Compositions and methods for treating cancer

Abstract

The disclosure is directed to methods for treating a cancer in a subject in need thereof by administering to the subject a bifunctional short hairpin (shRNA) molecule capable of inhibiting the expression of at least one mutated KRAS gene and at least one KRAS inhibitor.

Description

COMPOSITIONS AND METHODS FOR TREATING CANCERCROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to U.S. Provisional Patent Application No. 63 / 536,906, filed on September 6, 2023, the disclosure of which is incorporated herein by reference in its entirety for all purposes.BACKGROUND

[0002] Kirsten-ras sarcoma (KRAS) gene belongs to a member of the RAS family of signal transduction proteins. KRAS protein is a GTPase that regulates signal transduction by switches between the active GTP -bound and inactive GDP -bound conformations. Guanine nucleotide exchange factors (GEF) promote the exchange of GDP to GTP on KRAS, whereas GTPase- activating proteins (GAP) favor the exchange of GTP to GDP. The activation of receptor tyrosine kinases (RTKs) on the plasma membrane, such as epidermal growth factor receptor (EGFR) family, initiates KRAS activation and subsequent multiple effector pathways, especially mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3 -kinase (PI3K) pathways. As the downstream of RTKs, SOS Ras / Rac guanine nucleotide exchange factor 1 (S0S1) and protein tyrosine phosphatase non-receptor type 11 (PTPN11, also known as SHP2) promote the ratio of GDP-GTP exchange, leading to KRAS activation.

[0003] Mutations of RAS family of proteins are genetic drivers of multiple cancer types. KRAS G12 mutations are the predominant mutations in human cancers. KRAS G12 mutations constitute 89% of RAS family of mutations, followed by G13 (9%) and Q61 (1%) mutations. Amongst KRAS G12 mutations, the G12D mutation is the most common mutation, followed by G12C and G12V mutations. Distribution of G12 mutations differs amongst different tumor types. KRAS G12D mutation plays a major role in PDAC. KRAS G12C mutation is the most common mutation subtype in NSCLC (13%).

[0004] Because of its unusual shape, it has long been difficult to design small molecule inhibitor specifically targeting KRAS mutant proteins. The relatively smooth protein structure means that designing inhibitors to bind to surface grooves is difficult, thus, mutant KRAS was branded undruggable for over 30 years. Most recently, the discovery of a pocket resides beneath the switch II region of KRAS G12C mutant protein, adjacent to the mutant cysteineallows the binding of small inhibitory molecules favoring the affinity of KRAS for GDP, locking KRAS G12C mutant in its inactive state. This unique feature of the KRAS G12C mutant protein has led to the development of specific KRAS G12C irreversible inhibitors, such as adagrasib and sotorasib. Adagrasib and sotorasib are currently approved by FDA to treat patients with KRAS G12C tumor for lung cancer and colorectal cancer. Unfortunately, it was found that primary and acquired drug resistance developed very quickly soon after the treatment.SUMMARY OF THE DISCLOSURE

[0005] In one aspect, the disclosure provides a method for treating a cancer in a subject in need thereof, the method comprising administering to the subject: a bifunctional short hairpin (shRNA) molecule capable of inhibiting the expression of at least one mutated KRAS gene, wherein the bifunctional shRNA molecule encodes a nucleic acid sequence capable of hybridizing to one or more regions of an mRNA transcript encoding the mutated KRAS gene to inhibit the expression of the mutated KRAS gene via RNA interference, wherein the bifunctional shRNA comprises a first stem-loop structure that comprises an siRNA component and a second stem-loop structure that comprises a miRNA component.

[0006] In some embodiments, the method further comprises administering to the subject at least one KRAS inhibitor. In some embodiments, the mutated KRAS gene encodes a KRAS protein having a G12C mutation, a G12D mutation, a G12V mutation, or a G12R mutation.

[0007] In some embodiments, the DNA sequence of the mRNA transcript encoding the mutated KRAS gene comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of any one of SEQ ID NOS:10-12.

[0008] In some embodiments, the bifunctional shRNA molecule inhibits the expression of three mutated KRAS genes encoding three KRAS proteins comprising a G12C mutation, a G12D mutation, and a G12V mutation. In some embodiments, the bifunctional shRNA sequence comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOS:3-5.

[0009] In some embodiments of the methods, the siRNA component functions in a cleavagedependent manner and the miRNA component functions in a cleavage-independent manner.

[0010] In some embodiments, the bifunctional shRNA sequence is operably linked to a promoter, e.g., a CMV mammalian promoter.

[0011] In some embodiments, the bifunctional shRNA molecule is in a Doggybone DNA (dbDNA®) vector. In certain embodiments, the bifunctional shRNA molecule is provided in a liposome or lipid nanoparticle.

[0012] In some embodiments of the methods, the KRAS inhibitor is selected from the group consisting of sotorasib, ortipifamib, adagrasib, D-1553, BI1701963, GDC6036, JNJ74699157, ARS-3248, X-Chem KRAS, BBP-454, LY3537982, BI1823911, AS KRAS G12C, SF KRAS G12C, RMC032, JAB-21822, AST-KRAS G12C, AZ KRAS G12C, NYU-12VC1, and RMC6291. In certain embodiments, the KRAS inhibitor is sotorasib or adagrasib.

[0013] In some embodiments, the mutated KRAS gene encodes a KRAS protein having a G12C mutation and the KRAS inhibitor is sotorasib.

[0014] In some embodiments, the bifunctional shRNA molecule is administered before, simultaneous, or after the KRAS inhibitor.

[0015] In some embodiments of the methods, the cancer is selected from the group consisting of lung cancer, colorectal cancer, uterine cancer, appendiceal cancer, small-bowel cancer, esophageal cancer, hepatobiliary cancer, bladder cancer, ovarian cancer and a solid tumor. In certain embodiments, the cancer comprises a mutated KRAS gene. In certain embodiments, the cancer has become resistant to treatment with a KRAS inhibitor. In certain embodiments, the cancer has become resistant to treatment with a KRAS inhibitor after earlier treatment with the KRAS inhibitor.

[0016] In some embodiments of the methods, administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least at about the same level compared to the reduction from administering the KRAS inhibitor alone. In certain embodiments, administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least 2-fold more than the reduction from administering the KRAS inhibitor alone.

[0017] In some embodiments of the methods, administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least at about the same level compared to the reduction from administering the bifunctional shRNA molecule alone. In certain embodiments, administering the bifunctional shRNAmolecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least 2-fold more than the reduction from administering the bifunctional shRNA molecule alone.

[0018] In some embodiments of the methods, the cancer cell is resistant to the KRAS inhibitor.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0020] FIG. 1 : Doggybone DNA (dbDNA®) vector, a truncated version of bifunctional shRNA KRASG12CDVplasmid DNA with mammalian expression unit only arrangement.

[0021] FIG. 2: Effective knockdown of mutant KRAS at 12 hours post transfection with bifunctional shRNA KRASG12CDVin either dbDNA® vector (dbl32) or regular plasmid (pl 32). Left panel shows baseline dominant expressions of KRAS mutant and wild-type in NCLH358 cells (KRASG12C / +), a NSCLC cell line. Right panel shows dbDNA® vector and regular plasmid versions of bifunctional shRNA KRASG12CDVeffectively and selectively reduced mutant mRNA. Mutant mRNA reduced more than 90% while wild-type mRNA was not changed.

[0022] FIGS. 3 A and 3B: c-Myc and EIF4A 7gene counts were significantly downregulated in PANC-1 cells (KRASG12D / +) after treatment with bifunctional shRNA KRASG12CDVin circular (parent plasmid form) or dbDNA® vector. Counts were normalized by fragments per kilobase of transcript per million mapped reads (FPKM). Wild-type KRAS was not changed. FPKM data obtained from mRNA sequencing (mRNA-Seq) analysis. c-Myc and EIF4A1 are well-known highly activated genes via KRAS G12 mutations.

[0023] FIGS. 4A and 4B: Bifunctional shRNA KRASG12CDVtreated cells showed similar response to sotorasib (LUMAKRAS®) treated cells. PANC-1 is pancreatic cancer cell line with KRAS (WT / G12D). MIA PaCa-2 pancreatic cancer cell line with KRAS (G12C / G12C). Bifunctional shRNA KRASG12CDVtreatment resulted in increased EGFR, ERK, and AKT phosphorylation. Similar results were seen with sotorasib.

[0024] FIG. 5: The viability of NCI-H358 cells was reduced by db-bishKRASG12CDVtreatment in a dose-responsive manner.

[0025] FIGS. 6A and 6B: NCI-H358 cells were treated with dbDNA® vector version of bifunctional shRNAG12CDV (db-bishKRASG12CDV) alone or in combination with 50 nM of sotorasib. db-bishKRASG12CDValone was able to reduce NCI-H358 cells survival in a dose responsive manner. 50 nM of sotorasib alone reduced cell survival. 50 nM of sotorasib in combination with various concentrations of db-bishKRASG12CDVfurther enhanced reduction of cell survival, demonstrating synergistic effects from the two agents. The enhancement effect was similar from 25 nM to 100 nM of sotorasib, strongly suggesting 25 nM had already reached the saturating dose.

[0026] FIGS. 7A and 7B: NCI-H358 cells were treated with db-bishKRASG12CDVfirst, then with various concentrations of sotorasib (50 nM in FIG. 7A; 25 nM, 50 nM, or 100 nM in FIG. 7B) were added two days after the treatment with db-bishKRASG12CDV. The enhancement of cell survival reduction with sotorasib was minimum after one day of treatment with sotorasib.

[0027] FIG. 8: Semi-confluent NCI-H358 cells were treated with various concentrations of sotorasib continuously for two weeks. After initial massive cell death, sotorasib -resistant cultures emerged with altered morphology and growth characteristics.

[0028] FIG. 9: NCI-H358 cells resistant to 6 nM concentration of sotorasib were further challenged with various higher concentrations of sotorasib for two days. Survival or growth of NCI-H358 cells resistant to 6 nM of sotorasib was further reduced when challenged with higher concentrations of sotorasib in a dose responsive manner, even further reduction was saturated with > 80 nM of sotorasib.

[0029] FIG. 10: NCI-H358 cells resistant to 20 nM of sotorasib were transfected with various concentrations of db-bishKRASG12CDV. db-bishRNAKRASG12CDVtreatment effectively reduced sotorasib resistant cell survival.

[0030] FIG. 11 : Inhibition of tumor growth by plasmid version of bifunctional shRNAG12CDVdelivered with lipoplex in a pancreatic cancer PANC-1 (KRAS+ / G12D) xenograft model.

[0031] FIG. 12: Inhibition of PANC-1 (KRAS+ / G12D) 24 hours post electroporation with plasmid version pUMV3 (Control empty vector) or pl 32 (plasmid version) or dbDNA® vector version (pl32db) of bishRNAG12CDV.

[0032] FIG. 13: Schematic showing dbDNA® version of pbishRNA KRASG12CDVDETAILED DESCRIPTION

[0033] Disclosed herein, in certain embodiments, are expression vectors comprising a bifunctional short hairpin RNA (shRNA) sequence specific for knockdown of a mutant KRAS (e.g., KRAS G12C, G12D, or G12V). The bifunctional shRNA sequence encodes a nucleic acid sequence capable of hybridizing to one or more regions of an mRNA transcript encoding the mutant KRAS to inhibit the expression of the mutant KRAS via RNA interference. The bifunctional shRNA comprises a first stem-loop structure that comprises an siRNA component and a second stem-loop structure that comprises a miRNA component, see, e.g., as described in US Patent No. 9,353,373, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0034] The disclosure also provides methods for treating a cancer in a subject in need thereof by administering to the subject a bifunctional short hairpin (shRNA) molecule capable of inhibiting the expression of at least one mutated KRAS gene (e.g., KRAS G12C, G12D, or G12V) and at least one KRAS inhibitor.Definitions

[0035] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs.

[0036] As used herein, ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. Hence “about 5 pg” means “about 5 pg” and also “5 pg.” Generally, the term “about” includes an amount that would be expected to be within experimental error. In some embodiments, “about” refers to the number or value recited, “+” or 20%, 10%, or 5% of the number or value.

[0037] As used herein the term “bifunctional” refers to a shRNA (e.g., bi-shRNA) having two mechanistic pathways of action, that of the siRNA and that of the miRNA. The term “traditional” shRNA refers to a DNA transcription derived RNA acting by the siRNA mechanism of action. The term “doublet” shRNA refers to two shRNAs sets, each acting against the expression of two different genes but in the “traditional” siRNA mode.

[0038] As used herein, the terms “KRAS-encoding nucleic acid sequence,” “wild-type KRAS-encoding sequence,” “KRAS-encoding sequence,” and similar terms refer to a nucleicacid sequence that encodes the wild-type KRAS protein. For example, protein sequence of hKRAS is shown in SEQ ID NO:2. A KRAS-encoding sequence may only include a nucleic acid sequence that encodes the wild-type form of KRAS. Alternatively, the KRAS-encoding sequence may comprise the nucleic acid sequence that encodes the wild-type form of KRAS, along with other transcriptional control elements, such as a promoter, termination sequence, and / or other elements.

[0039] The terms “KRAS-encoding nucleic acid sequence,” “wild-type KRAS-encoding sequence,” “KRAS-encoding sequence,” and similar terms are further meant to include a nucleic acid sequence which, by virtue of the degeneracy of the genetic code, may not identical with that shown in any of the sequences shown herein, but which still encodes the amino acid sequence of the wild-type KRAS (e.g., amino acid sequence of hKRAS, e.g., SEQ ID NO:2), or a modified nucleic acid sequence that encodes a different amino acid sequence, provided that the resulting KRAS protein retains substantially the same (or even an improved) activity of the wild-type KRAS protein. That is, modifications to a KRAS-encoding sequence that alter the amino acid sequence of the wild-type KRAS protein in such a way that one amino acid is replaced with a similar amino acid are encompassed by the present invention, as well as other modifications which do not substantially negatively affect KRAS activity because the change (whether it be substitution, deletion or insertion) does not negatively affect the active site of the KRAS protein.

[0040] According to certain embodiments of the invention, the KRAS-encoding sequence may be disposed in or connected to an appropriate carrier or delivery vehicle. Various strategies may be employed to deliver the KRAS-encoding sequences described herein into target cells, including the use of lipid carriers (lipid nanoparticles), liposomes, lipoplexes, viral vectors, biodegradable polymers, polymer microspheres, and various conjugate systems.

[0041] The terms “effective amount” or “therapeutically effective amount,” as used herein, refer to a sufficient amount of an agent or a compound being administered which will relieve to some extent one or more of the symptoms of the disease or condition being treated or prevent the onset or recurrence of the one or more symptoms of the disease or condition being treated. In some embodiments, the result is reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an “effective amount” for therapeutic uses is the amount of the autologous tumor cell vaccine required to provide a clinically significant decrease in disease symptoms without undue adverseside effects. In another example, an “effective amount” for therapeutic uses is the amount of the autologous tumor cell vaccine as disclosed herein required to prevent a recurrence of disease symptoms without undue adverse side effects. An appropriate “effective amount” in any individual case may be determined using techniques, such as a dose escalation study. The term “therapeutically effective amount” includes, for example, a prophylactically effective amount. An “effective amount” of a compound disclosed herein, is an amount effective to achieve a desired effect or therapeutic improvement without undue adverse side effects. It is understood that, in some embodiments, “an effective amount” or “a therapeutically effective amount” varies from subject to subject, due to variation in metabolism of the autologous tumor cell vaccine, age, weight, general condition of the subject, the condition being treated, the severity of the condition being treated, and the judgment of the prescribing physician. The phrase “therapeutically effective amount” of a wild-type KRAS-encoding nucleic acid sequence refers to a sufficient amount of the sequence to express sufficient levels of wild-type KRAS. The phrase “therapeutically effective amount” of a bifunctional shRNA refers to a sufficient amount of the sequence to knockdown the expression of a mutant KRAS gene in the targeted cells of the patient and / or to otherwise treat, prevent, and / or ameliorate the effects of cancer in the patient. It will be understood, however, that the total daily usage of the wild-type KRAS-encoding nucleic acid sequence, the bifunctional shRNA sequence, and related compositions will be decided by the attending physician, within the scope of sound medical judgment.

[0042] As used herein, the terms “subject,” “individual,” and “patient” are used interchangeably. None of the terms are to be interpreted as requiring the supervision of a medical professional (e.g., a doctor, nurse, physician’s assistant, orderly, hospice worker). As used herein, the subject is any animal, including mammals (e.g., a human or non-human animal) and non-mammals. In one embodiment of the methods and autologous tumor cell vaccines provided herein, the mammal is a human.

[0043] As used herein, the terms “treat,” “treating,” or “treatment,” and other grammatical equivalents, including, but not limited to, alleviating, abating, or ameliorating one or more symptoms of a disease or condition, ameliorating, preventing or reducing the appearance, severity, or frequency of one or more additional symptoms of a disease or condition, ameliorating or preventing the underlying metabolic causes of one or more symptoms of a disease or condition, inhibiting the disease or condition, such as, for example, arresting the development of the disease or condition, relieving the disease or condition, causing regressionof the disease or condition, relieving a condition caused by the disease or condition, preventing recurrence or prophylactically treating recurrence of the disease or condition, or inhibiting the symptoms of the disease or condition either prophylactically and / or therapeutically. In a nonlimiting example, for prophylactic benefit, an autologous tumor cell vaccine composition disclosed herein is administered to an individual at risk of developing a particular disease or condition, predisposed to developing a particular disease or condition, or to an individual previously suffering from and treated for the disease or condition. In some embodiments, the disease or condition is cancer.

[0044] As used herein, the term "prevention" means a prophylactic treatment performed before the subject suffers from a disease or the disease previously diagnosed is deteriorated, thereby enabling the subject to avoid, prevent or reduce the likelihood of the symptoms or related diseases of the disease. The subject may be a subject with an increased risk of developing a disease or a disease previously diagnosed to be deteriorated.

[0045] As used herein, the term “transfection” refers to the introduction of foreign DNA into eukaryotic cells. In some embodiments, transfection is accomplished by any suitable means, such as for example, calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, or biolistics.

[0046] As used herein the term “nucleic acid” or “nucleic acid molecule” refers to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. In some embodiments, nucleic acid molecules are composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., a- enantiomeric forms of naturally-occurring nucleotides), or a combination of both. In some embodiments, modified nucleotides have alterations in sugar moieties and / or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, in some embodiments, the entire sugar moiety is replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclicsubstitutes. In some embodiments, nucleic acid monomers are linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. In some embodiments, the term “nucleic acid” or “nucleic acid molecule” also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. In some embodiments, nucleic acids are single stranded or double stranded.

[0047] As used herein, the term “expression vector” refers to nucleic acid molecules encoding a gene that is expressed in a host cell. In some embodiments, an expression vector comprises a transcription promoter, a gene, and a transcription terminator. In some embodiments, gene expression is placed under the control of a promoter, and such a gene is said to be “operably linked to” the promoter. In some embodiments, a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter. As used herein, the term “promoter” refers to any DNA sequence which, when associated with a structural gene in a host cell, increases, for that structural gene, one or more of 1) transcription, 2) translation or 3) mRNA stability, compared to transcription, translation or mRNA stability (longer half-life of mRNA) in the absence of the promoter sequence, under appropriate growth conditions.KRAS Inhibitor Development and Drug Resistance

[0048] To screen for inhibitors of KRAS protein, in 2013, Shokat and colleagues (see, e.g., Ostrem et al., Nature 503, 548-551, 2013) used protein mass spectrometry to screen 480 tethered compound libraries for KRAS-G12C in the GDP state and found the cysteine of G12C is located next to the pocket (P2) in the switch-II region. Small molecules can be designed to fit into the P2 pocket and covalently interact with the amine side chain of cysteine, thus specifically locking the G12C form of KRAS in an inactive GDP -bound form without affecting the wild-type KRAS. Amgen and Mirati Therapeutics quickly developed two direct KRAS- G12C inhibitors, namely sotorasib (also known as AMG 510 or Lumakras or Lymakras) and adagrasib (also known as MRTX849 or Krazati), respectively. Both sotorasib and adagrasib act by selectively forming a covalent bond with cysteine 12 within the switch-II pocket of KRAS-G12C protein, thereby locking KRAS in the inactive state to arrest cell proliferation.

[0049] Preclinical studies have shown that sotorasib and adagrasib selectively impair the viability of KRAS-G12C mutant cell lines, but do not affect cell lines with other KRASmutations or KRAS wild-type protein in vitro and in vivo. Half-life for sotorasib and adagrasib are 5.5-24 hours with extensive tissue distribution in humans. Neither sotorasib nor adagrasib affects PI3K signaling, suggesting that PI3K activation could bypass the inhibition mechanism of sotorasib or adagrasib, a potential pitfail of the KRAS-G12C specific inhibitors.

[0050] Sotorasib has shown enhanced anti-cancer activity in immunocompetent mice with compared with tumor xenograft in immune compromised mouse models, strongly suggesting the action of KRAS-G12C inhibitor could facilitate tumor microenvironment for T cell infiltration and activation. KRAS-G12C inhibitor may elicit robust adaptive immune responses against rechallenged tumors. Thus, immune checkpoint inhibitors are being tested as combination therapy partners. Clinical trials (NCT04185883 and NCT03785249) are ongoing to test the combination with pembrolizumab and adagrasib or sotorasib in KRAS-G12C-mutant advanced / metastatic solid tumors.

[0051] The U.S. Food and Drug Administration (FDA) accelerated the approval of sotorasib as the first KRAS-G12C blocking drug for the treatment of adult patients with NSCLC. The FDA granted application under Fast Track, Priority Review, Breakthrough Therapy and Orphan Drug designation with an unsurpassed speed. The approval is based on a phase 2 trial that included 124 NSCLC patients with KRAS-G12C mutations who had previously received other treatments. Sotorasib with brand name Lumakras®, administered orally at a dose of 960 mg once daily reduced tumor size in 37.1% of participants with a median duration of response of 11.1 months. Following sotorasib, the FDA also granted breakthrough therapy designation to adagrasib for NSCLC patients with KRAS-G12C mutations after previous therapy. A phase 1 / 2 study of 51 response-evaluable patients with KRAS-G12C mutation NSCLC, 600 mg twice daily doses of adagrasib, 45% had a partial response and 51% were in stable condition. Adagrasib with trade name Krazato® was approved.. Diarrhea, nausea, vomiting, fatigue, and elevated aminotransferase levels are the most common adverse events for sotorasib and adagrasib. Additional covalent inhibitors of KRAS-G12C, such as ARS-1620, GDC-6036, D- 1553, LY-3537982, MK-1084 and ARS-853, are underway for this class of target specific drugs on various advanced solid tumors carrying KRAS-G12C mutations.

[0052] Preclinical and clinical evidence show drug resistance to KRAS-G12C inhibitor treatment developed soon after. Resistance to therapy is multifaceted. Although KRAS mutations are recognized to be the driver mutation leading to tumor development, intercellular variability or intratumoral heterogeneity within tumor is considered to be the main factorleading to KRAS-G12C inhibitor resistance. Current FDA approval is for patients with previous anti-cancer therapies which in no doubt have developed complex drug resistance through prior treatments. Single-cell RNA sequencing analysis of KRAS-G12C mutant NSCLC cell line treated with KRAS-G12C inhibitor ARS1620 demonstrated that the subpopulation of cells increased the synthesis of new KRAS-G12C protein, rather than the wild-type KRAS protein, is the main cause of adaptive resistance. The increased synthesis of new KRAS-G12C protein was found to be due to mutant allele amplification. EGFR or aurora kinase A (AURKA) signals can maintain the newly expressed KRAS-G12C protein in the active GTP-bound form, thereby evading KRAS-G12C inhibitor treatment.

[0053] Wild-type RAS activation mediated by multiple RTKs are responsible for the acquired resistance of KRAS-G12C inhibitors in various types of cancer cell lines. Studies demonstrate the importance of PTPN11 / SHP2 as a common downstream of RTKs to activate the wild-type or mutant KRAS protein in mediating acquired drug resistance. Clinical trials (NCT04330664) are ongoing to test the combination with TNO155 (SHP2 inhibitor) and adagrasib in patients with advanced solid tumors carrying KRAS-G12C mutation. In addition, KRAS-G12C inhibitor do not affect PI3K mediated pathway, thus, the PI3K-AKT-mTOR pathway remain activated contributes to the development of sotorasib resistance in human PDAC cell line in vitro and in vivo xenograft mouse models.

[0054] Gene set enrichment analysis and mass spectrometry-based phosphoproteomics analysis found that induction of epithelial-to-mesenchymal transition (EMT) promotes resistance to sotorasib or ARS-1620 through the activation ofPI3K orERK pathway in NSCLC cells in a cell type-dependent manner. Nuclear factor, erythroid 2 like 2 (NFE2L2, NRF2) regulated by kelch like ECH associated protein 1 (KEAP1) is a key transcription factor in cellular antioxidant response. KEAP1 or NFE2L2 mutations that predict poor response to checkpoint inhibitor immunotherapy may also be related to resistance to adagrasib. Tumors with KEAP1 or NFE2L2 mutations are the key predictor of strong KRAS-G12C inhibitor resistance.

[0055] Intrinsic or adaptive resistance may also be caused by concurrent genetic changes, secondary KRAS mutations and / or mutations or upregulation of RAS family of proteins maintains oncogenic growth without the need of the original G12C mutation. A recent clinical study used next generation sequencing with deep mutation scanning to characterize genetic variations in tissue samples or circulating tumor DNA from patients resistant to adagrasib.Among 38 patients with KRAS-G12C mutation cancer received adagrasib monotherapy, 45% of patients are found to have a putative resistance mechanism to adagrasib. 18% of them have multiple overlapping RAS family of genetic mutations: acquired KRAS mutations of G12D / R / V / W, G13D, Q61H, R68S, H95D / Q / R, and Y96C; high-level amplification of the KRAS-G12C allele. Acquired bypass resistance mechanisms including MET amplification; activating mutations in NRAS, BRAF, MAP2K1, RETALK, RET, RAFI, FGFR3, NF1, and PTEN; oncogenic fusions involving ALK, RET, BRAF, RAFI, and FGFR3; and loss-of- function mutations in NF1 and PTEN.

[0056] In addition, acquired resistance to adagrasib related to the reactivation of the RAS- MAPK signaling by 10 secondary gene mutations on the RAS-RAF-MEK-ERK pathway has been reported in an NSCLC patient. KRAS-Y96D mutation directly affects the binding of adagrasib to the P2 pocket, thereby conferring resistance to sotorasib, adagrasib, or ARS-1620 were observed in multiple cancer cell lines (NCI-H358, MIAPaCa2, and BaF3). In addition to KRAS-Y96D, KRAS-Y96S and KRAS-Y96C also contribute to the resistance to sotorasib or adagrasib in BaF3 cells. Altogether, these findings highlight the complexity and the multitudes of genetic mechanism of KRAS-G12C inhibitor resistance. Although complex, all resistance mechanisms were developed to bypass the G12C inhibitor’s irreversible binding to the cysteine residue at the inactive GDP bound state.Bifunctional shRNA and pbishRNA KRASG12CDVtargeting KRAS G12C, G12D, and G12V Mutations

[0057] In some embodiments, the disclosure provides a bifunctional shRNA molecule in a Doggybone DNA (dbDNA®) vector. The dbDNA® vector has several advantages over traditional plasmids. Since the dbDNA® vector is not made in bacteria, there is no antibiotics used in the production process and also no residue bacterial components in the vector preparation. Hence, the dbDNA® vector does not have any bacterial backbone sequence and also has less unmethylated CpG island sequences and less potential to elicit proinflammatory immune response. dbDNA® is a minimal, linear, double stranded and covalently closed DNA construct. The dbDNA® vector is available from Touchlight DNA Services Ltd.. FIG. 1 is a schematic showing bifunctional shRNA targeting KRAS G12C, G12D, and G12V in a dbDNA® vector (db-bishKRASG12CDV) with mammalian expression unit only arrangement. In some embodiments, the disclosure provides a bifunctional shRNA molecule that is capable of inhibiting the expression of at least one mutated KRAS gene (e.g., the mutated KRAS gene encodes a KRAS protein having a G12C mutation, a G12D mutation, a G12V mutation, or aG12R mutation), wherein the bifunctional shRNA molecule sequence is in a Doggybone DNA (dbDNA®) vector and comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of SEQ ID NO:6.Expression Vector

[0058] In some embodiments, the bifunctional shRNA (bi-shRNA) that knocks down the mutant KRAS (e.g., KRAS G12C) comprises a first stem-loop structure that comprises an siRNA component and a second stem-loop structure that comprises a miRNA component. In some embodiments, the bifunctional shRNA has two mechanistic pathways of action, that of the siRNA and that of the miRNA. Thus, in some embodiments, the bifunctional shRNA described herein is different from a traditional shRNA, i.e., a DNA transcription derived RNA acting by the siRNA mechanism of action or from a “doublet or more shRNA” that refers to two or more shRNAs, each acting against the expression of two or more different genes but in the traditional siRNA mode. In some embodiments, the bi-shRNA incorporates siRNA (cleavage dependent) and miRNA (cleavage-independent) motifs. In some embodiments, the expression vector comprises both the bifunctional shRNA sequence and the wild-type KRAS sequence. In some embodiments, the expression vector only comprises the bifunctional shRNA sequence. In some embodiments, the expression vector only comprises the wild-type KRAS sequence.Bifunctional shRNA

[0059] An expression vector can comprise a bifunctional shRNA sequence specific for knockdown of a mutant KRAS or a multiple of mutant KRAS. In some embodiments, the bifunctional shRNA sequence encodes a nucleic acid sequence capable of hybridizing to one or more regions of an mRNA transcript encoding the mutant KRAS to inhibit the expression of the mutant KRAS via RNA interference.

[0060] SEQ ID NO: 1 in the table below provides the DNA sequence of mRNA transcript encoding wild-type hKRAS. SEQ ID NO:2 in the table below provides the protein sequence of hKRAS. In some embodiments, a mutant KRAS can comprise at least one mutation selected from G12C, G12D, and G12V, relative to the sequence of SEQ ID NO:2. In some embodiments, the mutant KRAS has G12C mutation.

[0061] In particular, a bifunctional shRNA sequence that knocks down a mutant KRAS G12C can comprise a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of SEQ ID NO:3.

[0062] In particular, a bifunctional shRNA sequence that knocks down a mutant KRAS G12D can comprise a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of SEQ ID NO:4.

[0063] In particular, a bifunctional shRNA sequence that knocks down a mutant KRAS G12V can comprise a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of SEQ ID NO:5.

[0064] In some embodiments, the expression vector further comprises a promoter, e.g., the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the mammalian CMV promoter comprises a CMV immediate early (IE) 5' UTR enhancer sequence and a CMV IE Intron A. In further embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence.

[0065] The first insert and the second insert in the expression vector can be operably linked to the promoter. In particular embodiments, the expression vector further comprises a nucleic acid sequence encoding a picornaviral 2A ribosomal skip peptide between the first and the second nucleic acid inserts.

[0066] In some embodiments, the bi-shRNA is capable of hybridizing to one of more regions of an mRNA transcript encoding the mutant KRAS. In some embodiments, the DNA sequence of mRNA transcript encoding the mutant KRAS G12C is a nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the DNA sequence of mRNA transcript encoding the mutant KRAS G12D is a nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the DNA sequence of mRNA transcript encoding the mutant KRAS G12V is a nucleic acid sequence of SEQ ID NO: 12.

[0067] In some embodiments, the expression vector targets the coding region of the mutant KRAS mRNA transcript, the 3 ' UTR region sequence of the mutant KRAS mRNA transcript, or both the coding sequence and the 3' UTR sequence of the mutant KRAS mRNA transcript simultaneously. In some embodiments, the bi-shRNA comprises a sequence having at least 90% identity to any one of SEQ ID NOS:3-5. In some embodiments, a bi-shRNA capable of hybridizing to one or more regions of an mRNA transcript encoding the mutant KRAS G12C, G12D, or G12V is referred to herein as bi-shRNAKRASG12CDV. In some embodiments, the bi- shRNAKRASG12CDVcomprises or consists of two stem-loop structures each with a miR-30a loop. In some embodiments, a first stem-loop structure of the two stem-loop structures comprises complementary guiding strand and passenger strand. In some embodiments, the second stem-loop structure of the two stem-loop structures comprises three mismatches in the passenger strand. In some embodiments, the three mismatches are at positions 9 to 11 in the passenger strand. In some embodiments, the bi-shRNAKRASG12CDVcomprises or consists of two stemloop structures each with a miR- 17 / 92 cluster backbone. In some embodiments, a first stemloop structure of the two stem-loop structures comprises complementary guiding strand and passenger strand. In some embodiments, the second stem-loop structure of the two stem-loop structures comprises three mismatches in the passenger strand. In some embodiments, the three mismatches are at positions 9 to 11 in the passenger strand.Table 1 - Sequences

[0068] In some embodiments, the first nucleic acid and the second nucleic acid are operably linked to a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is a mammalian CMV promoter. In some embodiments, the mammalian CMV promoter comprises a CMV immediate early (IE) 5' UTR enhancer sequence and a CMV IE Intron A.

[0069] In some embodiments, a nucleotide sequence encoding a picornaviral 2A ribosomal skip peptide sequence is intercalated between the first and the second nucleic acid inserts.KRAS G12C Inhibitors

[0070] KRAS is a key regulator of signaling pathway responsible for cell proliferation, differentiation, and survival. KRAS is the most frequently mutated oncogene in human cancer and mutations in KRAS can results in continuous cellular proliferation and cancer development. The G12C mutation is a single point mutation with a glycine-to-cysteine substitution at codon 12. This substitution favors the activated state of KRAS, amplifying signaling pathways that lead to oncogenesis. Other KRAS mutant cancer is characterized by a mutation selected from G12A, G12D, G12S, G12V, G13C, G13D, Q61H and combinations thereof.

[0071] The present disclosure provides treatment methods with bishRNA (bishRNA KRAS G12CDV) githgj- plasmid or Doggybone® vector versions, alone or in combination with a KRAS inhibitor, or one or more additional therapeutic agents for use in a method of treatment for cancer. The KRAS inhibitor can be one or more of the following KRAS inhibitors such as adagrasib or sotorasib. A combination therapy includes bishRNA with another KRAS G12C inhibitor. Examples of such a KRAS G12C inhibitors include, but are not limited to, sotorasib(Amgen), adagrasib (Mirati), D-1553 (InventisBio), BI1701963 (Boehringer), GDC6036 (Roche), JNJ74699157 or ARS-3248 (J&J), X-Chem KRAS (X-Chem), BBP-454 (BridgeBio Pharma), LY3537982 (Lilly), BI1823911 (Boehringer), AS KRAS G12C (Ascentage Pharma), SF KRAS G12C (Sanofi), RMC032 (Revolution Medicine), JAB-21822 (Jacobio Pharmaceuticals), AST-KRAS G12C (Allist Pharmaceuticals), AZ KRAS G12C (Astra Zeneca), NYU-12VC1 (New York University), and / or RMC6291 (Revolution Medicines). In some aspects, the KRAS G12C inhibitor is adagrasib, ARS-3248, BBP-454, BI 1701963, GDC-6036, sotorasib, ortipifamib.

[0072] In some aspects, the KRAS G12C inhibitor is adagrasib. In some aspects, the KRAS G12C inhibitor is sotorasib. Sotorasib, sold under the brand names Lumakras® and Lumykras®, is sold by Amgen and is an anti-cancer medication used to treat non-small-cell lung cancer (NSCLC). It targets a specific mutation, G12C, in the protein KRAS encoded by the gene KRAS, which is responsible for various forms of cancer. Sotorasib is an inhibitor of the RAS GTPase family.

[0073] Sotorasib is the first approved targeted therapy for tumors with any KRAS mutation, which accounts for approximately 25% of mutations in non-small cell lung cancers. KRAS G12C mutations occur in about 13% of patients with non-small cell lung cancers. In May 2021, sotorasib was approved by the FDA for the treatment of KRAS G12C mutated NSCLC.

[0074] Adagrasib is an experimental cancer drug being developed by Mirati Therapeutics. It acts as a covalently binding inhibitor for a mutant form of the protein KRAS, which is commonly present in various forms of cancer and acts as a growth factor. It has shown promising results in pre-clinical testing and is currently in clinical trials.Liposomes and Lipid Nanoparticles

[0075] The use of lipids, liposomes, exosomes, proteins or other particle forming compositions are a delivery vehicle for the bifunctional shRNA sequence described herein. Liposomes are attractive carriers insofar as they protect biological molecules, such as the bifunctional shRNA sequence described herein, from degradation while improving cellular uptake. One of the most commonly used classes of liposome formulations for delivering polyanions (e.g., DNA) is that which contains cationic lipids.

[0076] Lipid aggregates may be formed with macromolecules using cationic lipids alone or including other lipids and amphiphiles, such as phosphatidylethanolamine. It is well-known in the art that both the composition of the lipid formulation, as well as its method of preparation,have an effect on the structure and size of the resultant anionic macromolecule-cationic lipid aggregate. These factors can be modulated to optimize delivery of polyanions to specific cell types in vitro and in vivo.

[0077] The use of cationic lipids for cellular delivery of the bifunctional shRNA sequence described herein has several advantages. The encapsulation of anionic compositions using cationic lipids is essentially quantitative due to electrostatic interaction. In addition, it is believed that the cationic lipids interact with the negatively charged cell membranes, thereby initiating cellular membrane transport.

[0078] Experiments have shown that plasmid or vector DNA may be encapsulated in small particles (e.g., nanoparticles), which generally consist of a single plasmid / vector encapsulated within a bilayer lipid vesicle (Wheeler, et al., 1999, Gene Therapy 6, 271-281). These particles often contain the neutral lipid such as dioleoylphosphatidylethanolamine (DOPE), or cationic lipid such as DOTAP (l,2-Di-(9Z-octadecenoyl)-3-trimethylammonium propane methyl sulfate) and cholesterol or various combinations, and / or can be stabilized in aqueous media by the presence of a poly(ethylene glycol) (PEG) coating. In some embodiments, the nanoparticles can mediate either fusogenic or receptor mediated uptake into cells.

[0079] These lipid particles have systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection, can accumulate preferentially in various tissues and organs due to the enhanced vascular permeability in such regions, and can be designed to escape the lyosomic pathway of endocytosis by disruption of endosomal membranes. These properties can be useful in delivering biologically active molecules to various cell types for experimental and therapeutic applications, such as to muscle tissue cells. Various lipid nucleic acid particles and methods of preparation thereof are described in U.S. Patent Application Publication Nos. 2008-0020058, 2003-0077829, 2003-0108886, 2006-0051405, 2006- 0083780, 2003-0104044, 2006-0051405, 2004-0142025, 2006-00837880, 2005-0064595, 2005-0175682, 2005-0118253, 2005-0255153 and 2005-0008689; and U.S. Pat. Nos. 5,885,613; 6,586,001; 6,858,225; 6,858,224; 6,815,432; 6,586,410; 6,534,484; and 6,287,591, all of which are incorporated herein by reference in their entirety.

[0080] The invention provides that the bifunctional shRNA sequence, and the associated delivery vehicles used therewith, may be targeted towards specific cell types, for example, muscle cells, muscle tissue, and the like. For example, the liposomal nanoparticles can be directed to bind to cell surfaces by a number of specific interactions. This binding facilitatesthe uptake of the DNA into the cell by one of several well understood cell entry pathways. Rapid sequestration of the nanoparticles (e.g., liposomes) by these interactions reduces their time in the peripheral circulation, thereby decreasing the likelihood of degradation and nonspecific uptake. General targeting agents include, but are not limited to, transferrin (Trf) which binds to the transferrin receptor (TrfR) on a cell surface — or using an antibody (or a derivative thereof) that binds to the TrfR on the cell surface. Muscle has a relatively high proportion of TrfR on its cell surfaces. Another target for sequestration is the epidermal growth factor receptor (EGFR), which is prevalent on the surface of muscle cells and other epithelioid cell types. Erbitux (an EGFR monoclonal antibody approved for human use) is an exemplary agent for EGFR-targeting, which may also be used to decorate the liposomal nanoparticles described herein. Additional targeting moieties can be, but are not limited to, lectins or small molecules (peptides or carbohydrates) which recognize and bind to specific targets found only on (or are more restricted to) muscle cells. The advantage of smaller (and possibly higher affinity) molecules is that they could be present at a higher density on the surface of the nanoparticles employed.

[0081] In one aspect, the particle comprises a doggybone (dbDNA®) DNA. Named after its schematic structure, dbDNA® is a minimal, linear, double stranded and covalently closed DNA construct.Methods of Treatment

[0082] The present disclosure provides a method of treating (e.g., one or more of reducing, inhibiting, or delaying progression) cancer or tumor in a patient in need thereof, wherein the method comprises administering to the patient in need thereof, a therapeutically active amount of a bishRNA (bishKRASG12CDV) construct alone as a single agent or as combination therapy with a therapeutically active amount of one or two therapeutically active agents of KRAS inhibitors, wherein the cancer is lung cancer (including lung adenocarcinoma and non-small cell lung cancer) , colorectal cancer (including colorectal adenocarcinoma), pancreatic cancer (including pancreatic adenocarcinoma), uterine cancer (including uterine endometrial cancer), rectal cancer (including rectal adenocarcinoma) and a solid tumor, optionally wherein the cancer is KRAS-G12C mutated.

[0083] In some embodiments, the treatment comprises administering a therapeutically active amount of a bishKRASG12CDVconstruct in combination with one or more KRAS G12Cinhibitors, i.e., the bishKRASG12CDVconstruct is administered before, simultaneous, or after the KRAS G12C inhibitor.

[0084] In some embodiments, the treatment comprises administering a therapeutically active amount of a bishKRASG12CDVconstruct in combination with one or more KRAS G12D inhibitors, i.e., the bishKRASG12CDVconstruct is administered before, simultaneous, or after the KRAS G12D inhibitor.

[0085] In some embodiments, the treatment comprises administering a therapeutically active amount of a bishKRASG12CDVconstruct in combination with one or more KRAS G12V inhibitors, i.e., the bishKRASG12CDVconstruct is administered before, simultaneous, or after the KRAS G12V inhibitor.

[0086] In some embodiments, the treatment comprises administering a therapeutically active amount of a bishKRASG12CDVconstruct in combination with one or more pan-KRAS inhibitors, i.e., the bishKRASG12CDVconstruct is administered before, simultaneous, or after the pan- KRAS inhibitor.

[0087] In some embodiments, the treatment comprises administering a therapeutically active amount of a bishKRASG12CDVconstruct in combination with one or more receptor tyrosine kinase (RTK) inhibitors, i.e., the bishKRASG12CDVconstruct is administered before, simultaneous, or after the RTK inhibitor.

[0088] In some embodiments, the bishKRASG12CDVconstruct can be administered or delivered by lipid carriers (lipid nanoparticles), for example, liposomes, lipoplexes, and exosomes.

[0089] In other embodiments, the bishKRASG12CDVconstruct can be administered or delivered by way of viral delivery. For example, viral vectors that may be used include, but are not limited to, retroviral vectors, adenoviral vectors, poxviral vectors (e.g., vaccinia viral vectors, such as Modified Vaccinia Ankara), lentiviral vectors, adeno-associated viral vectors, and alphaviral vectors.

[0090] In certain aspects of the disclosure, the cancer or tumor to be treated is selected from the group of lung cancer (including lung adenocarcinoma, non-small cell lung cancer and squamous cell lung cancer), colorectal cancer (including colorectal adenocarcinoma), pancreatic cancer (including pancreatic adenocarcinoma), uterine cancer (including uterine endometrial cancer), rectal cancer (including rectal adenocarcinoma), appendiceal cancer,small-bowel cancer, esophageal cancer, hepatobiliary cancer (including liver cancer and bile duct carcinoma) , bladder cancer, ovarian cancer and a solid tumor, particularly when the cancer or tumor harbors a KRAS G12C mutation. Cancers of unknown primary site but showing a KRAS G12C mutation may also benefit from treatment with the methods of the disclosure.

[0091] In aspects of the methods of the disclosure, the cancer is selected from non-small cell lung cancer, colorectal cancer, pancreatic cancer and a solid tumor.

[0092] In a further aspect of the methods, the cancer is colorectal cancer.

[0093] In a further aspect of the methods, the cancer is gastric cancer.

[0094] In a further aspect of the methods, the cancer is nasopharyngeal cancer.

[0095] In a further aspect of the methods, the cancer is non-small cell lung cancer.

[0096] In a further aspect of the methods, the cancer is small cell lung cancer.

[0097] In a further aspect of the methods, the cancer is pancreatic cancer.

[0098] In a further aspect of the methods, the cancer is a solid tumor.

[0099] In a further aspect of the methods, the cancer is appendiceal cancer.

[0100] In a further aspect of the methods, the cancer is small-bowel cancer.

[0101] In a further aspect of the methods, the cancer is esophageal cancer.

[0102] In a further aspect of the methods, the cancer is hepatobiliary cancer.

[0103] In a further aspect of the methods, the cancer is hepatocellular cancer.

[0104] In a further aspect of the methods, the cancer is bladder cancer.

[0105] In a further aspect of the methods, the cancer is urothelial bladder cancer.

[0106] In a further aspect of the methods, the cancer is ovarian cancer.

[0107] In a further aspect of the methods, the cancer is Hodgkin’s Lymphoma.

[0108] The methods and combinations of the disclosure may be useful as first or second line of therapy or as more advanced lines of therapy. In this respect, the unique interactions of bishRNA with mutated KRAS G12C, e.g., compared to other KRAS G12C inhibitors such assotorasib or adagrasib would be useful in targeting resistance mutations which may arise after treatment with other KRAS G12C inhibitors such as sotorasib or adagrasib.

[0109] In an aspect, the cancer has become resistant to treatment with an inhibitor of KRAS G12C after earlier treatment with an inhibitor of KRAS G12C.

[0110] In an aspect, the cancer is resistant to treatment with sotorasib and / or adagrasib.[OHl] In some aspects, the cancer has become resistant to treatment with sotorasib and / or adagrasib after earlier treatment with sotorasib and / or adagrasib.

[0112] In one aspect, the compositions described herein are used for the treatment of diseases and conditions described herein. In addition, a method for treating any of the diseases or conditions described herein in a subject in need of such treatment, involves administration of compositions in therapeutically effective amounts to the subject.Dosing

[0113] Dosages of KRAS G12C inhibitors described herein can be determined by any suitable method. Maximum tolerated doses (MTD) and maximum response doses (MRD) can be determined via established animal and human experimental protocols. For example, toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD50 and ED50. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. Additional relative dosages, represented as a percent of maximal response or of maximum tolerated dose, are readily obtained via the protocols.

[0114] In some aspects, the amount of a given formulation comprising a KRAS inhibitor, or a pharmaceutically acceptable salt thereof that corresponds to such an amount varies depending upon factors such as the molecular weight of a particular salt or form, disease condition and its severity, the identity (e.g., age, weight, sex) of the subject or host in need of treatment, but can nevertheless be determined according to the particular circumstances surrounding the case,including, e.g., the specific agent being administered, the liquid formulation type, the condition being treated, and the subject or host being treated.

[0115] Generally, when administered to a human, the oral dosage of any of the compounds of the disclosure, or a pharmaceutically acceptable salt thereof, will depend on the nature of the compound, and can readily be determined by one skilled in the art. A dosage may be, for example, about 0.001 mg to about 2000 mg per day, about 1 mg to about 1000 mg per day, about 5 mg to about 500 mg per day, about 100 mg to about 1500 g per day, about 500 mg to about 1500 mg per day, about 500 g to about 2000 mg per day, or any range derivable therein, in some embodiments, the pharmaceutical composition may further include an additional compound having antiproliferative (e.g., anti-cancer) activity. Depending on the mode of administration, compounds, or a pharmaceutically acceptable salt thereof, will be formulated into suitable compositions to permit facile delivery. Each compound, or a pharmaceutically acceptable salt thereof, of a combination therapy may be formulated in a variety of ways that are known in the art. For example, the first and second agents of the combination therapy may be formulated together or separately. Desirably, the first and second agents are formulated together for the simultaneous or near simultaneous administration of the agents. It will be appreciated that the compounds and pharmaceutical compositions of the present disclosure can be formulated and employed in combination therapies, that is, the compounds and pharmaceutical compositions can be formulated with or administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder, or they may achieve different effects (e.g., control of any adverse effects).Administration

[0116] The bifunctional shRNA molecule described herein, which can be delivered to a system in connection with an appropriate delivery vehicle (such as a liposome or lipid nanoparticle), may be administered to a system using any of various well-know techniques. For example, in the case of a mammal, the bifunctional shRNA sequence may be administered to a mammal via parenteral injection. The term “parenteral,” as used herein, includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial,intrasynovial, or infusion techniques. In particular embodiments, the bifunctional shRNA sequence can be administered via intramuscular injection.

[0117] The bifunctional shRNA sequence and related compositions may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated composition or its delivery form. For example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables.

[0118] According to certain embodiments, a Plasma-Lyte® carrier may be employed and used to deliver the bifunctional shRNA sequence, particularly for parenteral injection (e.g., intramuscular injection). Plasma-Lyte® is a sterile, non-pyrogenic isotonic solution that may be used for intravenous administration. Each 100 mL volume contains 526 mg of Sodium Chloride, USP (NaCl); 502 mg of Sodium Gluconate (C6Hl lNaO7); 368 mg of Sodium Acetate Trihydrate, USP (C2H3NaO2.3H2O); 37 mg of Potassium Chloride, USP (KC1); and 30 mg of Magnesium Chloride, USP (MgC12.6H2O). It contains no antimicrobial agents. The pH is preferably adjusted with sodium hydroxide to about 7.4 (6.5 to 8.0).

[0119] The injectable formulations used to deliver the bifunctional shRNA sequence may be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved or dispersed in sterile water, Plasma-Lyte® or other sterile injectable medium prior to use.

[0120] In order to prolong the expression of the bifunctional shRNA sequence within a system (or to prolong the effect thereof), it may be desirable to slow the absorption of the composition from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. Therate of absorption of the composition may then depend upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form.

[0121] Alternatively, delayed absorption of a parenterally administered bifunctional shRNA sequence may be accomplished by dissolving or suspending the composition in an oil vehicle. Injectable depot forms may be prepared by forming microencapsule matrices of the bifunctional shRNA sequence in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of the bifunctional shRNA sequence material to polymer and the nature of the particular polymer employed, the rate of the bifunctional shRNA sequence release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). As described above, depot injectable formulations may also be prepared by entrapping the bifunctional shRNA sequence in liposomes (or even microemulsions) that are compatible with the target body tissues.EXAMPLESExample 1 - KRAS G12 mutant selective knockdown by db-bishRNAKRASG12CDV

[0122] Plasmid DNA was compared to dbDNA® vector for knockdown activity. We developed restriction fragment length polymorphism (RFLP) method to differentiate wild-type KRAS mRNA from G12 mutant KRAS mRNA. NCI-H358 cells are heterozygote KRAS (+ / G12C). Without bishKRASG12CDVtreatment, NCI-H358 cells show mutant form of KRAS is the predominant mRNA (FIG. 2, left panel). After transfecting NCI-H358 cells with either plasmid version or dbDNA® vector of bishKRASG12CDV, the ratio changed to be predominantly wild-type KRAS mRNA (FIG. 2, right panel), indicating selective knockdown of mutant KRAS mRNA without affecting wild-type KRAS mRNA.

[0123] The knockdown effect was further analyzed via the next generation sequencing (NGS) method. mRNAseq analysis comparing untreated PANC-1 cells to either PANC-1 cells treated with plasmid version of bishKRASG12CDVor dbDNA® vector of bishKRASG12CDV. PANC-1 cells are heterozygous KRAS (+ / G12D). As anticipated, mRNA of numerous genes was either up or down regulated when compared treated with untreated PANC-1 cells. The plasmid version bishKRASG12CDVand dbDNA® vector of bishKRASG12CDVtreated cells show very similar gene expression patterns. Most significantly, the gene expression profiling shows key KRAS mutation induced gene expressions such as c-Myc and EIF4A1 were significantly down regulated as the result. The gene count is shown FIG. 3.Example 2 - Effects on KRAS mediated signaling

[0124] Furthermore, the changes involving KRAS mediated RTK signaling MAPK and PI3K pathways were also examined. Constitutive activation KRAS mutation bypasses RTK mediated signal transduction requirement, in consequence, EGFR signaling and tyrosine phosphorylation is not activated resulting in low tyrosine phosphorylation. Eliminating constitutive activation KRAS mutation, reactivate EGFR mediated signal transduction, enhances EGFR tyrosine phosphorylation. PANC-1 or MIAPaCa-2 cells treated with db- bishKRASG12CDVvector or plasmid version of bishKRASG12CDVwere shown to enhance tyrosine phosphorylation at Y1068 and Y1125 positions of EGFR (FIG. 4A). KRAS G12C inhibitor Sotorsib (Lumakras) treated MIAPaCa-2 cells show similar response (FIG. 4B, obtained from FDA submission of sotorasib ND A 214665), however significantly lower in magnitude.Example 3 - Effect of db-bishRNA knockdown, cell survival, and synergy with KRAS G12C inhibitorsDevelop cell viability assay: XTT assay

[0125] To determine the growth characteristics of NCI-H358 cells and its sotorasib resistant derivatives, we utilized XTT assay. Cell Proliferation Kit II (XTT) from Roche was used following the manufacture protocol. Cells were plated in wells of 96 well plates with 50 pL growth medium. The desired amount of sotorasib in 50 pL growth medium was added after cell plating. After incubation in 37°C, 5% CO2 incubator for 2-7 days, the XTT labeling reagent and the electron coupling reagent were thawed and mixed at ratio of 5 mL to 0.1 mL right before the experiment. 50 pL XTT labeling mixture per well was added to the 96-well plate and incubated at 37°C, 5% CO2 for 2 or 4 hours. The absorbance at 450 nm was read using a BioTek Epoch plate reader. The reference wavelength was set to 660 nm. Each treatment condition was loaded on 96-well plate at least in quadruplicate.

[0126] We tested plating 50,000 NCI-H358 cells per well of 96 well plate to validate the assay system for growth inhibition. Plated cells were treated with various concentrations of Sotorasib. Cell viability was comparatively assessed with XTT Tetrazolium Assay method two days after. FIG. 5 shows NCI-H358 cells viability was reduced in a dose responsive manner.db-bishRNAKRASG12CDValone or with Sotorasib demonstrated dose related reduction of NCI-H358 cell viability

[0127] NCI-H358 cells were treated with db-bishKRASG12CDValone or in combination with 50 nM of sotorasib. Transfection of NCI-H358 cells with db-bishRNAKRASG12CDVwas by electroporation. The electroporation condition was optimized with Gene Pulser Xcell Electroporation of Bio-Rad. Essentially, cells at 2E+6 cells per mL of OptiMEM were pulsed at constant 275V with various amounts of db-bishKRASG12CDVDNA. Calculated # of cells were plated in 96 well plates. Cell viability was assayed with XTT method at 3 days post treatment. The results are shown in FIG. 6A. db-bishKRASG12CDValone was able to reduce NCI-H358 cells survival in a dose responsive manner. Higher dose of 100 pg / mL is a bit better than lower dose of 12.5 pg / mL. 50 nM of sotorasib alone reduced cell survival. 50 nM of sotorasib in combination with various concentrations of db-bishKRASG12CDVfurther enhanced reduction of cell survival. The effect of sotorasib and db-bishKRASG12CDVappears to be synergistic. Both db-bishKRASG12CDVand sotorasib are targeted at KRAS G12C ofNCI-H358 cells, db-bishKRASG12CDVinhibits G12C expression at mRNA level while sotorasib inhibits by locking G12C protein at inactive state. This synergy strongly suggests we detected a novel cooperativity between those two agents with two independent mechanisms.

[0128] Similar enhancement effect extends to 25 nM or 100 nM of sotorasib added as shown in FIG. 6B. The enhancement effect is similar from 25 nM to 100 nM strongly suggesting 25 nM has already reached the saturating dose. Literature reports sotorasib IC50 for NCLH358 cells is 6 nM.

[0129] When we added 50 nM of sotorasib two days after the treatment with db- bishKRASG12CDVand assayed a day after the addition of sotorasib, interestingly, the enhancement of sotorasib was minimum after one day of treatment with sotorasib on db- bishKRASG12CDVpretreated cells (FIG. 7A). Addition of sotorasib two days after db-bishRNA transfection did not significantly enhance or affect cell survival of db-bishRNA transfected cells. Non-small cell lung cancer (NSCLC) cell line NCI-H358 (KRASG12C / +) cells were transfected with various concentrations of db-bishRNAKRASG12CDV. The transfected cells were plated in 96 well plate at 4,000 cells per well. 50 nM of sotorasib was added to the culture two days after the transfection. Comparative cell survivals were assayed by XTT assay. It appears cooperativity between db-bishKRASG12CDVand sotorasib are working through two independent and yet linking mechanisms. This observed effect also extends to 25 nM or 100 nM of sotorasib (FIG. 7B).Example 4- bishRNAKRASG12CDVtreatment is effective on sotorasib resistant cellsGenerating sotorasib resistant NCI-H358 cells

[0130] KRAS G12C inhibitors quickly developed drug resistance in vitro, in vivo, and in clinic. We are interested to find out whether db-bishRNAKRASG12CDVtreatment can influence KRAS G12C inhibitor resistance development. In order to observe db-bishRNAKRASG12CDVeffect on KRAS G12C inhibitor resistance cells, we set out to generate sotorasib resistant NCI- 11358 cells. NCI-H358 cells are heterozygous G12C / + and are commonly used as model for KRAS G12C inhibitor development.

[0131] Semi-confluent NCI-H358 cells were treated with various concentrations of sotorasib continuously for two weeks. After initial massive cell death, Sotorasib drug resistant cultures emerged with altered morphology and growth characteristics as shown in FIG. 8. Resistant cultures developed continent or island-like structures with 3D growth characteristics in contrast to the parent culture with flat and contact inhibited growth. The resistant cell morphology could represent the epithelial-to-mesenchymal transition (EMT) observed with clinical samples. Sotorasib drug resistant cultures maintain their altered morphology and characteristics through many passages under the constant drug pressure. Resistant cultures maintained under different doses of sotorasib have significant different morphological appearances suggesting differed resistance mechanisms and changes.Sotorasib resistant NCI-H358 cells are sensitive to higher concentrations of sotorasib

[0132] We are first interested in finding out whether NCI-H358 cells resistant to an established concentration of sotorasib can be further challenged with higher concentrations of sotorasib. NCI-H358 cells resistant to 6 nM concentration of sotorasib were further challenged with various higher concentrations of sotorasib for two days. Comparative cell survival is shown in FIG. 9. Interestingly, survival or growth of NCI-H358 cells resistant to 6 nM of sotorasib was further reduced when challenged with higher concentrations of sotorasib. The growth reduction appears to be in a dose responsive manner plateau off starting at around 80 nM.NCI-H358 cells with resistance to sotorasib also respond to db-bishRNAKRASG12CDVsingle agent at higher concentration

[0133] We then ask whether sotorasib resistant NCI-H358 cells respond to db- bishRNAKRASG12CDVtreatment. NCI-H358 cells resistant to 20 nM of sotorasib were transfected with various concentrations of db-bishKRASG12CDV. Viability of cells wasdetermined two days after transfection. Comparative survival is shown in FIG. 10. As shown, db-bishRNAKRASG12CDVtreatment effectively reduced the resistant cell survival as well. Higher concentration of db-bishRNAKRASG12CDVwas required. Instead of 12.5 pg / mL or higher for non-resistant NCI-H358 cells, the resistant cells required 25 pg / mL or higher. The effect on resistant cells worked well by db-bishRNAKRASG12CDValone and cooperatively with higher concentrations of sotorasib.Example 5- Doggybone version of bishRNAKRASG12CDVshowed comparable activity as its plasmid version parentPANC-1 (G12D) cell growth inhibition 24 hrs post electroporation transfection with plasmid or Doggybone (db)-bishRNAKRASG12CDV

[0134] Pancreatic cancer cell line PANC-1 (KRASG12D / +) cells were transfected with varied concentrations of either empty plasmid (pUMVC3), plasmid version of bi- shRNAKRASG12CDV, or db vector version db-bi-shRNAKRASG12CDV. Transfections were done at 0.4 mL with three concentrations of DNA at 5 pg, 10 pg, or 25 pg per electroporation. The transfected cells were plated in 96 well plate. Comparative survivals were assayed at 24 hours post transfection by XTT assay. Dose related PANC-1 growth reduction demonstrated with db vector similar to standard plasmid of bi-shRNAKRASG12CDV. FIG. 12 shows inhibition of PANC-1 (KRAS+ / G12D) 24 hours post electroporation with plasmid version (pUMV3 or pl 32) or Doggybone® vector version (dbl32) of bishRNAG12CDV.PANC-1 (G12D driven) cell growth signal mRNA knockdown after db-bi- shRNAKRASG12CDVtreatment.

[0135] Pancreatic cancer cell line PANC-1 (KRASG12D / +) cells were transfected with 50 pg / mL of either control (empty plasmid, pUMVC3), or db vector version db-bi- shRNAKRASG12CDV. Total cell RNA was harvested at 48 hours post transfection for mRNAseq analysis. By gene count, housekeeping genes were not significantly affected (Data not shown). c-Myc and eIF4Al are genes well-known to be up-regulated by KRAS G12 mutations. c-Myc and eIF4Al gene counts were significantly downregulated in PANC-1 cells after treatment with db-bi-shRNAKRASG12CDV(FIGS. 3 A and 3B).Plasmid bi-shRNAKRASG12CDVis effective in vivo as demonstrated with lipoplex formulation in a pancreatic cancer PANC-1 (KRAS+ / G12D) xenograft model, db vector version of bi-shRNAKRASG12CDVis expected to have the same activity as the parent plasmid

[0136] Pancreatic cancer xenograft model with PANC-1 (KRAS+ / G12D) established tumor was treated with lipoplex formulation containing plasmid bi-shRNAKRASG12CDVvia intravenous infusion. Tumor growth reductions were observed with either 5 pg or 25 g of lipoplex treatment compared to no treatment or empty plasmid treatment. FIG. 11 shows inhibition of tumor growth by plasmid version of bifunctional shRNAG12CDVdelivered with lipoplex in a pancreatic cancer PANC-1 (KRAS+ / G12D) xenograft model. Doggybone vector version of bi-shRNAKRASG12CDVis expected to have similar in vivo activity as plasmid parent as demonstrated in vitro.Conclusion

[0137] The KRAS-G12C inhibitor covalently binds to the P2 pocket in the switch II region, trapping the oncoprotein in an inactive GDP -bound state. Multiple mechanisms of resistance subsequently emerge to overcome the KRAS-G12C inhibitor drug action. The KRAS-G12C inhibitor resistant NCI-H358 cells maintained under constant drug pressure no doubt would either adapt or acquire varieties of mechanisms described earlier for drug resistance. And yet, db-bishKRASG12CDVcan overcome the resistance further reduced the resistance cell survival. This finding is not expected. In addition, the db-bishKRASG12CDVsynergistically working with KRAS-G12C inhibitor to further inhibit cancer cell growth was also not anticipated. These findings represent a significant advantageous treatment paradigm for the treatment of KRAS mutations driven tumors. Treatment strategies involving effective dose of bishKRASG12CDValone or in combination with lower doses of KRAS G12C inhibitor may lead to effective cancer treatment without eliciting drug resistance. Additionally, bishKRASG12CDVadvantageously able to target KRAS G12C, G12D and G12V mutations, while KRAS G12C inhibitors only target KRAS G12C mutation driven tumors.Example 6 - MethodsWestern Blot

[0138] After treatment, MIA PaCa-2 or PANC-1 cells were collected with medium from culture dishes using cell lifter (Thermo Fisher Scientific, Waltham, MA), and centrifuged at 1500 rpm 10 min. The cell pellets were resuspended with 1 mL 1 x DPBS after removal ofsupernatant, then centrifugated at 1500 rpm 10 min again. After centrifugation, 1 x DPBS supernatant was removed, and the cell pellets were stored at -80°C before Western blot analysis. To prepare total cell lysate, cell pellets were lysed with 100 pL ice cold Cell Lysis Buffer II (Invitrogen, Thermo Fisher Scientific, Waltham, MA) with 1 x protease inhibitors (Sigma, St. Louis, MO), 1 x phosphatase inhibitors 2 (Sigma) and 1 x phosphatase inhibitors 3 (Sigma) on ice for 30 minutes. The lysates were centrifuged at 14,000 rpm for 10 min and the supernatants were transfered to a clean tube. The protein concentration was measured using Bradford method (Pierce, Thermo Fisher Scientific, Waltham, MA). 30 pg total protein lysate of each tumor sample was mixed with 1 / 3 volume of 4 x Laemmli Sample buffer (Bio-Rad, Hercules, CA) with 5% P-mercaptoethanol (Sigma) and denatured by heating at boiling temperature for 10 minutes, then loaded on 4-20% Mini -PROTEAN TGX gradient gel (BioRad). After electrophoresis, the protein was transferred to PVDF membrane using Trans-Blot Turbo system (Bio-Rad). To detect target protein, the membrane was first blocked with 5% Blotting-Grade Blocker (Bio-Rad), 0.1% Tween 20 (Sigma) in 1 x DPBS for 1 hour at room temperature on orbital shaker, then probed with primary antibody 1 : 1000 dilution at 4 C overnight in 5% Blotting-Grade Blocker (Bio-Rad), 0.1% Tween 20 in 1 x DPBS on orbital shaker. After wash the membrane with 0.1% Tween 20 in 1 x DPBS 3 times, 5 minutes each, the membrane was probed with HRP conjugated anti-mouse or rabbit 2nd antibody (Cell Signaling, Boston, MA) at 1 :2000 dilution in 5% Blotting-Grade Blocker (Bio-Rad), 0.1% Tween 20 in 1 x DPBS for 2 hours on orbital shaker. Then the membrane was washed three times with 0.1% Tween 20 in 1 x DPBS 3 times, 5 minutes each. The signal was detected using SuperSignal West Dura Chemiluminescent Substrate (Pierce, Thermo Scientific) and the signal was captured using ChemiDoc MP imaging system (Bio-Rad). For phosphorylated proteins, primary antibody targeting to specific phosphorylated site was first probed, then the membrane was striped with Restore Western Blot Stripping Buffer (Thermo Scientific) for 10-15 minutes at room temperature. The effect of stripping was verified by confirming no residual signal using ChemiDoc MP with SuperSignal West Dura Chemiluminescent Substrate for 15 - 30 minutes. Then the same membrane was probed with primary antibody targeting the total protein to visualize the amount of total protein. The densitometry of the protein signal was calculated using software Image J. The primary antibodies: anti-EGFR (D38B1), anti-phospho-EGFR (Y1068) (D7A5), anti-Akt (11E7), anti-phospho-Akt (S437) (D9E), anti-p44 / 42 MAPK (Erkl / 2) (137F5), anti-phospho-p44 / 42 MAPK (Erkl / 2) (197G2), anti-MEKl / 2 (47E6), anti- phospho-MEKl / 2 (Ser217 / 221) (41G9), anti-Ras (D2C1), anti-Ras G12D mutant specific (D8H7), anti-cMyc, anti-p70 S6 Kinase (49D7), anti-phospho-p-p70 S6 kinase (T421 / S424)(9204S), anti-P-actin (D6A8) antibodies were from Cell Signaling. Anti-phospho-EGFR (Y1125) antibody was from WuXi AppTec (San Diego, CA). Anti-GAPDH (EPR6256) antibody was from Abeam (Cambridge, UK).Cell survival assay

[0139] To measure the cell survival after KRAS knockdown or KRAS inhibitor treatment, Cell Proliferation Kit II (XTT) from Roche was used following the manufacture protocol. Briefly, after transfection of KRAS knockdown plasmid, cells were plated in on clear 96-well plate at density of 4000 - 5000 cells per well in 50 pL growth medium. Then the desired amount of KRAS inhibitor in 50 pL growth medium was added. After incubation in 37°C, 5% CO2 incubator for 2-7 days, the XTT labeling reagent and the electron coupling reagent were thawed and mixed at ratio of 5 mL to 0.1 mL right before the experiment. Then, 50 pL XTT labeling mixture per well was added to the 96-well plate and incubate at 37°C, 5% CO2 for 2 or 4 hours. The absorbance at 450 nm was read using a BioTek Epoch plate reader. The reference wavelength was set to 660 nm. Each treatment condition was loaded on 96-well plate at least in quadruplicate.RFLP assay

[0140] Total cell RNA was isolated using the Trizol-Phenol-Chloroform extraction method. 1-3 pg of total RNA was reverse transcribed with a random primer mix (New England Biolabs) and a ThermoFisher SimpiAmp thermocycler. 4 pL of cDNA was amplified by polymerase chain reaction (PCR) using primer set KRAS 014 (ACTGAATATAAACTTGTGGTCG4TGGAGCT (SEQ ID NO: 13)) and KRAS 001 (CTTGCTTCCTGTAGGAATCCTCT (SEQ ID NO: 14)). The PCR amplicon is 127 bp. The KRAS 014 primer introduces a B st XI site.

[0141] 4-10 pL of the PCR product was then digested by Bst XI (NEB, R0113S or Thermo Fisher, ER1021). Bst XI recognizes KRAS WT sequence and cuts the PCR amplicon into 99 bp and 28 bp fragments. Bst XI does not recognize Kras sequences mutated at the G12 position, and therefore does not cut these amplicons.

[0142] Both digested (Bst XI) and undigested PCR products were electrophoresed on a 4% agarose gel to score WT transcripts and mutant transcripts. Intensity of digested PCR amplicons was measured using ImageJ software.RNA extraction

[0143] Total cell RNA was isolated using the Trizol-Phenol-Chloroform extraction method. First, cells were harvested from cell culture flasks using trypsin (Corning, 25-053-CI), centrifuged at 430 ref x 10 minutes. The supernatant was removed, and cells were frozen at -80°C.

[0144] To extract RNA, TRI reagent (Zymo research, R22050-1-50) was added to the cell pellet. Cell pellets were triturated to break up cells. Once fully dissolved, an equal volume of 0.3M sodium acetate (Sigma-Aldrich, S7899-100ML) was added to the solution and mixed. Then, / i of the total volume in Phenol was added to the solution and vigorously mixed (Sigma- Aldrich, P4682-100ML). / i the total volume in chloroform was then added to the solution and again vigorously mixed. The solution was then centrifuged at 11,000 g x 10 minutes in a microcentrifuge (Labnet). The aqueous layer (top layer) was removed and transferred to a new tube. An equal volume chloroform was added to the new tube and vigorously mixed. Another centrifugation was done at 11,000 g x 3 minutes, and again the aqueous phase was removed and transferred to a new tube. Two and a half volumes of ethanol was then added to the tube and mixed. The solution was stored at -20°C. Before use in RFLP, the RNA solution was spun at 16,300 g x 10 min in a microcentrifuge. All ethanol was removed, and the RNA pellet was resuspended in 30 pL nuclease free water. RNA was quantified using Nanodrop (Thermo Scientific). 1 pg RNA was then mixed 1 :1 with RNA loading dye (NEB, B0363A), incubated at 65C for 5 min, and electrophoresed on a 1% gel to evaluate RNA integrity.

Claims

WHAT IS CLAIMED IS:

1. A method for treating a cancer in a subject in need thereof, the method comprising administering to the subject: a bifunctional short hairpin (shRNA) molecule capable of inhibiting the expression of at least one mutated KRAS gene, wherein the bifunctional shRNA molecule encodes a nucleic acid sequence capable of hybridizing to one or more regions of an mRNA transcript encoding the mutated KRAS gene to inhibit the expression of the mutated KRAS gene via RNA interference, wherein the bifunctional shRNA comprises a first stem-loop structure that comprises an siRNA component and a second stem-loop structure that comprises a miRNA component.

2. The method of claim 1, further comprising administering to the subject at least one KRAS inhibitor.

3. The method of claim 1 or 2, wherein the mutated KRAS gene encodes a KRAS protein having a G12C mutation, a G12D mutation, a G12V mutation, or a G12R mutation.

4. The method of any one of claims 1 to 3, wherein the DNA sequence of the mRNA transcript encoding the mutated KRAS gene comprises a sequence having at least 90% identity to the sequence of any one of SEQ ID NOS: 10-12.

5. The method of any one of claims 1 to 4, the bifunctional shRNA molecule inhibits the expression of three mutated KRAS genes encoding three KRAS proteins comprising a G12C mutation, a G12D mutation, and a G12V mutation.

6. The method of any one of claims 1 to 5, wherein the bifunctional shRNA sequence comprises a sequence having at least 90% identity to any one of SEQ ID NOS:3-5.

7. The method of any one of claims 1 to 6, wherein the siRNA component functions in a cleavage-dependent manner and the miRNA component functions in a cleavage-independent manner.

8. The method of any one of claims 1 to 7, wherein the bifunctional shRNA sequence is operably linked to a promoter.

9. The method of claim 8, wherein the promoter is a CMV mammalian promoter.

10. The method of any one of claims 1 to 9, wherein the bifunctional shRNA molecule is in a Doggybone DNA® (dbDNA®) vector.

11. The method of any one of claims 1 to 10, wherein the bifunctional shRNA molecule is provided in a liposome or lipid nanoparticle.

12. The method of any one of claims 2 to 11, wherein the KRAS inhibitor is selected from the group consisting of sotorasib, ortipifamib, adagrasib, D-1553, BI1701963, GDC6036, JNJ74699157, ARS-3248, X-Chem KRAS, BBP-454, LY3537982, BI1823911, AS KRAS G12C, SF KRAS G12C, RMC032, JAB-21822, AST-KRAS G12C, AZ KRAS G12C, NYU- 12 VC 1, and RMC6291.

13. The method of claim 12, wherein the KRAS inhibitor is sotorasib or adagrasib.

14. The method of any one of claims 2 to 13, wherein the mutated KRAS gene encodes a KRAS protein having a G12C mutation and the KRAS inhibitor is sotorasib.

15. The method of any one of claims 2 to 14, wherein the bifunctional shRNA molecule is administered before, simultaneous, or after the KRAS inhibitor.

16. The method of any one of claims 1 to 14, wherein the cancer is selected from the group consisting of lung cancer, colorectal cancer, uterine cancer, appendiceal cancer, small-bowel cancer, esophageal cancer, hepatobiliary cancer, bladder cancer, ovarian cancer and a solid tumor.

17. The method of any one of claims 1 to 16, wherein the cancer comprises a mutated KRAS gene.

18. The method of any one of claims 1 to 17, wherein the cancer has become resistant to treatment with a KRAS inhibitor.

19. The method of claim 18, wherein the cancer has become resistant to treatment with a KRAS inhibitor after earlier treatment with the KRAS inhibitor.

20. The method of any one of claims 2 to 19, wherein administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least at about the same level compared to the reduction from administering the KRAS inhibitor alone.

21. The method of claim 20, wherein administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least 2-fold more than the reduction from administering the KRAS inhibitor alone.

22. The method of any one of claims 2 to 19, wherein administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least at about the same level compared to the reduction from administering the bifunctional shRNA molecule alone.

23. The method of claim 22, wherein administering the bifunctional shRNA molecule and the KRAS inhibitor in combination reduces cancer cell growth and / or survival at least 2-fold more than the reduction from administering the bifunctional shRNA molecule alone.

24. The method of any one of claims 20 to 23, wherein the cancer cell is resistant to the KRAS inhibitor.

Images