Multi-OMIC analysis using beyond-poisson droplet loading

Abstract

This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, by creating nucleic acid libraries using beyond-Poisson loading of droplets with beads.

Description

MULTI-OMIC ANALYSIS USING BEYOND-POISSON DROPLET LOADINGTECHNICAL FIELD

[0001] This disclosure relates to methods and systems for multi-omic profding of single cells.BACKGROUND

[0002] Multi-omics generally refers to combining a number of different omic (e.g., genomic, transcriptomic, and proteomic) data to investigate or identify mechanisms of biological processes, including diseases affecting humans. Thus, at its core, multi-omic analysis requires data from a diverse set of biological molecules. In many multi-omic investigations, having data from these diverse sets of molecules from single samples (e.g., cells) at a single time is critical to inform and correlate the intertwined signals of a biological system. For example, such diverse single-cell data would enable a better understanding of cellular heterogeneity, e.g., in the context of intratumoral heterogeneity to better characterize or profile a tumor and devise or provide the most effective therapies. Though it is sometimes possible to overcome a lack of analyzed biomolecules from a single source, this often requires more data to infer trends and averages, which necessitates a corresponding increase in resources spent on collect and processing data and biological samples.

[0003] Single-cells often represent the best source from which to obtain the various biological molecules, such as nucleic acids and proteins, assessed in multi-omic analysis. As multi-omic is driven by molecularly complex data sets, a major bottleneck is often simply obtaining barcoded or labeled data from different molecular species, e.g., DNA, RNA, and proteins, which can be correlated with a particular cell, group of cells or biological samples. Consequently, assays designed to obtain, isolate, identify, and / or detect a number of different biomolecules concurrently form single cells represent an important advancement in advancing multi-omic analysis. For example, assessing the transcriptome, genome, and proteome of diseased versus healthy cells allows a potential path to discover and assess viable targets for alleviating a pathogenic condition.

[0004] Similarly, multi-omic biological assays can be used as tools in wider forms of biological or medical development. For example, a multi-omic assay could be used to assess the activity of a library of cells expressing antibodies against a particular pathogen, while concurrently allowing for identification of the antibody sequences and / or any nucleic acid encoding such an antibody.SUMMARY

[0005] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, by creating nucleic acid libraries using beyond-Poisson loading of droplets with particles, as described herein. The systems, methods, and compositions provide the ability to quickly characterize and quantify, for example, the transcriptome and / or proteome of single cells. This rapidity is due, in part, to the robust scale of throughput at which the methods, systems, and compositions of the disclosure are able to detect and correlate different types of biomolecules with individual cells and between groups of cells and / or samples.

[0006] Consequently, the present disclosure provides methods and systems that may be used, for example, to investigate or identify mechanisms of biological processes, including diseases affecting humans by analyzing a diverse set of biological molecules with extremely high throughput. The derived data may be used to elucidate intertwined signals of a biological system.

[0007] Moreover, the systems and compositions herein are flexible, allowing for a wide variety of assays resulting in unique combinations of correlated data types. For example, the compositions and systems of the invention may be leveraged to allow encapsulation of single cells with a plurality of barcoded beads, performance of single-step RT-PCR, or PCR to amplify specific regions of a genome.

[0008] As such, the multi-omic biological assays of the disclosure can be used as tools in wider forms of biological or medical development. For example, methods and systems of the disclosure may be used to assess the activity of a library of cells expressing antibodies against a particular pathogen, while concurrently allowing for identification of the antibody sequences and / or any nucleic acid encoding such an antibody.

[0009] In certain exemplary embodiments, single cells and / or the contents of single cells are encapsulated in a fluidic droplet with a plurality of beads and / or particles. In preferred aspects, single cells from a sample are encapsulated with a plurality of differently labeled beads and / or particles. In certain aspects, cells or their contents are captured within an aggregate matrix. The aggregate matrix may be encapsulated within a fluidic droplet. In certain aspects, particles may form part of the aggregate matrix.

[0010] Methods of the invention include capturing cells and / or other biomolecules (e.g., nucleic acids and proteins released from cells) in an aggregate network. Exemplary methods include those in which single cells and / or the contents of single cells are captured in an aggregate network andthose in which multiple cells are captured in such an aggregate network. In certain preferred aspects, the aggregate network is a particle aggregate network.

[0011] The network may include capture molecules and / or molecular labels integrated throughout the network. In certain aspects, the network is an aggregate particle network that includes functionalized particles. Particles may be functionalized, for example, with barcodes, labels, nucleic acid capture moieties, protein capture moieties, a portion that serves as a binding moiety, and / or combinations thereof. Upon capture, the single cells are isolated in a network, where the cell may be lysed to release various biomolecules of interest. The released biomolecules are then available for capture and / or labeling. In certain aspects, the aggregate matrix, in which single cells are captured, are encapsulated within a fluid droplet with a plurality of beads.

[0012] Nucleic acids from the aggregate matrix, such as nucleic acids from the cell, cDNA of RNA from the cell, and / or from a nucleic acid barcode label, are attached to nucleic acid labeled capture sequences or primers. In certain aspects, the capture sequences or primers are integrated into the matrix, e.g., using functionalized particles. In certain aspects, the capture sequences or primers are attached to the encapsulated beads. In certain aspects, the capture sequences are not attached to the particles but in solution. These sequences would then be crosslinked during the aggregate formation step After an amplification step, the amplicons are sequenced and the barcodes deconvoluted to provide a multi-omic profile for a single cell.

[0013] Advantageously, by using a plurality of beads and / or the methods disclosed herein to provide controlled loading of barcoded beads in droplets, the methods of the present disclosure are able to overcome a major bottleneck associated with existing single-cell, droplet based analysis methods. Namely, most such droplet-based techniques rely on Poisson loading of particles (e.g., cells or beads) and droplets. These techniques are not only long and complex, but require intricate setup of microfluidics to control bead loading and droplet formation. This is generally accomplished by diluting suspensions of the starting materials, including the particles to be encapsulated, and encapsulating the particles into the drops at random. The resulting Poisson statistics for prior methods of droplet encapsulation tend to cause a large number of empty drops with a much smaller number having a single particle. In such methods, due to the distribution of Poisson statistics and methods for tracking loaded droplets, the usual goal is that usable droplets contain only a single particle. This is generally essential to account for these prior techniques’ methods used to trace a sequence read back to a single cell. However, assuring data is collectedonly from 1 -bead-droplets requires high dilutions, stringent isolation techniques, and an overall increase in effort and cost. The issue compounds when techniques rely on isolating a single cell and a single bead in accordance with this Poisson loading strategy.

[0014] The present methods also provide advantages over prior methods using Poisson loading, in which both cells and beads are encapsulated. Such methods have proven extremely inefficient due the low capture efficiency inherent in Poisson loading. Under Poisson loading, the number of droplets encapsulating both single cells and a bead is very low. As these droplets are the only droplets of use in such an assay, throughput is necessarily restricted.

[0015] In contrast, the presently disclosed methods avoid the problems inherent in methods that rely on traditional Poisson loading. Instead, by using the combination of an aggregate matrix, multiple labels, and beyond-Poisson bead / particle loading, the methods overcome the underlying limitations of prior methods. This approach provides a massively parallel analytical workflow that is scalable to ascertain multi-omic analysis of large numbers and libraries of single cells.

[0016] In certain aspects, the disclosure provides methods for cellular analysis of single cells. An exemplary method of the disclosure comprises encapsulating within an aggregate network, single cells, and functionalized particles. In certain aspects, the functionalized particles are part of or grafted within the aggregate network.

[0017] In preferred aspects, the particles comprise one or more of a protein capture binder, a capture oligonucleotide, an orthogonal moiety (e.g., such as that which can attach other molecules, binders, capture oligonucleotides and the like via an attachment or linker means such as click chemistry), and combinations thereof. In certain aspects, each of the plurality of particles is of nanometer size or micrometer size. In certain aspects, the particles are, or include, magnetic particles. In certain aspects, the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.

[0018] In certain aspects, the method further includes lysing the cells encapsulated within the aggregate network to release one or more target intracellular proteins and / or one or more target nucleic acids. The target molecules (nucleic acids and / or proteins) are captured, e.g., proteins via a protein capture binders and oligonucleotides to capture the target nucleic acids.

[0019] In certain aspects, the method further includes binding the captured intracellular protein or its capture binder to a binder comprising a barcoded nucleic acid. In some methods, the method may include providing the barcoded binder after cell lysis and / or after breaking the emulsion.

[0020] In certain aspects, the method further includes encapsulating the aggregate matrices that had captured single cells in fluidic droplets with a plurality of beads. Alternatively, the single cell may be captured in the aggregate network with a plurality of beads before lysing.

[0021] The beads may comprise barcode labeled capture oligonucleotides and / or primers. Each different bead of the plurality may include a different barcode sequence. The oligonucleotides and / or primers of the beads may capture released nucleic acids, cDNA, and / or barcode labels from the aggregate network. The captured sequences are amplified, e.g., using a polymerase chain reaction. In certain methods of the disclosure, the captured sequences are amplified while attached to the beads. The beads are released from the droplets and the amplified sequences undergo sequencing to identify one or more protein and / or nucleic acid from a single cell.

[0022] In certain aspects, encapsulating the single cells within the aggregate comprises merging a fluidic stream comprising single cells with a fluidic stream comprising particles to produce a merged stream, and flowing said merged stream into a flow of immiscible fluid, thereby a droplet encapsulating a single cell and the particles. In certain embodiments, encapsulating the single cells within the particles comprises a membrane-based emulsification. In certain aspects, the particles are coupled to form the aggregate network.

[0023] Coupling may be accomplished, for example, by at least one technique selected from: exposure to ultraviolet light, exposure to heat, induction via nucleic acid / nucleic acid interactions (annealing of complimentary ssDNA strands), protein / nucleic acid crosslinkers, protein / protein crosslinkers, antibody / antigen interactions, enzymatic reactions (e.g., ligation), de novo binders, mini binders, pH change, addition of a cross-linking initiator to the droplets (either before or after formation of the droplets), collagen based binding, and / or an initiator that coats the particles. In certain aspects, the reagents to achieve coupling, e.g., a cross-linking initiator, are provided after droplet formation, e.g., via diffusion of crosslinkers inside droplets, micelle merging with droplets, and other known methods. Such reagents may be provided by, for example, by diffusion of crosslinkers inside droplets, micelle merging with droplets, and other known techniques.

[0024] Particles within the plurality of particles may display an antigen to facilitate coupling with particles displaying an antigen binder. An antigen may alternatively or also be released by a cellupon lysis. For example, the antigen may be a highly expressed protein, such as actin. An antiactin binder may be displayed on the particles for coupling. Advantageously, particles will then aggregate only in the presence of a cell expressing actin, making subsequent steps easier, including re-encapsulation and barcoding of aggregates allowing for increased scale of analysis.

[0025] Coupling as described throughout the invention may be accomplished via click-chemistry mediated coupling. Any click chemistry reaction may be used to mediate coupling. For example, azide-alkyne cycloaddition or alkyne-nitrone cycloaddition. Aspects of the invention may provide a bead coated with an alkyne moiety together with beads coated with azide moiety. Beads may comprise both azide and alkyne moiety. When combined, alkyne and azide coated beads may undergo azide-alkyne cycloaddition thereby forming aggregates. Non-aggregated beads may be washed from the sample, leaving click-chemistry mediated bead aggregates. The click chemistry may comprise dibenzocyclooctyne group (DBCO) coated beads, utilizing DBCO-azide mediated click chemistry.

[0026] In some methods, the single cells are encapsulated with barcoded binders. In some methods the barcoded binders are provided after capturing by the protein binders.

[0027] In certain aspects, the barcoded binders include a plurality of different barcoded binders that each target a different intracellular protein or extracellular protein domain and comprise a different target-identifying barcode. In certain aspects, such binders are attached to particles that form the aggregate matrix. In some aspects, the capture oligonucleotides comprise a plurality of different capture oligonucleotides. Different capture oligonucleotides may be used to capture different barcoded binders.

[0028] In certain methods, the one or more target nucleic acid is a DNA. In certain methods, the one or more target nucleic acid is an RNA. In certain aspects, the RNA is mRNA. In some methods, prior to performing the amplification reaction, the method further comprises performing a reverse transcription reaction of the captured RNA to produce a target cDNA. The method may further comprise amplifying the target cDNA to produce bead-bound amplification products.

[0029] In certain aspects, the barcoded binders comprise a universal sequence and / or the capture oligonucleotides comprise a universal capture sequence. In certain aspects, barcodes may comprise in addition or alternatively, one or more unique molecular identified (UMI).

[0030] An exemplary method for multi-omic analysis of single cell according to the present disclosure comprises: encapsulating single cells with a plurality of beads and one or more proteincapture binder within a particle aggregate network in which the capture binders are grafted to functionalized particles and / or beads, wherein each functionalized particle comprises one or more different barcoded oligonucleotides. The method further includes lysing said encapsulated single cells within said particle aggregate matrix to release one or more target intracellular protein and one or more target nucleic acid. In certain embodiments, the method further includes capturing the target intracellular proteins with the protein capture binders and capturing the one or more target nucleic acids with the barcoded oligonucleotides; binding the captured intracellular protein to a binder comprising a barcoded nucleic acid; encapsulating each aggregate matrix in a fluidic droplet; and amplifying the nucleic acid barcodes of the barcoded binders and the captured target nucleic acids to produce amplification products.

[0031] In some aspects, the method further comprises, releasing the particles / beads from the fluidic droplets, and sequencing bead-bound amplification products to identify the one or more target intracellular protein and nucleic acid from a single cell.

[0032] In certain aspects, encapsulating the single cells within the particles comprises merging fluidic streams, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fluidic streams, including via concurrent and / or sequential mergers. In an exemplary embodiment, a fluidic stream comprising single cells with a fluidic stream comprising particles and said capture oligonucleotides to produce a merged stream, and flowing said merged stream into a flow of immiscible fluid, thereby forming an aggregate particle encapsulating a single cell. In certain embodiments, encapsulating the single cells within the aggregate matrix comprises a membrane-based emulsification.

[0033] In some methods, the single cells are encapsulated with the barcoded binder. In some methods the barcoded binder is provided after capturing by the protein binder.

[0034] In certain aspects, the barcoded binders include a plurality of different barcoded binders that each target a different intercellular protein and comprise a different target-identifying barcode. In some aspects, the capture oligonucleotides comprise a plurality of different capture oligonucleotides. Different capture oligonucleotides may be used to capture different barcoded binders.

[0035] In certain methods, the one or more target nucleic acid is a DNA. In certain methods, the one or more target nucleic acid is an RNA. In certain aspects, the RNA is mRNA. In some methods, prior to performing the amplification reaction, the method further comprises performing a reversetranscription reaction of the captured RNA to produce a target cDNA. The method may further comprise amplifying the target cDNA to produce bead-bound amplification products.

[0036] In certain aspects, the barcoded binders comprise a universal sequence and / or the capture oligonucleotides comprise a universal capture sequence.

[0037] The present disclosure also provides compositions that include: a plurality of fluidic droplets, each droplet comprising: an aggregate network of a single lysed cell captured in the network; and a plurality of different beads, each different bead comprising different barcoded oligonucleotide capture sequences. In some aspects, the intracellular proteins captured in said network are bound to protein capture binders. In compositions of the disclosure, the intercellular proteins are further bound to barcoded binders.

[0038] In some aspects, oligonucleotide capture sequences capture the barcodes of the barcoded binders bound to the intracellular proteins. The protein capture binders may include a barcode. In some aspects, the intracellular proteins are captured in the network via protein capture binders grafted in the network to particles that form the network. In some aspects, the capture binders are not grafted to the network. In some aspects, the aggregate further includes nucleic acids of the single lysed cells. Such nucleic acids may be captured on oligonucleotide capture sequences. In certain aspects, such oligonucleotide capture sequences are attached to the different beads.

[0039] The present disclosure also provides a composition comprising: a plurality of fluidic droplets, each droplet comprising: nucleic acids of a single lysed cell captured in an aggregate network; and a plurality of different beads, each different bead comprising a different barcoded primer.

[0040] In certain methods, the released nucleic acid is RNA. Thus, methods can also include reverse transcribing the released RNA captured by the capture oligonucleotides to produce a cDNA library. The released RNA can include, for example, one or more of mRNA, microRNA, ncRNA, tRNA, snRNA, and vault RNA. In certain methods, the RNA is mRNA.

[0041] In certain methods, the single cells captured in aggregate networks are obtained from a biological sample. Such methods may further include assessing a pathology in the subject using proteomic and transcriptomic information obtained using methods of the disclosure. The methods may also include quantifying amounts of individual nucleic acids and proteins in a cell subject to a particular disease state or therapeutic regime.BRIEF DESCRIPTION OF DRAWINGS

[0042] FIG. 1 diagrams an exemplary method for encapsulating a single cell in an exemplary aggregate particle.

[0043] FIG. 2 illustrates capture of released nucleic acids and proteins from a single captured cell lysed in the aggregate network using capture oligonucleotides and capture protein binders.

[0044] FIG. 3 illustrates an exemplary method for encapsulating an aggregate network with a single cell, or its contents after lysis, and a plurality of barcoded beads.

[0045] FIG. 4 illustrates the capture of nucleic acids from the cell and protein binder barcodes from captured proteins via barcoded sequences on the barcoded beads. The captured sequences and barcodes are then amplified.

[0046] FIG. 5 illustrates a portion of an exemplary method of the disclosure in which the beadbound amplicons are released from the droplet for subsequent sequencing and analysis.

[0047] FIG. 6 shows a schematic showing the formation of an aggregate matrix in a droplet with a single cell from a sample and lysing of the cell to released biomolecules (e.g., nucleic acids and proteins), which are captured by functionalized particles in the resulting aggregate matrix.

[0048] FIG. 7 shows a schematic showing the formation bead aggregation of the invention.

[0049] FIG. 8 show bright field and fluorescent images of bead aggregation of the invention.

[0050] FIG. 9 shows a schematic of poly dT functionalization of beads of the invention.

[0051] FIG. 10A-B show bright field and fluorescent images of functionalized beads of the invention.

[0052] FIG. 11 shows a schematic of functionalized bead aggregation of the invention.

[0053] FIG. 12A-C shows images of droplets encapsulating functionalized beads.

[0054] FIG. 13-A-B show graphs of relative quantification from aggregates of the invention.

[0055] FIG. 14A shows a schematic of bead / cell encapsulation with a microfluidic chip.

[0056] FIG. 14B shows an image of bead / cell encapsulation with a microfluidic chip.

[0057] FIG. 15A-B shows images of droplets encapsulating functionalized beads.DETAILED DESCRIPTION

[0058] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using aggregate networks to capture the cells. The systems,methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells. a. Beyond-Poisson loadins and particle aggregation

[0059] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, by creating nucleic acid libraries using beyond-Poisson loading of droplets with particles, as described herein. The systems, methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells.

[0060] Methods of the disclosure include capturing single cells in an aggregate network. In certain preferred aspects, methods of the disclosure include encapsulation of a single cell with a plurality of barcoded beads, which allows, for example, single-step RT-PCR, or PCR to amplify specific regions of a genome. The network may include capture molecules and / or molecular labels integrated throughout the network. Upon capture, the single cells are in the network, where the cell may be lysed to release various biomolecules of interest. The released biomolecules are then available for capture and / or labeling. In certain aspects, the aggregate networks, in which single cells are captured, are encapsulated within a fluid droplet with a plurality of beads.

[0061] FIG. 1 diagrams a portion of an exemplary method for analyzing single cells from a sample according to the disclosure. The method includes capturing a single cell 103 in an aggregate matrix 113. In certain preferred aspects, the aggregate matrix is a particle aggregate matrix. In some methods, this can include flowing a first fluid 105, e.g., an aqueous fluid containing cells, with a miscible fluid 109, e g., an aqueous mixture, that comprises matrix precursors and / or particles used to form the aggregate matrix, capture binders and / or capture oligonucleotides 107 (which may in some embodiments be attached to functionalized particles), barcodes, reagents, and other components as described herein. The fluids are combined, and optionally sheared with a second immiscible fluid, e.g., an oil, which facilitates generation of the aggregate matrix 113 that capture single cells during their formation. In certain aspects, components, such as the capture binders, captured oligonucleotides, and / or labels (107) are grafted into the matrix and / or are attached to functionalized particles of the matrix.

[0062] The matrix 113 may include a porous matrix in which a single cell is captured 103. In certain aspects, the matrix is made using particles. In certain aspects, the particles are nano tomicron sized particles, e.g., magnetic and non-magnetic beads known in the art. In certain aspects, the particles can have different composition (e.g., capture reagents such as primers, protein binders, gene specific primers, fluorophores for optical barcoding and screening etc.). In certain aspects, the particles are one or more of a protein(s), a cell(s), a bead(s), a hydrogel, a polymer, an antibody, a biparatopic antibody, a binder, de novo binders, a collagen like peptide and / or precursors thereof. In certain aspects, the hydrogel matrix further comprises a plurality of beads.

[0063] In some methods of the disclosure, the particles are cross linked or otherwise attached to form the aggregate matrix used to capture single cells and / or other biomolecules as described herein. In certain aspects, the particles are crosslinked into an aggregate via a stimulus. A stimulus may be, for example, and depending on the particles used, electromagnetic radiation (e.g., UV light exposure), heat, a protein-protein or protein-DNA crosslinker (e.g., g formaldehyde, bis sulfosuccinimidyl suberate), biomolecular interactions (e.g., nucleic acid hybridization / ligation and protein-protein interaction / binding, such as biotin-streptavidin interaction, or protein-antibody reactions), sugar mediated collagen polymerization, addition of binders or de novo binders, a change in pH, and polymer crosslinkers (e.g., ethylene glycol, methacrylic acid, and methyl methacrylate). In certain aspects, one or more of the stimulus is provided in a fluid stream during droplet formation.

[0064] In certain aspects, after aggregation, particles can be barcoded (RE Beyond Poisson multi- omics). In certain methods, the aggregate can be separated to perform specific assays on certain bead composition (e.g., mass spectrometry, on-bead sequencing, gene specific sequencing [TCR, BCR etc.], etc.).

[0065] In certain aspects, the aggregate matrix 113 is made, either wholly or in part, from a crosslinked, porous structure throughout some or all of the cross-linked matrix. In preferred aspects, the cross-linked, porous structure is or comprises a hydrogel. The cross-linked aggregate matrix forms a mesh of cross-linked polymers and / or particles that defines the porous structure. In certain aspects, the porous structure may provide interconnected voids that permeate the aggregate matrix. In certain aspects, the aggregate matrix also includes one or more loaded reagents. The reagents may be disposed on the outer surface of the aggregate and / or within the porous structure. In certain aspects, fluid and / or analytes in the aggregate, in a droplet with an aggregate, and / or during aggregate formation, may access the reagents loaded within the interior of an aggregate.

[0066] Capturing individual cells in the matrix may be accomplished using a variety of processes known in the art. In preferred aspects, methods may include combining an aqueous fluid 105 containing the cells 103 to be analyzed with an aqueous fluid 109 comprising one or more aggregate network precursors, e.g., particles as described herein, that crosslink and form an aggregate matrix. In an exemplary method, aggregates containing single cells can be manufactured by preparing, for example, a hydrogel in an aqueous phase fluid that contains cells 119. The aqueous phase fluid 119 with the hydrogel is co-flowed with a fluid 111 immiscible to the aqueous phase, such as an oil, through a droplet generation device. In certain aspects, the aggregate matrix 113 forms upon application of a particular stimulus to the hydrogel precursor. Such stimuli may include, thermal changes, photo-exposure, chemical exposure (e.g., a crosslinking initiator), or the like. In some aspects, particles, cells, and optionally required precursors and reagents are mixed in an aqueous phase to produce droplets.

[0067] In certain aspects, the particles comprise a polymer, such as a hydrogel. In certain embodiments, the hydrogel is selected from naturally derived materials, synthetically derived materials and combinations thereof. Examples of hydrogels include, but are not limited to, collagen, hyaluronan, chitosan, fibrin, gelatin, alginate, agarose, chondroitin sulfate, polyacrylamide, polyethylene glycol (PEG), polyvinyl alcohol (PVA), acrylamide / bisacrylamide copolymer matrix, polyacrylamide / poly(acrylic acid) (PAA), hydroxyethyl methacrylate (HEMA), poly N- isopropylacrylamide (NIP AM), and polyanhydrides, polypropylene fumarate) (PPF).

[0068] In certain aspects, the aggregate 113 and / or particles that compose the aggregate 113 are allowed to solidify by triggering a gelation mechanism, including, but not limited to, the polymerization or crosslinking of a gel matrix. For instance, polyacrylamide gels are formed by copolymerization of acrylamide and bis-acrylamide. The reaction is a vinyl addition polymerization initiated by a free radical -generating system.

[0069] The composition and nature of the aggregate 113 may vary. For instance, in certain aspects, the aggregate may be formed using microgel particles that are micron-scale spheres of gel matrix. In some embodiments, the microgels are composed of a hydrophilic polymer that is soluble in water, including alginate or agarose. In other embodiments, the microgels are composed of a lipophilic microgel.

[0070] In some embodiments, the aggregate has an average volume, and a method as described herein includes shrinking the aggregate to decrease the average volume. The shrinking may occur upon the application of an external stimulus, e.g., heat. For instance, the aggregate may be encapsulated in a fluid by shearing, followed by the application of heat, causing the aggregate to shrink in size. The aggregate 113 may be loaded / grafted with at least one reagent and / or sample, which may include one or more of a single cell 103 and / or released biomolecules from the single cell, genes, drug molecules, therapeutic agents, particles, bioactive agents, osteogenic agents, osteoconductive agents, anti-inflammatory agents, growth factors, fibroin derived polypeptide particles, nucleic acid synthesis reagents, nucleic acid amplification reagents, reverse transcription reagents, nucleic acid detection reagents, DNA molecules, RNA molecules, genomic DNA molecules, and combinations of the same. The aggregate may be loaded with reagents that can be triggered to release a desired compound, e.g., a substrate for an enzymatic reaction. For instance, the aggregate may be triggered to rupture or dissolve upon the application of a stimulus, e.g., heat.

[0071] As shown in FIG. 1, aggregates may be generated under microfluidic control or, for example, using membrane emulsification. The aggregate generation process may be accomplished by pumping two or more immiscible fluids, such as oil and water containing cells and aggregate precursors (particles), into a junction or through a membrane. Thejunction / membrane shape, fluid properties (viscosity, interfacial tension, etc.), and flow rates influence the properties of the aggregates generated. However, for a relatively wide range of properties, aggregates of controlled, uniform size can be generated using methods like junctions, flow focusing, and membrane emulsification. To vary aggregate size, the flow rates of the immiscible liquids may be varied since, for junction and flow focus methodologies over a certain range of properties, hydrogel particle size depends on total flow rate and the ratio of the two fluid flow rates. To generate an aggregate with microfluidic methods, the two fluids are normally loaded into two inlet reservoirs (e.g., syringes, pressure tubes) and then pressurized as needed to generate the desired flow rates (e.g., using syringe pumps, pressure regulators, gravity, etc.). This pumps the fluids through the device at the desired flow rates, thus generating droplet of the desired size and rate.

[0072] In some embodiments, aggregates may be generated using parallel droplet generation techniques, including, but not limited to, serial splitting, distribution plates, and step emulsification.

[0073] In some embodiments, the aggregates and any captured single cells may be removed from the fluid, dried, and stored in a stable form for a period of time. Examples of drying approaches include, but are not limited to, heating, drying under vacuum, freeze drying, and supercritical drying. In some embodiments, the dried aggregates may be combined with a fluid, but still retain the shape and structure as independent, often spherical, gel aggregates. In some embodiments, the dried aggregates are combined with an appropriate fluid, causing a portion of the fluid to be absorbed by the aggregates. In some embodiments, the porosity of the aggregates may vary, to allow at least one of a plurality of protein capture binders and / or barcoded binders 107 to be absorbed into the aggregates when combined with the appropriate fluid. Any convenient fluid that allows for the desired absorption to be performed in the aggregates may be used.

[0074] In certain aspects, a surfactant may be used to stabilize the aggregates. Accordingly, producing an aggregate may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion. Any convenient surfactant that allows for the desired reactions to be performed in the aggregates may be used.

[0075] In some embodiments of the aggregates a variation in diameter or largest dimension of the aggregates such that at least 50% or more, e.g., 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the aggregates vary in diameter or largest dimension by less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4, less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of 1.05, or less than a factor of 1.01.

[0076] Aggregates encapsulated cells or cell populations may provide certain advantages, such as being storable and more portable than droplet based partitioned cells. Furthermore, in some cases, it may be desirable to allow cells to be analyzed to incubate for a select period of time, in order to characterize changes in such cells over time, either in the presence or absence of different stimuli. In such cases, capture of individual cells in an aggregate matrix may allow for longer incubation than in emulsion droplets alone, although in some cases, droplet encapsulated cellular biomolecules may also be incubated for different periods of time, e.g., at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, or at least 10 hours or more. In some embodiments, aggregatematrices with captured cells or their released contents may be readily deposited into droplets with a plurality of barcoded beads.

[0077] As shown in FIG. 2, in certain methods the captured single cells 103 are lysed within their aggregate networks 113 to release biomolecules, e.g., target nucleic acids 205 and proteins 203.

[0078] In certain aspects, lysis may be induced by a stimulus, such as, for example, lytic reagents, detergents, or enzymes that are loaded into the aggregates and released. Lysing can additionally or alternatively involve heating the aggregates to a temperature sufficient to release lytic reagents contained inside the aggregates.

[0079] In accordance with certain aspects, single cells may be captured in an aggregate matrix with lysis reagents in order to release the contents of the cells within the aggregate. In such cases, the lysis agents may be contacted with the cell suspension concurrently with, or immediately prior to the introduction of the cells into a fluid used in production of the aggregate matrix as described herein. Examples of lysis agents include bioactive reagents, such as lysis enzymes that are used for lysis of different cell types as required. In some embodiments, surfactant based lysis solutions are used to lyse cells. In some cases, lysis solutions may include non-ionic surfactants such as, for example, TritonX-100 and Tween 20. In some cases, lysis solutions may include ionic surfactants such as, for example, sarcosyl and sodium dodecyl sulfate (SDS).

[0080] In addition to the lysis agents co-partitioned with the cells described above, other reagents may also be co-partitioned with the cells, including, for example, DNase and RNase inactivating agents or inhibitors, such as proteinase K, chelating agents, such as EDTA, and other reagents employed in removing or otherwise reducing negative activity or impact of different cell lysate components on subsequent processing of nucleic acids or proteins.

[0081] In preferred embodiments, the aggregates comprise capture moieties such as capture oligonucleotides and capture protein binders 107. Capture oligonucleotides 107 may be used to capture nucleic acids 205 released from a cell, e.g., genomic DNA and mRNA. Nucleic acids that bind to capture oligonucleotides may be subsequently amplified and / or reverse transcribed to form cDNA. In certain aspects, the aggregates comprise protein capture binders, which capture proteins of a single cell, which may include one or more proteins released upon cellular lysis. Protein capture binders may comprise a protein capture moiety, such as antibody, aptamer, or de novo binder to bind and capture a protein from a single cell in the aggregate.

[0082] An exemplary capture oligonucleotide and / or protein capture binder may include a linker region to allow covalent bond with the aggregate and / or a particle of the aggregate. In certain aspects, a capture oligonucleotide / binder comprises a primer region, which may be a universal primer region, a primer nucleotide sequence, one or more barcode regions, which may include an index sequence, and / or a unique molecular identifier (UMI), a random capture sequence, a poly-T capture sequence, and / or a target-specific capture sequence. In certain aspects, capture oligonucleotides comprise a barcode. In certain aspects, protein capture binders do not contain barcodes, i.e., universal or generic protein capture binders.

[0083] As shown in FIG. 2, in preferred aspects, a barcoded protein binder 209 is added to the aggregate during or after aggregate formation and / or cell lysis. The barcoded protein binder may bind captured proteins or a portion of the captured barcodes with a captured protein.

[0084] The term barcode region may comprise any number of barcodes, index or index sequence, UMIs, which are unique, i.e., distinguishable from other barcode, or index, UMI sequences. The sequences may be of any suitable length which is sufficient to distinguish the barcode, or index, sequence from other barcode sequences. A barcode, or index, sequence may have a length of 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides, or more. In some embodiments, the barcodes, or indices, are pre-defined.

[0085] UMIs are advantageous in that they can be used to correct for errors created during amplification, such as amplification bias or incorrect base pairing during amplification. For example, when using UMIs, because every nucleic acid molecule in a sample together with its UMI or UMIs is unique or nearly unique, after amplification and sequencing, molecules with identical sequences may be considered to refer to the same starting nucleic acid molecule, thereby reducing amplification bias and / or allowing correlation of a sequence read to a particular sample, e.g., a single cell. Methods for error correction using UMIs are described in Karlsson et al., 2016, Counting Molecules in cell-free DNA and single cells RNA”, Karolinska Institutet, Stockholm Sweden, incorporated herein by reference.

[0086] Such UMIs, present in the barcodes herein, can allow for relative quantification of various expressions of proteins and nucleic acids of a single cell by permitting the grouping of proteins and nucleic acids from a singular source.

[0087] As shown in FIG. 3, after cell lysis, capture of target nucleic acids and proteins from the lysed cell, and labeling with the barcoded binders, the aggregate matrix is encapsulated in a droplet307 with a plurality of barcoded beads 313. Alternatively, the plurality of barcoded beads 313 are captured in the aggregate matrix 113 along with the single cell 103.

[0088] Droplets encapsulating the aggregate matrix and plurality of beads may include, for example, single-emulsion droplets, multiple- emulsion droplets, or Giant Unilamellar Vesicles (GUV)

[0089] In preferred aspects, the droplets generally range from about 0.1 to about 1000pm in diameter or largest dimension, and may have a variation in diameter or largest dimension of less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4, less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of 1.05, or less than a factor of 1.01, in diameter or the largest dimension. In some embodiments, droplets have a variation in diameter or largest dimension such that at least 50% or more, e.g., 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the droplets, vary in diameter or largest dimension by less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4, less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of 1.05, or less than a factor of 1.01. In some embodiments, droplets have a diameter of about 1.0 pm to 1000 pm, inclusive, such as about 1.0 pm to about 750 pm, about 1.0 pm to about 500 pm, about 1.0 pm to about 250 pm, about 1.0 pm to about 200 pm, about 1.0 pm to about 150 pm, about 1.0 pm to about 100 pm, about 1.0 pm to about 10 pm, or about 1.0 pm to about 5 pm, inclusive.

[0090] In practicing the methods as described herein, the composition and nature of the droplets, e.g., single-emulsion and multiple-emulsion droplets, may vary. For instance, in certain aspects, a surfactant may be used to stabilize the droplets.

[0091] Accordingly, a droplet may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion.

[0092] The droplets described herein may be prepared as emulsions, e.g., as an aqueous phase fluid dispersed in an immiscible phase carrier fluid (e.g., a fluorocarbon oil, silicone oil, or a hydrocarbon oil) or vice versa. In particular, multiple-emulsion droplets as described herein may be provided as double-emulsions, e.g., as an aqueous phase fluid in an immiscible phase fluid, dispersed in an aqueous phase carrier fluid; quadruple emulsions, e.g., an aqueous phase fluid in an immiscible phase fluid, in an aqueous phase fluid, in an immiscible phase fluid, dispersed in anaqueous phase carrier fluid; and so on. Generating a single-emulsion droplet or a multipleemulsion droplet as described herein may be performed with or without microfluidic control, e.g., using membrane emulsification. In alternative embodiments, a single-emulsion may be prepared without the use of a microfluidic device, but then modified using a microfluidic device to provide a multiple emulsion, e.g., a double emulsion. Droplets may also be prepared, for example, by producing a first emulsion containing cells, a second emulsion containing particles, and then fusing the two emulsions one by one to generate a droplet containing a cell fused with a droplet containing particles. Droplet fusion may be accomplished through the use of a microfluidic module, for example a picoinjector.

[0093] Producing an emulsion using aggregate particles, such as hydrogel particles, can provide emulsions including droplets that are extremely uniform in size. The droplet generation process may be accomplished by combining a plurality of aggregates with captured single cells with a first fluid 305 to provide a first mixture, the mixture may be further combined with a miscible fluid 309 that contains the barcoded beads 313. The miscible fluids may be combined to form the first mixture, which is then combined or sheared with a second, immiscible fluid 311, e.g., an oil. Shear with the first mixture and second fluid produces droplets 307 that each contain aggregated matrix 113 that is encapsulated with a plurality of labeled beads 113 and the first mixture fluid, surrounded by the second fluid. To vary droplet size, the shearing rate and aggregate matrix sizes may be varied. In certain aspects, the aggregates are liquefied using an external stimulus (e.g., heat or an acid / base change) to generate a liquid emulsion.

[0094] The percentage of droplets, e.g., single-emulsion droplets or multiple-emulsion droplets, with one, and not more than one, capture aggregate matrix and a plurality of beads may be about 70% or more; about 75% or more; about 80% or more; about 85% or more; about 90% or more; or about 95% or more. For example, the percentage of droplets with one, and not more than one, capture aggregate matrix and a plurality of beads may be from about 70% to about 100%, e.g., from about 75% to about 100%, from about 80% to about 100%, from about 85% to about 100%, from about 90% to about 100%, or from about 95% to about 100%. As a further example, the percentage of droplets with one, and not more than one, aggregate matrix and plurality of beads may be from about 70% to about 95%, e.g., from about 75% to about 90%, or from about 80% to about 85%. The percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be about 70% or more; about 75% or; about 80% or more; about85% or more; or about 90% or more. For example, the percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be from about 70% to about 100%, e.g., from about 75% to about 100%, from about 80% to about 100%, from about 85% to about 100%, from about 90% to about 100%, or from about 95% to about 100%. As a further example, the percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be from about 70% to about 95%, e.g., from about 75% to about 90%, or from about 80% to about 85%.

[0095] In certain aspects, the percentage of droplets, e.g., single-emulsion droplets or multipleemulsion droplets, with one, and not more than one, capture aggregate matrix and a plurality of beads may be at or near a Poisson distribution. In such aspects, single cells are captured in an aggregate network (which may include a plurality of beads as described herein and / or beads added during encapsulation) and the aggregates encapsulated into droplets using Poisson loading.

[0096] Double emulsions may also be generated with or without the use of microfluidic devices using methods known in the art. A double emulsion includes droplets contained within droplets, e.g., an aqueous phase fluid surrounded by an immiscible phase shell in an aqueous phase carrier fluid (e.g., water-in oil-in water) or an immiscible phase fluid surrounded by an aqueous phase shell in an immiscible phase carrier fluid (e.g., oil-in water-in oil). The second mixture described herein, which includes single- emulsion droplets in the second fluid, is combined with a third fluid to produce a third mixture, wherein the third fluid is immiscible with at least the second fluid. The third mixture is then sheared to encapsulate the particles and beads in double- emulsion droplets in the third fluid. The third fluid may be immiscible with both the first and second fluids.

[0097] A particularly useful kind of double emulsion includes an aqueous droplet encapsulated within a slightly larger oil droplet, itself dispersed in a carrier aqueous phase. Double emulsions are valuable because the inner “core” of the structure can be used to provide active compounds, like dissolved solutes or biological materials, where they are shielded from the external environment by the surrounding oil shell. A benefit of generating double emulsions using hydrogel particles is similar to that for the generation of single emulsions, in that the double emulsion dimensions (inner and outer droplet sizes) can be controlled over a wide range and the droplets can be formed with a high degree of uniformity. As discussed herein, in suitable embodiments the aggregate matrices can be dissolved and / or melted within the droplets. Accordingly, in someembodiments multiple emulsions, e.g., double emulsions, may be prepared from droplets which no longer contain an intact aggregate matrix yet retain their original size.

[0098] Encapsulation in droplets of particles, cells, aggregate matrices, their precursors and / or reagents, e.g., nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents), barcode labels, and the like can be achieved via a number of methods, including microfluidic and non-microfluidic methods. In the context of microfluidic methods, there are a number of techniques that can be applied, including glass microcapillary emulsification or emulsification using sequential droplet generation in wettability patterned devices.

[0099] Microcapillary techniques form droplets by generating coaxial jets of the immiscible phases that are induced to break into droplets via coaxial flow focusing through a nozzle. Sequential drop formation in spatially patterned droplet generation junctions can be achieved in devices fabricated lithographically.

[0100] In some aspects the present disclosure provides methods for generating an emulsion which encapsulates an aggregate matrix containing a single cell, a plurality of beads, and / or reagents, e.g., nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents) without the use of a microfluidic device.

[0101] In some embodiments described herein, the first fluid is an aqueous phase fluid; the second fluid is a fluid which is immiscible with the first fluid, such as a non-aqueous phase, e g., a fluorocarbon, silicone oil, oil, or a hydrocarbon oil, or a combination thereof; and the third fluid may be an aqueous phase fluid. Alternatively, in some embodiments the first fluid is a non-aqueous phase, e.g., a fluorocarbon oil, silicone oil, or a hydrocarbon oil, or a combination thereof; the second fluid is a fluid which is immiscible with the first fluid, e.g., an aqueous phase fluid; and the third fluid is a fluorocarbon oil, silicone oil, or a hydrocarbon oil or a combination thereof.

[0102] The non-aqueous phase may serve as a carrier fluid forming a continuous phase that is immiscible with water, or the non-aqueous phase may be a dispersed phase. The non- aqueous phase may be referred to as an oil phase including at least one oil, but may include any liquid (or liquefiable) compound or mixture of liquid compounds that is immiscible with water. The oil may be synthetic or naturally occurring. The oil may or may not include carbon and / or silicon, and may or may not include hydrogen and / or fluorine. The oil may be lipophilic or lipophobic. In otherwords, the oil may be generally miscible or immiscible with organic solvents. Exemplary oils may include at least one silicone oil, mineral oil, fluorocarbon oil, vegetable oil, or a combination thereof, among others.

[0103] In exemplary embodiments, the oil is a fluorinated oil, such as a fluorocarbon oil, which may be a perfluorinated organic solvent.

[0104] In certain aspects, the first fluid includes a plurality of aggregate matrices with captured single cells and / or biomolecules.

[0105] In certain aspects, a surfactant may be included in the first fluid, second fluid, and / or third fluid. Accordingly, a droplet may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion, where the surfactant is soluble in the first fluid, second fluid, and / or third fluid. Any convenient surfactant that allows for the desired reactions to be performed in the droplets may be used, including, but not limited to, octylphenol ethoxylate (Triton X-100), polyethylene glycol (PEG), C26H50010 (Tween 20) and / or octylphenoxypolyethoxyethanol (IGEPAL). In other aspects, a droplet is not stabilized by surfactants.

[0106] The surfactant used depends on a number of factors such as the oil and aqueous phases (or other suitable immiscible phases, e.g., any suitable hydrophobic and hydrophilic phases) used for the emulsions. For example, when using aqueous droplets in a fluorocarbon oil, the surfactant may have a hydrophilic block (PEG-PPO) and a hydrophobic fluorinated block (Krytox® FSH). If, however, the oil was switched to a hydrocarbon oil, for example, the surfactant may instead be chosen such that it had a hydrophobic hydrocarbon block, like the surfactant AB IL EM90.

[0107] Other surfactants can also be envisioned, including ionic surfactants. Other additives can also be included in the oil to stabilize the droplets, including polymers that increase droplet stability at temperatures above 35°C.

[0108] Exemplary surfactants which may be utilized to provide thermostable emulsions are the “biocompatible” surfactants that include PEG-PFPE (polyethyleneglycol- perflouropolyether) block copolymers, e.g., PEG-Krytox®, surfactants that include ionic Krytox® in the oil phase and Jeffamine® (polyetheramine) in the aqueous phase. Additional and / or alternative surfactants may be used provided they form stable interfaces. Many suitable surfactants will thus be block copolymer surfactants (like PEG-Krytox®) that have a high molecular weight. These examples include fluorinated molecules and solvents, but it is likely that non-fluorinated molecules can beutilized as well. The presently disclosed methods are not limited to a particular surfactant. A variety of surfactants are contemplated including, but not limited to, nonionic and ionic surfactants (e.g., TRITON X-100; TWEEN 20; and TYLOXAPOL) or combinations thereof.

[0109] To generate emulsion, the disclosed methods include a step of shearing the second mixture provided by combining the first mixture with a third fluid immiscible with the first fluid. Any suitable method or technique may be utilized to apply a sufficient shear force to the second mixture. For example, the second mixture may be sheared by flowing the second mixture through a pipette tip. Other methods include, but are not limited to, shaking the second mixture with a homogenizer (e.g., vortexer), or shaking the second mixture with large mixing beads, e.g., sapphire beads. The application of a sufficient shear force breaks the second mixture into droplets that encapsulate one of a plurality of hydrogel particles along with a plurality of barcoded beads, as described herein.

[0110] Generally, if the shear is increased, the average droplet size generated will be lower than that of the size of the particles. However, since the particles are in solid form, the droplets containing them will not be any smaller in size, thereby generating an emulsion. If the shear rate is substantially higher than the modulus of the hydrogel particle, then the shear can squeeze liquid out of the particles.[0U1] As shown in FIG. 4, Each bead 307 contains barcoded capture sequences or primers 415, with a barcode that contains at least a bead-specific sequence. Captured nucleic acids from the single cell and the barcodes of the barcoded protein binders are captured by the barcoded sequences of the beads.

[0112] In certain aspects, the aqueous mixture inside the droplets from the first fluid also includes additional components, e.g., buffers and reagents. In some methods, the capture sequences on the plurality of beads bind to captured nucleic acids, cDNA, and / or the barcodes of captured proteins.

[0113] Nucleic acid molecules or protein binder barcodes hybridized to capture oligonucleotides or captured proteins may be released from the aggregate for binding to barcoded beads, for example by dissolving the aggregate or by using a reducing reagent to reduce oligonucleotide modifications or linkages in a capture oligonucleotide / peptide binder linker region.

[0114] In an exemplary method, the released biological components include one or more mRNA. The released mRNA is captured by a capture oligonucleotide of the aggregate matrix, reverse transcribed and, along with the barcode labels of the captured protein barcode binders, amplifiedand analyzed by, for example, using nucleic acid sequencing to identify one or more target sequences and / or target proteins from a single cell. In aspects of the invention, capture oligonucleotides are not attached to particles and are free within droplets. The capture oligonucleotides are then crosslinked into the aggregate matrix, for example during particle aggregation and formation of the aggregate matrix.

[0115] In certain aspects, in order to sequence and quantify mRNA, reverse transcription is carried out to generate a library including cDNA with a barcode sequence that allows each library sequence to be traced back to the single aggregate matrix and thus cell from which the mRNA was derived. In certain methods, the plurality of beads encapsulated with mRNA released from a captured cell include a plurality of barcoded capture sequences that hybridize with target mRNA. After hybridization, cDNA is synthesized by reverse transcription. Reagents for reverse transcription can be provided in a variety of ways in a variety of formats. In some instances, reagents and reverse transcriptase are provided by the aggregate matrices. Once a library is generated comprising barcoded cDNA, the cDNA can be amplified, by for example, PCR, to generate amplicons for sequencing.

[0116] As shown in FIG. 5, the nucleic acids captured by the barcoded beads are subject to an amplification reaction to produce barcoded amplicons and released from the droplets. In certain aspects, the barcoded capture sequences include a PCR handle that functions as a primer site used for subsequent PCR amplification. Accordingly, the inclusion of PCR-handle-specific primers during amplification of the barcoded cDNA library will result in amplification of both mRNA- derived cDNA and barcodes of the protein binders for subsequent sequencing. In certain aspects, inclusion of a poly A tag in the protein binder barcode allows for the use of poly T barcoded capture sequences on the barcoded beads to hybridize both the protein binder barcodes and mRNA from the lysed cell for gene expression profiling. In certain aspects, the inclusion of such a poly A tag permits capture by antibody derived tags (ADT) for use in cellular indexing of transcriptomes and epitopes by sequencing (CITE-Seq, Stoeckius, et al., 2017, Simultaneous epitope and transcriptome measurement in single cells, Nature Methods, 14:865-868). Primer domains for subsequent PCR amplification can then be introduced as part of the capture sequence barcode of the aggregate and / or beads. Sequence reads are processed according to methods described herein to accomplish the quantification and identification of nucleic acids and protein expression, allowing for example, epitope discovery and screening.

[0117] Aspects of the invention provide methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using capture particles that aggregate together. The systems, methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells.

[0118] As shown in FIG. 6, the aggregate matrices described herein may be formed by aggregating one or more type of particle / precursor. In the exemplary method of FIG. 6, a plurality of functionalized particles are encapsulated within a droplet with single cells. Such functionalized particles may include, for example, nano to micron sized particles, including magnetic and nonmagnetic beads, proteins, cells, hydrogel, polymer, collagen like peptides, antibodies, binders (as described herein) and the like.

[0119] The particles may include one or more of a protein capture binder, a capture oligonucleotide, an orthogonal moiety (e.g., such as that which can attach other molecules via an attachment or linker means such as click chemistry), and combinations thereof. In certain aspects, the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, antibody or a combination thereof. The matrix 113 may include a porous matrix in which a single cell is captured 103. In certain aspects, the matrix is made using particles. In certain aspects, the particles are nano to micron sized particles, e.g., magnetic and non -magnetic beads known in the art. In certain aspects, the particles can have different composition (e.g., capture reagents such as primers, protein binders, gene specific primers, fluorophores for optical barcoding and screening etc ). In certain aspects, the particles are one or more of a protein(s), a cell(s), a bead(s), a hydrogel, a polymer, a collagen like peptide and / or precursors thereof. In certain aspects, the hydrogel matrix further comprises a plurality of beads.

[0120] In some methods of the disclosure, the particles are cross linked or otherwise attached to form the aggregate matrix used to capture single cells and / or other biomolecules as described herein. In certain aspects, the particles are crosslinked into an aggregate via a stimulus. A stimulus may be, for example, and depending on the particles used, electromagnetic radiation (e.g., UV light exposure), heat, a protein-DNA crosslinker (e.g., g formaldehyde, bis sulfosuccinimidyl suberate), biomolecular interactions (e.g., nucleic acid hybridization / ligation and protein-protein interaction / binding, such as biotin-streptavidin interaction, antibody / antigen interactions, including superantigen, do novo binders and mini binders), sugar mediated collagenpolymerization, a change in pH, and polymer crosslinkers (e.g., ethylene glycol, methacrylic acid, and methyl methacrylate). In certain aspects, one or more of the stimulus is provided in a fluid stream during droplet formation.

[0121] Collagen and / or collagen-like peptides can mediate aggregate formation, for example through sugar mediated collagen polymerization. Where pH is used to mediate aggregate formation, a pH responsive microgel particle coated with a vinyl functional group may be used that cross-links with pH change. Method that may be used for pH mediated cross-linking are described in U.S. Patent No. 10,695,465, the entirety of the contents of which are incorporated by reference herein. An initiator may be added or coated to a particle to provide a crosslinked polymer network with differing properties, for example ethylene glycol, methacrylic acid, or methylmethacrylate may be added to alter the properties of aggregate formation.

[0122] The cross linker may be provided by particles or added to particles. For example, the crosslinking agent may be added in the oil phase of droplet formation or diffused into droplets.

[0123] In some aspects, related to cross-linking in methods and compositions of the disclosure, collapsed or slightly swollen vinyl is functionalized on the microgel particles. Cross-linking monomers are added to the particles and an initiator / accelerator mediates the addition of monomers to the surface of particles. Once particles are saturated with a chosen cross-linking agent, particle swelling followed by a stimulus (e.g., heat, light, or UV) are used to initiate and mediate crosslinking. Particles may be double cross-linked resulting in an interpenetrating network and particle peripheries.

[0124] As shown in FIG. 6, in step 3, a stimulus causes aggregation of the particles in the droplet to form the aggregate matrix, which includes biomolecules from the lysed cells. In some aspects of the invention, the particles aggregate only when a cell is present in the droplet. Particles within the plurality of particles may display an antigen to facilitate coupling with particles displaying an antigen binder. For example, as described, an antigen may be released by a cell upon lysis. For example, the antigen may be a highly expressed protein, such as actin. An anti-actin binder may be displayed on the particles for coupling. Advantageously, particles will then aggregate only in the presence of a cell expressing actin, making subsequent steps easier, including re-encapsulation and barcoding of aggregates allowing for increased scale of analysis.

[0125] In certain aspects, the method further includes lysing the cells encapsulated within the aggregate network to release one or more target intracellular protein and / or one or more targetnucleic acid, allowing, for example, a CITE-seq assay. The target molecules (nucleic acids and / or proteins) are captured, e.g., proteins via a protein capture binders and oligonucleotides to capture the target nucleic acids.

[0126] Aggregation of the invention methods increase scale, throughput, cell capture efficiency, allowing hydrogel barcoded beads to be used for intracellular protein capture. Aggregation methods greatly improve multi-omic analysis, include single-cell multi-omics and sample archiving.

[0127] In certain aspects, quantification and / or identification of mRNA, DNA, and / or proteins from a single cell may provide information that the cell from which the nucleic acids and proteins were released. For example, the methods of the disclosure may be used to show an increased expression of mRNA / protein(s) associated with cancer or decreased expression of mRNAZprotein(s) associated with cancer in response to a candidate compound. Since each nucleic acid molecule / protein may be tagged with a bead-specific barcode and thus single cell from which it was released, gene expression levels may be traced back to the droplet, hydrogel particle, and cell from which the nucleic acid / protein was released. This allows for determination of the cell type, cell line, epitope, expression profiles and response to drug candidate for the captured single cells. Because methods of the present disclosure allow any number of single cells to be captured in hydrogel particles and encapsulated in droplets, without the stringent requirements of Poisson loading, any number of cell types and cell lines may be screened against any number of candidate compounds simultaneously. By using barcodes and UMIs nucleic acids, proteins, and their expression levels can be traced back to each bead, droplet, hydrogel particle, and thus cell, allowing for minimal to no loss of information.

[0128] For RNA or mRNA sequencing, sequencing may first comprise the step of preparing a barcoded cDNA library from released RNA, through reverse transcription, and sequencing the cDNA. RNA sequencing may advantageously allow for the quantification of gene expression within the single cell, and can be used to identify characteristics of the single cell that can be used to, for example, make a diagnosis, prognosis, or determine drug effectiveness. Reverse transcription of cDNA molecules from RNA can be performed both within the droplet or after barcoded RNA molecules have been captured by the barcoded beads and released from each droplet.

[0129] Reverse transcription may be performed using without limitation dNTPs (mix of the nucleotides dATP, dCTP, dGTP and dTTP), buffer / s, detergent / s, or solvent / s, as required, and suitable enzyme such as polymerase or reverse transcriptase. The polymerase used may be a DNA polymerase, and may be selected from Taq DNA polymerase, Phusion polymerase (Thermo Fisher Scientific, Waltham, Massachussetts), or Q5 polymerase. Nucleic acid amplification reagents are commercially available, and may be purchased from, for example, New England Biolabs, Ipswich, MA, USA. The reverse transcriptase used in the presently disclosed targeted library preparation method may be for example, maxima reverse transcriptase. In some embodiments, the general parameters of the reverse transcription reaction comprise an incubation of about 15 minutes at 25 degrees and a subsequent incubation of about 90 minutes at 52 degrees.

[0130] Sequencing nucleic acid molecules may be performed by methods known in the art. For example, see, generally, Quail, et al ., 2012, A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers, BMC Genomics 13:341. Nucleic acid molecule sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, or preferably, next generation sequencing methods. For example, sequencing may be performed according to technologies described in U.S. Pub. 2011 / 0009278, U.S. Pub. 2007 / 0114362, U.S. Pub. 2006 / 0024681, U.S. Pub. 2006 / 0292611, U.S. Pat. 7,960,120, U.S. Pat. 7,835,871, U.S. Pat. 7,232,656, U.S. Pat. 7,598,035, U.S. Pat. 6,306,597, U.S. Pat. 6,210,891, U.S. Pat. 6,828,100, U.S. Pat. 6,833,246, and U.S. Pat. 6,911,345, each incorporated by reference.

[0131] The conventional pipeline for processing sequencing data includes generating FASTQ- format files that contain reads sequenced from a next generation sequencing platform, aligning these reads to an annotated reference genome, optionally deconvoluting barcodes in the case of single-cell RNA-seq, and quantifying expression of genes. These steps are routinely performed using known computer algorithms, which a person skilled in the art will recognize can be used for executing steps of the present invention. For example, see Kukurba, Cold Spring Harb Protoc, 2015 (11):951-969, incorporated by reference.

[0132] Bead-bound nucleic acid molecules may advantageously be amplified prior to sequencing, preferably within the droplets when bound to the beads. Amplification may comprise methods for creating copies of nucleic acids by using isothermal methods or thermal cycling to expose reactants to repeated cycles of heating and cooling, and to permit different temperature-dependent reactions(e g., by Polymerase chain reaction (PCR). Any suitable PCR method known in the art may be used in connection with the presently described methods. Non limiting examples of PCR reactions include real-time PCR, nested PCR, multiplex PCR, quantitative PCR or touchdown PCR. Notably, each amplified copy of the nucleic acid molecule will comprise the barcode unique to a bead for identifying the droplet and cell form which the nucleic acid molecule was released.

[0133] Primer sequences may comprise a binding site, for example a primer sequence that would be expected to hybridize to a complementary sequence, if present, on any nucleic acid molecule or protein barcode that is captured by a barcoded bead and provide an initiation site for a reaction, for example an elongation or polymerization reaction. The primer sequence may also be a “universal” primer sequence, i.e., a sequence that is complimentary to nucleotide sequences that are very common for a particular set of nucleic acid fragments. The primer sequences used may be P5 and P7 primers as provided by Illumina, Inc., San Diego, California. The primer sequence may also allow the capture probe to bind to a solid support, such as flow cell of a DNA sequencing machine.

[0134] A feature of certain methods as described herein is the use of a polymerase chain reaction (PCR)-based assay to detect the presence of certain nucleic acids or binder barcodes. Examples of PCR-based assays of interest include, but are not limited to, quantitative PCR (qPCR), quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), digital droplet PCR (ddPCR) single cell PCR, PCR-RFLP / real time-PCR-RFLP, hot start PCR, nested PCR, in situ polony PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR, emulsion PCR and reverse transcriptase PCR (RT-PCR). Other suitable amplification methods include the ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP -PCR), arbitrarily primed polymerase chain reaction (AP-PCR), degenerate oligonucleotide-primed PCR (DOP- PCR) and nucleic acid based sequence amplification (NABSA).

[0135] A PCR-based assay may be used to detect the presence of certain nucleic acids (e.g., genes, mRNA, viral-associated nucleic acids) and / or protein barcodes. In such assays, one or more primers specific to each sequence of interest are reacted with the nucleic acids captured by the plurality of barcoded beads in each droplet. These primers have sequences specific to a sequence of interest, so that they will only hybridize and initiate PCR when they are complementary to thesequence of the cell / barcode. If the sequence of interest is present and the primer is a match, many copies of the sequence are created. To determine whether a particular sequence is present, the PCR products may be detected through an assay probing the liquid of the droplet, such as by staining the solution with an intercalating dye, like SybrGreen or ethidium bromide, or detecting them through an intermolecular reaction, such as FRET. These dyes, beads, and the like are each example of a “detection component,” a term that is used broadly and generically herein to refer to any component that is used to detect the presence or absence of nucleic acid amplification products, e.g., PCR products.

[0136] The presence of certain nucleic acids / proteins in cells may be used to produce a bioarchive of cells, which may be used to determine and compare signatures of different cell types, cells under certain stimuli, and / or signatures indicative of certain pathologies.

[0137] In some aspects, the captured cells include cells obtained from, for example, a sample (tissue of bodily fluid) of a patient. The sample may include a fine needle aspirate, a biopsy, or a bodily fluid from the patient. Upon being isolated from the sample, the cells may be processed by, for example, generating a suspension with an appropriate solution. Such solution will generally be a balanced salt solution, e.g., normal saline, PBS, Hank’s balanced salt solution, etc., and in certain instances supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from 5-25 mM. Convenient buffers include HEPES, phosphate buffers, lactate buffers, etc. The separated cells can be collected in any appropriate medium that maintains the viability of the cells, usually having a cushion of serum at the bottom of the collection tube. Various media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Iscove’s medium, etc., frequently supplemented with fetal calf serum.

[0138] For proteomic analysis, captured proteins from single cells in aggregate matrices from samples can be incubated with a mixture comprising one or more index barcoded labeled antibody conjugates or aptamers as a barcoded binder. Antibody conjugates and processes for their use in multi-omic analysis along with mRNA gene expression profding can be found in descriptions of CITE-seq including Stoeckius, et al., 2017, Simultaneous epitope and transcriptome measurement in single cells, Nature Methods, 14:865-868. CITE-seq as used with the methods of the disclosure may include the use of barcoded antibody binding to cell surface protein. Cells are incubated with barcoded antibody and washed to remove unbound antibodies before encapsulation. In certainpreferred aspects, methods of the invention include performing both CITE-seq and protein capture (e g., via a protein capture binder in a droplet) from the same cells.

[0139] The protein binder barcode and / or bead barcode may include an index sequence that may comprise various sequence portions. For example, the index oligonucleotide sequence may include a PCR handle or universal primer site used for subsequent PCR amplification. The sequence may include a barcode that is specific to the captured protein / capture barcode to which it is linked and can be used to subsequently identify the captured protein by sequence analysis.

[0140] Additional components may include a UMI which can be used where multiple copies of a single type of barcoded binder or barcoded bead capture sequence are used in order to cluster sequencing reads and remove amplification or sequencing errors in quantifying protein expression. The barcode sequence may also include a capture portion that is complementary to the capture sequence on the barcoded beads for subsequent amplification and the potential addition of further adapter sequences. In preferred methods and systems, the capture portion comprises a poly A sequence to allow poly T capture probes to be used to hybridize both mRNA and antibody conjugates / aptamers for multi-omic analysis.

[0141] In certain aspects, aggregate particles may be washed with a wash buffer to remove any unbound binders that did not bind to a captured protein released from the cell. The aggregate matrices can then be encapsulated in droplets with a plurality of barcoded beads as described herein.

[0142] In certain methods, protein binder barcodes are captured by sequences on barcoded beads as described herein. In certain aspects, the aggregate may be incubated with the barcoded protein and barcoded beads alongside mRNA from the lysed cell. Emulsions can then be broken, the particles washed, and cDNA generated by reverse transcription. The cDNA can then be amplified which should generate the profile of captured cDNA while concurrently generating a significant population of sequences that contain barcode binder sequences.

[0143] In certain methods, additive primers are added to the cDNA PCR amplification to increase yield of the barcode binder sequences from the same cell. In certain aspects, barcode binder sequences are identified by qPCR as a control check for the cDNA amplification. The PCR products can then be purified and sequenced using known sequencing techniques (e.g., Illumina sequencing).

[0144] In certain methods and systems, specific capture oligonucleotides and / or capture protein binders are conjugated directly to the aggregate matrices in order to allow for selective nucleic acid and protein capture. In such cases, a library of specific labeled aggregate matrix particles can be used to capture single cells.

[0145] Other capture probes may also be included on particles forming the aggregate matrix depending on the desired application, including small molecule drugs to select for particular receptors, RNA derived aptamers, DNA sequences for specific hybridization of targeted DNA sequences, and / or antibodies or antigens.

[0146] In preferred embodiments, quantifying nucleic acids and protein binder barcodes comprises sequencing, which may be performed by methods known in the art. For example, see, generally, Quail, et al., 2012, A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers, BMC Genomics 13:341. Nucleic acid sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, or preferably, next generation sequencing methods. For example, sequencing may be performed according to technologies described in U.S. Pub. 2011 / 0009278, U.S. Pub. 2007 / 0114362, U.S. Pub. 2006 / 0024681, U.S. Pub. 2006 / 0292611, U.S. Pat. 7,960,120, U.S. Pat. 7,835,871, U.S. Pat. 7,232,656, U.S. Pat. 7,598,035, U.S. Pat. 6,306,597, U.S. Pat. 6,210,891, U.S. Pat. 6,828,100, U.S. Pat. 6,833,246, and U.S. Pat. 6,911,345, each incorporated by reference.

[0147] The conventional pipeline for processing sequencing data includes generating FASTQ- format fries that contain reads sequenced from a next generation sequencing platform, aligning these reads to an annotated reference genome, deconvoluting barcodes and quantifying expression of genes. These steps are routinely performed using known computer algorithms, which a person skilled in the art will recognize can be used for executing steps of the present invention. For example, see Kukurba, Cold Spring Harb Protoc, 2015 (11 ):951-969, incorporated by reference.

[0148] In certain aspects, the resulting sequence reads include barcodes from the capture oligonucleotides of the plurality of beads, which are used to ascertain whether a particular nucleic acid or protein was included in a particular droplet. Quantification and / or identification of these barcodes can provide the identity or state of a cell from which a particular nucleic acid or protein were captured in a particular aggregate matrix.

[0149] The presently disclosed methods for high-throughput, single cell, multi-omic analysis that enable detection and classification of cells, epitope discovery, and biomarker screening amongst cells in various states. The presently disclosed methods and systems provide the ability to analyze individual cells and link individual nucleic acid and protein markers, providing previously inaccessible insight into the diversity of cellular behavior in disease, and links in proteins and nucleic acid expression. b. Sample Preparation

[0150] Aspects of the invention allow for the improved analysis of nucleic acid molecules. Nucleic acid molecules may be acquired from a sample or a subject. Nucleic acid molecules include DNA and RNA. Methods of the invention are applicable to DNA from whole cells, portions of genetic or proteomic material obtained from one or more cells, artificial nucleic acid molecules, or viral DNA or RNA. Nucleic acid molecules may be extracted from a sample by any method. The nucleic acid molecule may include DNA, RNA, cDNA, PNA, ssDNA, LNA and others that are contained within a sample.

[0151] Biological samples for use in the present invention include viral particles or preparations. Nucleic acid molecules can be obtained directly from an organism or from a biological sample obtained from an organism, e.g., from blood, urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool and tissue. Any tissue or body fluid specimen may be used as a source for nucleic acid for use in the invention. Nucleic acid molecules can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which template nucleic acids are obtained can be infected with a virus or other intracellular pathogen. In addition, nucleic acids can be obtained from non-cellular or non-tissue samples, such as viral samples, or environmental samples.

[0152] In certain embodiments, the nucleic acid molecules are bound as to other target molecules such as proteins, enzymes, substrates, antibodies, binding agents, beads, small molecules, peptides, or any other molecule and serve as a surrogate for quantifying and / or detecting the target molecule. Nucleic acid molecules may be single-stranded, double-stranded, or double-stranded with singlestranded regions (for example, stem- and loop- structures). Proteins or portions of proteins (amino acid polymers) that can bind to high affinity binding moieties, such as antibodies or aptamers, are target molecules for oligonucleotide labeling, for example, in droplets.

[0153] In aspects of the invention, molecules may be compartmentalized. A compartment may be an aqueous droplet in a water-in-oil emulsion. Said droplets may be formed using microfluidic devices according to known techniques in the art. Other methods for generating droplets as described herein may be used as appropriate, including, but not limited to, high speed vortex, ultrasonic waves, extrusion, filtering, microsieve chips, or the like. Individual oligonucleotides may be loaded into separate droplets according to known methods in the art.

[0154] Nucleic acid templates can be obtained directly from an organism or from a biological sample obtained from an organism, e.g., from blood, urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool and tissue. In a particular embodiment, nucleic acid is obtained from fresh frozen plasma (FFP). In a particular embodiment, nucleic acid is obtained from formalin-fixed, paraffin-embedded (FFPE) tissues. Any tissue or body fluid specimen may be used as a source for nucleic acid for use in the invention. Nucleic acid templates can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which template nucleic acids are obtained can be infected with a virus or other intracellular pathogen. A sample can also be total RNA extracted from a biological specimen, a cDNA library, viral, or genomic DNA.A biological sample may be homogenized or fractionated in the presence of a detergent or surfactant. Cells within a sample may also be lysed by a lysing agent to release nucleic acid molecules and cell components. Lysis or homogenization solutions may further contain other agents, such as reducing agents or lytic enzymes. Examples of such reducing agents include dithiothreitol (DTT), beta-mercaptoethanol, DTE, GSH, cysteine, cysteamine, tricarboxyethyl phosphine (TCEP), or salts of sulfurous acid. Once obtained, the nucleic acid is denatured by any method known in the art to produce single stranded nucleic acid templates and a pair of first and second oligonucleotides is hybridized to the single stranded nucleic acid template such that the first and second oligonucleotides flank a target region on the template.EXPERIMENTAL EXAMPLES

[0155] Multi-omic analysis using capture particle aggregation was conduct. 1-cell / l-bead encapsulation is challenging due to Poisson’s distribution. In situ bead aggregation can mitigate the challenge.Bead formation and aggregation

[0156] FIG. 7 shows a schematic showing the formation bead aggregation of the invention. Single cell droplet formation with beads and cells frequently results in the formation of empty droplets, droplets with a cell but without beads, or droplets with a bead without a cell. As a consequence, cells from the sample remain uncounted. Over saturation with beads can solve the problem by ensuring that all droplets encapsulate at least one bead. However, this results in overcounting of cells that are encapsulated with multiple beads. Oversaturating with bead aggregation of the invention solves this problem by allowing all beads within a droplet to be counted as a “single bead.” As a result, each droplet with a cell also comprises just one “single bead” aggregate, allowing for efficient multi-omic analysis.

[0157] FIG. 8 show bright field and fluorescent images of bead aggregation of the invention. DBCO beads (magnetic beads coated with dibenzocycloctyne functional groups on their surface) and azide coated beads at a ratio of 1 : 10 were mixed in a phosphate-buffered saline (PBS) buffer and incubated overnight at room temperature. Multiple DBCO / azide aggregates (via alkyne-azide cycloaddition click-chemistry) were observed.

[0158] FIG. 9 shows a schematic of poly dT functionalization of DMCO beads. DBCO beads were partially functionalized with poly dT. Poly dT was labeled with TAMRA (red fluorescence) to show functionalization. DBCO beads and azide-poly dT-TAMRA were incubated overnight and excess azide were removed afterwards. The molar ratio of DBCO functional groups to azides was 1 : 0.07.

[0159] FIG. 10A-B show bright field and fluorescent images of functionalized beads of the invention.RNA quantification

[0160] FIG. 11 shows a schematic of functionalized bead aggregation of the invention. DBCO beads with or without oligo dT25 functionalization were mixed with azide beads and encapsulated into droplets right after mixing and incubated at room temperature 4 hours. Average droplet size was 65~70um. The molar ratios of DBCO functional groups to azides were 1 :0, 1:0.1, and 1 :0.5. Bead concentration was 5 DBCO beads / droplet and 25 azide beads / droplet.

[0161] FIG. 12A-C shows images of droplets encapsulating functionalized beads.

[0162] Droplets were broken and the bead aggregates in droplets were collected after incubation. Bulk RNA capture by bead-aggregates was conducted together with reverse transcriptase and qPCR detection.

[0163] The table below shows sample details for analysis.

[0164] FIG. 13-A-B show graphs of relative quantification from aggregates of the invention. 5 x 105Jurkat cells were lysed by the lysis / binding buffer from the NEB Magnetic mRNA Isolation Kit (NEB, S1550S). The pre-aggregated beads were mixed with the Jurkat cell lysate to capture cellular poly-A RNA in bulk. The captured RNA on bead aggregates were reverse transcribed by the SuperScript IV First-Strand Synthesis System (as sold by Invitrogen, 18091050). qPCR was conducted on different numbers of bead-aggregate particle by the PowerUp SYBR Green Master Mix (as sold by Applied Biosystems, A25742) on a QuantStudio Real-Time PCR instrument (as sold by Applied Biosystems). Human ACTB gene (ACT) were amplified using primer set GCCTTCATACATCTCAAGTTGGG (F) and GAATGATGAGCCTTCGTGCC (R). Human TRBC1 gene (TRBC) were amplified using primer set GGTCGCTGTGTTTGAGCCAT (F) and ACCAGTGTGGCCTTTTGGGTG (R).

[0165] Quantitative polymerase chain reaction (qPCR) showing relative quantifications of human ACTB sequence (ACT) and human TRBC1 sequence (TRBC) were plotted for Jurkat bulk poly- A RNA captured by bead aggregates produced using DBCO bead / azide poly dT oligos at ratio of 1 :0, 1 :0.1, or 1 :0.5, normalized to sample 2 on 200 bead-aggregate particles, n.s. indicates no specific qPCR signal. Mean values of two duplicates were calculated and plotted. DCBO bead / azide poly dT oligos at ratios of 1 :01 and 1 :0.5 produced robust quantification of ACT and TRBC RNA at all bead numbers used for qPCR.

[0166] FIG. 14A shows a schematic of bead / cell encapsulation with a microfluidic chip.

[0167] FIG. 14B shows an image of bead / cell encapsulation with a microfluidic chip. The oil phase comprised HFE7500 together with a surfactant. The cell suspension comprised Jurkat cellsin PBS sold under the trade name DULBECCO’S PHS (DPBS). A lysis buffer was used. Beads comprised oligo dT25 functionalized DBCO beads as described with azide beads. Droplets were collected and incubated for cell lysis, particle aggregation, and RNA capture.

[0168] Cells were lysed in 30 mins. Intracellular RNA was released and captured by the functionalized DBCO beads. DBCO beads and azide beads aggregate together through click chemistry. Afterwards, droplets in oil were broken by a droplet breaking reagent and beads were collected. Unbound azide beads were removed during the washing process.

[0169] FIG. 15A-B shows images of droplets encapsulating functionalized beads in droplets with cell lysates. Droplet diameter was approximately 45pm.

[0170] RT-qPCR on droplet captured cellular RNA by aggregates was conducted.

[0171] The table below shows sample details for analysis.

[0172] FIG. 13 -A-B show graphs of relative quantification from aggregates of the invention.

[0173] The captured RNA on bead aggregates were reverse transcribed by the SuperScript IV First-Strand Synthesis System (as sold by Invitrogen, 18091050). qPCR was conducted on different numbers of bead-aggregate particle by the PowerUp SYBR Green Master Mix (as sold by Applied Biosystems, A25742) on a QuantStudio Real-Time PCR instrument (as sold by Applied Biosystems). Human ACTB gene (ACT) were amplified using primer set GCCTTCATACATCTCAAGTTGGG (F) and GAATGATGAGCCTTCGTGCC (R). Human TRBC1 gene (TRBC) were amplified using primer set GGTCGCTGTGTTTGAGCCAT (F) and ACCAGTGTGGCCTTTTGGGTG (R).

[0174] Quantitative polymerase chain reaction (qPCR) showing relative quantifications of human ACTB sequence (ACT) and human TRBC1 sequence (TRBC) were plotted for Jurkat cells lysed and captured by bead aggregates formed in droplets and incubated overnight at room temperature (sample 1) or at 4 degree Celsius (sample 2). Results were normalized to sample 2 on 200 beadaggregate particles, n.s. indicates no specific qPCR signal. Mean values of two duplicates were calculated and plotted.

[0175] Bead aggregates of the invention were successful and capturing and quantifying RNA from single cells.INCORPORATION BY REFERENCE

[0176] References and citations to other documents, such as patents, patent applications, patent publications, journals, books, papers, web contents, have been made throughout this disclosure. All such documents are hereby incorporated herein by reference in their entirety for all purposes.EQUIVALENTS

[0177] Various modifications of the invention and many further embodiments thereof, in addition to those shown and described herein, will become apparent to those skilled in the art from the full contents of this document, including references to the scientific and patent literature cited herein. The subject matter herein contains important information, exemplification and guidance that can be adapted to the practice of this invention in its various embodiments and equivalents thereof.

Claims

CLAIMSWhat is claimed is:

1. A method for cellular analysis, the method comprising: encapsulating within a fluidic droplet proteins and nucleic acids from a single cell that are captured within a matrix, and a plurality of different beads that each comprise one or more attached barcoded primers, wherein each of the proteins comprises a binder comprising a barcoded nucleic acid; amplifying the nucleic acid barcodes of the captured barcoded binders and the captured nucleic acids with the barcoded primers to produce amplification products; releasing the beads from the fluid droplet; and sequencing the amplification products to identify the one or more target cellular protein and nucleic acid from a single cell.

2. The method of claim 1, wherein the matrix comprises a hydrogel network, polymer matrix, or particle aggregate.

3. The method of claim 1, wherein the matrix comprises a plurality of particles, each of the plurality of particles comprises at least a protein capture binder, a capture oligonucleotide, or a combination thereof, and the plurality of particles are couple to each other to form an aggregate that comprises the proteins and nucleic acids.

4. The method of claim 1, wherein an extracellular matrix (ECM) component is captured within the aggregate.

5. The method of claim 1, wherein encapsulating comprises a membrane-based emulsification, merging of fluidic streams, or vortexing.

6. The method of claim 1, wherein the barcoded binder is grafted into the matrix, or wherein the barcoded binder is provided after capturing by the protein capture binder.

7. The method of claim 1, wherein the barcoded binders comprise a plurality of different barcoded binders that each target a different intracellular protein and comprise a different targetidentifying barcode.

8. The method of claim 1, wherein the nucleic acids in the matrix are captured via capture oligonucleotides in the matrix, wherein the capture oligonucleotides comprise a plurality of different of different capture oligonucleotides.

9. The method of claim 8, wherein the different capture oligonucleotides capture different barcoded binders.

10. The method of claim 1, wherein the nucleic acids comprise DNA.

11. The method of claim 1, wherein the nucleic acids comprise RNA.

12. The method of claim 11, wherein the RNA comprises an mRNA.

13. The method of claim 11, wherein prior to performing the amplification reaction, the method further comprises performing a reverse transcription reaction of the captured RNA to produce a target cDNA.

14. The method of claim 13, wherein the method further comprises amplifying the target cDNA to produce bead-bound amplification products.

15. The method of claim 1, wherein the barcoded binders one or more of a universal binding site, barcode, universal priming site, and unique molecular identifier (UMI). .

16. The method of claim 8, wherein the capture oligonucleotides comprise one or more of a universal capture sequence, universal priming site, and unique molecular identifier (UMI).

17. The method of claim 1, wherein the amplifying step produces bead-bound amplification products that are sequenced in the sequencing step.

18. The method of claim 3, wherein coupling is accomplished by at least one technique selected from the group consisting of: exposure to ultraviolet light, exposure to heat, induction via protein / nucleic acid crosslinkers, pH change, antigen / antigen-binder mediated coupling,collagen-mediated coupling, addition of a cross-linking initiator to the droplets, click-chemistry mediated coupling, and / or an initiator that coats the particles.

19. A composition comprising: a plurality of fluidic droplets, each droplet comprising: a matrix comprising a captured single cell, captured proteins and / or nucleic acid of a single lysed cell and a plurality of beads, each different bead comprising different barcoded oligonucleotide capture sequence.

20. The composition of claim 19, wherein the matrix comprises a hydrogel network, polymer matrix, or particle aggregate.

21. The composition of claim 19 wherein the matrix comprises a plurality of plurality of particles, each of the plurality of particles comprises at least a protein capture binder, a capture oligonucleotide, or a combination thereof, and the plurality of particles are couple to each other to form an aggregate that comprises the proteins and nucleic acids.

22. The composition of claim 19, wherein the intracellular proteins captured in said matrix are bound to protein capture binders.

23. The composition of claim 19, wherein the intracellular proteins are further bound to barcoded binders.

24. The composition of claim 19, wherein oligonucleotide capture sequences capture the barcodes of the barcoded binders bound to the intracellular proteins.

24. The composition of claim 18, wherein the protein capture binders comprise one or more of a barcode, universal priming site, and unique molecular identifier (UMI).

Images