / 0332169, 2023 / 0330265, and 2023 / 0323390; or Gene Volume 231, Issues 1-2, 29 April1999, Pages 77-86, Mol Cell Biol. 1989 Oct; 9(10): 4248-4258, and Nucleic Acids Research, Volume 15, Issue 23, 10 December 1987, Pages 9627-9640 and the disclosed PolyA signal sequences are hereby incorporated by reference in their entireties.

[0153] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5.

[0154] Additional suitable polyA signal sequences can be selected from one or more of human neurophilin- 1 polyA, nopaline synthase polyA, alpha globulin polyA, rabbit globin polyA, and / or other applicable polyadenylation signal sequences. In such instances, the polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: 6-10._ Enhancers

[0155] An enhancer can be any enhancer or combination of enhancers that increase transcription and / or translation of a gene. In certain cases, the enhancer present downstream of the polyA signal sequence (e.g., AAV Rep polyA signal sequence or a stronger polyA signal sequence, such as, bGH-PolyA signal sequence or SV40 polyA signal sequence) that is present downstream of the Rep coding sequence may be a single enhancer or may include combination of enhancers that increase transcription and / or translation of AAV Rep proteins. A combination of enhancers can include two enhancers (i.e., double enhancer), three enhancers (i.e., triple enhancer), four enhancers, five enhancers, or more enhancers.

[0156] In certain instances, an enhancer is selected from a cytomegalovirus (CMV) enhancer (SEQ ID NO: 165), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), and a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167). In certain embodiments, the enhancer comprises a sequence selected from SEQ ID NOs: 165-167. In various embodiments, the enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one of SEQ ID NOs: 165-167. In certain embodiments, the enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one of SEQ ID NOs: 165-167.

[0157] Some embodiments incorporate a “double enhancer” comprising any two enhancers selected from a CMV enhancer (SEQ ID NO: 165), an SV40 enhancer (SEQ ID NO: 166), and anhTERT enhancer (SEQ ID NO: 167). In some embodiments incorporating a double enhancer, the double enhancer comprises a CMV enhancer and an SV40 enhancer. In some embodiments incorporating a double enhancer, the double enhancer comprises an hTERT enhancer and an SV40 enhancer. In some embodiments incorporating a double enhancer, the double enhancer comprises a CMV enhancer and an hTERT enhancer.

[0158] In certain embodiments, the double enhancer comprises the sequence of SEQ ID NO: 168. In various embodiments, the double enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 168. In certain embodiments, the double enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 168.

[0159] Some embodiments incorporate a “triple enhancer” comprising a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments, the order from 5’ to 3’ of the enhancers of a triple enhancer is 5 ’-hTERT enhancer-SV40 enhancer-CMV enhancer-3’. In some embodiments, an enhancer, such as a triple enhancer, is operably linked to the Rep gene. Additional details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a REIC / Dkk-3 -encoding adenoviral vector, Oncology Reports 31 :1089-95 (2014); the disclosure of which is hereby incorporated by reference in its entirety.

[0160] In certain embodiments, the triple enhancer comprises the sequence of SEQ ID NO: 11. In various embodiments, the triple enhancer comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 11. In certain embodiments, the triple enhancer comprises at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 11.

[0161] In some embodiments, the enhancer is a transcriptional enhancer comprising a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: Tl-25. In some embodiments, the enhancer can include two or more of these sequences.

[0162] In addition to or instead of a transcriptional enhancer, some embodiments include a translational enhancer. In various embodiments, a translational enhancer is selected from a SARS- CoV2 5’-UTR or a variant thereof (SEQ ID NOs: 26-42). Specifically, SEQ ID NO: 26 provides the entire SARS-CoV2 5’-UTR, while SEQ ID Nos: 27-42 provide variants of the SARS-CoV2 5’-UTR. Such variants include substituting a region of the SARS-CoV2 5’-UTR with anotherelement (SEQ ID NO: 27), altering a sequence of the SARS-CoV2 5’-UTR (SEQ ID NO: 28), or deletion variants of the SARS-CoV2 5’-UTR (SEQ ID Nos: 29-42), where each deletion variant represents a fragment of the entire SARS-CoV2 5’-UTR. In some embodiments, a SARS-Cov2 5’UTR is operably linked to the Rep coding sequence. Additional details can be found in WO 2021 / 231503; the disclosure of which is hereby incorporated by reference in its entirety. In many instances, the SARS-Cov2 5’UTR is located upstream of (i.e., 5’ of) the Rep coding sequence. In many instances, the SARS-Cov2 5’UTR is located downstream of (i.e., 3’ of) the Rep coding sequence.

[0163] Additionally or alternatively, some embodiments select a translational enhancer based on a mouse homeobox a9 (Hoxa9) IRES-like element. The Hoxa9 IRES-like element possesses four pairing elements (P1-P4). The P4 element (SEQ ID NO: 43) forms a stem-loop structure that has shown an ability to enhance translation. Certain embodiments may utilize a variant of the P4 element, such as a sequence variant selected from SEQ ID Nos: 44-54 or a structural variant selected from SEQ ID Nos: 55-56. The structural variants of SEQ ID Nos: 55-56 represent the respective arms of the P4 stem-loop structure. In some embodiments, a Hoxa9 IRES-like element is operably linked to the Rep gene. Additional details can be found in WO 2021 / 231502; the disclosure of which is hereby incorporated by reference in its entirety. In many instances, the Hoxa9 IRES-like element is located upstream of the Rep coding sequence. In many instances, the Hoxa9 IRES-like element is located downstream of the Rep coding sequence.

[0164] In various instances, a translational enhancer comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to any one of SEQ ID NOs: 11-116 and 165-168.

[0165] Additional details regarding enhancers are disclosed in one or more of: US Pat. No. 5,723,332; US Pat. Pub. Nos. 2023 / 0323390, 2023 / 0321238, 2023 / 0272378, 2023 / 0265381, 2023 / 0203515, 2023 / 0193304, 2023 / 0175018, 2021 / 0060182, and 2013 / 0177581 ; PCT Pub. Nos. WO 2021 / 231503 and WO 2021 / 231502; and Scientific Reports volume 8, Article number: 13753 (2018), Proc Natl Acad Sci U S A. 2012 Apr 24; 109(17): 6626-6631, PNAS January 7, 2010 107 (4) 1385-1390, Transgenic Research volume 19, pages 667-674 (2010), Journal of Bioscience and Bioengineering Volume 105, Issue 3, March 2008, Pages 300-302, Journal of Bioscience and Bioengineering, Volume 98, Issue 1, 2004, Pages 1-8, Virology Volume 321, Issue 1, 30 March 2004, Pages 36-46; the disclosures of which are hereby incorporated by reference in their entireties.

[0166] In certain aspects, the polynucleotide also includes an AAV Cap coding sequence. The AAV Cap coding sequence may be operatively linked to an inducible promoter or constitutive promoter.

[0167] In certain aspects, the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence. In certain aspects, the polynucleotide comprises an inducible promoter operably linked to the Cap coding sequence. In certain aspects, the intervening sequence comprises a transcriptional blocking element (TBE). In these embodiments, a TBE separates the p5 promoter that is operably linked to the large Rep coding sequence and the inducible promoter p3 operably linked to AAV Cap coding sequence. In certain embodiments, the TBE comprises the sequence of SEQ ID NO: 117. In various embodiments, the TBE comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 117. In certain embodiments, the TBE comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 117.

[0168] In certain aspects, the Cap coding sequence may be operably linked to a polyadenylation (poly A) signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.

[0169] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2:

[0170] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5:

[0171] In certain aspects, the first promoter operatively linked to the large Rep coding sequence is present adjacent to the inducible promoter or constitutive promoter operatively linked to AAV Cap coding sequence, where the adjacent promoters are blocked from cross-promoting transcription by presence of an intervening sequence between the adjacent promoters. The intervening sequence may include a TBE such that the first promoter cannot affect transcriptionof Cap coding sequence and the inducible promoter or constitutive promoter operatively linked to AAV Cap coding sequence cannot affect transcription from the large Rep coding sequence.

[0172] In certain aspects, the large Rep coding sequence and small Rep coding sequence are both operably linked to a polyadenylation (poly A) signal sequence. In certain aspects, the large Rep coding sequence and small Rep coding sequence are both operably linked to a transcriptional and / or translational enhancer positioned downstream of the large Rep coding sequence and small Rep coding sequence. In certain aspects, the transcriptional and / or translational enhancer may be positioned downstream of the polyA signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.

[0173] In certain aspects, the transcriptional and / or translational enhancer positioned downstream of the large Rep coding sequence and small Rep coding sequence may be any transcriptional and / or translational enhancer functional in the cells used for producing the rAAV. In certain cases, the enhancer present downstream of the large Rep coding sequence and small Rep coding sequence and / or downstream of the polyA signal (e.g., bGH-PolyA signal or SV40 polyA signal) may be a single enhancer or may include combination of enhancers that increase transcription and / or translation of a gene. In certain embodiments, an enhancer can be any enhancer or combination of enhancers that increase transcription and translation of a gene.

[0174] Some embodiments utilize one or more enhancers selected from a cytomegalovirus (CMV) enhancer, a Simian virus 40 (SV40) enhancer, and a human telomerase reverse transcriptase (hTERT) enhancer. Some embodiments incorporate a “triple enhancer” comprising a CMV enhancer, an SV40 enhancer, and an hTERT enhancer. In some embodiments, the order from 5’ to 3’ of the enhancers of a triple enhancer is 5 ’-hTERT enhancer-SV40 enhancer-CMV enhancer-3’. In some embodiments, an enhancer, such as a triple enhancer, is operably linked to the Rep gene. Additional details can be found in M. Watanabe et al., A novel gene expression system strongly enhances the anticancer effects of a RElC / Dkk-3-encoding adenoviral vector, Oncology Reports 31 : 1089-95 (2014); the disclosure of which is hereby incorporated by reference in its entirety.

[0175] In certain embodiments, the triple enhancer comprises the sequence of SEQ ID NO: 11 :

[0176] In various embodiments, the triple enhancer comprises approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to SEQ ID NO: 11. In certain embodiments, the triple enhancer comprises at least 70%, at least 75%, at least80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 11.

[0177] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 2.

[0178] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 5.

[0179] FIG. 10 depicts an exemplary polynucleotide for expressing Rep and Cap proteins. In this embodiment, a TBE separates the first promoter that is operably linked to the large Rep coding sequence and the inducible promoter operatively linked to AAV Cap coding sequence. A triple enhancer is located downstream to the polyA signal sequence (denoted as PolyA).

[0180] hi other aspects, the AAV Cap coding sequence may be operably linked to a promoter, e.g., a constitutive promoter. In certain aspects, the promoter may be a native promoter. In certain aspects, the native promoter may be p40. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence. The AAV Cap coding sequence may be operably linked to an inducible promoter.

[0181] In some aspects, the capsid is a capsid selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC1 1, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68 (described in W02020 / 033842, incorporated herein by reference in its entirety). The hu68 capsid is described in WO 2018 / 160582, incorporated herein by reference in its entirety. In some aspects, the capsid is an AAV5 capsid.

[0182] In some aspects, the capsid is a derivative, modification, or pseudotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV 13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4,AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.

[0183] In some aspects, capsid protein is a chimera of capsid proteins from two or more serotype selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1 , AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 (described in W02020 / 033842, incorporated herein by reference in its entirety). In certain embodiments, the capsid is an rh32.33 capsid, described in US Pat. No. 8,999,678, incorporated herein by reference in its entirety.

[0184] In certain aspects, the polynucleotide also includes a coding sequence for a selectable marker. The coding sequence for the selectable marker may be operatively linked to a constitutive promoter. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR).

[0185] The polynucleotide described herein may be used in a vector. The vector comprising the polynucleotide may be used in conjunction with one or more additional vectors for producing rAAV. Such vector systems are provided in the following section.Vector Systems for Inducible Production of rAAV

[0186] A vector system for producing rAAV may include the vector for producing Rep proteins comprising the polynucleotide provided herein and described in the preceding section. This vector is referred to as a first vector as described in this section and the Methods for Producing recombinant AAV section. It is noted that use of the term first, second, third and the like is for purpose of distinguishing the components being referred to. In other instances, the vector for producing Rep proteins comprising the polynucleotide provided herein and described in the preceding section may be referred to as a second vector for example in Methods for Producing Cells for Inducibly Producing rAAV. One or more vectors as described in this section may be stably integrated into a cell. The vector systems as described herein may be stably integrated into a cell to produce a stable cell line, which when induced, is capable of producing rAAV.

[0187] A vector system for producing rAAV may include a first vector comprising the polynucleotide that is described in the preceding section; a second vector comprising a sequence encoding one or more AAV helper proteins and a third vector comprising a polynucleotide payload flanked by AAV inverted terminal repeats (ITRs). The ITRs may be ssITRs or scITRs.

[0188] In certain aspects, the second vector comprises an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a third recombination site and a fourth recombination site flanking the sequence encoding the inducible recombinase, wherein the third recombination site and the fourth recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding the one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a constitutive promoter operably linked to a sequence encoding a second selectable marker. It is noted that unless specified otherwise, upstream and downstream in the context a promoter and coding sequence is used to refer to the relative location of the promoter and the coding sequence where the promoter is upstream to the coding sequence.

[0189] In certain aspects, the first vector comprises a sequence encoding a first portion of a first selectable marker and a constitutive promoter operably linked to the sequence and the third vector comprises a sequence encoding a second portion of the first selectable marker and a constitutive promoter operably linked to the sequence, wherein the first and second portions associate to form functional first selectable marker, e.g., blasticidin.

[0190] hi certain aspects, the first vector comprises a VA-RNA coding sequence. In certain aspects, the first vector comprises an insert comprising: a first part of a constitutive promoter and a second part of a constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA. In certain aspects, the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter.

[0191] In various embodiments, the VA-RNA sequence is selected from one or more of SEQ IDNOs: 169-172:0192] In various embodiments, a fourth construct comprising a sequence encoding VA-RNA can comprise the sequence of any one of SEQ ID NOs: 173-174, wherein SEQ ID NO: 173 represents an uninduced or “off’ state, while SEQ ID NO: 174 represents an induced or “on” state. In various embodiments, the fourth polynucleotide or fourth construct comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOs: 173-174. In certain embodiments, the fourth polynucleotide or fourth construct comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one or more of SEQ ID NOs: 173-174.

[0193] In certain embodiments, the second polynucleotide or the fourth polynucleotide comprises an interrupted constitutive promoter operably linked to the VA-RNA coding sequence. The interrupted constitutive promoter is inactive due to presence of an insert. In one embodiment, the split constitutive promoter comprises: a first part of the constitutive promoter and a second part of a constitutive promoter separated by a second excisable element. The second excisable element comprising a fifth recombination site and a sixth recombination site flanking a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, wherein excision of the second excisable element by the inducible recombinase generates a functional complete constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA.

[0194] In certain embodiments, the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promotercomprises a proximal sequence element (PSE) of a U6 promoter. In certain embodiments, the staffer sequence comprises a constitutive promoter operably linked to a selectable marker. In certain embodiments, the selectable marker is the second selectable marker. In various embodiments, the interrupted constitutive promoter operably comprises the sequence of SEQ ID NO: 175. When the staffer sequence is excised (e.g., post- induction with a triggering agent and / or contacting with a recombinase), the resulting constitutive promoter operably comprises the sequence of SEQ ID NO: 176.

[0195] Adenoviral helper proteins may be any adenoviral helper protein selected from El A, E1B, E2A and E4 that is absent from a host cell for producing rAAV. In some embodiments, the host cell provides, one, two, or three of the four helper proteins. For example, for a host cell expressing El A and E1B, the second vector provides E2A and E4. For a host cell expressing E2A and E4, the second vector provides E1A and E1B. For a host cell expressing E1B, the second vector provides E1A, E2A and E4. For a host cell expressing E2A, the second vector provides E1B, El A and E4. For a host cell expressing E4, the second vector provides E1B, E2A and El A. For a host cell expressing E1A, E2A and E4, the second vector provides E1B. For a host cell expressing E1B, El A and E4, the second vector provides E2A. For a host cell expressing E1B, E2A and El A, the second vector provides E4. In some embodiments, E4 is E4orf6.

[0196] In certain aspects, the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding at least two AAV helper proteins. In certain aspects, the helper proteins comprise E2A and E4. In some embodiments, the sequence encoding E4 is a sequence encoding E4orf6.

[0197] In certain aspects, the inducible promoter in the second vector operably linked to a sequence encoding the inducible recombinase comprises a tetracycline-responsive promoter element (TRE). In certain aspects, the activator is Tet-on 3G.

[0198] In certain aspects, the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.

[0199] In certain aspects, the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

[0200] In certain aspects, the second vector comprises a VA-RNA coding sequence. In certain aspects, the second vector comprises an insert comprising: a first part of a constitutive promoter and a second part of a constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA codingsequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA. In certain aspects, the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter. In certain aspects, the staffer sequence encodes for a constitutive promoter operably linked to a selectable marker.

[0201] In certain aspects, the second vector may include, a Cre coding sequence, , adenoviral helper protein coding sequences, an activator, e.g., a Tet responsive activator protein (such as, Tet-on 3G), and a selectable marker (e.g., an antibiotic resistance gene). The Cre coding sequence is flanked by a first lox site and a second lox site, and is operatively linked to an inducible promoter. The inducible promoter comprises a plurality of tetracycline (Tet) operator elements capable of binding to the activator in the presence of a first expression triggering agent, e.g., doxycycline or tetracycline. In some embodiments, the inducible promoter is a tetracycline response element (TRE) promoter that comprises a plurality of tetracycline (Tet) operator elements (tetO) capable of binding to an activator in the presence of a first expression triggering agent. In certain aspects, tetO comprises seven repeats of a 19-base pair tet operator sequence located upstream of a minimal CMV promoter. The activator may be Tet-on 3G. The sequence encoding the activator may be operatively linked to a constitutive promoter (e.g., EF-1 alpha promoter). The selectable marker can be puromycin resistance (see, e.g., FIG. 8A). FIGS. 9A- 12B further depict the optional inclusion of a polynucleotide encoding for inducible production of VA-RNA, which are short non-coding transcripts essential for Adenovirus replication. In this schematic, a Cre inducible U6 promoter that drives the expression of transcriptionally dead mutants of VA RNA1 (e.g., a double point mutant G16A- G60A) is shown. The U6 promoter is split into 2 parts separated by a Lox flanked staffer sequence (see, e.g., FIG. 12A). The U6 promoter is inactive because of the presence of the staffer sequence. Cre mediated excision of the staffer activates the U6 promoter which then drives the expression of VA RNA (FIG. 12B). Other embodiments may provide for alternative sources of VA-RNA.

[0202] In some embodiments, the Cre coding sequence is an estrogen inducible Cre that has a strong polyadenylation signal (PolyA signal) at its 3 ’ end. Following this is a bicistronic E2A, E4orf6 cassette. The plasmid also has a constitutive promoter (CMV) which drives the expression of the Tet responsive activator protein (Tet-on 3G). In the off state when doxycycline (Dox) is absent, the Tet-on 3G cannot bind to the Tet operator elements in the TRE promoter so the promoter is not active. Estrogen responsive Cre (ER2 Cre) is used instead of simple Cre tocounteract basal or leaky expression of the TRE promoter. In the off state, leaky ER2 Cre protein expression from the ER2 Cre gene is held inactive in the cytoplasm. The strong polyadenylation signal, 3’ of the cre gene will prevent basal expression of adenoviral helper genes, E2A and E4. To induce expression, doxycycline and tamoxifen are added to the cell culture. Doxycycline will bind to the Tet-on 3G protein and this will promote binding of the Tet-on 3G to the let operator elements in the TRE promoter (also referred to as doxycycline-inducible promoter). This will trigger the activation of the promoter. ER2 Cre will be expressed at high levels and tamoxifen will bring the ER2 Cre to the nucleus. In the nucleus, Cre will mediate excisions at lox sites.

[0203] In certain aspects, the sequence coding for VA-RNA is a transcriptionally dead sequence. In certain aspects, the sequence coding for VA RNA comprises at least two mutations in an internal promoter. In some embodiments, the sequence coding for the VA-RNA comprises a deletion of from about 5-10 nucleotides in the promoter region. In some embodiments, the sequence coding for the VA-RNA comprises at least one mutation. In some embodiments, the at least one mutation is in the A Box promoter region. In some embodiments, the at least one mutation is in the B Box promoter region. In some embodiments, the at least one mutation is G16A and G60A.

[0204] In certain aspects, the vector system comprises a third vector comprising a polynucleotide pay load flanked by AAV inverted terminal repeats (ITRs). The polynucleotide payload when delivered into a cell using a rAAV comprising the polynucleotide payload may provide DNA to the cell or may be transcribed into RNA (e.g., siRNA, guide RNA) in the cell and / or may be transcribed and subsequently translated into a protein in the cell. Polynucleotide payloads are further described herein in a separate section.

[0205] hi certain aspects, the first vector comprises a sequence encoding a first portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the first portion of the first selectable marker and the third vector comprises a sequence encoding a second portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the second portion of the first selectable marker, wherein the first and second portions associate to form a functional first selectable marker. In certain aspects, the first selectable marker is a split selectable marker comprising N- and C- terminal inteins are further described in a different section herein.

[0206] In certain aspects, the vector system may further include a fourth vector comprising an AAV Cap encoding sequence. An inducible promoter may be operatively linked to the AAV cap encoding sequence. The fourth vector may further include a selectable marker. The selectable marker may be expressed under the control of a constitutive promoter. An exemplary fourth vectoris depicted in FIGS. 12A and 12B. The inducible promoter may be the same as the inducible promoter for controlling expression of the inducible recombinase. In certain embodiments, the inducible promoter may be a inducible by binding of a complex of Tet-on 3G activator and doxycycline.

[0207] hi certain aspects, the system of polynucleotides or system of vectors can comprise the following. The polynucleotide comprising the sequence encoding Rep proteins and further encoding the sequence encoding Cap proteins (e.g., a first polynucleotide or first vector) since it encodes the Rep and Cap genes as described above, can comprise the sequence of any one of SEQ ID NOs: 118-121, where PGK replaces p5 for expressing large Rep proteins and CAG present in an intron for expressing small Rep proteins, where SEQ ID NO: 119 represents an uninduced or “off” state, while SEQ ID NO: 120 represents an induced or “on” state, and SEQ ID NO: 121 is a plasmid that comprises the polynucleotide sequence of SEQ ID NO: 119.

[0208] In certain aspects, the system of polynucleotides or system of vectors can comprise the following. The polynucleotide comprising the sequence encoding Rep proteins and further encoding the sequence encoding Cap proteins (e.g., a first polynucleotide or first vector) since it encodes the Rep and Cap genes as described above, can comprise the sequence of any one of SEQ ID NOs: 122-125, where UBC replaces p5 for expressing large Rep proteins and CAG present in an intron for expressing small Rep proteins, where SEQ ID NO: 123 represents an uninduced or “off’ state, while SEQ ID NO: 124 represents an induced or “on” state, and SEQ ID NO: 125 is a plasmid that comprises the polynucleotide sequence of SEQ ID NO: 123.

[0209] In certain aspects, the system of polynucleotides or system of vectors can comprise the following. The polynucleotide comprising the sequence encoding Rep proteins and further encoding the sequence encoding Cap proteins (e.g., a first polynucleotide or first vector) since it encodes the Rep and Cap genes as described above, can comprise the sequence of any one of SEQ ID NO: 126, where p5 for expressing large Rep proteins and pl9 for expressing small Rep proteins.

[0210] In various embodiments, the first polynucleotide or first vector comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOs: 118-126. In certain embodiments, the first polynucleotide or first vector comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one or more of SEQ ID NOs: 118-126.

[0211] The polynucleotide comprising the sequence encoding inducible helper proteins (e.g., a second polynucleotide or second vector can comprise the sequence of any one of SEQ ID NOs:127-129, where SEQ ID NO: 127 represents an uninduced or “off’ state, while SEQ ID NO: 128 represents an induced or “on” state, and SEQ ID NO: 129 represents a plasmid that comprises the polynucleotide sequence of SEQ ID NO: 127. In various embodiments, the second polynucleotide or the second vector comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOs: 127-129. In certain embodiments, the second polynucleotide or the second vector comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one or more of SEQ ID NOs: 127-129.

[0212] The polynucleotide comprising the sequence encoding a pay load (e.g., a third polynucleotide or third vector) can comprise the sequence of any one of SEQ ID NOs: 130-133, wherein SEQ ID NO: 130 comprises the payload in a self-complementary format and SEQ ID NO: 131 is a sequence of a plasmid that comprises the sequence of SEQ ID NO: 130, and wherein SEQ ID NO: 132 comprises the payload in a single- stranded format and SEQ ID NO: 133 is a sequence of a plasmid that comprises the sequence of SEQ ID NO: 132. In various embodiments, the third polynucleotide or third vector comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOs: 130-133. In certain embodiments, the third polynucleotide or third vector comprises a sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one or more of SEQ ID NOs: 130-133. In some embodiments, the third polynucleotide or third vector comprises a sequence having approximately 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOs: 130-133, wherein the payload sequence is swapped out or replaced with a different sequence encoding a pay load (e.g., any payload as described herein).

[0213] A vector in accordance with this section may include features or components to assist integration of the construct. Various such components are known in the art and include enzymebased methods, such as the use of a nuclease, an integrase, a transposase, and / or any other relevant enzyme; mechanical based systems, such as biolistics; vector-based, such as viral -based and / or bacterial based (e.g., using Agrobacterium spp.). In some instances, the integration may utilize innate mechanisms, such as DNA repair pathways (e.g., non-homologous end joining, double strand break repair, etc.). Some instances utilize homology-based integration (e.g., long terminal repeats, inverted terminal repeats, etc.). Some instances, include features that are specific to exogenously added transposases, including (but not limited to) PiggyBac sites along with the PiggyBac, Tol2, Sleeping Beauty, Mariner, Minos, Hermes, Frog Prince, any other applicable transposon system, and combinations thereof.Vector Systems for Transient Production of rAAV

[0214] Vector systems for producing rAAV by triple transfection of a cell are disclosed. In certain aspects, a vector system for triple transfection includes a first vector as described in the preceding section for expressing Rep proteins and Cap proteins. For example, the large Rep transcripts and small Rep transcripts are expressed under the control of a first and a second promoter, respectively, such that the ratio of small Rep transcripts expression to large Rep transcripts expression is increased as compared to the first vector not comprising the first and / or the second promoter. The For example, the large Rep proteins and small Rep proteins are expressed under the control of a first and a second promoter, respectively, such that the ratio of small Rep proteins expression to large Rep proteins expression is increased as compared to the first vector not comprising the first and / or the second promoter. The vector system may further include a second vector encoding adenoviral helper proteins and optionally VA RNA. The vector system may further include a third vector comprising a polynucleotide payload flanked by ITRs.Cells

[0215] One or more of the polynucleotides, vectors, and / or other constructs described herein may be present in a cell, cell line, and / or other collection of cells. In certain aspects, the present disclosure provides a cell comprising the polynucleotides and / or first vector described in the preceding sections. In certain aspects, the present disclosure provides a cell comprising the polynucleotides and / or second vector described in the preceding sections. In certain aspects, the present disclosure provides a cell comprising the polynucleotides and / or third vector described in the preceding sections. In certain aspects, the cell comprising the first vector may also include the second vector. In certain aspects, the cell comprising the first vector may also include the third vector. In certain aspects, the cell comprising the second vector may also include the third vector. In certain aspects, the cell comprising the first vector and the second vector may also include the third vector.

[0216] Transiently transfected constructs can include other vectors, constructs, and / or polynucleotides described herein and / or readily available vectors, constructs, and / or polynucleotides, including commercially available constructs, custom constructs to express the encoded components. For example, an AAV helper construct can be stably integrated in a cell, while a Rep / Cap construct and a payload construct are transiently transfected into the cell. Alternatively, an AAV helper construct and a Rep / Cap construct can be stably integrated in a cell, while a payload construct is transiently transfected; similarly an AAV helper construct and apayload construct can be stably integrated in a cell, while a Rep / Cap construct is transiently transfected. As can be appreciated, the stable cell lines in all other combinations (e.g., with 1, 2, or 3 of the AAV helper construct, Rep / Cap construct, and payload construct) can be generated in accordance with embodiments.

[0217] The cell may include the polynucleotides transiently or one or more of these polynucleotides may be integrated into the nuclear genome of the cell, cell line, and / or other collection of cells.

[0218] The cell may include the vectors transiently or one or more of these vectors may be integrated into the nuclear genome of the cell, cell line, and / or other collection of cells.

[0219] The cell may include the first vector, second vector, third vector, or any combination of these vectors, transiently or one or more of these vectors may be integrated into the nuclear genome of the cell, cell line, and / or other collection of cells.

[0220] Alternative constructs as described herein can be used in a complete system. In some embodiments, the complete system can be integrated into the host cell genome to produce a stable cell line. In other embodiments, the complete system can be transfected into the host cell and then conditional production of AAV virion from the plasmids can be induced. In some embodiments, the complete system comprises episomes in the host cell and conditional production of AAV virion from the episomes is induced.

[0221] In certain aspects, the cell may be a mammalian cell, including, without limitation, murine cells, and primate cells (e.g., human cells). Suitable mammalian cells include, but are not limited to, primary cells and cell lines, where suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, and the like. Non-limiting examples of suitable host cells include, e.g., HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.

[0222] In certain aspects, the cell is a mammalian cell, optionally wherein the mammalian cell is a HEK293 cell, further optionally, wherein the HEK293 cell expresses AAV helper proteins El A and E1B. HEK293 cells were established by transfection of human embryonic cells with sheared adenovirus 5 DNA. It is widely accepted that HEK293 cells stably express adenoviral El A and E1B proteins. (See e.g., Olsen PA & S Krauss, The Adenoviral ElB-55k Protein Presentin HEK293 Cells Mediates Abnormal Accumulation of Key WNT Signaling proteins in Large Cytoplasmic Aggregates, Genes (Basel), 2021 Nov 29; 12(12): 1920; the disclosure of which is incorporated by reference in its entirety for all purposes.)

[0223] Such cells are also referred to as a host cell. A subject host cell may be an isolated cell, e.g., a cell in in vitro culture. A subject host cell may be useful for producing AAV virions.

[0224] The vector system may be introduced into a host cell, either simultaneously or serially in any order, using established transfection techniques, including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like. In certain embodiments, a host cell comprising a first polynucleotide or a first vector may be selected prior to transfecting in an additional polynucleotide or vector (e.g., a second vector and / or a third vector). Selection may be performed using a cell medium to select for expression of an enzyme rendering the cell resistant to an antibiotic or able to grow in absence of certain amino acids or by FACS for cells expressing a cell surface protein.

[0225] In some embodiments, this cell is expanded to produce a population of cells. In some embodiments, the population of cells produces a stable cell line wherein the polynucleotide as described herein is in integrated into the genome of the cells. In some embodiments, the population of cells produces a stable cell line wherein the first vector as described herein is in integrated into the genome of the cells. In some embodiments, the population of cells produces a stable cell line wherein the first vector, second vector, third vector, or any combination thereof, as described herein is in integrated into the genome of the cells. In some embodiments, this cell is passaged at least three times. In some embodiments, this cell can be passaged up to 60 times. In some embodiments, this cell can be passage more than 60 times. In some embodiments, expanding the population of cells comprises passaging the population of cells at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 times. In some embodiments, the cell maintains the ability to be conditionally induced after each passage.

[0226] In some embodiments, the population of cells is conditionally capable of producing rAAV virions having a payload encapsidation ratio of no less than 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99. In some embodiments, the rAAV virions have a payload encapsidation ratio of no less than 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 prior to purification. In some embodiments, the population of cells are capable of reaching a viable cell density of no less than 1 x 106, 2 x 106, 5 x 106, or 1 x 107cells per milliliter. In some embodiments, the rAAV have a concentration of greater than 1 x 1011or no less than 5 x 1011, 1 x 1012, 5 x 1012, 1 x 1013or 1 x 1014viral genomes per milliliter prior to purification. In some embodiments, the population of cells is capable of producing rAAV comprising the payload nucleic acid sequence at a titer of greater than 1 x 108or no less than 5 x 108, 1 x 109, 5 x IO10, 1 x IO10, 5 x 1011, 1 x 1012, 5 x 1012, 1 x 1013or 1 x 1014viral genomes per milliliter. In some embodiments, the population of cells is capable of producing rAAV virions comprising the payload nucleic acid sequence at a concentration of greater than 1 x 1011or no less than 5 x 1011, 1 x 1012, 5 x 1012, 1 x 1013or 1 x 1014viral genomes per milliliter prior to purification. In some embodiments, the rAAV virions comprising the capsid protein and the payload nucleic acid sequence have an infectivity of no less than 50%, 60%, 70%, 80%, 90%, 95%, or 99% at an MOI of 1 x 105vg / target cell or less. In some embodiments, the rAAV virions have an increased infectivity compared rAAV virions produced by an otherwise comparable the population of cells capable of producing rAAV virions upon transient transfection at the same MOI. In some embodiments, the rAAV virions have at least 1%, 5%, 10%, 15%, 20%, 30%, 40%, or 50% greater infectivity compared rAAV virions produced by an otherwise comparable the population of cells capable of producing rAAV virions upon transient transfection at the same MOI. In some embodiments, the rAAV virions have at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% infectivity as compared AAV virions AAV at the same MOI. In some embodiments, the AAV virions are wildtype AAV virions produced by a cell having wildtype AAV. In some embodiments, the MOI is 1 x 101, 1 x 102, 2 x 103, 5 x 104, or 1 x 105vg / target cell. In some embodiments, the MOI is selected from a range of 1 x 101to 1 x 105vg / target cell. In some embodiments, the cell is conditionally capable of producing rAAV virions having a F:E ratio of no less than 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99. In some embodiments, the rAAV virions have a F:E ratio of no less than 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 prior to purification. In some embodiments, the cell is conditionally capable of producing rAAV virions where at least 1% of the rAAV virions include the polynucleotide payload. In some embodiments, at least 2%, at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or more of the rAAV virions include the polynucleotide pay load. In some embodiments, a population of cells with integrated polynucleotides for rAAV production provide for a consistent titer of the rAAV between different productions. For example, a population of cells with integrated polynucleotides for rAAV production provide for a rAAV titer that does not vary by more than 5%, 10%, or 20% between different production batches. In some embodiments, the cells are cryopreserved. In some embodiments, the cells are comprised within a vial, flask, syringe, or other suitable cell-storage container.Rep / Cap Stable Cell Line

[0227] A Rep / Cap stable cell line as described herein may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide construct encodingAAV Rep and Cap proteins, comprises spacer or excisable elements, and is integrated into the genome of the cell. This polynucleotide is also referred to as a Rep / Cap construct, and / or “AAV Rep / Cap Construct” to be used in production of rAAV virions. The Rep / Cap construct that is integrated into a cell to produce Rep / Cap stable cell line may be any Rep / Cap construct, or AAV Rep / Cap Construct as illustrated in FIGs 1A-2B, FIG. 5, FIGs. 8A-16B.

[0228] In various embodiments incorporating an AAV Rep / Cap Construct as described herein, a polynucleotide encoding helper genes (e.g., a helper construct or adenovirus helper construct) and a polynucleotide encoding a payload (e.g., a pay load construct) can be transiently transfected. The polynucleotide encoding helper and a polynucleotide encoding a payload can be the constructs such as those described herein or can be readily available (e.g., commercially available) constructs. When transfecting with a polynucleotide encoding helper genes and a polynucleotide encoding a pay load as illustrated in FIGs. 8A-9B, FIGs. 11A-16B and described herein, the first and second triggering agents include doxycycline and tamoxifen, respectively. In such instances, the doxycycline induces expression of a ere recombinase. In certain embodiments (e.g., with a Tet-On inducible promoter operably linked to AAV Cap proteins, including the constructs of FIGs. 10-12B, FIGs. 14A-14B, FIGs. 16A-16B), the doxycycline further induces expression of the AAV Cap proteins. The tamoxifen allows the estrogen response element fused to the ere recombinase to translocate the ere recombinase to the nucleus to allow expression of AAV Rep proteins and possibly AAV Cap proteins.

[0229] Readily available AAV helper constructs may not include a ere recombinase within the construct. Under such circumstances, ere may be used as a triggering agent to induce expression of the AAV Rep proteins and possibly AAV Cap proteins. In the exemplary embodiments of FIGs. 10-12B, FIGs. 14A-14B, FIGs. 16A-16B, expression of some or all AAV Cap proteins is driven by an inducible promoter, thus the appropriate triggering agent (e.g., doxycycline) can be added to induce expression of the AAV Cap proteins.

[0230] In some embodiments, where the cell comprises a polynucleotide encoding AAV Rep and AAV Cap proteins (e.g., of FIGs 1A-2B, FIG. 5, FIGs. 8A-16B) integrated into the nuclear genome of the cell, a transiently transfected polynucleotide encoding helper genes, and a transiently transfected polynucleotide encoding a payload, absence of activation of the second inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus. In some embodiments, absence the first triggering agent the cell does not express detectable levels of the one or more AAV capsid proteins and in the absence of the second triggering agent, the cellexpresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.AAV Helper Stable Cell Line

[0231] An AAV helper stable cell line as described herein may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide encoding helper genes (e.g., a helper construct and / or an AAV Helper construct), which encodes for one or more adenoviral helper proteins and is integrated into the genome of the cell. In some embodiments, the polynucleotide encoding AAV Helper proteins is integrated into a cell to produce an AAV helper stable cell line may be any adenoviral helper construct as described herein and / or in WO2022026927, which is hereby incorporated by reference in its entirety. In some embodiments, a polynucleotide encoding helper genes is integrated into the nuclear genome of the cell.

[0232] In some embodiments, in the presence of the first triggering agent, the activator activates the second inducible promoter resulting in expression of the inducible recombinase, and the inducible recombinase is expressed. In some embodiments, in the presence of a second triggering agent, the inducible recombinase translocates to a nucleus of the cell and causes recombination between the third recombination site and the fourth recombination site resulting in excision of the self-excising element, thereby operably linking the second inducible promoter to the sequence encoding the one or more adenoviral helper proteins and allowing expression of the one or more adenoviral helper proteins.

[0233] In some embodiments, in absence of activation of the inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus.

[0234] In some embodiments where the cell comprises a polynucleotide encoding helper genes is integrated into the nuclear genome of the cell, the cell comprises a transiently transfected polynucleotide encoding AAV Rep and AAV Cap proteins and a transiently transfected polynucleotide encoding a payload. In some embodiments, where the cell comprises a polynucleotide encoding helper genes integrated into the nuclear genome of the cell, a transiently transfected polynucleotide encoding AAV Rep and AAV Cap proteins, and a transiently transfected polynucleotide encoding a payload, the polynucleotide encoding AAV Rep and AAVCap proteins and the polynucleotide encoding a payload are not integrated into the nuclear genome of the cell.

[0235] In some embodiments, where the cell comprises a polynucleotide encoding helper genes integrated into the nuclear genome of the cell, a transiently transfected polynucleotide encoding AAV Rep and AAV Cap proteins of FIGs 1A-2B, FIG. 5, FIGs. 8A-16B, and a transiently transfected polynucleotide encoding a payload, absence of the first triggering agent and the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element. In some embodiments, in absence of activation of the inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus; and optionally wherein in absence the first triggering agent and the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.

[0236] In some embodiments, where the cell comprises a polynucleotide encoding one or more helper proteins integrated into the nuclear genome of the cell, a transiently transfected polynucleotide encoding AAV Rep and AAV Cap proteins of FIGs 1A-2B, FIG. 5, FIGs. 8A-16B, and a transiently transfected polynucleotide encoding a payload, absence of activation of the second inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more adenovirus helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus. In some embodiments, absence the first triggering agent the cell does not express detectable levels of the one or more AAV capsid proteins and in the absence of the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.Payload Stable Cell Line

[0237] A payload stable cell line as described herein may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide encoding an expressible payload and is integrated into the genome of the cell. This polynucleotide encoding a payload may also be referred to as a payload construct to be used in production of rAAV virions. The payload construct that is integrated into a cell to produce payload stable cell line may be any polynucleotide encoding a pay load or pay load construct as described in WO2022026927, which is hereby incorporated by reference in its entirety. In some embodiments, the payload construct encodes progranulin. In some embodiments, the pay load construct encodes dystrophin. In some embodiments, the expressible payload is progranulin. In some embodiments, the expressible pay load is dystrophin. In some embodiments, the dystrophin is a shortened, functional form of dystrophin. In some embodiments, a third polynucleotide construct comprises a promoter operably linked to a sequence encoding a payload and a third selectable marker, wherein the sequence encoding the pay load is flanked by a 5’ AAV inverted terminal repeat (5’ ITR) and a 3’ AAV inverted terminal repeat (3’ ITR). In some embodiments, the payload is progranulin or dystrophin; optionally, wherein the dystrophin is a short, functional dystrophin. In some embodiments, the third polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NOs: 130-133; optionally, wherein the sequence encoding progranulin is replaced with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin. In some embodiments, the second plasmid comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replaced with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin. In some embodiments, the sequence encoding the payload flanked by a 5’ AAV inverted terminal repeat (5’ ITR) and a 3’ AAV inverted terminal repeat (3’ ITR) comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replaced with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin. In some embodiments, the polynucleotide encoding a payload further comprises a spacer between the 5 ’ ITR and the sequence encoding the third selectable marker or a spacer between the sequence encoding the third selectable marker and the 3’ ITR, or a combination thereof. In some embodiments, the spacer ranges in length from 500 base pairs to 5000 base pairs.

[0238] In some embodiments, where the cell comprises a polynucleotide encoding a payload integrated into the nuclear genome of the cell, a transiently transfected polynucleotide encoding AAV Rep and AAV Cap proteins of FIGs 1A-2B, FIG. 5, FIGs. 8A-16B and a transiently transfected polynucleotide encoding one or more helper proteins, absence of activation of the second inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more adenovirus helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus. In some embodiments, absence the first triggering agent the cell does not express detectable levels of the one or more AAV capsid proteins and in the absence of the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.Dual Stable Cell Lines

[0239] A stable cell line may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide encoding AAV Rep and / or Cap proteins as described herein integrated into the genome of the cell and a polynucleotide encoding one or more helper proteins as described herein integrated into the genome of the cell. A stable cell line may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide encoding a payload as described herein integrated into the genome of the cell and a polynucleotide encoding one or more helper proteins as described herein integrated into the genome of the cell. A stable cell line may comprise a population of cells, wherein the population of cells comprises a cell comprising a polynucleotide encoding AAV Rep and / or Cap proteins as described herein integrated into the genome of the cell and a polynucleotide encoding a payload as described herein integrated into the genome of the cell.

[0240] Certain embodiments integrate two of the three polynucleotides as described herein into the nuclear genome of a cell, such as i) integrating a polynucleotide encoding AAV Rep / Cap proteins and a second polynucleotide encoding AAV helper proteins; ii) integrating a polynucleotide encoding AAV Rep / Cap proteins and a polynucleotide encoding a payload; or iii) integrating a polynucleotide encoding AAV helper proteins and polynucleotide encoding a payload. In some embodiments one or more other polynucleotides may be transiently transfected into the cell. In some embodiments, one or more other polynucleotides are not integrated into the nuclear genome of the cell.Integrated AAV Rep / Cap and Helper

[0241] In some embodiments that stably integrate a polynucleotide encoding AAV Rep and / or Cap proteins and a polynucleotide encoding AAV helper genes into the nuclear genome of the cell and transfecting a payload construct (e.g., a polynucleotide encoding a payload), the polynucleotide encoding AAV Rep and / or Cap proteins and the polynucleotide encoding helper genes are commensurate with one or more of FIGs. 8A-9B, FIGs. 11A-16B and the descriptions herein. In some embodiments, the polynucleotide encoding a payload is transiently transfected into the cell. In some embodiments, the polynucleotide encoding a payload is not integrated into the nuclear genome of the cell.

[0242] In some embodiments, the polynucleotide encoding AAV Rep and / or Cap proteins comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any one of SEQ ID NO: 118-126, and the polynucleotide encoding one or more helper genes comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any one of SEQ ID NO: 118-126.

[0243] In some embodiments, the polynucleotide encoding AAV Rep and / or Cap proteins comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 118-126, and the polynucleotide encoding one or more helper genes comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any one of SEQ ID NO: 118-126.

[0244] In some embodiments, the polynucleotide encoding a payload is commensurate with the payload constructs described herein or may be readily available payload constructs. In some embodiments, the polynucleotide encoding a payload comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133. In some embodiments, the sequence encoding progranulin is replaced with a sequence encoding dystrophin. In some embodiments, the sequence encoding dystrophin encodes for a short, functional dystrophin.

[0245] In such embodiments, the first and second triggering agents include doxycycline and tamoxifen, respectively. In such instances, the doxycycline induces expression of a ere recombinase (e.g., as in FIGs. 8A-9B, FIGs. 11A-16B). In some embodiments, the doxycycline further induces expression of the AAV Cap proteins (e.g., as in FIGs. 10-12B, FIGs 14A-14B, FIGs. 16A-16B). The tamoxifen allows the estrogen response element fused to the ere recombinase to translocate the ere recombinase to the nucleus to allow expression of AAV Rep proteins and possibly AAV Cap proteins (e.g., in the exemplary embodiments of FIGs 14A-14B, FIGs. 16A-16B).SI

[0246] In some embodiments (e.g., when the polynucleotide encoding AAV Rep and Cap proteins is akin to the exemplary embodiments of FIGs 1A-2B, FIG. 5, FIGs. 8A-16B), absence of activation of the inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus; and optionally wherein in absence the first triggering agent and the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.Integrated AAV Rep / Cap and Payload

[0247] In some embodiments that stably integrate a polynucleotide encoding AAV Rep and / or Cap proteins and a polynucleotide encoding a payload and transfecting a polynucleotide encoding helper proteins. In some embodiments, the polynucleotide encoding AAV Rep and / or Cap proteins and polynucleotide encoding a payload are commensurate with the examples illustrated in FIGs. 8A-9B, FIGs. 11A-16B and the descriptions herein. In some embodiments, the polynucleotide encoding AAV Rep and / or Cap proteins comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any one of SEQ ID NO: 118-126, and the polynucleotide encoding a payload may be commensurate with the plasmids described herein. The AAV helper construct can be a readily available construct (e.g., commercially available) or it may be commensurate with an inducible AAV helper construct as illustrated in FIGs. 8A-9B, FIGs. 11A-16B and described herein.

[0248] In embodiments that transfect with polynucleotide encoding a payload commensurate with the polynucleotides described herein, the AAV helper construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to any one of SEQ ID NO: 130-133. In such embodiments, the first and second triggering agents include doxycycline and tamoxifen, respectively. In such instances, the doxycycline induces expression of a ere recombinase (e.g., as in FIGs. 8A-9B, FIGs. 11A-16B). In the exemplary embodiments illustrated in FIGs. 10-12B, FIGs. 14A-14B, FIGs. 16A-16B, the doxycycline further induces expression of the AAV Cap proteins. The tamoxifen allows the estrogen response element fused to the ere recombinase to translocate the ere recombinase to the nucleus to allow expression of AAV Rep proteins and possibly AAV Cap proteins (e.g., in the exemplary embodiments of FIGs 14A-14B, FIGs. 16A-16B).

[0249] Readily available polynucleotides encoding helper proteins may not include a ere recombinase within the construct. Under such circumstances, exogenously provided ere may be used as a triggering agent to induce expression of the AAV Rep proteins and possibly AAV Cap proteins (e.g., in the exemplary embodiments of FIGs. 1A-2B, FIG. 5, FIGs. 8A-16B). In the exemplary embodiments of FIGs. 10-12B, FIGs. 14A-14B, FIGs. 16A-16B, expression of the AAV Cap proteins is driven by an inducible promoter, thus the appropriate triggering agent (e.g., doxycycline) can be added to induce expression of the AAV Cap proteins.

[0250] In some embodiments (e.g., when the polynucleotide encoding AAV Rep and Cap proteins is akin to the exemplary embodiments of FIGs. 1A-2B, FIG. 5, FIGs. 8A-16B), absence of activation of the inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus; and optionally wherein in absence the first triggering agent and the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.Integrated Helper and Payload

[0251] A third combination of stably integrated constructs in accordance with some embodiments comprises a cell comprising an polynucleotide encoding AAV helper proteins and a polynucleotide encoding a payload integrated into the nuclear genome of the cell. In some embodiments, the polynucleotide encoding AAV helper proteins and polynucleotide encoding a payload are commensurate with FIGs. 8A-16B and the descriptions herein. In some such embodiments, the polynucleotide encoding AAV helper proteins and polynucleotide encoding a payload are commensurate with the plasmids and nucleic acid constructs described herein. The transfected AAV Rep / Cap construct can be a readily or commercially available construct or it may be commensurate with AAV Rep / Cap constructs as described herein, including FIGs. 1A-2B, FIG. 5, FIGs. 8A-16B. In such embodiments, the first and second triggering agents include doxycycline and tamoxifen, respectively. In such instances, the doxycycline induces expression of a ere recombinase (e.g., as in FIGs. 8A-16B). In the exemplary embodiments illustrated in FIGs. 10-12B, FIGs. 14A-14B, FIGs. 16A-16B, the doxycycline further induces expression of the AAV Cap proteins. The tamoxifen allows the estrogen response element fused to the ere recombinase to translocate the ere recombinase to the nucleus to allow expression of AAV Repproteins and possibly AAV Cap proteins (e.g., in the exemplary embodiments of FIGs. 14A-14B, FIGs. 16A-16B).

[0252] In some embodiments, where the non-integrated and / or transiently transfected polynucleotide encoding AAV Rep and / or Cap proteins is commensurate with the exemplary embodiments of FIGs. 1A-2B, FIG. 5, FIGs. 8A-16B, absence of activation of the inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus; and optionally wherein in absence the first triggering agent and the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.

[0253] In some embodiments, where the non-integrated and / or transiently transfected polynucleotide encoding AAV Rep and / or Cap proteins is commensurate with the exemplary embodiments of FIGs. 1A-2B, FIG. 5, FIGs. 8A-16B, absence of activation of the second inducible promoter by the first triggering agent, the cell does not express detectable levels of the inducible recombinase and the one or more AAV helper proteins, wherein in the absence of the second triggering agent, the inducible recombinase is unable to translocate to the nucleus; and optionally wherein in absence the first triggering agent the cell does not express detectable levels of the one or more AAV capsid proteins and in the absence of the second triggering agent, the cell expresses a fusion protein comprising a partial Rep protein encoded by the first part of the AAV Rep coding sequence that terminates at a stop signaling sequence comprised within the excisable element. In some instances, the fusion protein includes a tag (e.g., BFP, His, etc. as described above) encoded within the excisable element.Methods for Producing recombinant AAV

[0254] In certain aspects, a method for producing recombinant AAV is provided. The method may include performing triple transfection of a cell with a vector system of described herein.

[0255] In certain aspects, a method for inducibly producing a recombinant AAV (rAAV) is provided. The method may include contacting a cell comprising the vectors described herein to a first triggering agent and a second triggering agent, thereby inducing the production of a rAAV.

[0256] In certain aspects, the cell expresses higher levels of the small Rep compared to a cell comprising a vector comprising a native pl9 promoter instead of the second promoter and comprising the second and third vectors.

[0257] In certain aspects, the cell expresses lower levels of the large Rep compared to a cell comprising a vector comprising a native p5 promoter instead of the first promoter and comprising the second and third vectors.

[0258] In certain aspects, the cell produces higher small Repdarge Rep ratio as compared to a cell comprising a vector comprising a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter and comprising the second and third vectors.

[0259] In certain aspects, the cell expresses lower level of the large Rep compared to the small Rep. In some aspects, the cell expresses a ratio of small Rep: large Rep having a range of from 1.5:1 to 10,000: 1. In some aspects, the cell expresses a ratio of small Rep: large Rep is 1.5:1 ; 1.8:1; 2: 1; 2.3: 1; 2.5:1 ; 2.8:1; 3:1; 3.5:1 ; 4:1 ; 4.5:1; 5: 1; 5.5:1 ; 6: 1; 6.5:1 ; 7:1; 7.5:1 ; 8:1; 8.5: 1; 9:1; 9.5: 1; 10: 1 ; 50: 1; 100:1; 300:1; 500: 1; 1000: 1; 3000: 1; 5000:1; or 10,000:1.

[0260] In certain aspects, the cell expresses higher levels of rAAV compared to a cell comprising a vector comprising a native pl9 promoter instead of the second promoter and comprising the second and third vectors.

[0261] In certain aspects, the cell expresses higher levels of rAAV compared to a cell comprising a vector comprising a native p5 promoter instead of the first promoter and comprising the second and third vectors. In certain aspects, the cell produces higher levels of rAAV as compared to a cell comprising a vector comprising a native p5 promoter instead of the first promoter and a pl 9 promoter instead of the second promoter and comprising the second and third vectors.

[0262] In some embodiments, a population of the cell is capable of producing rAAV virions comprising the pay load nucleic acid sequence at a concentration of greater than 1 x 1011or no less than 5 x 1011, 1 x 1012, 5 x 1012, 1 x 1013or 1 x 1014viral genomes per milliliter. In some embodiments, a population of the cell is capable of producing rAAV virions comprising the pay load nucleic acid sequence at a concentration of greater than 1 x 1011or no less than 5 x 1011, 1 x 1012, 5 x 1012, 1 x 1013or 1 x 1014viral genomes per milliliter prior to purification. In some embodiments, a population of the cell is conditionally capable of producing rAAV virions having a encapsidation ratio of no less than 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99. In some embodiments, the rAAV virions have a encapsidation ratio of no less than 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, 0.97, or 0.99 prior to purification. In some embodiments, a population of the cell is a pool of cells produced after transient transfection of the vector system described herein. In someembodiments, a population of the cell is a pool of cells produced after transient transfection and subsequent selection for genome integration of the vector system. In some embodiments, a population of the cell is a monoclonal population of the cell.Methods for Generating Cells for Inducibly Producing rAAV

[0263] Also provided herein is a method of generating a cell for inducibly producing recombinant AAV (rAAV) comprising a polynucleotide payload using the vectors described in the previous sections.

[0264] In certain aspects, the method may include:(i) introducing into a cell a first vector comprising: an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a first recombination site and a second recombination site flanking the sequence encoding the inducible recombinase, wherein the first recombination site and the second recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator and the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a second constitutive promoter operably linked to a sequence encoding a first selectable marker, wherein the cell constitutively expresses the first selectable marker;(ii) selecting for a cell expressing the first selectable marker;(iii) introducing a second vector and a third vector into the cell expressing the first selectable marker, the second vector comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising (i) an intron comprising a second promoter; and (ii) the small Rep coding sequence, wherein the second promoter is operably linked to the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, and wherein the second promoter has higher promoter activity as compared to the first promoter, wherein the small Rep coding sequence comprises an excisable element comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon; a sequence encoding AAV capsid proteins; and a third constitutive promoter operably linked to a sequence encoding a first portion of a second selectable marker; and the third vector comprising a sequenceencoding the payload and a fourth constitutive promoter operably linked to a sequence encoding a second portion of the second selectable marker, wherein the sequence encoding the payload is flanked by AAV inverted terminal repeats (ITRs); and (iv) selecting for a cell expressing the first selectable marker and the second selectable marker, thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising the polynucleotide payload comprising expanding a cell expressing the first and second selectable markers. In certain embodiments, the sequence encoding the first portion of a selectable marker is operably linked to a constitutive promoter and a sequence encoding the second portion of the selectable marker is operably linked to a constitutive promoter, wherein when expressed in the cell, the first portion and the second portion of the selectable marker interact to produce a complete selectable marker. In some embodiments, the constitutive promoter is a cytomegalovirus promoter or EFl alpha promoter. In some embodiments, the constitutive promoter is a weak or attenuated promoter.

[0265] In certain aspects, the first and second selectable markers are antibiotic resistance proteins. In certain aspects, the second selectable marker is a blasticidin resistance gene. In some embodiments, the second selectable marker is a blasticidin resistance gene, and the first portion of the second selectable marker is a first portion of a blasticidin resistance gene and the second portion of the second selectable marker is a second portion of the blasticidin resistance gene. In certain embodiments, this selectable marker is referred to as a “split blasticidin,” as the functional blasticidin is formed by the association of the first and second portions. In various embodiments, the first and second portions of the split blasticidin are encoded by SEQ ID NOs: 177-178.

[0266] In certain aspects, the first promoter in the second vector is heterologous to the large Rep coding sequence. In certain aspects, the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the p 19 promoter and upstream of the transcription start site of the small Rep coding sequence. In certain aspects, the pl 9 promoter is mutated to substantially reduced promoter activity. In certain aspects, the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.

[0267] In certain aspects, the second vector lacks a functional p5 promoter. In certain aspects, the first promoter replaces the p5 promoter. In certain aspects, the first promoter and / or second promoter in the second vector is a constitutive promoter.

[0268] In certain aspects, the second vector lacks a functional p5 promoter that is upstream of the large Rep Coding sequence. In certain aspects, the second vector lacks a functional p5 promoter that is upstream of the large Rep Coding sequence and lacks a functional p5 promoterthat is downstream of the small Rep coding sequence. In certain aspects, the second vector lacks a functional p5 promoter that is upstream of the large Rep Coding sequence but comprises a functional p5 promoter that is downstream of the small Rep coding sequence. In certain aspects, the first promoter replaces the p5 promoter upstream of the large Rep Coding sequence. In certain aspects, the first promoter and / or second promoter in the second vector is a constitutive promoter.

[0269] In certain aspects, in the second vector, (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (C AG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter.

[0270] In certain aspects, the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3 ’ splice acceptor site compatible with a cell used for expressing the large Rep proteins.

[0271] In certain aspects, the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.

[0272] In certain aspects, the second vector comprises a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag. The tag may be a purification tag and / or a detectable tag.

[0273] In certain aspects, the AAV capsid proteins coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence. In certain aspects, the second vector comprises an inducible promoter operably linked to the AAV capsid proteins coding sequence. In certain aspects, the intervening sequence comprises a transcriptional blocking element (TBE).

[0274] In certain aspects, the TBE comprises a nucleotide sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to the nucleotide sequence:

[0275] AATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAA TCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGC AAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT.

[0276] In certain aspects, the inducible promoter operably linked to the sequence encoding the inducible recombinase and the inducible promoter operably linked to the AAV capsid proteins coding sequence are the same promoters. In certain aspects, the promoters comprise a tetracyclineresponsive promoter element (TRE) as described in the preceding section of the application. In certain aspects, the activator that binds to the TRE in the presence of the first triggering agent is Tet-on 3G. In certain aspects, the inducible recombinase is fused to an estrogen response element (ER2) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent. In certain aspects, the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

[0277] In certain aspects, the polynucleotide payload may encode a payload that is progranulin. Polynucleotide payloads are discussed in detail in a separate section.

[0278] In certain aspects, the first vector further comprises a VA-RNA coding sequence. The sequence coding for VA-RNA may be a transcriptionally dead sequence. The sequence coding for VA RNA may comprise at least two mutations in an internal promoter.

[0279] Expression of the inducible recombinase is triggered by the activator and the first triggering agent. The recombinase may be linked to an estrogen response element which prevents the recombinase from translocating to the nucleus. The recombinase translocates to the nucleus upon binding to the second triggering agent. In the nucleus, the recombinase may cause one or more recombination events (e.g., two recombination events). The recombinase may excise itself. This excision may position the AAV helper genes to be operably linked to the inducible promoter that is induced in the presence of the activator and the first triggering agent thus triggering the expression of AAV helper proteins (e.g., Ela, Elb, E2A, or E4, or any combination thereof). Expression of the recombinase may also cause excision of other segments in the constructs that are flanked by recombination sites. For example, the sequence encoding the stop codon in the second vector is excised from the AAV Rep coding sequence, thus allowing for expression of Rep proteins.

[0280] In some embodiments, the segment flanked by recombination sites that split a constitutive promoter operably linked to VA RNA1 is also excised, resulting in joining of the split constitutive promoter and therefore allowing expression of the operably linked VA RNA1 sequence. The cells now may express all adenovirus helper genes required for AAV production,thus, completing the expression of all components required for AAV production, rendering the cells competent to produce recombinant AAV.

[0281] FIG. 9A depicts the off state of an exemplary embodiment. In the embodiment shown, three constructs of synthetic polynucleotides are separately integrated into the nuclear genome of a cell in a cell line that expresses adenovirus E1A and E1B, such as HEK 293 cells. These polynucleotides may have been introduced as vectors and the cells that have integrated these vectors in the genome may be selected as described above. In the off state, transcriptional read- through of Rep coding sequence (“Rep2”) on Construct 2 is blocked by an excisable element that includes a stop codon. Construct 2 encodes a split mammalian selection marker under the control of a constitutive promoter, the AAV large Rep proteins under the control of pl promoter, and the small Rep proteins under the control of p2 promoter, pl promoter refers to the first promoter described herein for controlling expression of the large Rep proteins and p2 promoter refers to the second promoter described herein for controlling expression of the small Rep proteins. p2 may be positioned within a synthetic intron inserted upstream of the transcription start site for the sequence encoding small Rep proteins, pl and p2 may be promoters as described herein, wherein the promoter activity of p2 is stronger than the promoter activity of pl.

[0282] In the off state (FIG. 9A), the ER2-Cre coding sequence is under the control of an inducible promoter. For example, the inducible promoter is a Tet-inducible promoter. In the absence of a first triggering agent (e.g., tetracycline or doxycycline), the Tet-inducible promoter is not active. In the absence of a tetracycline, such as doxycycline (“Dox”), Tet activator protein (Tet-On 3G) cannot bind and activate the Tet-On promoter. In this figure, the Tet-inducible promoter is interchangeably referred to as doxycycline-inducible promoter and Tet-On promoter. In addition, the localization of Cre is under control of estrogen response elements (“ER2”) that require binding of a second triggering agent, e.g., an estrogen agonist or selective modulator, such as tamoxifen, for the translocation from the cytoplasm to the nucleus. This approach limits leaky Cre expression, thereby limiting consequent promiscuous recombination events and toxicity. The ER2 Cre coding sequence also comprises a strong 3’ polyadenylation signal, which prevents basal expression of the downstream adenoviral helper genes, E2A and E4.

[0283] In some embodiments, the Cre is split into two fragments, that can associate in the presence of a chemical agent, such as rapamycin. In some embodiments, the Cre is a light inducible Cre.

[0284] When the first triggering agent (e.g., Dox) and second triggering agent tamoxifen are added to the culture medium, Tet-On 3G and Dox bind the Tet responsive basal promoter and ER2 Cre is expressed and translocates to the nucleus. ER2 Cre excises its own coding sequencefrom Construct 1, leaving the construct shown in FIG. 9B. Excision of the ER2 Cre coding sequence allows expression of E2A and E4 helper proteins. Similarly, for the optional additional VA RNA coding sequence shown in FIG. 9B, VA RNA is expressed by Cre mediated excision of the stuffer sequence, which results in joining of the U6 promoter portions which then drives the expression of VA RNA.

[0285] Construct 1 also includes a selectable marker, e.g., puromycin, expressed constitutively.

[0286] FIG. 9A shows the off state of integrated nucleic acid construct 2. Construct 2 is designed to prevent expression of AAV large Rep proteins and small Rep proteins prior to expression of the ER2 Cre in the presence of the first triggering agent and activation of the ER2 Cre by the second triggering agent. Construct 2 is also designed to prevent expression of Cap prior to the activation of the ER2 Cre by the second triggering agent.

[0287] In FIGS. 11A and 11B, the Cap coding sequence is also under the control of the Tet- On promoter similar to ER2 Cre. Thus, addition of the first triggering agent induces expression of Cap proteins.

[0288] Construct 2 also encodes a first portion of a split selectable marker and Construct 3 encodes a second portion of the split selectable marker.

[0289] In Construct 2, the small Rep coding sequence comprises an excisable element comprising a first lox site and a second lox site flanking a sequence comprising a stop codon, wherein the lox sites are oriented in the same direction and wherein recombination between the lox sites by ER2 Cre results in excision of the sequence comprising the stop codon.

[0290] FIG. 9B shows the conversion of Constructs 1 and 2 to an on-state following exposure to ER2 Cre within the cell nucleus. ER2 Cre excises the excisable element position in the small Rep coding sequence. As rearranged, the Construct 2 now allows expression of functional Rep transcripts.

[0291] Construct 3 includes a polynucleotide payload, which can be a gene of interest flanked by URs and a second portion of the selectable marker expressed from a constitutive promoter. The polynucleotide payload can be any payload for which rAAV is an appropriate vehicle, including a transgene encoding a protein of interest, a homology element for homology-directed repair, or a guide RNA. The polynucleotide pay load is flanked by AAV ITRs, represented by the brackets.

[0292] In another certain embodiment, the sequence encoding the payload includes a reporter gene, a therapeutic gene, a transgene encoding a protein of interest, a sequence encoding an antibody, a sequence encoding regulatory element, an antigen (e.g., an immunogenic), etc. In afurther certain embodiment, the sequence encoding the payload is a sequence encoding progranulin. In another further certain embodiment, the sequence encoding the payload comprises a suppressor tRNA, a guide RNA, a heterologous messenger RNA, a small RNA (e.g., for RNA interference), or a homology region for homology-directed repair.

[0293] hi various embodiments, the sequence encoding a payload comprises a sequence of approximately 4700 nucleotides. In various embodiments, the sequence encoding a payload comprises a sequence of approximately 4400-4700 nucleotides. Tn various embodiments, the sequence encoding a payload comprises a sequence of at least approximately 2200 nucleotides. Some instances comprise a payload as a self-complementary sequence — such embodiments may be beneficial when a desired payload is smaller than approximately 2200 nucleotides. Additional details about payload design can be found in Li, L., et al., Advances in Recombinant Adeno- Associated Virus Vectors for Neurode generative Diseases, Biomedicines, 2023 Oct 8;11 ( 10):2125 ; the disclosure of which is incorporated by reference in its entirety for all purposes.

[0294] FIG. 9B depicts the constructs in an on-state following the addition of tamoxifen and doxycycline to the cell medium. Adenoviral E2A and E4 helper proteins are expressed from integrated Construct 1 under control of the inducible promoter (e.g., a Tet-On promoter activated in the presence of Dox). AAV Rep and Cap coding sequences are expressed from Construct 2. The ratio of small Rep proteins to the large Rep proteins is controlled by selection of the promoters pl and p2. pl and p2 may be promoters as described herein, wherein the promoter activity of p2 is stronger than the promoter activity of pl . The payload is expressed under control of a specific for that payload to get the desired pay load expression level, e.g., a constitutive promoter, tissuespecific promoter, ubiquitous promoter, etc constitutive promoter. rAAV virions that encapsidate the polynucleotide payload are therefore produced.

[0295] FIGS. 11A and 11B shows another embodiment of the present disclosure.

[0296] FIG. 11A depicts the off state of an exemplary embodiment. In the embodiment shown, three constructs of synthetic polynucleotides are separately integrated into the nuclear genome of a cell in a cell line that expresses adenovirus E1A and E1B, such as HEK 293 cells. These polynucleotides may have been introduced as vectors and the cells that have integrated these vectors in the genome may be selected as describe above. In the off state, transcriptional read-through of Rep coding sequence on Construct 2 is blocked by an excisable element comprising a first lox site and a second lox site flanking a sequence comprising a stop codon (e.g., a sequence coding for blue fluorescent protein “BFP”), wherein the first lox site and the second lox site are oriented in the same direction and wherein recombination between the first and second lox sites by the ER2 Cre results in excision of the sequence comprising the stop codon. Construct2 encodes a split mammalian selection marker under the control of a constitutive prompter and AAV large Rep proteins under the control of p 1 promoter and small Rep proteins under the control of p2 promoter, pl promoter refers to the first promoter described herein for controlling expression of the large Rep proteins and p2 promoter refers to the second promoter described herein for controlling expression of the small Rep proteins. p2 may be positioned within a synthetic intron inserted upstream of the transcription start site for small Rep, as described in the preceding sections, pl and p2 may be promoters as described herein, wherein the promoter activity of p2 is stronger than the promoter activity of pl.

[0297] In Construct 2, the AAV capsid proteins (Cap) coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible promoter operably linked to the Cap coding sequence. The intervening sequence comprises a transcriptional blocking element (TBE). For example, the inducible promoter is a Tet-inducible promoter.

[0298] In the off state (FIG. 11A), the ER2-Cre coding sequence is under the control of an inducible promoter and sequence encoding the Cap proteins is under the control of an inducible promoter. For example, the inducible promoter for each of these is a Tet-inducible promoter. In the absence of a first triggering agent (e.g., tetracycline or doxycycline), the Tet-inducible promoter is not active. In the absence of a tetracycline, such as doxycycline (“Dox”), Tet activator protein (Tet-On 3G) cannot bind and activate the Tet-On promoter. In this figure, the Tet-inducible promoter is interchangeably referred to as doxycycline-inducible promoter and Tet-On promoter. In addition, the localization of Cre is under control of estrogen response elements (“ER2”) that require binding of a second triggering agent, e.g., an estrogen agonist or selective modulator, such as tamoxifen, for the translocation from the cytoplasm to the nucleus. This approach limits leaky Cre expression with consequent promiscuous recombination events and toxicity. The ER2 Cre coding sequence also comprises a strong 3’ polyadenylation signal, which prevents basal expression of the downstream adenoviral helper genes, E2A and E4.

[0299] In some embodiments, the Cre is split into two fragments, that can associate in the presence of a chemical agent, such as rapamycin. In some embodiments, the Cre is a light inducible Cre.

[0300] When the first triggering agent (e.g., Dox) and second triggering agent tamoxifen are added to the culture medium, Tet-On 3G and Dox bind the Tet responsive basal promoter and ER2 Cre is expressed and translocates to the nucleus. ER2 Cre excises its own coding sequence from Construct 1, leaving the construct shown in FIG. 11B. Excision of the ER2 Cre coding sequence allows expression of E2A and E4 helper proteins. Similarly, for the optional additionalVA RNA coding sequence shown in FIG. 11B, VA RNA is expressed by Cre mediated excision of the staffer sequence, which results in joining of the U6 promoter portions which then drives the expression of VA RNA. Additionally, when the first triggering agent is added to the culture medium, Tet-On 3G and Dox bind the Tet responsive basal promoter upstream of the sequence encoding the Cap proteins and the Cap proteins are expressed.

[0301] Construct 1 also includes a selectable marker, e.g., puromycin, expressed constitutively.

[0302] FIG. 11A shows the off state of integrated nucleic acid construct 2. Construct 2 is designed to prevent expression of AAV large Rep proteins and small Rep proteins prior to expression of the ER2 Cre in the presence of the first triggering agent and activation of the ER2 Cre by the second triggering agent. Construct 2 is also designed to prevent expression of Cap prior to the presence of the first triggering agent.

[0303] Construct 2 also encodes a first portion of a split selectable marker and Construct 3 encodes a second portion of the split selectable marker.

[0304] In Construct 2, the small Rep coding sequence comprises an excisable element comprising a first lox site and a second lox site flanking a sequence comprising a stop codon (e.g., in a blue fluorescent protein “BFP”), wherein the lox sites are oriented in the same direction and wherein recombination between the lox sites by ER2 Cre results in excision of the sequence comprising the stop codon.

[0305] FIG. 11B shows the conversion of Constructs 1 and 2 to an on-state following exposure to ER2 Cre within the cell nucleus. ER2 Cre excises the excisable element positioned in the small Rep coding sequence. As rearranged, the Construct 2 now allows expression of functional Rep transcripts.

[0306] Construct 3 includes a polynucleotide payload, which can be a gene of interest flanked by ITRs, and a second portion of the selectable marker expressed from a constitutive promoter. The polynucleotide payload can be any payload for which rAAV is an appropriate vehicle, including a transgene encoding a protein of interest, a homology element for homology-directed repair, or a guide RNA. The polynucleotide pay load is flanked by AAV ITRs, represented by the brackets.

[0307] FIG. 11B depicts the constructs in an on-state following the addition of tamoxifen and doxycycline to the cell medium. Adenoviral E2A and E4 helper proteins are expressed from integrated Construct 1 under control of the inducible promoter (e.g., a Tet-On promoter activated in the presence of Dox). AAV Rep and Cap coding sequences are expressed from Construct 2. The ratio of small Rep proteins to the large Rep proteins is controlled by selection of the promoterspl and p2. pl and p2 may be promoters as described herein, wherein the promoter activity of p2 is stronger than the promoter activity of pl . The pay load is expressed under control of a promoter specific for that pay load to get the desired pay load expression level, e.g., a constitutive promoter, tissue-specific promoter, ubiquitous promoter, etc. rAAV virions that encapsidate the polynucleotide payload are therefore produced.

[0308] Expression of the Cap proteins is under the control of native promoter.

[0309] Construct 1 and Construct 3 of FIGS. 10A and 10B are same as Construct 1 and Construct 3, respectively, depicted in FIGS. 9A and 9B.

[0310] FIGS. 10A and 10B shows the same constructs as FIGS. 9A and 9B, respectively, and include an additional polynucleotide, Construct 4, for expression of Cap proteins from an inducible promoter. Construct 4 also includes a selectable marker (e.g., hygromycin resistance) expressed constitutively. The Tet inducible promoter is the same promoter as the doxycycline- inducible promoter and is activated in the presence of Tet-on 3G and doxycycline.

[0311] Construct 1 and Construct 3 of FIGS. 12A and 12B are same as Construct 1 and Construct 3, respectively, depicted in FIGS. 11A and 11B.

[0312] FIGS. 12A and 12B show the same constructs as FIGS. 11A and 11B, respectively, and include an additional polynucleotide, Construct 4, for expression of Cap proteins from an inducible promoter. Construct 4 also includes a selectable marker (e.g., hygromycin resistance) expressed constitutively. The Tet inducible promoter is the same promoter as the doxycycline- inducible promoter and is activated in the presence of Tet-on 3G and doxycycline.Site-Specific Recombinase System

[0313] Any suitable site-specific recombinase system may be used to recombine the recombination sites described herein. A recombination system refers to a site-specific recombinase and the recombination sites are where the recombinase recombines. Exemplary sitespecific recombinase systems include, without limitation, Cre-lox, Flp-FRT, PhiC31-att, Dre-rox, and Tre-loxLTR site-specific recombinase systems. The Cre-lox system uses a Cre recombinase to catalyze site-specific recombination between two lox sites. For example, between two loxp sites, two loxB sites, two loxl sites, two loxR sites, or two loxC2 sites. As used herein, the term “lox” refers to a specific sequence of nucleotides recognized by cre recombinase. The Flp-FRT system uses a flippase (FLP) recombinase to catalyze site-specific recombination between two flippase recognition target (FRT) sites. The PhiC31-att system uses a phiC31 recombinase to catalyze site-specific recombination between two attachment (att) sites referred to as attB and attP.The Dre-rox system uses a DreO recombinase to catalyze site-specific recombination between two rox sites. The Tre-loxLTR system uses a Tre recombinase to catalyze site-specific recombination between two loxP sites that are modified with HIV long terminal repeats (loxLTR). For a description of various site-specific recombinase systems, see, e.g., Stark et al. (2011) Biochem. Soc. Trans. 39(2):617-22; Olorunniji et al. (2016) Biochem. J. 473(6):673-684; Birling et al. (2009) Methods Mol. Biol. 561 :245-63; Garcia-Otin et al. (2006) Front. Biosci. 11 :1108- 1136; Weasner et al. (2017) Methods Mol. Biol. 1642:195-209; herein incorporated by reference in their entireties.

[0314] In certain embodiments, an inducible recombinase, e.g., a ligand- activated site-specific recombinase, may be used to control activity of the recombinase. In some embodiments, a ligandbinding domain of a steroid receptor is fused to the recombinase to confer ligand-dependent regulation of recombination. For example, ligand-activated site-specific recombination may be performed with a tamoxifen-inducible Cre-ER (or modified versions such as CreERT2), which comprises an estrogen response element (ER) fused to Cre as a transgene (Cre-ER). The Cre-ER fusion only becomes activated and translocates to the nucleus in the presence of a triggering agent (e.g., a second triggering agent), such as, tamoxifen (see Metzger et al. (1995) Proc. Natl. Acad. Sci. USA 92(15):6991-5.; Feil et al. (1996) Proc. Natl. Acad. Sci. USA 93(20):10887-90. Indra et al. (1999) Nucleic Acids Res. 27(22):4324-7; Zhong et al. (2015) Bone 81: 614-619; herein incorporated by reference in their entireties. Alternatively, a tamoxifen-inducible FLP recombinase may be used, which comprises an estrogen response element (ER) fused to FLP as a trans gene (FLP-ER). The FLP-ER fusion similarly only becomes activated and translocates to the nucleus in the presence of tamoxifen (see, e.g., Hunter et al. (2005) Genesis 41 (3):99- 109; Nichols et al. (1997) Mol. Endocrinol. 11 (7):950-61 herein incorporated by reference in their entireties).

[0315] A recombination site for a site-specific recombinase may be linked to an oligonucleotide in a number of ways. For example, an oligonucleotide may be amplified with a primer comprising a recombination site. In addition, a selectable marker may be used that selects for clones that have undergone successful site-specific recombination.

[0316] In certain aspects, in examples of polynucleotides disclosed herein comprising a first and second recombination site and a third and fourth recombination site, the first and second recombination site is the same as the third and fourth recombination site. In certain aspects, in examples of the polynucleotides disclosed herein comprising a first and second recombination site, a third and fourth recombination site, and a fifth and sixth recombination site, the first and second recombination site is the same as the third and fourth recombination site and the fifth and sixth recombination site. For example, these recombination sites can all be loxP sites or fit sites.

[0317] In certain aspects, in examples of the polynucleotides disclosed herein, comprising a first and second recombination site and a third and fourth recombination site, the first and second recombination sites are different from the third and fourth recombination sites such that a recombinase recombines the first recombination site with the second recombination site and the third recombination site with the fourth recombination site and does not recombine, e.g., the first recombination site with the fourth recombination site.

[0318] Tn certain aspects, in certain examples, the first and second recombination sites may be loxP sites while third and fourth recombination sites may be loxL sites and the recombinase may be ere. In another examples, the first and second recombination sites may be loxP sites and the third and fourth recombination sites may be fit sites.

[0319] In certain examples, the fifth and sixth recombination sites as disclosed herein may be the same as the first and second recombination sites or the third and fourth recombination sites.Inducible Promoters

[0320] In certain aspects, the inducible promoters are selected on the basis of the regulatory sequence that allows for control of the promoter. The regulatory sequence may be operably linked to the promoter and positioned upstream of the promoter. Such regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. The regulatory sequence used to control expression may be endogenous or exogenous to the host cell. In some embodiments, bacterial gene control elements in combination with viral transactivator proteins are used to provide mammalian inducible expression. Examples of mammalian-compatible regulatory sequences include those capable of controlling an engineered promoter to adjust transcription in response to antibiotics including, without limitation, tetracyclines, streptogramins, and macrolides. For example, inclusion of a bacterial tetracycline response element (TRE) in a construct allows mammalian expression to be induced by tetracycline or a derivative thereof (e.g., doxycycline). See, e.g., Weber et al. (2004) Methods Mol. Biol. 267:451-66, Das et al. (2016) Curr. Gene Then 16(3): 156-67, Chruscicka et al. (2015) J. Biomol. Screen. 20(3):350-8, Yarranton (1992) Curr. Opin. Biotechnol. 3(5):506-l 1, Gossen & Bujard (1992) Proc. Natl.Acad. Sci. U.S.A. 89( 12):5547-51 , Gossen et al. (1995) Science 268(5218): 1766-9; herein incorporated by reference.In some embodiments, the TRE comprises seven repeats of a 19 base pair operator sequence (tetO). In further embodiments, the TRE comprises seven repeats of a 19 base pair operator sequence upstream of a minimal human cytomegalovirus (CMV) promoter.Selectable Marker

[0321] In addition, the polynucleotide constructs of the vector system may be constructed to include selectable markers. Suitable markers include genes which confer resistance to antibiotics or toxins, or sensitivity, or impart color, or change the antigenic characteristics when cells, which have been transfected with the nucleic acid constructs, are grown in an appropriate selective medium. Exemplary selectable marker genes include, without limitation, the neomycin resistance gene (neo encoding aminoglycoside phosphotransferase (APH)) that allows selection in mammalian cells by conferring resistance to G418 (Geneticin), the hygromycin-B resistance gene (hygB encoding hygromycin-B -phosphotransferase (HPH)) that confers resistance to hygromycin-B, the puromycin resistance gene (pac encoding puromycin-N-acetyltransferase) that confers resistance to puromycin, Zeocin resistance gene (Sh bla encodes a protein that binds to Zeocin) that prevents Zeocin from binding DNA and damaging it, and the blasticidin resistance gene (BSD) that confers resistance to blasticidin. In addition, dihydrofolate reductase (DHFR)- based methotrexate (MTX) selection or glutamine synthetase (GS)-based methionine sulfoximine (MSX) selection may be used in mammalian cells. Other suitable markers and selection methods are known to those of skill in the art.

[0322] In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split selectable marker that allows for selection of cells retaining two different polynucleotides using a single selective pressure. In some embodiments, the antibiotic resistance protein is split into two portions that can associate to form a functional antibiotic resistance protein. A first portion of the antibiotic resistance protein is encoded by a first polynucleotide and a second portion of the antibiotic resistance protein is encoded by a second polynucleotide. In some embodiments, a split intervening proteins (inteins) system that permits stable retention of two integrated nucleic acid constructs under a single selective pressure is used. Inteins auto catalyze a protein splicing reaction that results in excision of the intein and joining of the flanking amino acids (extern sequences) via a peptide bond. Inteins exist in nature as a single domain within a host protein or, less frequently, in a split form. For split inteins, the two separate polypeptide fragments of the intein must associate in order for protein trans- splicing to occur to excise the intein. Split intein systems are described in: Cheriyan et al, J. Biol. Chem 288: 6202-6211 (2013); Stevens et al, PNAS 114: 8538-8543 (2017); Jillette et al., Nat Comm 10: 4968 (2019); US 2020 / 0087388 Al; and US 2020 / 0263197 Al. In some embodiments, a split intein is derived from the Nostoc punctiforme (Npn) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, a first portion of the antibiotic resistance protein is the N-terminal portion which is fused to a N-terminal intein at the C-terminus and a second portion of the antibiotic resistance protein is the C-terminal portion which is fused to a C-terminal intein at the N-terminus. When both portions are present, the N-terminal intein associates with the C-terminal intein resulting in excision of the inteins and splicing of the C-terminus of the N-terminal portion of the antibiotic resistance protein to the N- terminus of the C-terminal portion of the antibiotic resistance protein, thereby forming a functional antibiotic resistance protein. s

[0323] In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter and DHFR Z-Nter. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein.

[0324] In certain embodiments, a split auxotrophic selection system that permits stable retention of two integrated nucleic acid constructs under a single selective pressure can be used. One construct encodes the N-terminal fragment of mammalian dihydrofolate reductase (DHFR) fused to a leucine zipper peptide (“Nter-DHFR”). This N-terminal fragment is enzymatically nonfunctional. The other construct encodes the C-terminal fragment of DHFR fused to a leucine zipper peptide (“Cter-DHFR”). This C-terminal fragment is enzymatically nonfunctional. When both fragments are concurrently expressed in the cell, a functional DHFR enzyme complex is formed through association of the leucine zipper peptides. Both constructs can be stably retained in the genome of a DHFR null cell by growth in a medium lacking hypoxanthine and thymidine.

[0325] Polynucleotide Payload The sequence encoding a payload as disclosed herein encompasses any nucleotide sequence that is to be delivered to a cell. The nucleotide sequence may be utilized in the cell for, e.g., insertion of the nucleotide sequence or a part thereof. For example, the nucleotide sequence may be used to repair an endogenous DNA. In such a case, the nucleotide sequence itself is the payload being delivered by the rAAV to a cell.

[0326] Tn other cases, the polynucleotide payload is transcribed in the cell into an RNA which is not translated into a protein. In such a case, the RNA is the payload that is delivered by the polynucleotide pay load present in the rAAV. In other cases, the polynucleotide pay load is transcribed in the cell into an mRNA which is translated into a protein. In such a case, the protein is the payload that is delivered by the polynucleotide payload present in the rAAV.

[0327] The polynucleotide payload may include a promoter operably linked to a DNA sequence. The promoter may be any promoter that allows for transcription of the DNA in the cell. A payload disclosed herein may be a therapeutic pay load.

[0328] The DNA sequence may be transcribed to produce RNA in the cell. The RNA may be mRNA. The RNA may be a guide RNA (gRNA), a tRNA, a suppressor tRNA, an mRNA, or a circular RNA. The RNA may be a regulatory RNA of interest such as, but not limited to, a microRNA (miRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a small nuclear RNA (snRNA), a long non-coding RNA (IncRNA), an antisense nucleic acid, and the like.

[0329] The polynucleotide payload may be a gene encoding a polypeptide, such as, an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, a DNAzyme, or any combination thereof.

[0330] A payload may include any one or combination of the following: a transgene, a tRNA suppressor, a guide RNA, or any other target binding / modifying oligonucleotide or derivative thereof, or pay loads may include immunogens for vaccines, and elements for any gene editing machinery (DNA or RNA editing). Payloads may also include those that deliver a transgene encoding antibody chains or fragments that are amenable to viral vector-mediated expression (also referred to as “vectored or vectorized antibody” for gene delivery). See, e.g., Curr Opin HIV AIDS. 2015 May; 10(3): 190-197, describing vectored antibody gene delivery for the prevention or treatment of HIV infection. See also, U.S. Pat. No. 10,780,182, which describes AAV delivery of trastuzumab (Herceptin) for treatment of HER2+ brain metastases. A payload disclosed herein may not be a therapeutic payload (e.g., a coding for a detectable marker such as GFP). In particular, in some instances the polynucleotide payload refers to a polynucleotide that may be ahomology element for homology-directed repair, or polynucleotide transcribed into a guide RNA to be delivered for a variety of purposes. In some embodiments, the transgene refers to a nucleic acid sequence coding for expression of guide RNA for ADAR editing or AD AT editing. In some embodiments, the transgene refers to a transgene packaged for gene therapy. In some embodiments, the transgene refers to synthetic constructs packaged for vaccines. In certain aspects, a polynucleotide payload may be described as encoding an RNA, which is meant to refer to the RNA transcribed from the polynucleotide.

[0331] In certain examples, the sequence encoding the payload comprises two expressible sequences, wherein a first expressible sequence encodes for a first gRNA and a second expressible sequence encodes for a second gRNA. In some embodiments, the first gRNA and the second gRNA are different. In some embodiments, the first gRNA and the second gRNA are the same. In certain examples, the sequence encoding the payload comprises two or more expressible sequences. In some embodiments, the two or more expressible sequences encode for two or more gRNA. In some embodiments, the two or more gRNA are all different gRNA, all the same gRNA, or a combination of the same and different gRNA.

[0332] In some cases, the sequence encoding the payload comprises an expressible sequence encoding both a heterologous RNA and a heterologous polypeptide. In other cases, the expressible sequence encodes two or more heterologous payloads. Where the expressible sequence encodes two heterologous payloads, in some cases, the nucleotide sequences encoding the two heterologous payloads are operably linked to the same promoter. Where the expressible sequence encodes two heterologous payloads, in some cases, the nucleotide sequences encoding the two heterologous pay loads are operably linked to two different promoters. In some cases, sequence encoding the payload comprises an expressible sequence encoding three heterologous payloads. Where the expressible sequence encodes three heterologous payloads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to the same promoter. Where the expressible sequence encodes three heterologous payloads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to two or three different promoters. In some cases, the fourth polynucleotide construct of the present disclosure comprises two or more expressible sequences, each comprising a nucleotide sequence encoding a heterologous payload.

[0333] In some embodiments, the expressible sequence encodes a polypeptide of interest. The polypeptide of interest may be any type of protein / peptide including, without limitation, an enzyme, an extracellular matrix protein, a receptor, transporter, ion channel, or other membrane protein, a hormone, a neuropeptide, an antibody, or a cytoskeletal protein; or a fragment thereof,or a biologically active domain of interest. In some cases, the payload is a therapeutic polypeptide, e.g., a polypeptide that provides clinical benefit.

[0334] Where the payload is an interfering RNA (RNAi), suitable RNAi include RNAi that decrease the level of an apoptotic or angiogenic factor in a cell. For example, an RNAi may be an shRNA or siRNA that reduces the level of a payload that induces or promotes apoptosis in a cell. A payload may be a gene whose gene product induces or promotes apoptosis are referred to herein as “pro- apoptotic genes” and the products of those genes (mRNA; protein) are referred to as “pro- apoptotic gene products.” Pro-apoptotic gene products include, e.g., Bax, Bid, Bak, and Bad gene products. See, e.g., U.S. Patent No. 7,846,730. In another example, the RNAi specifically reduces the level of an RNA and / or a polypeptide product of a defective allele.

[0335] In some embodiments, the payload is an aptamer. In some cases, the aptamer is a therapeutic aptamer. For example, the aptamer may function as an antagonist by blocking interactions at a disease-associated target (e.g., receptor-ligand interactions). Alternatively, an aptamer may serve as an agonist for activating the function of a target receptor. Exemplary aptamers of interest include aptamers against growth factor receptors and growth factors such as aptamers that bind to epidermal growth factor receptor (see, e.g., Wang et al. (2014) Biochem. Biophys. Res. Commun. 453(4):681-5), transforming growth factor-beta type III receptor (see, e.g., Ohuchi et al. (2006) Biochimie 88(7): 897-904.), vascular endothelial growth factor (VEGF) (see, e.g., Ng et al. (2006) Nat. Rev. Drug Discovery 5: 123; and Lee et al. (2005) Proc. Natl. Acad. Sci. USA 102:18902) or platelet-derived growth factor (PDGF), e.g., E10030 (see, e.g., Ni and Hui (2009) Ophthalmologica 223:401 ; and Akiyama et al. (2006) J. Cell Physiol. 207:407).

[0336] In some embodiments, the expressible sequence encodes a sequence-specific endonuclease for use in genome editing. The sequence specific endonuclease may be used to create a double-stranded break at a specific site in the genome. The double stranded breaks may then be repaired by non-homologous end joining (NHEI), microhomology-mediated end joining (MMEI), or homology-directed repair (HDR) pathways. Desired genome edits may be introduced into the genome using donor DNA to repair double-strand breaks by homologous recombination. Various sequence-specific endonucleases may be used in genome editing for creation of doublestrand breaks in DNA, including, without limitation, engineered zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and clustered regularly interspaced short palindromic repeats (CRISPR) Cas9. See, e.g., Targeted Genome Editing Using Site-Specific Nucleases: ZFNs, TALENs, and the CRISPR / Cas9 System (T. Yamamoto ed., Springer, 2015); Genome Editing: The Next Step in Gene Therapy (Advances in Experimental Medicine and Biology, T. Cathomen, M. Hirsch, and M. Porteus eds., Springer, 2016); AachenPress Genome Editing (CreateSpace Independent Publishing Platform, 2015); herein incorporated by reference. Precise control over the timing of production of the genome editing enzyme may be achieved by inducibly producing recombinant adenovirus associated virus (rAAV) virions with the vector system to allow turning on and off of expression as desired.

[0337] hi some cases, a pay load of interest is a site-specific endonuclease that provides for site-specific knock-down of gene function, e.g., where the endonuclease knocks out an allele associated with a disease. For example, in a case where a dominant allele encodes a defective copy of a gene, and the wild-type gene provides for normal function, a site-specific endonuclease may be targeted to the defective allele and knock out the defective allele. In some cases, a site-specific endonuclease is an RNA-guided endonuclease.

[0338] A site-specific nuclease may also be used to stimulate homologous recombination with a donor DNA that encodes a functional copy of the protein encoded by the defective allele. Thus, e.g., a subject rAAV virion may be used to deliver a site-specific endonuclease that knocks out a defective allele and also be used to deliver a functional copy of the defective allele, resulting in repair of the defective allele, thereby providing for production of a functional gene product.

[0339] In some cases, the payload is an RNA-guided endonuclease. In some cases, the payload is an RNA comprising a nucleotide sequence encoding an RNA-guided endonuclease. In some cases, the payload is a guide RNA, e.g., a single-guide RNA. In some cases, the pay loads are: 1) a guide RNA; and 2) an RNA-guided endonuclease. The guide RNA may comprise: a) a proteinbinding region that binds to the RNA-guided endonuclease; and b) a region that binds to a target nucleic acid. An RNA-guided endonuclease is also referred to herein as a “genome editing nuclease.”

[0340] Examples of RNA-guided endonucleases are CRISPR / Cas endonucleases (e.g., class 2 CRISPR / Cas endonucleases such as a type II, type V, or type VI CRISPR / Cas endonucleases). A suitable genome editing nuclease is a CRISPR / Cas endonuclease (e.g., a class 2 CRISPR / Cas endonuclease such as a type II, type V, or type VI CRISPR / Cas endonuclease). In some cases, a suitable RNA-guided endonuclease is a class 2 CRISPR / Cas endonuclease. In some cases, a suitable RNA-guided endonuclease is a class 2 type II CRISPR / Cas endonuclease (e.g., a Cas9 protein). In some cases, a genome targeting composition includes a class 2 type V CRISPR / Cas endonuclease (e.g., a Cpfl protein, a C2cl protein, or a C2c3 protein). In some cases, a suitable RNA-guided endonuclease is a class 2 type VI CRISPR / Cas endonuclease (e.g., a C2c2 protein; also referred to as a “Casl3a” protein). Also suitable for use is a CasX protein. Also suitable for use is a CasY protein.

[0341] In some cases, the genome-editing endonuclease is a Type II CRISPR / Cas endonuclease. In some cases, the genome-editing endonuclease is a Cas9 polypeptide. The Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g., a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the protein-binding segment of the Cas9 guide RNA. In some cases, the Cas9 polypeptide used in a composition or method of the present disclosure is a Staphylococcus aureus Cas9 (saCas9) polypeptide. In some cases, a suitable Cas9 polypeptide is a high-fidelity (HF) Cas9 polypeptide. Kleinstiver et al. (2016) Nature 529:490. In some cases, a suitable Cas9 polypeptide exhibits altered PAM specificity. See, e.g., Kleinstiver et al. (2015) Nature 523:481. In some cases, the genome-editing endonuclease is a type V CRISPR / Cas endonuclease. In some cases a type V CRISPR / Cas endonuclease is a Cpfl protein. In some cases, the genome-editing endonuclease is a CasX or a CasY polypeptide. CasX and CasY polypeptides are described in Burstein et al. (2017) Nature 542:237.

[0342] In some cases, a genome editing nuclease is a fusion protein that is fused to a heterologous polypeptide (also referred to as a “fusion partner”). In some cases, a genome editing nuclease is fused to an amino acid sequence (a fusion partner) that provides for subcellular localization, i.e. , the fusion partner is a subcellular localization sequence (e.g. , one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.).

[0343] Also suitable for use is an RNA-guided endonuclease with reduced enzymatic activity. Such an RNA-guided endonuclease is referred to as a “dead” RNA-guided endonuclease; for example, a Cas9 polypeptide that comprises certain amino acid substitutions such that it exhibits substantially no endonuclease activity, but such that it still binds to a target nucleic acid when complexed with a guide RNA, is referred to as a “dead” Cas9 or “dCas9.” In some cases, a “dead” Cas9 protein has a reduced ability to cleave both the complementary and the non-complementary strands of a double stranded target nucleic acid. For example, a “nuclease defective” Cas9 lacks a functioning RuvC domain (i.e., does not cleave the non-complementary strand of a double stranded target DNA) and lacks a functioning HNH domain (i.e., does not cleave the complementary strand of a double stranded target DNA). Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded or double stranded target nucleic acid) but retains the ability to bind a target nucleic acid. A Cas9 protein that maynot cleave target nucleic acid (e.g., due to one or more mutations, e.g., in the catalytic domains of the RuvC and HNH domains) is referred to as a “nuclease defective Cas9”, “dead Cas9” or simply “dCas9.” Otherresidues may be mutated to achieve the above effects (i.e. inactivate one or the other nuclease portions).

[0344] In some cases, the genome-editing endonuclease is an RNA-guided endonuclease (and its corresponding guide RNA) known as Cas9-synergistic activation mediator (Cas9-SAM). The RNA-guided endonuclease (e.g., Cas9) of the Cas9-SAM system is a “dead” Cas9 fused to a transcriptional activation domain (wherein suitable transcriptional activation domains include, e.g., VP64, p65, MyoDl , HSF1 , RTA, and SET7 / 9) or a transcriptional repressor domain (where suitable transcriptional repressor domains include, e.g., a KRAB domain, a NuE domain, an NcoR domain, a SID domain, and a SID4X domain). The guide RNA of the Cas9-SAM system comprises a loop that binds an adapter protein fused to a transcriptional activator domain (e.g., VP64, p65, MyoDl , HSF1 , RTA, or SET7 / 9) or a transcriptional repressor domain (e.g., a KRAB domain, a NuE domain, an NcoR domain, a SID domain, or a SID4X domain). For example, in some cases, the guide RNA is a single-guide RNA comprising an MS2 RNA aptamer inserted into one or two loops of the sgRNA; the dCas9 is a fusion polypeptide comprising dCas9 fused to VP64; and the adaptor / functional protein is a fusion polypeptide comprising: i) MS2; ii) p65; and iii) HSF1. See, e.g., U.S. Patent Publication No. 2016 / 0355797.

[0345] Also suitable for use is a chimeric polypeptide comprising: a) a dead RNA-guided endonuclease; and b) a heterologous fusion polypeptide. Examples of suitable heterologous fusion polypeptides include a polypeptide having, e.g., methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, DNA integration activity, or nucleic acid binding activity.

[0346] A nucleic acid that binds to a class 2 CRISPR / Cas endonuclease (e.g., a Cas9 protein; a type V or type VI CRISPR / Cas protein; a Cpfl protein; etc.) and targets the complex to a specific location within a target nucleic acid is referred to herein as a “guide RNA” or “CRISPR / Cas guide nucleic acid” or “CRISPR / Cas guide RNA.” A guide RNA provides target specificity to the complex (the RNP complex) by including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.

[0347] In some cases, a guide RNA includes two separate nucleic acid molecules: an “activator” and a “targeter” and is referred to herein as a “dual guide RNA”, a “double-molecule guide RNA”, a “two-molecule guide RNA”, or a “dgRNA.” In some cases, the guide RNA is one molecule (e.g., for some class 2 CRISPR / Cas proteins, the corresponding guide RNA is a single molecule; and in some cases, an activator and targeter are covalently linked to one another, e.g.,via intervening nucleotides), and the guide RNA is referred to as a “single guide RNA”, a “singlemolecule guide RNA,” a “one-molecule guide RNA”, or simply “sgRNA.”

[0348] In some cases, the guide RNA is at least partially complementary to a target RNA sequence and is capable of recruiting an ADAR enzyme for RNA editing of the target RNA sequence.

[0349] Where the payload is an RNA-guided endonuclease, or is both an RNA-guided endonuclease and a guide RNA, the payload may modify a target nucleic acid. In some cases, e.g., where a target nucleic acid comprises a deleterious mutation in a defective allele (e.g., a deleterious mutation in a neural cell target nucleic acid), the RNA-guided endonuclease / guide RNA complex, together with a donor nucleic acid comprising a nucleotide sequence that corrects the deleterious mutation (e.g., a donor nucleic acid comprising a nucleotide sequence that encodes a functional copy of the protein encoded by the defective allele), may be used to correct the deleterious mutation, e.g., via homology-directed repair (HDR).

[0350] In some cases, the payloads are an RNA-guided endonuclease and 2 separate sgRNAs, where the 2 separate sgRNAs provide for deletion of a target nucleic acid via non-homologous end joining (NHEJ).

[0351] In some cases, the payloads are: i) an RNA-guided endonuclease; and ii) one guide RNA. In some cases, the guide RNA is a single-molecule (or “single guide”) guide RNA (an “sgRNA”). In some cases, the guide RNA is a dual-molecule (or “dual-guide”) guide RNA (“dgRNA”).

[0352] In some cases, the payloads are: i) an RNA-guided endonuclease; and ii) 2 separate sgRNAs, where the 2 separate sgRNAs provide for deletion of a target nucleic acid via non- homologous end joining (NHEJ). In some cases, the guide RNAs are sgRNAs. In some cases, the guide RNAs are dgRNAs.

[0353] In some cases, the payloads are: i) a Cpfl polypeptide; and ii) a guide RNA precursor; in these cases, the precursor may be cleaved by the Cpfl polypeptide to generate 2 or more guide RNAs.

[0354] The payloads as described herein may be flanked by ITRs.Pharmaceutical Compositions

[0355] The present disclosure provides pharmaceutical compositions comprising the polynucleotides, or vector system described herein or an rAAV virion encasidating a polynucleotide payload (e.g., for encoding a therapeutic protein, such as an antibody or any fragment or derivative thereof), produced from such a vector system, and a pharmaceuticallyacceptable carrier, diluent, excipient, or buffer. In some cases, the pharmaceutically acceptable carrier, diluent, excipient, or buffer is suitable for use in a human. Such excipients, carriers, diluents, and buffers include any pharmaceutical agent that may be administered without undue toxicity.

[0356] Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, polyethylene glycol, hyaluronic acid, and ethanol. Pharmaceutically acceptable salts may be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy,” 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., eds., 7th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3rd ed. Amer. Pharmaceutical Assoc. Certain facilitators of nucleic acid uptake and / or expression may also be included in the compositions or coadministered.Methods of Delivering a Payload or Protein

[0357] Once formulated, compositions comprising an rAAV virion or protein (e.g., therapeutic protein such as an antibody or any fragment or derivative thereof) may be administered directly to a subject or, alternatively, delivered ex vivo, to cells derived from the subject. For example, methods for the ex vivo delivery and reimplantation of transformed cells into a subject are known in the art and may include, e.g., dextran- mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, lipofectamine and LT-1 mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei. Direct delivery of a vector system comprising an expressible sequence encoding a payload of interest in vivo will generally be accomplished by injection using either a conventional syringe, needless devices such as Bioject or a gene gun, such as the Accell gene delivery system (PowderMed Ltd, Oxford, England).

[0358] In certain embodiments, rAAV of the present disclosure or compositions comprising the rAAV may be administered to a subject in need thereof by any suitable route, such as,intravenous, intramuscular, intracranial, intracerebroventicular, intrathecal, intracistemal, or via brain surgery.

[0359] In some embodiments, the rAAV virions comprising an expressible sequence encoding a payload of interest are used in gene therapy applications to treat a disease. The payload may be, for example, a polypeptide, a protein, or an RNA. A polypeptide or a protein may be, for example, an enzyme, an antibody, a hormone, an aptamer, or an endonuclease (e.g., a site-specific endonuclease such an RNA-guided endonuclease), a component of a CRTSPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, or any combination thereof, as described above. The payload may be progranulin. An RNA may be, for example, a guide RNA, a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, an antisense oligonucleotide (ASO), a ribozyme, a DNAzyme, an aptamer, or any combination thereof. In some embodiments, the rAAV virions used in gene therapy applications to treat a disease comprise one or more expressible sequences encoding one or more payloads of interest. For example, the rAAV virions comprise two expressible sequences, wherein a first expressible sequence encodes for a first gRNA and a second expressible sequence encodes for a second gRNA. In some embodiments, the first gRNA and the second gRNA are different. In some embodiments, the first gRNA and the second gRNA are the same.

[0360] In some embodiments, the protein (e.g., therapeutic protein such as an antibody or any fragment or derivative thereof) is used in gene therapy applications to treat a disease. The protein may be, for example, a polypeptide. A polypeptide or a protein may be, for example, an enzyme, an antibody, a hormone, an aptamer, or an endonuclease (e.g., a site-specific endonuclease such an RNA-guided endonuclease), a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, or any combination thereof, as described above.

[0361] The rAAV virions or protein (e.g., therapeutic protein) may be formulated into compositions for delivery to a vertebrate subject (e.g., mammalian subject, preferably human). These compositions may either be prophylactic (to prevent a disease or condition) or therapeutic (to treat a disease or condition). The compositions will comprise a "therapeutically effective amount" of the rAAV virions such that amounts of the payload of interest may be produced in vivo sufficient to have a therapeutic benefit in the individual to which it is administered. The compositions will comprise a "therapeutically effective amount" of the protein (e.g., therapeutic protein) such that amounts has a therapeutic benefit in the individual to which it is administered. The exact amounts necessary will vary depending on the subject being treated; the age and generalcondition of the subject to be treated; the degree of protection desired; the severity of the condition being treated; the particular therapeutic agent produced, and the mode of administration, among other factors. An appropriate effective amount may be readily determined by one of skill in the art. Thus, a "therapeutically effective amount" will fall in a relatively broad range that may be determined through routine trials.

[0362] A "therapeutically effective amount" of virion comprising an expressible sequence encoding a payload of interest will fall in a relatively broad range that may be determined through experimentation and / or clinical trials. For example, for in vivo injection, a therapeutically effective dose of rAAV virions will be on the order of from about 106to about 1015of the rAAV virions, e.g., from about 108to 1012rAAV virions. For in vitro transduction, an effective amount of rAAV virions to be delivered to cells will be on the order of from about 10sto about 1013of the rAAV virions. Other effective dosages may be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.

[0363] hi some cases, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of gene expression. In some cases, more than one administration is administered at various intervals, e.g., daily, weekly, twice monthly, monthly, every 3 months, every 6 months, yearly, etc. In some cases, multiple administrations are administered over a period of time from 1 month to 2 months, from 2 months to 4 months, from 4 months to 8 months, from 8 months to 12 months, from 1 year to 2 years, from 2 years to 5 years, or more than 5 years.Methods of Filtering Filled and Unfilled Capsids

[0364] Some embodiments increase are directed to filtering or selecting for filled capsids. Some embodiments utilize a chromatographic methodology to separate filled rAAV capsids (i.e., a capsid containing a payload) from unfilled capsids. Chromatographic methods can include one or more of high performance liquid chromatography, density separation, ion (including anion and / or cation) exchange chromatography. The preferred methodology of some embodiments is anion exchange chromatography (AEX), which can separate molecules based on their net negative charge. The principle behind this method lies in the interaction between negatively charged molecules (anions) and positively charged functional groups on the stationary phase of the chromatography column.

[0365] Due to the presence of a negative charge on the phosphates of a nucleic acid backbone, filled rAAV capsids can be retained within an AEX column longer than unfilledcapsids. In some embodiments, a trace or chromatogram is monitored (manually and / or automatically) to determine when to collect the eluent and / or discard the eluent.Kits

[0366] Also provided are kits comprising the polynucleotide, vector system, rAAV virions, or cell lines for inducibly producing rAAV virions, as described herein. In some embodiments, the AAV vector system is provided with cells (e.g., already transfected with one or more of the AAV polynucleotide constructs of the vector system or separately). Other agents may also be included in the kit such as transfection agents, suitable media for culturing cells, buffers, antibiotics, agents for inducing production of rAAV virions, expression of an expressible sequence encoding a payload of interest, and / or inducing a sequence encoding the induced Rep / Cap (e.g., tetracycline, doxycycline, tamoxifen), and the like.

[0367] hi addition to the above components, the subject kits may further include (in certain embodiments) instructions for practicing the subject methods. In some embodiments, instructions for using the vector systems or cell lines to inducibly produce recombinant AAV (rAAV) virions comprising an expressible sequence of interest are provided in the kits. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, and the like. Yet another form of these instructions is a computer readable medium, e.g., diskette, compact disk (CD), DVD, flash drive, SD drive, and the like, on which the information has been recorded. Yet another form of these instructions that may be present is a website address which may be used via the internet to access the information at a removed site.Cell Storage

[0368] Various embodiments are directed to a preserved and / or stored cell — e.g., cell, cell line, and / or other collection of cells, as described herein, including (but not limited to) a cell, cell line, and / or other collection of cells comprising one or more of the polynucleotides, plasmids, and / or other constructs as described herein. Such process can include “cell banking” such as for long term and / or freezer-based storage. In such instances, an appropriate media may be used to maintain integrity and viability of a cell, cell line, and / or other collection of cells in storage. In various instances, the cell, cell line, and / or other collection of cells have not been induced (e.g., by adding one or more triggering agents). In many instances, the cells have been grown to aparticular concentration (e.g., cells / mL). Such concentration may be a minimum concentration, a maximum concentration, and / or a range of concentrations. To prepare cells for banking, the cells may be collected, such as through centrifugation. Then, the collected cells may be resuspended in an appropriate buffer. Such buffers may include one or more components that prevent freezing, ice crystal formation, and / or limit ice crystal size — such properties may prevent damage of the cell, cell line, and / or other collection of cells. The cell, cell line, and / or other collection of cells may then be placed in storage, such as a freezer (e.g., -20°C, -80°C, dry ice, liquid nitrogen, etc.)Methods to Harvest rAAVs

[0369] Also provided are methods to harvest rAAVs following a period of time after a cell, cell line, and / or other collection of cells as described herein, including (but not limited to) a cell, cell line, and / or other collection of cells comprising one or more of the polynucleotides, plasmids, and / or other constructs as described herein. In some instances, a cellular structure (e.g., plasma membrane) remains intact, thus sequestering produced rAAVs.

[0370] To release sequestered, produced rAAVs, various embodiments lyse or otherwise disrupt the cell, cell line, and / or other collection of cells. Lysis can be achieved with various known methods, including heat shock, electroporation, detergent-based lysis, protein disruption, sonication and / or any other method, which can lyse the cell, cell line, and / or other collection of cells. In preferred embodiments, a lysis method that has minimal or no effect on the produced rAAVs is used.

[0371] Once cells are lysed or otherwise disrupted, the produced rAAVs can be collected. Such collection can utilize one or more of filters, centrifugation, chromatography (e.g., sizeexclusion, affinity, etc.). In various instances, large debris or other components with a higher sedimentation rate than rAAV can be collected and removed by centrifugation, while the remaining suspension undergoes one or more filters to remove additional debris. For example, filtering may utilize one or more filters with a pore size of approximately 1.00 pm, 0.95 p m, 0.90 m, 0.85 pm, 0.80 pm, 0.75 pm, 0.70 pm, 0.65 pm, 0.60 pm, 0.55 pm, 0.50 pm, 0.45 pm, 0.40 pm, 0.35 pm, 0.30 pm, 0.25 pm, 0.20 pm, 0.15 pm, 0.10 pm, or 0.05 pm. In certain instances, a filter with a larger pore size (e.g., approximately 0.50 pm (or 0.50 pm ± 0.10 pm)) may be used followed by a filter with a smaller pore size (e.g., approximately 0.25 pm (or 0.25 pm ± 0.10 pm)).

[0372] In various instances, filtering may be performed at a specific pressure rate or based on a pressure differential. Such pressure may be approximately 0 psi, 5 psi, 10 psi, 15 psi, 20 psi, 25 psi, 30 psi, 35 psi, 40 psi, 45 psi, 50 psi, or greater.

[0373] Certain instances use affinity chromatography to further purify harvested rAAVs. Such chromatography may use a resin (or matrix) that allows for reversible binding of the harvested rAAVs. Certain resins may bind all AAV serotypes, while some resins may be serotype- and / or epitope-specific. Once a sample containing the harvested rAAVs is moved through an affinity column, an elution buffer may be used to release the captured rAAVs, thus removing any additional material that has not yet been removed (e.g., via centrifugation and / or filtration). Resins may comprise particles of any relevant size. Certain commercial varieties include particles with an average size of approximately 50 pm. Additional resins may contain particles of other average sizes, such as approximately 10 pm, 15 pm, 20 pm, 25 pm, 30 pm, 35 pm, 40 pm, 45 pm, 50 pm, 55 pm, 60 pm, 65 pm, 70 pm, 75 pm, 80 pm, 85 pm, 90 pm, 95 pm, 100 pm, or greater. The amount of retention and elution of captured rAAVs is a function of the binding capacity of the resin and the amount of resin used. The particular volume of sample added to an affinity column can be varied based on expected or estimated production amounts. For example, binding capacity may be approximately 100 particles / mL of resin, 250 particles / mL of resin, 500 particles / mL of resin, 750 particles / mL of resin, 1000 particles / mL of resin, 1250 particles / mL of resin, 1500 parti cles / mL of resin, 1750 particles / mL of resin, 2000 particles / mL of resin, 2500 particles / mL of resin, 5000 particles / mL of resin, 7500 particles / mL of resin, 10000, particles / mL of resin, or greater.Methods to Quantify rAAV production

[0374] Also provided are methods to quantify rAAV production. Such production can be measured based on a rAAV harvested from a cell, cell line, and / or other collection of cells as described herein, including (but not limited to) a cell, cell line, and / or other collection of cells comprising one or more of the polynucleotides, plasmids, and / or other constructs as described herein. In various instances, rAAV may be measured based on a titer level of viral protein (vp), viral genome (vg), fill rate (e.g., percentage of encapsidated viral genomes), and / or any other quantifiable metric.

[0375] To quantify vp production, various embodiments use a fluorescent and / or colorimetric detection, chromatography, and / or other method to quantify a target protein. For example, liquid chromatography (including HPLC), SDS-PAGE, quantitative TOF, protein blots (e.g., western blots) and / or any applicable other chromatographic method. Some embodiments utilize fluorescence and / or colorimetric detection. Such methodologies can include an antibody-based detection method. In certain instances, ELISA is used as the detection method. In various instances, the ELISA utilizes an antibody that is specific to one AAV serotype (e.g., AAV5,AAV7, etc.), and / or in certain instances, ELISA may utilize an antibody that is AAV-ambivalent (e.g., can bind to multiple AAV serotypes). In some embodiments one of the foregoing antibodies may provide a measurable signal and / or reaction. Additional embodiments utilize one or more secondary antibodies to increase a signal and / or provide a measurable reaction. Certain embodiments may coat a reaction plate or vessel with a serotype-specific antibody while using a serotype- ambivalent antibody during detection. Other embodiments may coat a plate using a serotype- ambivalent antibody while using a serotype-specific antibody during detection. To prevent overestimation, some antibodies are specific for an epitope that is presented only in fully formed capsids (e.g., loose or free capsid proteins do not bind). A secondary antibody may be used to bind to the detection antibody for the previously mentioned reasons. In certain situations, the detection may take the form of a fluorescence, while certain embodiments may utilize a catalytic reaction using an enzyme conjugated to one of the foregoing antibodies.

[0376] Various instances utilize a quantitative metric to measure vg. Such methods can include electrophoresis (gel, column, capillary, etc.), sequencing, amplification, and / or any other applicable method to quantify specific nucleic acids. Amplification based methods can include PCR and / or isothermal amplification. Various instances use quantitative and / or real-time PCR, droplet PCR, droplet digital PCR (ddPCR), and / or another PCR-based amplification method. Certain instances use probe-based methods, such as a TaqMan assay, while others use a dye-based method (e.g., cyber-green, cyber-gold, ethidium bromide, etc.) Certain embodiments remove unencapsidated nucleic acids from a sample prior to any quantitative analysis to avoid an overestimation of vg titer levels. Such removal can include any applicable method to remove nucleic acids, including a nuclease-based hydrolysis. Certain embodiments lyse or rupture capsids to release encapsidated nucleic acids for quantitative determination.

[0377] Certain embodiments determine fill rate based on a ratio of vg and vp, such as described above. Various embodiments use chromatographic-based methodologies to determine fill rate. Certain embodiments use anion-exchange chromatography (e.g., AEX-HPLC) to segregate and quantify filled from empty capsids. Due to the negative charge of nucleic acids, filled capsids (those that contain a nucleic acid) have a slight negative charge as compared to unfilled (or empty) capsids (those that do not contain a nucleic acid). This charge differential causes filled capsids to possess a lower isoelectric point (pl) from unfilled capsids — pl is a measure of pH where a molecule carries no electric charge. The lower pl in filled capsids can be exploited to allow filled capsids to be retained in an anion exchange column for a longer duration allowing the measurement of empty versus filled capsids. The lower pl of filled capsids may alsobe utilized to enrich a sample for filled capsids, such that unfilled capsids may be discarded, while the filled capsids are eluted into a separate container.

[0378] Various anion exchange resins are known in the art and vary in specificity, strength, and particle size. Generally, anion exchange resins comprise a polymer bead with a positively charged functional group. In various instances, the particular resin may be selected for flow rate, particle size, functional group, and / or other property. In various instances, particle size may be between approximately 5 pm and 100 pm or greater, including approximately 5 pm, 10 pm, 15 pm, 20 pm, 25 pm, 30 pm, 35 pm, 40 pm, 45 pm, 50 pm, 55 pm, 60 pm, 65 pm, 70 pm, 75 pm, 80 pm, 85 pm, 90 pm, 95 pm, 100 pm or greater. Depending on column properties, the columns may be loaded to a present amount — for example, a particular number of capsids are added to a column regardless of total volume. In certain instances, the total load of the column is approximately 1 x 1010capsids, 1.5 x 1010capsids, 2 x 1010capsids, 2.5 x 1010capsids, 3 x 1010capsids, 3.5 x 1010capsids, 4 x 1010capsids, 4.5 x 1010capsids, 5 x 1010capsids, 7.5 x 1010capsids, 1 x 1011capsids, 1.5 x 1011capsids, 2 x 1011capsids, 2.5 x 1011capsids, 3 x 1011capsids, 3.5 x 1011capsids, 4 x 1011capsids, 4.5 x 1011capsids, 5 x 1011capsids, 7.5 x 1011capsids, 1 x 1012capsids, 1.5 x 1012capsids, 2 x 1012capsids, 2.5 x 1012capsids, 3 x 1012capsids, 3.5 x 1012capsids, 4 x 1012capsids, 4.5 x 1012capsids, 5 x 1012capsids, 7.5 x 1012capsids, or greater.Aspects of the Invention

[0379] The below items disclose various aspects of the invention. Each of the aspects described below can be combined with other aspects and embodiments disclosed elsewhere herein, including the claims, where the combinations are clearly compatible. Certain aspects include:Aspect 1. A polynucleotide comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising: an intron comprising a second promoter operably linked to a small Rep coding sequence; and the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, and wherein the second promoter has higher promoter activity as compared to the first promoter.Aspect 2. The polynucleotide of Aspect 1 , wherein the first promoter is heterologous to the large Rep coding sequence.Aspect 3. The polynucleotide of Aspect 1 or 2, wherein the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl 9 promoter and upstream of the transcription start site of the small Rep coding sequence.Aspect 4. The polynucleotide of Aspect 3, wherein the pl9 promoter is mutated to substantially reduce promoter activity.Aspect 5. The polynucleotide of Aspect 4, wherein the p!9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.Aspect 6. The polynucleotide of any one of Aspects 1-5, wherein the vector lacks a functional p5 promoter.Aspect 7. The polynucleotide of Aspect 6, wherein the first promoter replaces the p5 promoter. Aspect 8. The polynucleotide of any one of Aspects 1-7, wherein the first promoter and / or second promoter is a constitutive promoter.Aspect 9. The polynucleotide of any one of Aspects 1-7, wherein the first promoter and / or second promoter is an inducible promoter.Aspect 10. The polynucleotide of any one of Aspects 1-9, wherein (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter.Aspect 11. The polynucleotide of any one of Aspects 1-10, further comprising a polyadenylation (Poly A) signal sequence downstream of the Rep coding sequence, wherein the PolyA signal sequence is stronger than a native AAV Rep PolyA signal sequence.Aspect 12. The polynucleotide of Aspect 11, wherein the PolyA signal sequence is selected from: a bovine growth hormone (bGH) PolyA signal sequence, a human growth hormone (hGH) PolyA signal sequence, a Simian Virus 40 (SV40) PolyA signal sequence, a Chinese hamster growth hormone PolyA signal sequence, a human neurophilin-1 PolyA signal sequence, a nopaline synthase PolyA signal sequence, an alpha globulin PolyA signal sequence, and a rabbit globin PolyA signal sequence.Aspect 13. The polynucleotide of Aspect 11 or 12, wherein the polyadenylation signal sequence comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99%identity to the nucleotide sequence of SEQ ID NO: 2.Aspect 14. The polynucleotide of any one of Aspects 11-13, wherein the polyadenylation signal sequence comprises the nucleotide sequence of SEQ ID NO: 2.Aspect 15. The polynucleotide of any one of Aspects 11-14, further comprising an enhancer downstream of the PolyA signal sequence.Aspect 16. The polynucleotide of Aspect 15, wherein the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer.Aspect 17. The polynucleotide of Aspect 15 or 16, wherein the enhancer comprises one or more sequences selected from SEQ ID NOs: 11-116 and 165-168.Aspect 18. The polynucleotide of any one of Aspects 15-17, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).Aspect 19. The polynucleotide of any one of Aspects 15-18, wherein the enhancer is a double enhancer.Aspect 20. The polynucleotide of Aspect 19, wherein the double enhancer comprises one of the following enhancers: a telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165). Aspect 21. The polynucleotide of Aspect 19 or 20, wherein the double enhancer comprises two of a telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).Aspect 22. The polynucleotide of any one of Aspects 19-21, wherein the double enhancer comprises a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166) and a CMV enhancer (SEQ ID NO: 165).Aspect 23. The polynucleotide of any one of Aspects 19-22, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 168.Aspect 24. The polynucleotide of any one of Aspects 19-23, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO: 168.Aspect 25. The polynucleotide of any one of Aspects 15-18, wherein the enhancer is a triple enhancer.Aspect 26. The polynucleotide of Aspect 25, wherein the triple enhancer comprises a telomerase reverse transcriptase (hTERT) (SEQ ID NO: 167), a Simian virus 40 (SV40) (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).Aspect 27. The polynucleotide of Aspect 25 or 26, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 10.Aspect 28. The polynucleotide of any one of Aspects 25-27, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO: 10.Aspect 29. The polynucleotide of any one of Aspects 1-28, wherein the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing a large Rep protein.Aspect 30. The polynucleotide of any one of Aspects 1-29, wherein the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.Aspect 31. The polynucleotide of any one of Aspects 1-30, further comprising a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.Aspect 32. The polynucleotide of Aspect 31, wherein the tag is a purification tag and / or a detectable tag.Aspect 33. The polynucleotide of any one of Aspects 1-32, wherein the vector is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the large Rep proteins and / or large Rep transcripts from a vector not having the first promoter and / or having a p5 promoter.Aspect 34. The polynucleotide of any one of Aspects 1-32, wherein the vector is configured to provide for an expression of the small Rep proteins and / or small Rep transcripts at a level that is higher than the expression of the small Rep proteins and / or small Rep transcripts from a vector not having the second promoter and / or having a pl9 promoter.Aspect 35. The polynucleotide of any one of Aspects 1-34, wherein the vector is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the small Rep proteins and / or small Rep transcripts.Aspect 36. The polynucleotide of any one of Aspects 1-35, wherein a ratio of the expression level of the small Rep proteins and / or small Rep transcripts to the expression level of the largeRep proteins and / or large Rep transcripts ranges from 1.5:1 to 10,000: 1, including 5:1; 6:1 ; 7: 1; 8:1 ; 9:1 ; 10:1; 100:1; 1000: 1; or 5000: 1; 5.Aspect 37. The polynucleotide of any one of Aspects 1-36, further comprising an AAV Cap coding sequence.Aspect 38. The polynucleotide of any one of Aspects 1-37, further comprising a sequence encoding a first selectable marker operably linked to a constitutive promoter.Aspect 39. The polynucleotide of Aspect 38, wherein the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.Aspect 40. The polynucleotide of Aspect 39, wherein the polynucleotide comprises an inducible promoter operably linked to the Cap coding sequence; optionally, wherein the inducible promoter comprises a tetracycline-responsive promoter element (TRE).Aspect 41. The polynucleotide of Aspect 39 or 40, wherein the intervening sequence comprises a transcriptional blocking element (TBE).Aspect 42. The polynucleotide of Aspect 38, wherein the AAV Cap coding sequence is operably linked to a native promoter.Aspect 43. The polynucleotide of Aspect 42, wherein the native promoter is a p40 promoter located in the small Rep coding sequence.Aspect 44. The polynucleotide of Aspect 38, wherein the AAV Cap encoding sequence is operably linked to a heterologous promoter.Aspect 45. The polynucleotide of Aspect 44, wherein the heterologous promoter is an inducible promoter.Aspect 46. A vector comprising the polynucleotide of any one of Aspects 1-41.Aspect 47. A vector comprising the polynucleotide of any one of Aspects 1-37 and 42-45.Aspect 48. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of Aspect 46, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; and a third vector comprising a polynucleotide payload flanked by AAV inverted terminal repeats (ITRs).Aspect 49. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of Aspect 47, wherein the vector is a first vector;a second vector comprising a sequence encoding one or more AAV helper proteins; a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).Aspect 50. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of Aspect 47, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs); and a fourth vector comprising an AAV Cap encoding sequence.Aspect 51. The vector system of any one of Aspects 48-50 for inducibly producing rAAV, the second vector comprising an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a third recombination site and a fourth recombination site flanking the sequence encoding the inducible recombinase, wherein the third recombination site and the fourth recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding the one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a constitutive promoter operably linked to a sequence encoding a second selectable marker.Aspect 52. The vector system of any one of Aspects 48-51, wherein the first vector comprises a sequence encoding a first portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the first portion of the first selectable marker and the third vector comprises a sequence encoding a second portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the second portion of the first selectable marker, wherein the first and second portions associate to form a functional first selectable marker.Aspect 53. The vector system of any one of Aspects 51-52, wherein the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding at least two AAV helper proteins.Aspect 54. The vector system of any one of Aspects 51-53, wherein the helper proteins comprise E2a and E4.Aspect 55. The vector system of any one of Aspects 51-54, wherein the inducible promoter inthe second vector comprises a tetracycline-responsive promoter element (TRE) and is operably linked to a sequence encoding the inducible recombinase, and the activator is Tet-on 3G.Aspect 56. The vector system of any one of Aspects 51-55, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.Aspect 57. The vector system of Aspect 56, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.Aspect 58. The vector system of any one of Aspects 48-57, wherein the payload is progranulin. Aspect 59. The vector system of any one of Aspects 48-58, wherein the second vector further comprises a VA-RNA coding sequence.Aspect 60. The vector system of Aspect 59, wherein the second vector further comprises an insert comprising: a first part of a constitutive promoter and a second part of a constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a staffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA. Aspect 61. The vector system of Aspect 60, wherein the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter. Aspect 62. The vector system of Aspect 59-61, wherein the sequence coding for VA-RNA is a transcriptionally dead sequence.Aspect 63. The vector system of any one of Aspects 59-62, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.Aspect 64. A cell comprising the polynucleotide of any one of Aspects 1-45 or the vector of Aspect 46 or 47.Aspect 65. The cell of Aspect 64, wherein the polynucleotide or the vector is integrated into a genome of the cell.Aspect 66. A cell comprising the first vector and the second vector of any one of Aspects 48-50. Aspect 67. The cell of Aspect 66, wherein the first vector and the second vector are integrated into a genome of the cell.Aspect 68. A cell comprising the vector system of any one of Aspects 48-51.Aspect 69. The cell of any one of Aspects 64-68, wherein the cell is a mammalian cell, optionally wherein the mammalian cell is a HEK293 cell, further optionally, wherein the HEK293 cell expresses AAV helper proteins El A and E1B.Aspect 70. The cell of Aspect 68 or 69, wherein the vector system is integrated into a genome of the cell.Aspect 71. A method for producing recombinant AAV, the method comprising performing transfection of a cell with the vector system of any one of Aspects 48-51 .Aspect 72. A method for inducibly producing a recombinant AAV (rAAV), the method comprising contacting the cell of any one of Aspects 68-70 with a first triggering agent and a second triggering agent, thereby inducing the production of a rAAV.Aspect 73. The method of Aspect 71 or 72, wherein the cell expresses higher levels of the small Rep protein compared to a cell comprising the first vector having a native pl9 promoter instead of the second promoter and comprising the second and third vectors.Aspect 74. The method of any one of Aspects 71-73, wherein the cell expresses lower levels of the large Rep compared to a cell comprising the first vector having a native p5 promoter instead of the first promoter and comprising the second and third vectors.Aspect 75. The method of any one of Aspects 71-74, wherein the cell expresses lower level of the large Rep protein compared to the small Rep protein.Aspect 76. The method of any one of Aspects 71-75, wherein the cell produces higher levels of rAAV as compared to a cell comprising the first vector having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter and comprising the second and third vectors.Aspect 77. A method of generating a cell for inducibly producing recombinant AAV (rAAV) comprising a payload, the method comprising:(i) introducing into a cell a first vector comprising: an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a first recombination site and a second recombination site flanking the sequence encoding the inducible recombinase, wherein the first recombination site and the second recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator and the activator is unable to activate theinducible promoter in absence of a first triggering agent; and a second constitutive promoter operably linked to a sequence encoding a first selectable marker, wherein the cell constitutively expresses the first selectable marker,(ii) selecting for a cell expressing the first selectable marker;(iii) introducing a second vector and a third vector into the cell expressing the first selectable marker, the second vector comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising (i) an intron comprising a second promoter and (ii) the small Rep coding sequence, wherein the second promoter is operably linked to the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, and wherein the second promoter has higher promoter activity as compared to the first promoter, wherein the small Rep coding sequence comprises an excisable element comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon; an AAV capsid proteins coding sequence; and a third constitutive promoter operably linked to a sequence encoding a first portion of a second selectable marker; and the third vector comprising a polynucleotide payload sequence and a fourth constitutive promoter operably linked to a sequence encoding a second portion of the second selectable marker, wherein the polynucleotide payload sequence is flanked by AAV inverted terminal repeats (ITRs); and(iv) selecting for a cell expressing the first selectable marker and the second selectable marker, thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising the payload.Aspect 78. The method of Aspect 77, further comprising expanding a cell expressing the first and second selectable markers.Aspect 79. The method of Aspect 77 or 78, wherein the first and second selectable markers areantibiotic resistance proteins.Aspect 80. The method of Aspect 79, wherein the second selectable marker is a split blasticidin. Aspect 81. The method of any one of Aspects 77-80, wherein the first promoter in the second vector is heterologous to the large Rep coding sequence.Aspect 82. The method of any one of Aspects 77-81, wherein the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl 9 promoter and upstream of the transcription start site of the small Rep coding sequence.Aspect 83. The method of Aspect 82, wherein the pl 9 promoter is mutated to substantially reduce promoter activity.Aspect 84. The method of Aspect 83, wherein the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.Aspect 85. The method of any one of Aspects 77-84, wherein the second vector lacks a functional p5 promoter.Aspect 86. The method of Aspect 85, wherein the first promoter replaces the p5 promoter.Aspect 87. The method of any one of Aspects 77-86, wherein the first promoter and / or second promoter in the second vector is a constitutive promoter or an inducible promoter.Aspect 88. The method of any one of Aspects 77-87, wherein in the second vector, (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RS V promoter.Aspect 89. The method of any one of Aspects 77-88, wherein the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site compatible with a cell used for expressing the large Rep proteins.Aspect 90. The method of any one of Aspects 77-89, wherein the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.Aspect 91. The method of any one of Aspects 77-90, wherein the second vector comprises a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.Aspect 92. The method of Aspect 91, wherein the tag is a purification tag and / or a detectable tag.Aspect 93. The method of any one of Aspects 77-92, wherein the AAV capsid proteins coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.Aspect 94. The method of Aspect 93, wherein the second vector comprises an inducible promoter operably linked to the AAV capsid proteins coding sequence.Aspect 95. The method of Aspect 93 or 94, wherein the intervening sequence comprises a transcriptional blocking element (TBE).Aspect 96. The method of Aspect 94 or 95, wherein the inducible promoter operably linked to the sequence encoding the inducible recombinase and the inducible promoter operably linked to the AAV capsid proteins coding sequence are the same promoters.Aspect 97. The method of Aspect 96, wherein the promoters comprise a tetracycline-responsive promoter element (TRE).Aspect 98. The method of Aspect 97, wherein the activator that binds to the TRE in the presence of the first triggering agent is Tet-on 3G.Aspect 99. The method of any one of Aspects 77-98, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.Aspect 100. The method of any one of Aspects 77-99, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.Aspect 101. The method of any one of Aspects 77-100, wherein the payload is progranulin.Aspect 102. The method of any one of Aspects 77-101, wherein the first vector further comprises a VA-RNA coding sequence.Aspect 103. The method of Aspect 102, wherein the sequence coding for VA-RNA is a transcriptionally dead sequence.Aspect 104. The method of Aspect 102 or 103, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.Aspect 105. A method to increase small Rep proteins expression comprising introducing thepolynucleotide of any one of Aspects 1 -45 into a cell, thereby increasing the expression of small Rep proteins compared to introducing the polynucleotide of any one of Aspects 1 -45 having a native p5 promoter instead of the first promoter and a pl 9 promoter instead of the second promoter.Aspect 106. A method to increase small Rep protein expression comprising introducing the vector system of any one of Aspects 48-63 into a cell and contacting the cell to the first triggering agent and the second triggering agent, thereby increasing the expression of small Rep protein compared to introducing the vector system of any one of Aspects 48-63 having a native p5 promoter instead of the first promoter and a pl 9 promoter instead of the second promoter. Aspect 107. A method to decrease large Rep protein expression comprising introducing the vector of any one of Aspects 46 or 47 into a cell, thereby decreasing the expression of large Rep protein compared to introducing the vector of any one of Aspects 46 or 47 having a native p5 promoter instead of the first promoter.Aspect 108. A method to increase small Rep protein expression comprising introducing the vector system of any one of Aspects 48-63 into a cell and contacting the cell to the first trigger and the second trigger, thereby increasing the expression of small Rep protein compared to introducing the vector system of any one of Aspects 48-63 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.Aspect 109. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first plasmid comprising a first polynucleotide construct of any one of Aspects 1 - 45;(b) a second polynucleotide a second polynucleotide construct integrated into the nuclear genome of the cell, comprising a sequence encoding one or more AAV helper proteins; and(c) a second plasmid comprising a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).Aspect 110. The cell of Aspect 109, wherein the first polynucleotide construct and the third polynucleotide construct are not integrated into the nuclear genome of the cell.Aspect 111. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first polynucleotide comprising a first polynucleotide construct integrated into the nuclear genome of the cell, wherein the first polynucleotide construct comprises apolynucleotide construct of any one of Aspects 1-45;(b) a second polynucleotide comprising a second polynucleotide construct integrated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins; and(c) a first plasmid comprising a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).Aspect 1 12. The cell of Aspect 1 1 1 , wherein the third polynucleotide construct is not integrated into the nuclear genome of the cell.Aspect 113. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first plasmid comprising a first polynucleotide construct of any one of Aspects 1 - 45;(b) a second polynucleotide comprising a second polynucleotide construct integrated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins; and(c) a third polynucleotide comprising a third polynucleotide construct integrated into the nuclear genome of the cell, wherein the third poly plasmid comprises a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).Aspect 114. The cell of Aspect 113, wherein the first polynucleotide construct is not integrated into the nuclear genome of the cell.Aspect 115. The cell of any one of Aspects 109-114, wherein the second polynucleotide comprises: a second inducible promoter operably linked to a sequence encoding an inducible recombinase, wherein the sequence encoding the inducible recombinase is flanked by a third recombination site and a fourth recombination site forming a selfexcising element, wherein the third recombination site and the fourth recombination site are oriented in the same direction, wherein the self-excising element separates the second inducible promoter from a sequence encoding the one or more AAV helper proteins such that the second inducible promoter is not operably linked to the sequenceencoding the one or more AAV helper protein; and a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the first inducible promoter or the second inducible promoter in absence of a first triggering agent.Aspect 116. The cell of any one of Aspects 109-105, wherein the second polynucleotide comprises a constitutive promoter operably linked to a sequence encoding a second selectable marker.Aspect 117. The cell of any one of Aspects 109-116, wherein the second polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 127.Aspect 118. The cell of any one of Aspects 109-1 17, wherein the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 127.Aspect 119. The cell of any one of Aspects 109-1118, wherein the first selectable marker is a split selectable marker and comprises a first portion of the first selectable marker and the third polynucleotide comprises a sequence encoding a second portion of the first selectable marker, and wherein the first and second portions associate to form a functional first selectable marker.Aspect 120. The cell of any one of Aspects 109-119, wherein the second inducible promoter comprises tetracycline-responsive promoter element (TRE).Aspect 121. The cell of Aspect 120, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.Aspect 122. The cell of Aspect 121, wherein the minimal promoter is a human cytomegalovirus promoter.Aspect 123. The cell of any one of Aspects 115-122, wherein the sequence encoding the activator is operably linked to a constitutive promoter.Aspect 124. The cell of Aspect 123, wherein the constitutive promoter is EFlalpha promoter or human cytomegalovirus promoter.Aspect 125. The cell of any one of Aspects 115-124, wherein the activator is reverse tetracycline controlled transactivator (rTA) comprising a Tet Repressor binding protein (TetR) fused to VP16 transactivation domain.Aspect 126. The cell of any one of Aspects 115-125, wherein the first triggering agent for inducing the tetracycline-inducible promoter is tetracycline or doxycycline.Aspect 127. The cell of any one of Aspects 115-126, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of asecond triggering agent.Aspect 128. The cell of any one of Aspects 109-127, comprising a fourth polynucleotide encoding a viral associated RNA (VA-RNA).Aspect 129. The cell of Aspect 128, wherein the VA-RNA is a mutated VA-RNA.Aspect 130. The cell of Aspect 128 or 129, wherein the first and the fourth polynucleotides are present in a single construct.Aspect 131. The cell of any one of Aspects 109-130, wherein the sequence encoding the payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest.Aspect 132. The cell of any one of Aspects 109-131, wherein the sequence encoding the payload is a sequence encoding progranulin.Aspect 133. The cell of any one of Aspects 109-132, wherein the sequence encoding the payload comprises a suppressor tRNA, a guide RNA, or a homology region for homology- directed repair.Aspect 134. The cell of any one of Aspects 109-133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 130.Aspect 135. The cell of any one of Aspects 109-133, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 130.Aspect 136. The cell of any one of Aspects 105-133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 132.Aspect 137. The cell of any one of Aspects 109-133 and 136, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 132.Aspect 138. The cell of any one of Aspects 109-137, wherein the payload is progranulin or dystrophin; optionally, wherein the dystrophin is a short, functional dystrophin.Aspect 139. The cell of any one of Aspects 109-138, wherein the coding sequence encoding the stop signaling sequence of the first sequence encodes for, from 5’ to 3’: an exon and the stop signaling sequence; optionally, wherein the coding sequence encoding the stop signaling sequence of the first sequence further comprises a sequence encoding a protein marker, wherein the sequence encoding the protein marker is in-frame with the stop signaling sequence.Aspect 140. The cell of any one of Aspects 109-139, wherein the cell further comprises: an adenovirus El A protein and E1B protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are an adenovirus E2A protein and E4 protein, or an adenovirus E2A protein and E4 protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are an adenovirus El A protein and E1B protein.Aspect 141. The cell of any one of Aspects 109-140, further comprising a fourth polynucleotide construct comprising an inducible or constitutive promoter operably linked to a sequence encoding one or more helper proteins.Aspect 142. The cell of any one of Aspects 109-141, wherein the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding two AAV helper proteins.Aspect 143. The cell of Aspect 142, wherein the two AAV helper proteins are E2A and E4 or ElA and E1B.Aspect 144. The cell of Aspect 142 or 143, wherein the bicistronic open reading frame comprises an internal ribosome entry site (IRES) or a peptide 2A (P2A) sequence.Aspect 145. The cell of any one of Aspects 109-144, wherein the AAV capsid proteins comprise VP1, VP2, and VP3.Aspect 146. The cell of any one of Aspects 109-145, wherein the cell is a mammalian cell; optionally, wherein the mammalian cell is a HEK293 cell.Aspect 147. The cell of any one of Aspects 109-146, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of tamoxifen.Aspect 148. The cell of any one of Aspects 109-147, wherein the second triggering agent for translocating the inducible recombinase is a hormone, optionally, wherein the second triggering agent is tamoxifen.Aspect 149. The cell of any one of Aspects 109-148, wherein the recombination sites in the first polynucleotide construct and the second polynucleotide construct are lox sites and the inducible recombinase is a ere recombinase or wherein the recombination sites in the first polynucleotide construct and the second polynucleotide are flippase recognitiontarget (FRT) sites and the inducible recombinase is a flippase (Flp) recombinase.Aspect 150. The cell of any one of Aspects 109-149, wherein the second polynucleotide construct further comprises an insert comprising a sequence encoding VA-RNA; or optionally, wherein a fifth construct comprises an insert comprising a sequence encoding VA-RNA.Aspect 151. The cell of Aspect 150, wherein the VA-RNA is wild-type VA-RNA or VA-RNA comprising one or more mutations in the VA-RNA internal promoter.Aspect 152. The cell of Aspect 150 or 151, wherein the insert comprises: a first part of a fifth constitutive promoter and a second part of a fifth constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence to allow expression of the VA-RNA.Aspect 153. The cell of Aspect 152, wherein the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of an RNA polymerase III promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of an RNA polymerase III promoter; the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter; or the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of a U7 promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of a U7 promoter.Aspect 154. The cell of any one of Aspects 109-153, wherein the first polynucleotide construct further comprises:(i) a first spacer segment and a second spacer segment flanking the excisable element, wherein the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are separated by the first spacer segment, the excisable element, and the second spacer segment, wherein the first spacersegment comprises a first intron and the second spacer segment comprises a second intron, wherein the first polynucleotide construct further comprises a 5’ splice site at the 5’ end of the first spacer segment, a first 3’ splice site at the 3’ end of the second spacer segment, and a second 3’ splice site at the 3’ end of the first recombination site; or(ii) a first spacer segment and a second spacer segment flanking the inversible element, wherein the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are separated by the first spacer segment, the inversible element, and the second spacer segment, wherein the first spacer segment comprises a first intron and the second spacer segment comprises a second intron, wherein the first polynucleotide construct further comprises a 5’ splice site at the 5’ end of the first spacer segment, a first 3’ splice site at the 3’ end of the second spacer segment, and a second 3’ splice site at the 3’ end of the first recombination site.Aspect 155. The cell of any one of Aspects 109-154, wherein the second polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 127-129.Aspect 156. The cell of any one of Aspects 109-155, wherein the third polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replace with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin.Aspect 157. The cell of any one of Aspects 109-156, wherein the sequence encoding the pay load flanked by a 5’ AAV inverted terminal repeat (5’ ITR) and a 3’ AAV inverted terminal repeat (3’ ITR) comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replace with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin.Aspect 158. The cell of any one of Aspects 109-157, wherein the third polynucleotide construct further comprises a spacer between the 5 ’ ITR and the sequence encoding the third selectable marker or a spacer between the sequence encoding the third selectable marker and the 3’ ITR, or a combination thereof.Aspect 159. The cell of Aspect 158, wherein the spacer ranges in length from 500 base pairs to5000 base pairs.Aspect 160. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) the first plasmid according to an...

Claims

CLAIMSWhat is claimed is:

1. A polynucleotide comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising: an intron comprising a second promoter operably linked to a small Rep coding sequence; and the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, and wherein the second promoter has higher promoter activity as compared to the first promoter.

2. The polynucleotide of claim 1 , wherein the first promoter is heterologous to the large Rep coding sequence.

3. The polynucleotide of claim 1 or 2, wherein the large Rep coding sequence comprises a pl 9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.

4. The polynucleotide of claim 3, wherein the pl9 promoter is mutated to substantially reduce promoter activity.

5. The polynucleotide of claim 4, wherein the p 19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl9 promoter activity.

6. The polynucleotide of any one of claims 1-5, wherein the vector lacks a functional p5 promoter.

7. The polynucleotide of claim 6, wherein the first promoter replaces the p5 promoter.

8. The polynucleotide of any one of claims 1-7, wherein the first promoter and / or second promoter is a constitutive promoter.

9. The polynucleotide of any one of claims 1-7, wherein the first promoter and / or second promoter is an inducible promoter.

10. The polynucleotide of any one of claims 1 -9, wherein (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter.

11. The polynucleotide of any one of claims 1-10, further comprising a poly adenylation (Poly A) signal sequence downstream of the Rep coding sequence, wherein the PolyA signal sequence is stronger than a native AAV Rep PolyA signal sequence.

12. The polynucleotide of claim 11, wherein the PolyA signal sequence is selected from: a bovine growth hormone (bGH) PolyA signal sequence, a human growth hormone (hGH) PolyA signal sequence, a Simian Virus 40 (SV40) PolyA signal sequence, a Chinese hamster growth hormone PolyA signal sequence, a human neurophilin- 1 PolyA signal sequence, a nopaline synthase PolyA signal sequence, an alpha globulin PolyA signal sequence, and a rabbit globin PolyA signal sequence.

13. The polynucleotide of claim 11 or 12, wherein the polyadenylation signal sequence comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 2.

14. The polynucleotide of any one of claims 11-13, wherein the polyadenylation signal sequence comprises the nucleotide sequence of SEQ ID NO: 2.

15. The polynucleotide of any one of claims 11-14, further comprising an enhancer downstream of the PolyA signal sequence.

16. The polynucleotide of claim 15, wherein the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer.

17. The polynucleotide of claim 15 or 16, wherein the enhancer comprises one or more sequences selected from SEQ ID NOs: 11-116 and 165-168.

18. The polynucleotide of any one of claims 15-17, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

19. The polynucleotide of any one of claims 15-18, wherein the enhancer is a double enhancer.

20. The polynucleotide of claim 19, wherein the double enhancer comprises one of the following enhancers: a telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

21. The polynucleotide of claim 19 or 20, wherein the double enhancer comprises two of a telomerase reverse transcriptase (hTERT) enhancer (SEQ ID NO: 167), a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

22. The polynucleotide of any one of claims 19-21, wherein the double enhancer comprises a Simian virus 40 (SV40) enhancer (SEQ ID NO: 166) and a CMV enhancer (SEQ ID NO: 165).

23. The polynucleotide of any one of claims 19-22, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 168.

24. The polynucleotide of any one of claims 19-23, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO: 168.

25. The polynucleotide of any one of claims 15-18, wherein the enhancer is a triple enhancer.

26. The polynucleotide of claim 25, wherein the triple enhancer comprises a telomerase reverse transcriptase (hTERT) (SEQ ID NO: 167), a Simian virus 40 (SV40) (SEQ ID NO: 166), or a CMV enhancer (SEQ ID NO: 165).

27. The polynucleotide of claim 25 or 26, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 10.

28. The polynucleotide of any one of claims 25-27, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO: 10.

29. The polynucleotide of any one of claims 1-28, wherein the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing a large Rep protein.

30. The polynucleotide of any one of claims 1 -29, wherein the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.

31. The polynucleotide of any one of claims 1-30, further comprising a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.

32. The polynucleotide of claim 31, wherein the tag is a purification tag and / or a detectable tag.

33. The polynucleotide of any one of claims 1-32, wherein the vector is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the large Rep proteins and / or large Rep transcripts from a vector not having the first promoter and / or having a p5 promoter.

34. The polynucleotide of any one of claims 1-32, wherein the vector is configured to provide for an expression of the small Rep proteins and / or small Rep transcripts at a level that is higher than the expression of the small Rep proteins and / or small Rep transcripts from a vector not having the second promoter and / or having a pl 9 promoter.

35. The polynucleotide of any one of claims 1-34, wherein the vector is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the small Rep proteins and / or small Rep transcripts.

36. The polynucleotide of any one of claims 1-35, wherein a ratio of the expression level of the small Rep proteins and / or small Rep transcripts to the expression level of the large Rep proteins and / or large Rep transcripts ranges from 1.5:1 to 10,000:1, including 5:1 ; 6:1 ; 7: 1 ; 8:1 ; 9:1;10:1; 100:1; 1000:1 ; or 5000:1; 5.

37. The polynucleotide of any one of claims 1-36, further comprising an AAV Cap coding sequence.

38. The polynucleotide of any one of claims 1-37, further comprising a sequence encoding a first selectable marker operably linked to a constitutive promoter.

39. The polynucleotide of claim 38, wherein the Cap coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.

40. The polynucleotide of claim 39, wherein the polynucleotide comprises an inducible promoter operably linked to the Cap coding sequence; optionally, wherein the inducible promoter comprises a tetracycline-responsive promoter element (TRE).

41. The polynucleotide of claim 39 or 40, wherein the intervening sequence comprises a transcriptional blocking element (TBE).

42. The polynucleotide of claim 38, wherein the AAV Cap coding sequence is operably linked to a native promoter.

43. The polynucleotide of claim 42, wherein the native promoter is a p40 promoter located in the small Rep coding sequence.

44. The polynucleotide of claim 38, wherein the AAV Cap encoding sequence is operably linked to a heterologous promoter.

45. The polynucleotide of claim 44, wherein the heterologous promoter is an inducible promoter.

46. A vector comprising the polynucleotide of any one of claims 1-41.

47. A vector comprising the polynucleotide of any one of claims 1-37 and 42-45.

48. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 46, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; and a third vector comprising a polynucleotide payload flanked by AAV inverted terminal repeats (ITRs).

49. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 47, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins; a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).

50. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 47, wherein the vector is a first vector; a second vector comprising a sequence encoding one or more AAV helper proteins;a third vector comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs); and a fourth vector comprising an AAV Cap encoding sequence.

51. The vector system of any one of claims 48-50 for inducibly producing rAAV, the second vector comprising an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a third recombination site and a fourth recombination site flanking the sequence encoding the inducible recombinase, wherein the third recombination site and the fourth recombination site are oriented in the same direction; the selfexcising element separating the inducible promoter from a sequence encoding the one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a constitutive promoter operably linked to a sequence encoding a second selectable marker.

52. The vector system of any one of claims 48-51, wherein the first vector comprises a sequence encoding a first portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the first portion of the first selectable marker and the third vector comprises a sequence encoding a second portion of the first selectable marker and a constitutive promoter operably linked to the sequence encoding the second portion of the first selectable marker, wherein the first and second portions associate to form a functional first selectable marker.

53. The vector system of any one of claims 51-52, wherein the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding at least two AAV helper proteins.

54. The vector system of any one of claims 51-53, wherein the helper proteins comprise E2a and E4.

55. The vector system of any one of claims 51-54, wherein the inducible promoter in the second vector comprises a tetracycline-responsive promoter element (TRE) and is operably linked to a sequence encoding the inducible recombinase, and the activator is Tet-on 3G.

56. The vector system of any one of claims 51-55, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.

57. The vector system of claim 56, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

58. The vector system of any one of claims 48-57, wherein the payload is progranulin.

59. The vector system of any one of claims 48-58, wherein the second vector further comprises a VA-RNA coding sequence.

60. The vector system of claim 59, wherein the second vector further comprises an insert comprising: a first part of a constitutive promoter and a second part of a constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a stuffer sequence, wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence thereby allowing expression of the VA-RNA.

61. The vector system of claim 60, wherein the first part of the constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter.

62. The vector system of claim 59-61, wherein the sequence coding for VA-RNA is a transcriptionally dead sequence.

63. The vector system of any one of claims 59-62, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.

64. A cell comprising the polynucleotide of any one of claims 1-45 or the vector of claim 46 or 47.

65. The cell of claim 64, wherein the polynucleotide or the vector is integrated into a genome of the cell.

66. A cell comprising the first vector and the second vector of any one of claims 48-50.

67. The cell of claim 66, wherein the first vector and the second vector are integrated into a genome of the cell.

68. A cell comprising the vector system of any one of claims 48-51.

69. The cell of any one of claims 64-68, wherein the cell is a mammalian cell, optionally wherein the mammalian cell is a HEK293 cell, further optionally, wherein the HEK293 cell expresses AAV helper proteins El A and E1B.

70. The cell of claim 68 or 69, wherein the vector system is integrated into a genome of the cell.

71. A method for producing recombinant AAV, the method comprising performing transfection of a cell with the vector system of any one of claims 48-51.

72. A method for inducibly producing a recombinant AAV (rAAV), the method comprising contacting the cell of any one of claims 68-70 with a first triggering agent and a second triggering agent, thereby inducing the production of a rAAV.

73. The method of claim 71 or 72, wherein the cell expresses higher levels of the small Rep protein compared to a cell comprising the first vector having a native p!9 promoter instead of the second promoter and comprising the second and third vectors.

74. The method of any one of claims 71-73, wherein the cell expresses lower levels of the large Rep compared to a cell comprising the first vector having a native p5 promoter instead of the first promoter and comprising the second and third vectors.

75. The method of any one of claims 71-74, wherein the cell expresses lower level of the large Rep protein compared to the small Rep protein.

76. The method of any one of claims 71-75, wherein the cell produces higher levels of rAAV as compared to a cell comprising the first vector having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter and comprising the second and third vectors.

77. A method of generating a cell for inducibly producing recombinant AAV (rAAV) comprising a payload, the method comprising:(i) introducing into a cell a first vector comprising: an inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a first recombination site and a second recombination site flanking the sequence encoding the inducible recombinase, wherein the first recombination site and the second recombination site are oriented in the same direction; the self-excising element separating the inducible promoter from a sequence encoding one or more AAV helper proteins such that the inducible promoter is not operably linked to the sequence encoding the one or more AAV helper proteins; a first constitutive promoter operably linked to a sequence encoding an activator, wherein the cell constitutively expresses the activator and the activator is unable to activate the inducible promoter in absence of a first triggering agent; and a second constitutive promoter operably linked to a sequence encoding a first selectable marker, wherein the cell constitutively expresses the first selectable marker,(ii) selecting for a cell expressing the first selectable marker;(iii) introducing a second vector and a third vector into the cell expressing the first selectable marker, the second vector comprising: a first promoter operably linked to a large Rep coding sequence, the large Rep coding sequence comprising (i) an intron comprising a second promoter and (ii) the small Rep coding sequence, wherein the second promoter is operably linked to the small Rep coding sequence, wherein the second promoter is heterologous to the small Rep coding sequence, andwherein the second promoter has higher promoter activity as compared to the first promoter, wherein the small Rep coding sequence comprises an excisable element comprising a third recombination site and a fourth recombination site flanking a sequence comprising a stop codon, wherein the third recombination site and the fourth recombination site are oriented in the same direction and wherein recombination between the third and fourth recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon; an AAV capsid proteins coding sequence; and a third constitutive promoter operably linked to a sequence encoding a first portion of a second selectable marker; and the third vector comprising a polynucleotide payload sequence and a fourth constitutive promoter operably linked to a sequence encoding a second portion of the second selectable marker, wherein the polynucleotide payload sequence is flanked by AAV inverted terminal repeats (ITRs); and(iv) selecting for a cell expressing the first selectable marker and the second selectable marker, thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising the payload.

78. The method of claim 77, further comprising expanding a cell expressing the first and second selectable markers.

79. The method of claim 77 or 78, wherein the first and second selectable markers are antibiotic resistance proteins.

80. The method of claim 79, wherein the second selectable marker is a split blasticidin.

81. The method of any one of claims 77-80, wherein the first promoter in the second vector is heterologous to the large Rep coding sequence.

82. The method of any one of claims 77-81, wherein the large Rep coding sequence comprises a pl9 promoter operably linked to the small Rep coding sequence and the intron comprising the second promoter is located downstream of the pl9 promoter and upstream of the transcription start site of the small Rep coding sequence.

83. The method of claim 82, wherein the pl9 promoter is mutated to substantially reduce promoter activity.

84. The method of claim 83, wherein the pl9 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native pl 9 promoter activity.

85. The method of any one of claims 77-84, wherein the second vector lacks a functional p5 promoter.

86. The method of claim 85, wherein the first promoter replaces the p5 promoter.

87. The method of any one of claims 77-86, wherein the first promoter and / or second promoter in the second vector is a constitutive promoter or an inducible promoter.

88. The method of any one of claims 77-87, wherein in the second vector, (i) the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; or (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter.

89. The method of any one of claims 77-88, wherein the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site compatible with a cell used for expressing the large Rep proteins.

90. The method of any one of claims 77-89, wherein the small Rep coding sequence comprises an excisable element comprising a first recombination site and a second recombination site flanking a sequence comprising a stop codon, wherein the first recombination site and the second recombination site are oriented in the same direction and wherein recombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon.

91. The method of any one of claims 77-90, wherein the second vector comprises a sequence encoding a tag in frame with the large Rep coding sequence and the small Rep coding sequence, wherein large Rep proteins and small Rep proteins each are expressed as a fusion protein comprising the tag.

92. The method of claim 91 , wherein the tag is a purification tag and / or a detectable tag.

93. The method of any one of claims 77-92, wherein the AAV capsid proteins coding sequence is separated from the large Rep coding sequence and the small Rep coding sequence by an intervening sequence and the polynucleotide further comprises an inducible or constitutive promoter operably linked to the Cap coding sequence.

94. The method of claim 93, wherein the second vector comprises an inducible promoter operably linked to the AAV capsid proteins coding sequence.

95. The method of claim 93 or 94, wherein the intervening sequence comprises a transcriptional blocking element (TBE).

96. The method of claim 94 or 95, wherein the inducible promoter operably linked to the sequence encoding the inducible recombinase and the inducible promoter operably linked to the AAV capsid proteins coding sequence are the same promoters.

97. The method of claim 96, wherein the promoters comprise a tetracycline-responsive promoter element (TRE).

98. The method of claim 97, wherein the activator that binds to the TRE in the presence of the first triggering agent is Tet-on 3G.

99. The method of any one of claims 77-98, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus of a cell comprising the second vector in the presence of the second triggering agent.

100. The method of any one of claims 77-99, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.

101. The method of any one of claims 77-100, wherein the pay load is progranulin.

102. The method of any one of claims 77-101, wherein the first vector further comprises a VARNA coding sequence.

103. The method of claim 102, wherein the sequence coding for VA-RNA is a transcriptionally dead sequence.

104. The method of claim 102 or 103, wherein the sequence coding for VA RNA comprises at least two mutations in an internal promoter.

105. A method to increase small Rep proteins expression comprising introducing the polynucleotide of any one of claims 1-45 into a cell, thereby increasing the expression of small Rep proteins compared to introducing the polynucleotide of any one of claims 1 -45 having a native p5 promoter instead of the first promoter and a pl 9 promoter instead of the second promoter.

106. A method to increase small Rep protein expression comprising introducing the vector system of any one of claims 48-63 into a cell and contacting the cell to the first triggering agent and the second triggering agent, thereby increasing the expression of small Rep protein compared to introducing the vector system of any one of claims 48-63 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.

107. A method to decrease large Rep protein expression comprising introducing the vector of any one of claims 46 or 47 into a cell, thereby decreasing the expression of large Rep protein compared to introducing the vector of any one of claims 46 or 47 having a native p5 promoter instead of the first promoter.

108. A method to increase small Rep protein expression comprising introducing the vector system of any one of claims 48-63 into a cell and contacting the cell to the first trigger and the second trigger, thereby increasing the expression of small Rep protein compared to introducingthe vector system of any one of claims 48-63 having a native p5 promoter instead of the first promoter and a pl9 promoter instead of the second promoter.

109. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first plasmid comprising a first polynucleotide construct of any one of claims 1-45;(b) a second polynucleotide a second polynucleotide construct integrated into the nuclear genome of the cell, comprising a sequence encoding one or more AAV helper proteins; and(c) a second plasmid comprising a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).

110. The cell of claim 109, wherein the first polynucleotide construct and the third polynucleotide construct are not integrated into the nuclear genome of the cell.

111. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first polynucleotide comprising a first polynucleotide construct integrated into the nuclear genome of the cell, wherein the first polynucleotide construct comprises a polynucleotide construct of any one of claims 1-45;(b) a second polynucleotide comprising a second polynucleotide construct integrated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins; and(c) a first plasmid comprising a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).

112. The cell of claim 111, wherein the third polynucleotide construct is not integrated into the nuclear genome of the cell.

113. A cell for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the cell comprising:(a) a first plasmid comprising a first polynucleotide construct of any one of claims 1-45;(b) a second polynucleotide comprising a second polynucleotide construct integrated into the nuclear genome of the cell, wherein the second polynucleotide construct comprises a sequence encoding one or more AAV helper proteins; and(c) a third polynucleotide comprising a third polynucleotide construct integrated into the nuclear genome of the cell, wherein the third poly plasmid comprises a third polynucleotide construct comprising a sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).

114. The cell of claim 113, wherein the first polynucleotide construct is not integrated into the nuclear genome of the cell.

115. The cell of any one of claims 109-114, wherein the second polynucleotide comprises: a second inducible promoter operably linked to a sequence encoding an inducible recombinase, wherein the sequence encoding the inducible recombinase is flanked by a third recombination site and a fourth recombination site forming a selfexcising element, wherein the third recombination site and the fourth recombination site are oriented in the same direction, wherein the self-excising element separates the second inducible promoter from a sequence encoding the one or more AAV helper proteins such that the second inducible promoter is not operably linked to the sequence encoding the one or more AAV helper protein; and a constitutive promoter operably linked to a sequence encoding an activator, wherein the activator is unable to activate the first inducible promoter or the second inducible promoter in absence of a first triggering agent.

116. The cell of any one of claims 109-105, wherein the second polynucleotide comprises a constitutive promoter operably linked to a sequence encoding a second selectable marker.

117. The cell of any one of claims 109-116, wherein the second polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 127.

118. The cell of any one of claims 109-117, wherein the second polynucleotide comprises the nucleotide sequence of SEQ ID NO: 127.

119. The cell of any one of claims 109-118, wherein the first selectable marker is a split selectable marker and comprises a first portion of the first selectable marker and the third polynucleotide comprises a sequence encoding a second portion of the first selectable marker, and wherein the first and second portions associate to form a functional first selectable marker.

120. The cell of any one of claims 109-119, wherein the second inducible promoter comprises tetracycline-responsive promoter element (TRE).

121. The cell of claim 120, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.

122. The cell of claim 121, wherein the minimal promoter is a human cytomegalovirus promoter.

123. The cell of any one of claims 1 15-122, wherein the sequence encoding the activator is operably linked to a constitutive promoter.

124. The cell of claim 123, wherein the constitutive promoter is EFl alpha promoter or human cytomegalovirus promoter.

125. The cell of any one of claims 115-124, wherein the activator is reverse tetracycline controlled transactivator (rTA) comprising a Tet Repressor binding protein (TetR) fused to VP16 trans activation domain.

126. The cell of any one of claims 115-125, wherein the first triggering agent for inducing the tetracycline-inducible promoter is tetracycline or doxycycline.

127. The cell of any one of claims 115-126, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of a second triggering agent.

128. The cell of any one of claims 109-127, comprising a fourth polynucleotide encoding a viral associated RNA (VA-RNA).

129. The cell of claim 128, wherein the VA-RNA is a mutated VA-RNA.

130. The cell of claim 128 or 129, wherein the first and the fourth polynucleotides are present in a single construct.

131. The cell of any one of claims 109-130, wherein the sequence encoding the payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest.

132. The cell of any one of claims 109-131, wherein the sequence encoding the pay load is a sequence encoding progranulin.

133. The cell of any one of claims 109-132, wherein the sequence encoding the payload comprises a suppressor tRNA, a guide RNA, or a homology region for homology- directed repair.

134. The cell of any one of claims 109-133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 130.

135. The cell of any one of claims 109-133, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 130.

136. The cell of any one of claims 105-133, wherein the third polynucleotide comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 132.

37. The cell of any one of claims 109-133 and 136, wherein the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 132.

138. The cell of any one of claims 109-137, wherein the payload is progranulin or dystrophin; optionally, wherein the dystrophin is a short, functional dystrophin.

139. The cell of any one of claims 109-138, wherein the coding sequence encoding the stop signaling sequence of the first sequence encodes for, from 5’ to 3’ : an exon and the stop signaling sequence; optionally, wherein the coding sequence encoding the stop signaling sequence of the first sequence further comprises a sequence encoding a protein marker, wherein the sequence encoding the protein marker is in-frame with the stop signaling sequence.

140. The cell of any one of claims 109-139, wherein the cell further comprises: an adenovirus El A protein and E1B protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are an adenovirus E2A protein and E4 protein, or an adenovirus E2A protein and E4 protein, and the one or more AAV helper proteins expressed by the second polynucleotide construct are an adenovirus El A protein and E1B protein.

141. The cell of any one of claims 109-140, further comprising a fourth polynucleotide construct comprising an inducible or constitutive promoter operably linked to a sequence encoding one or more helper proteins.

142. The cell of any one of claims 109-141, wherein the sequence coding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding two AAV helper proteins.

143. The cell of claim 142, wherein the two AAV helper proteins are E2A and E4 or El A andE1B.

144. The cell of claim 142 or 143, wherein the bicistronic open reading frame comprises an internal ribosome entry site (IRES) or a peptide 2A (P2A) sequence.

145. The cell of any one of claims 109-144, wherein the AAV capsid proteins comprise VP1,VP2, and VP3.

146. The cell of any one of claims 109-145, wherein the cell is a mammalian cell; optionally, wherein the mammalian cell is a HEK293 cell.

147. The cell of any one of claims 109-146, wherein the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of tamoxifen.

148. The cell of any one of claims 109-147, wherein the second triggering agent for translocating the inducible recombinase is a hormone, optionally, wherein the second triggering agent is tamoxifen.

149. The cell of any one of claims 109-148, wherein the recombination sites in the first polynucleotide construct and the second polynucleotide construct are lox sites and the inducible recombinase is a ere recombinase or wherein the recombination sites in the first polynucleotide construct and the second polynucleotide are flippase recognition target (FRT) sites and the inducible recombinase is a flippase (Flp) recombinase.

150. The cell of any one of claims 109-149, wherein the second polynucleotide construct further comprises an insert comprising a sequence encoding VA-RNA; or optionally, wherein a fifth construct comprises an insert comprising a sequence encoding VA-RNA.

151. The cell of claim 150, wherein the VA-RNA is wild-type VA-RNA or VA-RNA comprising one or more mutations in the VA-RNA internal promoter.

152. The cell of claim 150 or 151, wherein the insert comprises: a first part of a fifth constitutive promoter and a second part of a fifth constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a stuffer sequence,wherein the fifth and sixth recombination sites are oriented in the same direction, and the VA-RNA coding sequence, wherein excision of the second excisable element by the inducible recombinase generates a functional complete fifth constitutive promoter operably linked to the VA-RNA coding sequence to allow expression of the VA-RNA.

153. The cell of claim 152, wherein the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of an RNA polymerase III promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of an RNA polymerase III promoter; the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter; or the first part of the fifth constitutive promoter comprises a distal sequence element (DSE) of a U7 promoter, and the second part of the fifth constitutive promoter comprises a proximal sequence element (PSE) of a U7 promoter.

154. The cell of any one of claims 109-153, wherein the first polynucleotide construct further comprises:(i) a first spacer segment and a second spacer segment flanking the excisable element, wherein the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are separated by the first spacer segment, the excisable element, and the second spacer segment, wherein the first spacer segment comprises a first intron and the second spacer segment comprises a second intron, wherein the first polynucleotide construct further comprises a 5’ splice site at the 5’ end of the first spacer segment, a first 3’ splice site at the 3’ end of the second spacer segment, and a second 3’ splice site at the 3’ end of the first recombination site; or(ii) a first spacer segment and a second spacer segment flanking the inversible element, wherein the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are separated by the first spacer segment, the inversible element, and the second spacer segment, wherein the first spacersegment comprises a first intron and the second spacer segment comprises a second intron, wherein the first polynucleotide construct further comprises a 5’ splice site at the 5’ end of the first spacer segment, a first 3’ splice site at the 3’ end of the second spacer segment, and a second 3’ splice site at the 3’ end of the first recombination site.

155. The cell of any one of claims 109-154, wherein the second polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 127-129.

156. The cell of any one of claims 109-155, wherein the third polynucleotide construct comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replace with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin.

157. The cell of any one of claims 109-156, wherein the sequence encoding the payload flanked by a 5’ AAV inverted terminal repeat (5’ ITR) and a 3’ AAV inverted terminal repeat (3’ ITR) comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 130-133; optionally, wherein the sequence encoding progranulin is replace with a sequence encoding dystrophin; further optionally, wherein the sequence encoding dystrophin encodes for a short, functional dystrophin.

158. The cell of any one of claims 109-157, wherein the third polynucleotide construct further comprises a spacer between the 5’ ITR and the sequence encoding the third selectable marker or a spacer between the sequence encoding the third selectable marker and the 3 ’ ITR, or a combination thereof.

159. The cell of claim 158, wherein the spacer ranges in length from 500 base pairs to 5000 base pairs.

160. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) the first plasmid according to any one of claims 109, 110, or 115-137;(b) a cell comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 109, 110, or 115-137; and(c) the second plasmid according to any one of claims 109, 110, or 115-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising (e) the fifth polynucleotide construct according to any one of claims 150- 159.

161. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) the first polynucleotide construct of the first plasmid according to any one of claims 109, 110, or 115-137;(b) a cell comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 109, 110, or 115-137; and(c) the third polynucleotide construct of the second plasmid according to any one of claims 109, 110, or 115-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising (e) the fifth polynucleotide construct according to any one of claims 150-159.

162. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) a cell comprising the first polynucleotide construct integrated into the nuclear genome of the cell to any one of claims 111, 112, or 115-137;(b) the cell further comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 111, 112, or 115-137; and(c) the first plasmid according to any one of claims 111, 112, or 115-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising (e) the fifth polynucleotide construct according to any one of claims 151-159.

163. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) a cell comprising the first polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 1 11, 112, or 115-137;(b) the cell further comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 111, 112, or 115-137; and€ the third polynucleotide construct of the first plasmid according to any one of claims 111, 112, or 115-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising (e) the fifth polynucleotide construct according to any one of claims 150-159.

164. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) the first plasmid according to any one of claims 113-137;(b) a cell comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 1 13-137; and(e) the cell further comprising the third polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 113-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising € the fifth polynucleotide construct according to any one of claims 150-159.

165. A system for inducibly producing recombinant adenovirus associated virus (rAAV) virions, the system comprising:(a) the first polynucleotide construct of the first plasmid according to any one of claims 113-137;(b) a cell comprising the second polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 113-137; and(c) the cell further comprising the third polynucleotide construct integrated into the nuclear genome of the cell according to any one of claims 113-137; optionally further comprising (d) the fourth polynucleotide construct according to any one of claims 141-159; and optionally further comprising (e) the fifth polynucleotide construct according to any one of claims 150-159.

166. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell the second polynucleotide construct according to any one of claims 109, 110, or 115-137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the first polynucleotide construct according to any one of claims 109, 1 10, or 1 15-137and the third polynucleotide construct according to any one of claims 109, 110, or 115-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the first selectable marker, and the third selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the second polynucleotide construct is integrated into the nuclear genome of the cell and the first polynucleotide construct and the third polynucleotide construct are not integrated into the genome of the cell.

167. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell the second polynucleotide construct according to any one of claims 109, 110, or 115-137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the first plasmid according to any one of claims 109, 110, or 115-137and the second plasmid according to any one of claims 109, 110, or 115-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the first selectable marker, and the third selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the first polynucleotide construct is integrated into the nuclear genome of the cell and the first plasmid and the second plasmid are not integrated into the genome of the cell.

168. The method of claim 166 or 167, wherein the first selectable marker is a first portion of a selectable marker and the third selectable marker is a second portion of a selectable marker.

169. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell a second polynucleotide construct according to any one of claims 111, 112, or 115-137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the first polynucleotide construct according to any one of claims 111, 112, or 115-137; selecting for cells expressing the second selectable marker and the first selectable marker; introducing the third polynucleotide construct according to any one of claims 111, 112, or 115-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the first selectable marker, and the third selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the first polynucleotide construct and the second polynucleotide construct are integrated into the nuclear genome of the cell and the third polynucleotide construct is not integrated into the genome of the cell.

170. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell a second polynucleotide construct according to any one of claims 111, 112, or 115-137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the first polynucleotide construct according to any one of claims 11 1, 112, or 115-137; selecting for cells expressing the second selectable marker and the first selectable marker; introducing the first plasmid according to any one of claims 111, 112, or 115-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the first selectable marker, and the third selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the first polynucleotide construct and the second polynucleotide construct are integrated into the nuclear genome of the cell and the first plasmid is not integrated into the genome of the cell.

171. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell a second polynucleotide construct according to any one of claims 113- 137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the third polynucleotide construct according to any one of claims 113-137; selecting for cells expressing the second selectable marker and the third selectable marker; introducing the first polynucleotide construct according to any one of claims 113-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the third selectable marker, and the first selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the second polynucleotide construct and the third polynucleotide construct are integrated into the nuclear genome of the cell and the first polynucleotide construct is not integrated into the genome of the cell.

172. A method of generating a cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload, the method comprising: introducing into a cell a second polynucleotide construct according to any one of claims 113- 137; selecting for cells expressing the second selectable marker; introducing into a cell of the cells expressing the second selectable marker the third polynucleotide construct according to any one of claims 113-137; selecting for cells expressing the second selectable marker and the third selectable marker; introducing the first plasmid according to any one of claims 113-137, optionally, wherein the introducing is via transient transfection; selecting for cells expressing the second selectable marker, the third selectable marker, and the first selectable marker; thereby generating the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload wherein the second polynucleotide construct and the third polynucleotide construct are integrated into the nuclear genome of the cell and the first plasmid is not integrated into the genome of the cell.

173. The method of any one of claims 166-172, further comprising contacting the cell for inducibly producing recombinant AAV (rAAV) virions comprising a payload with the first triggering agent and the second triggering agent, wherein in the presence of the first triggering agent, the activator activates the inducible promoter resulting in expression of the inducible recombinase, wherein in the presence of the second triggering agent, the inducible recombinase translocates to the nucleus, wherein recombination between the third recombination site and the fourth recombination site in the second polynucleotide construct results in excision of the self excising element comprising the sequence encoding the inducible recombinase, wherein the inducible promoter becomes operably linked to the sequence encoding the one or more AAV helper proteins to allow expression of the one or more AAV helper proteins; optionally, further comprising:(i) recombination between the first recombination site and the second recombination site in the first polynucleotide construct results in excision of the excisable element, and the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are joined to form a complete AAV Rep coding sequence, or(ii) recombination between the first recombination site and the second recombination site in the first polynucleotide construct results in inversion of the inversible element, and the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are joined to form a complete AAV Rep coding sequence, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of an AAV Rep protein and an AAV Cap protein, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of an AAV Rep protein and an AAV Cap protein; thereby inducibly producing recombinant AAV (rAAV) virions comprising a payload.

174. The method of any one of claims 166-173, wherein the first polynucleotide construct is in a plasmid comprising at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO: 126-128.

175. A method for generating a recombinant adenovirus associated virus (rAAV) virion comprising a sequence encoding a payload, the method comprising contacting the cell according to any one of claims 115-143 to the first triggering agent and the second triggering agent, wherein in the presence of the first triggering agent, the activator activates the inducible promoter of the second polynucleotide construct resulting in expression of the inducible recombinase, wherein in the presence of the second triggering agent, the inducible recombinase translocates to the nucleus, wherein recombination between the third recombination site and the fourth recombination site in the second polynucleotide construct by the inducible recombinase results in excision of the self-excising element comprising the sequence encoding the inducible recombinase, and wherein the inducible promoter becomes operably linked to the sequence encoding the one or more AAV helper proteins to allow expression of the one or more AAV helper proteins; and optionally, wherein recombination between the first recombination site and the second recombination site in the first polynucleotide construct by the inducible recombinase results in excision of the excisable element or inversion of the inversible element wherein the first part of the AAV Rep coding sequence and the second part of the AAV Rep coding sequence are joined to form a complete AAV Rep coding sequence, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of the one or more Rep proteins and the one or more capsid proteins; and wherein the expression of the one or more AAV helper proteins results in expression of the one or more Rep proteins and the one or more capsid proteins, thereby generating an rAAV virion comprising the sequence encoding the payload of interest.

176. The method of claim 175, wherein the payload is progranulin or dystrophin; optionally, wherein the dystrophin is a short, functional dystrophin.

177. The method of claim 175 or 176, wherein the first triggering agent is doxycycline.

178. The method of any one of claims 175-177, wherein the second triggering agent is tamoxifen.

Images