Multi-OMIC analysis using capture particle aggregation

Abstract

This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using capture captures that aggregate together.

Description

MULTI-OMIC ANALYSIS USING CAPTURE PARTICLE AGGREGATIONTECHNICAL FIELD

[0001] This disclosure relates to methods and systems for multi-omic profiling of single cells.BACKGROUND

[0002] Multi-omics generally refers to combining a number of different omic (e.g., genomic, transcriptomic, and proteomic) data to investigate or identify mechanisms of biological processes, including diseases affecting humans. Thus, at its core, niulti-omic analysis requires data from a diverse set of biological molecules. In many multi-omic investigations, having data from these diverse sets of molecules from single samples (e.g., cells) at a single time is critical to inform and correlate the intertwined signals of a biological system. For example, such diverse single-cell data would enable a better understanding of cellular heterogeneity, e.g., in the context of intratumoral heterogeneity to better characterize or profile a tumor and devise or provide the most effective therapies. Though it is sometimes possible to overcome a lack of analyzed biomolecules from a single source, this often requires more data to infer trends and averages, which necessitates a corresponding increase in resources spent on collect and processing data and biological samples.

[0003] Single-cells often represent the best source from which to obtain the various biological molecules, such as nucleic acids and proteins, assessed in multi-omics. As multi-omics is driven by molecularly complex data sets, a major bottleneck is often simply obtaining barcoded or labeled data from different molecular species, e.g., DNA. RNA, and proteins, which can be correlated with a particular cell, group of cells or biological samples. Consequently, assays designed to obtain, isolate, identify, and / or detect a number of different biomolecules concurrently from single cells represent an important advancement in multi-omic analysis. For example, assessing the transcriptome, genome, and proteome of diseased versus healthy cells allows a potential path to discover and assess viable targets for alleviating a pathogenic condition.

[0004] Similarly, multi-omic biological assays can be used as tools in wider forms of biological or medical development. For example, a multi-omic assay could be used to assess the activity ofa library of cells expressing antibodies against a particular pathogen, while concurrently allowing for identification of the antibody sequences and / or any nucleic acid encoding such an antibody.SUMMARY

[0005] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using capture particles that aggregate together. The systems, methods, and compositions provide the ability to quickly characterize and quantify, for example, the transcriptome and / or proteome of single cells. This rapidity is due, in part, to the robust scale of throughput at which the methods, systems, and compositions of the disclosure are able to detect and correlate different types of biomolecules with individual cells and between groups of cells and / or samples.

[0006] Consequently, the present disclosure provides methods and systems that may be used, for example, to investigate or identify mechanisms of biological processes, including diseases affecting humans by analyzing a diverse set of biological molecules with extremely high throughput. The derived data may be used to elucidate intertwined signals of a biological system.

[0007] Moreover, the systems and compositions herein are flexible, allowing for a wide variety of assays resulting in unique combinations of correlated data types. For example, the compositions and systems of the invention may be leveraged to allow encapsulation of single cells with a plurality of barcoded beads, performance of single-step RT-PCR, or PCR to amplify specific regions of a genome.

[0008] As such, the multi-omic biological assays of the disclosure can be used as tools in wider forms of biological or medical development. For example, methods and systems of the disclosure may be used to assess the activity of a library of cells expressing antibodies against a particular pathogen, while concurrently allowing for identification of the antibody sequences and / or any nucleic acid encoding such an antibody.

[0009] Aspects of the invention provide a method for capturing cellular content by forming a droplet comprising at least one cell and a plurality of particles. Cells are lysed within the droplet to release nucleic acid and proteins from the cell. The nucleic acids and / or proteins are captured on the plurality of particles. Advantageously, the plurality of particles to attach via bonding orcoupling to each other to form an aggregate that comprises the nucleic acids and proteins. The aggregate may then be released from the droplet.

[0010] Each of the plurality of particles may comprise at least a protein capture binder, a capture oligonucleotide, an orthogonal moiety, or a combination thereof. The capture hinders and the orthogonal moiety may be added to the particles by click chemistry.

[0011] Each of the plurality of particles may be of nanometer size or micrometer size. Each of the plurality of particles may be magnetic or non-magnetic. The plurality of particles may be of the same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.

[0012] Coupling may be accomplished, for example, by at least one technique selected from the group consisting of: exposure to ultraviolet light, exposure to heat, induction via protein / nucleic acid interactions (annealing of complimentary ssDNA strands), protein / nucleic acid crosslinkers, protein / protein crosslinkers, antibodies / antigen interactions, enzymatic reactions (e.g., ligation) de novo designed binders, mini binders. pH change, addition of a cross-linking initiator to the droplets (either before or after formation of the droplets), collagen based binding, and / or an initiator that coats the particles. Particles within the plurality of particles may display an antigen to facilitate coupling with particles displaying an antigen binder. The plurality of particles may comprise controllable self-annealing particles. In certain aspects, the reagents to achieve coupling, e.g., a cross-linking initiator, are provided after droplet formation, e.g. via diffusion of crosslinkers inside droplets, micelle merging with droplets, and other known methods. Such reagents may be provided by, for example, by diffusion of crosslinkers inside droplets, micelle merging with droplets, and other known techniques.

[0013] Droplets may further comprise a plurality of barcoded beads. Barcoded beads may also couple to the plurality of particles to form part of the aggregate and / or molecular barcodes may be added to the release aggregate.

[0014] One or more individual particles from the aggregate may be separated and a discrete assay performed on the proteins and / or nucleic acids captured on the one or more individual particles. For example, particles may be sorted. Particles may be separated by flow cytometry, for example fluorescence-activated cell sorting (FACS) to conduct a fluorescent assay.

[0015] Aspects of the invention further comprise methods for cellular analysis. Methods comprise encapsulating in a droplet a single cell with a plurality of particles, each particle of the plurality comprising a plurality of protein capture binders and / or capture oligonucleotides. Encapsulated single cells are lysed within said droplet to release one or more target intracellular protein and one or more target nucleic acid within said droplet. Within the droplets, target intracellular proteins are captured with the protein capture binders and target nucleic acids are captured with the capture oligonucleotide. The plurality of particles are bound and / or coupled to each other to form an aggregate within the droplet and the aggregate is released from the droplet.

[0016] The encapsulating step can be by any known method. For example, the encapsulation step may comprise merging a fluidic stream comprising single cells with a fluidic stream comprising particles to produce a merged stream. The merged stream is flowed into a flow of immiscible fluid, thereby forming a plurality of droplets, wherein at least one of the plurality of the droplets comprises the single cell and the plurality of particles. Alternatively, droplets may be formed without fluidic or microfluidic streaming, for example by vortexing or membrane emulsification. Particles may also be mixed in one single stream prior to encapsulation.

[0017] In preferred aspects, the particles comprise one or more of a protein caphire binder, a capture oligonucleotide, an orthogonal moiety (e.g., such as that which can attach other molecules, binders, caphire oligonucleotides and the like via an attachment or linker means such as click chemishy), and combinations thereof. In certain aspects, each of the plurality of particles is of nanometer size or micrometer size. In certain aspects, the particles are, or include, magnetic particles. In certain aspects, the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.

[0018] Each of the plurality of particles may be of nanometer size or micrometer size. Each of the plurality of particles may be magnetic or non-magnetic. The plurality of particles may be of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.

[0019] Binding and / or coupling may be accomplished by at least one technique selected from the group consisting of: exposure to ultraviolet light, exposure to heat, induction via protein / nucleic acid interactions (annealing of complimentary ssDNA strands), protein / nucleic acid crosslinkers,protein / protein crosslinkers, antibodies / antigen interactions, enzymatic reactions (e.g.. ligation) de novo designed binders, mini binders, pH change, addition of a cross-linking initiator to the droplets (either before or after formation of the droplets), collagen based binding, and / or an initiator that coats the particles.

[0020] Particles within the plurality of particles may display an antigen to facilitate coupling with particles displaying an antigen binder. An antigen may alternatively or also be released by a cell upon lysis. For example, the antigen may be a highly expressed protein, such as actin. An anti-actin binder may be displayed on the particles for coupling. Advantageously, particles will then aggregate only in the presence of a cell expressing actin, making subsequent steps easier, including re-encapsulation and barcoding of aggregates allowing for increased scale of analysis. The plurality of particles may comprise controllable self-annealing particles. In certain aspects, the reagents to achieve coupling, e.g., a cross-linking initiator, are provided after droplet formation. Such reagents may be provided by, for example, diffusion of crosslinkers inside droplets, micelle merging with droplets, and other known techniques.

[0021] Coupling as described throughout the invention may be accomplished via click-chemistry mediated coupling. Any click chemistry reaction may be used to mediate coupling. For example, azide-alkyne cycloaddition or alkyne-nitrone cycloaddition. Aspects of the invention may provide a bead coated with an alkyne moiety together with beads coated with azide moiety. Beads may comprise both azide and alkyne moiety. When combined, alkyne and azide coated beads may undergo azide-alkyne cycloaddition thereby forming aggregates. Non-aggregated beads may be washed from the sample, leaving click-chemistry mediated bead aggregates. The click chemistry may comprise dibenzocyclooctyne group (DBCO) coated beads, utilizing DBCO-azide mediated click chemistry.

[0022] Droplets may further comprise a plurality of barcoded beads. Barcoded beads may also couple to the plurality of particles to form part of the aggregate and / or molecular barcodes may be added to the release aggregate.

[0023] One or more individual particles from the aggregate may be separated and a discrete assay performed on the proteins and / or nucleic acids captured on the one or more individual particles. For example, particles may be sorted. Particles may be separated by flow cytometry, for example fluorescence-activated cell sorting (FACS) to conduct a fluorescent assay.BRIEF DESCRIPTION OF DRAWINGS

[0024] FIG. 1 diagrams an exemplary method for encapsulating a single cell in an exemplary aggregate particle.

[0025] FIG. 2 illustrates capture of released nucleic acids and proteins from a single captured cell lysed in the aggregate network using capture oligonucleotides and capture protein binders.

[0026] FIG. 3 illustrates an exemplary method for encapsulating an aggregate network with a single cell, or its contents after lysis, and a plurality of barcoded beads.

[0027] FIG. 4 illustrates the capture of nucleic acids from the cell and protein binder barcodes from captured proteins via barcoded sequences on the barcoded beads. The captured sequences and barcodes are then amplified.

[0028] FIG. 5 illustrates a portion of an exemplary method of the disclosure in which the beadbound amplicons are released from the droplet for subsequent sequencing and analysis.

[0029] FIG. 6 shows a schematic showing the formation of an aggregate matrix in a droplet with a single cell from a sample and lysing of the cell to released biomolecules (e.g., nucleic acids and proteins), which are captured by functionalized particles in the resulting aggregate matrix.

[0030] FIG. 7 shows a schematic showing the formation bead aggregation of the invention.

[0031] FIG. 8 show bright field and fluorescent images of bead aggregation of the invention.

[0032] FIG. 9 shows a schematic of poly dT functionalization of beads of the invention.

[0033] FIG. 10A-B show bright field and fluorescent images of functionalized beads of the invention.

[0034] FIG. 11 shows a schematic of functionalized bead aggregation of the invention.

[0035] FIG. 12A-C shows images of droplets encapsulating functionalized beads.

[0036] FIG. 13-A-B show graphs of relative quantification from aggregates of the invention.

[0037] FIG. 14A shows a schematic of bead / cell encapsulation with a microfluidic chip.

[0038] FIG. 14B shows an image of bead / cell encapsulation with a microfluidic chip.

[0039] FIG. 15A-B shows images of droplets encapsulating functionalized beads.DETAILED DESCRIPTION

[0040] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using capture particles that aggregate to form networks to capture the cells content. The systems, methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells.Bevond-Poisson loading and particle aggregation

[0041] This disclosure provides methods, compositions, and systems for multi-omic analyses of cells, including individual cells, by creating nucleic acid libraries using beyond-Poisson loading of droplets with particles, as described herein. The systems, methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells.

[0042] Methods of the disclosure include capturing single cells in an aggregate network. In certain preferred aspects, methods of the disclosure include encapsulation of a single cell with a plurality of barcoded beads, which allows, for example, single-step RT-PCR, or PCR to amplify specific regions of a genome. The network may include capture molecules and / or molecular labels integrated throughout the network. Upon capture, the single cells are in the network, where the cell may be lysed to release various biomolecules of interest. The released biomolecules are then available for capture and / or labeling. In certain aspects, the aggregate networks, in which single cells are captured, are encapsulated within a fluid droplet with a plurality of beads.of the aggregate matrix 113 that capture single cells during their formation. In certain aspects, components, such as the capture binders, captured oligonucleotides, and / or labels (107) are grafted into the matrix and / or are attached to functionalized particles of the matrix.

[0044] The matrix 113 may include a porous matrix in which a single cell is captured 103. In certain aspects, the matrix is made using particles. In certain aspects, the particles are nano to micron sized particles, e.g., magnetic and non-magnetic beads known in the art. In certain aspects, the particles can have different composition (e.g., capture reagents such as primers, protein binders, gene specific primers, fluorophores for optical barcoding and screening etc). In certain aspects, the particles are one or more of a protein(s), a cell(s), a bead(s), a hydrogel, a polymer, an antibody, a biparatopic antibody, a binder, de novo binders, a collagen like peptide and / or precursors thereof, hr certain aspects, the matrix further comprises a plurality of beads.

[0045] In some methods of the disclosure, the particles are cross linked or otherwise attached to form the aggregate matrix used to capture single cells and / or other biomolecules as described herein. In certain aspects, the particles are crosslinked into an aggregate via a stimulus. A stimulus may be, for example, and depending on the particles used, electromagnetic radiation (e.g., UV light exposure), heat, a protein-protein or protein-DNA crosslinker (e.g., g formaldehyde, bis sulfosuccinimidyl suberate), biomolecular interactions (e.g., nucleic acid hybridization / ligation and protein-protein interaction / binding, such as biotin-strepta vidin interaction, or protein-antibody reactions), sugar mediated collagen polymerization, addition of hinders or de novo binders, a change in pH, and polymer crosslinkers (e.g., ethylene glycol, methacrylic acid, and methyl methacrylate). In certain aspects, one or more of the stimulus is provided in a fluid stream during droplet fonnation.

[0046] In certain aspects, after aggregation, particles can be barcoded (RE Beyond Poisson multi-omics). In certain methods, the aggregate can be separated to perform specific assays on certain bead composition (e.g., mass spectrometry, on-bead sequencing, gene specific sequencing [TCR, BCR etc.], etc.).

[0047] In certain aspects, the aggregate matrix 113 is made, either wholly or in part, from a cross-linked, porous structure throughout some or all of the cross-linked matrix. In preferred aspects, the cross-linked, porous structure is or comprises a hydrogel. The cross-linked aggregate matrix forms a mesh of cross-linked polymers and / or particles that defines the porous structure.In certain aspects, the porous structure may provide interconnected voids that permeate the aggregate matrix. In certain aspects, the aggregate matrix also includes one or more loaded reagents. The reagents may be disposed on the outer surface of the aggregate and / or within the porous structure. In certain aspects, fluid and / or analytes in the aggregate, in a droplet with an aggregate, and / or during aggregate formation, may access the reagents loaded within the interior of an aggregate.

[0048] Capturing individual cells in the matrix may be accomplished using a variety of processes known in the art. In preferred aspects, methods may include combining an aqueous fluid 105 containing the cells 103 to be analyzed with an aqueous fluid 109 comprising one or more aggregate network precursors, e.g., particles as described herein, that crosslink and form an aggregate matrix. In an exemplary method, aggregates containing single cells can be manufactured by preparing, for example, a hydrogel in an aqueous phase fluid that contains cells 119. The aqueous phase fluid 119 with the hydrogel is co-flowed with a fluid 111 immiscible to the aqueous phase, such as an oil, through a droplet generation device. In certain aspects, the aggregate matrix 113 forms upon application of a particular stimulus to the hydrogel precursor. Such stimuli may include, thermal changes, photo-exposure, chemical exposure (e.g., a crosslinking initiator), or the like. In some aspects, particles, cells, and optionally required precursors and reagents are mixed in an aqueous phase to produce droplets.

[0049] In certain aspects, the particles comprise a polymer, such as a hydrogel. In certain embodiments, the hydrogel is selected from naturally derived materials, synthetically derived materials and combinations thereof. Examples of hydrogels include, but are not limited to, collagen, hyaluronan, chitosan, fibrin, gelatin, alginate, agarose, chondroitin sulfate, polyacrylamide, polyethylene glycol (PEG), polyvinyl alcohol (PVA), acrylamide / bisacrylamide copolymer matrix, polyacrylamide / poly(acrylic acid) (PAA), hydroxyethyl methacrylate (HEMA), poly N- isopropylacrylamide (NIP AM), and polyanhydrides, poly(propylene fumarate) (PPF).

[0050] In certain aspects, the aggregate 113 and / or particles that compose the aggregate 113 are allowed to solidify by triggering a gelation mechanism, including, but not limited to, the polymerization or crosslinking of a gel matrix. For instance, polyacrylamide gels are formed bycopolymerization of acrylamide and bis-acrylamide. The reaction is a vinyl addition polymerization initiated by a free radical-generating system.

[0051] The composition and nature of the aggregate 113 may vary. For instance, in certain aspects, the aggregate may be formed using microgel particles that are micron-scale spheres of gel matrix. In some embodiments, the microgels are composed of a hydrophilic polymer that is soluble in water, including alginate or agarose. In other embodiments, the microgels are composed of a lipophilic microgel.

[0052] In some embodiments, the aggregate has an average volume, and a method as described herein includes shrinking the aggregate to decrease the average volume. The shrinking may occur upon the application of an external stimulus, e.g., heat. For instance, the aggregate may be encapsulated in a fluid by shearing, followed by the application of heat, causing the aggregate to shrink in size. The aggregate 113 may be loaded / grafted with at least one reagent and / or sample, which may include one or more of a single cell 103 and / or released biomolecules from the single cell, genes, drug molecules, therapeutic agents, particles, bioactive agents, osteogenic agents, osteoconductive agents, anti-inflammatory agents, growth factors, fibroin derived polypeptide particles, nucleic acid synthesis reagents, nucleic acid amplification reagents, reverse transcription reagents, nucleic acid detection reagents, DNA molecules, RNA molecules, genomic DNA molecules, and combinations of the same. The aggregate may be loaded with reagents that can be triggered to release a desired compound, e.g., a substrate for an enzymatic reaction. For instance, the aggregate may be triggered to rupture or dissolve upon the application of a stimulus, e.g., heat.

[0053] As shown in FIG. 1, aggregates may be generated under microfluidic control or, for example, using membrane emulsification. The aggregate generation process may be accomplished by pumping two or more immiscible fluids, such as oil and water containing cells and aggregate precursors (particles), into a junction or through a membrane. The junction / membrane shape, fluid properties (viscosity, interfacial tension, etc.), and flow rates influence the properties of the aggregates generated. However, for a relatively wide range of properties, aggregates of controlled, uniform size can be generated using methods like junctions, flow focusing, and membrane emulsification. To vary aggregate size, the flow rates of the immiscible liquids may be varied since, for junction and flow focus methodologies over a certainrange of properties, hydrogel particle size depends on total flow rate and the ratio of the two fluid flow rates. To generate an aggregate with microfluidic methods, the two fluids are normally loaded into two inlet reservoirs (e.g., syringes, pressure tubes) and then pressurized as needed to generate the desired flow rates (e.g., using syringe pumps, pressure regulators, gravity, etc.). This pumps the fluids through the device at the desired flow rates, thus generating droplet of the desired size and rate.

[0054] In some embodiments, aggregates may be generated using parallel droplet generation techniques, including, but not limited to, serial splitting, distribution plates, and step emulsification.

[0055] In some embodiments, the aggregates and any captured single cells may be removed from the fluid, dried, and stored in a stable form for a period of time. Examples of drying approaches include, but are not limited to, heating, drying under vacuum, freeze drying, and supercritical drying. In some embodiments, the dried aggregates may be combined with a fluid, but still retain the shape and structure as independent, often spherical, get-aggregates. In some embodiments, the dried aggregates are combined with an appropriate fluid, causing a portion of the fluid to be absorbed by the aggregates. Tn some embodiments, the porosity of the aggregates may vary, to allow at least one of a plurality of protein capture binders and / or barcoded binders 107 to be absorbed into the aggregates when combined with the appropriate fluid. Any convenient fluid that allows for the desired absorption to be performed in the aggregates may be used.

[0056] In certain aspects, a surfactant may be used to stabilize the aggregates. Accordingly, producing an aggregate may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion. Any convenient surfactant that allows for the desired reactions to be performed in the aggregates may be used.

[0057] In some embodiments of the aggregates a variation in diameter or largest dimension of the aggregates such that at least 50% or more, e.g., 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the aggregates vary in diameter or largest dimension by less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4, less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of 1.05, or less than a factor of 1.01.

[0058] Aggregates encapsulated cells or cell populations may provide certain advantages, such as being storable and more portable than droplet based partitioned cells. Furthermore, in some cases, it may be desirable to allow cells to be analyzed to incubate for a select period of time, in order to characterize changes in such cells over time, either in the presence or absence of different stimuli. In such cases, capture of individual cells in an aggregate matrix may allow for longer incubation than in emulsion droplets alone, although in some cases, droplet encapsulated cellular biomolecules may also be incubated for different periods of time, e.g., at least 10 seconds, at least 30 seconds, at least 1 minute, at least 5 minutes, at least 10 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, or at least 10 hours or more. In some embodiments, aggregate matrices with captured cells or their released contents may be readily deposited into droplets with a plurality of barcoded beads.

[0059] As shown in FIG. 2, in certain methods the captured single cells 103 are lysed within their aggregate networks 113 to release biomolecules, e.g., target nucleic acids 205 and proteins 203.

[0060] In certain aspects, lysis may be induced by a stimulus, such as, for example, lytic reagents, detergents, or enzymes that are loaded into the droplet, or added after the release of aggregates from the droplets. Lysing can additionally or alternatively involve heating the aggregates to a temperature sufficient to release lytic reagents contained inside the aggregates.

[0062] In addition to the lysis agents co-partitioned with the cells described above, other reagents may also be co-partitioned with the cells, including, for example. DNase and RNaseinactivating agents or inhibitors, such as proteinase K, chelating agents, such as EDTA, and other reagents employed in removing or otherwise reducing negative activity or impact of different cell lysate components on subsequent processing of nucleic acids or proteins.

[0063] In preferred embodiments, the aggregates comprise capture moieties such as capture oligonucleotides and capture protein binders 107. Capture oligonucleotides 107 may be used to capture nucleic acids 205 released from a cell, e.g., genomic DNA and mRNA. Nucleic acids that bind to capture oligonucleotides may be subsequently amplified and / or reverse transcribed to form cDNA. In certain aspects, the aggregates comprise protein capture binders, which capture proteins of a single cell, which may include one or more proteins released upon cellular lysis. Protein caphire binders may comprise a protein capture moiety, such as antibody or aptamer, or a de novo binder to bind and capture a protein from a single cell in the aggregate.

[0064] An exemplary caphire oligonucleotide and / or protein caphire binder may include a linker region to allow covalent bond with the aggregate and / or a particle of the aggregate. In certain aspects, a capture oligonucleotide / binder comprises a primer region, which may be a universal primer region, a primer nucleotide sequence, one or more barcode regions, which may include an index sequence, and / or a unique molecular identifier (UMI), a random capture sequence, a poly- T capture sequence, and / or a target-specific caphire sequence. In certain aspects, capture oligonucleotides comprise a barcode. In certain aspects, protein capture binders do not contain barcodes, i.e., universal or generic protein capture binders.

[0065] As shown in FIG. 2, in preferred aspects, a barcoded protein binder 209 is added to the aggregate during or after aggregate formation and / or cell lysis. The barcoded protein binder may bind captured proteins or a portion of the captured barcodes with a captured protein.

[0066] The term barcode region may comprise any number of barcodes, index or index sequence, UMIs, which are unique, i.e., distinguishable from other barcode, or index, UMI sequences. The sequences may be of any suitable length which is sufficient to distinguish the barcode, or index, sequence from other barcode sequences. A barcode, or index, sequence may have a length of 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 nucleotides, or more. In some embodiments, the barcodes, or indices, are pre-defined.

[0067] UMIs are advantageous in that they can be used to correct for errors created during amplification, such as amplification bias or incorrect base pairing during amplification. For example, when using UMIs, because every nucleic acid molecule in a sample together with its UMI or UMIs is unique or nearly unique, after amplification and sequencing, molecules with identical sequences may be considered to refer to the same starting nucleic acid molecule, thereby reducing amplification bias and / or allowing correlation of a sequence read to a particular sample, e.g., a single cell. Methods for error correction using UMIs are described in Karlsson et al., 2016, Counting Molecules in cell-free DNA and single cells RNA”, Karolinska Institutet, Stockholm Sweden, incorporated herein by reference.

[0068] Such UMIs, present in the barcodes herein, can allow for relative quantification of various expressions of proteins and nucleic acids of a single cell by permitting the grouping of proteins and nucleic acids from a singular' source.

[0070] Droplets encapsulating the aggregate matrix and plurality of beads may include, for example, single-emulsion droplets, multiple- emulsion droplets, or Giant Unilamellar Vesicles (GUV)

[0071] hi preferred aspects, the droplets generally range from about 0.1 to about 1000pm in diameter or largest dimension, and may have a variation in diameter or largest dimension of less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4. less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of 1.05, or less than a factor of 1.01, in diameter or the largest dimension. In some embodiments, droplets have a variation in diameter or largest dimension such that at least 50% or more, e.g., 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more of the droplets, vary in diameter or largest dimension by less than a factor of 10, e.g., less than a factor of 5, less than a factor of 4, less than a factor of 3, less than a factor of 2, less than a factor of 1.5, less than a factor of 1.4, less than a factor of 1.3, less than a factor of 1.2, less than a factor of 1.1, less than a factor of1.05, or less than a factor of 1.01. In some embodiments, droplets have a diameter of about 1.0 pm to 1000 pm, inclusive, such as about 1.0 pm to about 750 pm, about 1.0 pm to about 500 pm, about 1.0 pm to about 250 pm, about 1.0 pm to about 200 pm, about 1.0 pm to about 150 pm, about 1.0 pm to about 100 pm, about 1.0 pm to about 10 pm, or about 1.0 pm to about 5 pm, inclusive.

[0072] In practicing the methods as described herein, the composition and nature of the droplets, e.g., single-emulsion and multiple-emulsion droplets, may vary. For instance, in certain aspects, a surfactant may be used to stabilize the droplets.

[0073] Accordingly, a droplet may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion.

[0075] Producing an emulsion using aggregate particles, such as hydrogel particles, can provide emulsions including droplets that are extremely uniform in size. The droplet generation process may be accomplished by combining a plurality of aggregates with captured single cells with a first fluid 305 to provide a first mixture, the mixture may be further combined with a miscible fluid 309 that contains the barcoded beads 313. The miscible fluids may be combined to form thefirst mixture, which is then combined or sheared with a second, immiscible fluid 311, e.g., an oil. Shear with the first mixture and second fluid produces droplets 307 that each contain aggregaten matrix 113 that is encapsulated with a plurality of labeled beads 113 and the first mixture fluid, surrounded by the second fluid. To vary droplet size, the shearing rate and aggregate matrix sizes may be varied. In certain aspects, the aggregates are liquefied using an external stimulus (e.g., heat or an acid / base change) to generate a liquid emulsion.

[0076] The percentage of droplets, e.g., single-emulsion droplets or multiple-emulsion droplets, with one, and not more than one. capture aggregate matrix and a plurality of beads may be about 70% or more; about 75% or more; about 80% or more; about 85% or more; about 90% or more; or about 95% or more. For example, the percentage of droplets with one, and not more than one, capture aggregate matrix and a plurality of beads may be from about 70% to about 100%, e.g., from about 75% to about 100%, from about 80% to about 100%, from about 85% to about 100%, from about 90% to about 100%, or from about 95% to about 100%. As a further example, the percentage of droplets with one, and not more than one, aggregate matrix and plurality of beads may be from about 70% to about 95%, e.g., from about 75% to about 90%, or from about 80% to about 85%. The percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be about 70% or more; about 75% or; about 80% or more; about 85% or more; or about 90% or more. For example, the percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be from about 70% to about 100%, e.g., from about 75% to about 100%, from about 80% to about 100%, from about 85% to about 100%. from about 90% to about 100%, or from about 95% to about 100%. As a further example, the percentage of aggregate matrices and plurality of beads that are encapsulated in droplets in the second fluid may be from about 70% to about 95%, e.g., from about 75% to about 90%, or from about 80% to about 85%.

[0077] In certain aspects, the percentage of droplets, e.g., single-emulsion droplets or multipleemulsion droplets, with one, and not more than one, capture aggregate matrix and a plurality of beads may be at or near a Poisson distribution. In such aspects, single cells are captured in an aggregate network (which may include a plurality of beads as described herein and / or beads added during encapsulation) and the aggregates encapsulated into droplets using Poisson loading.

[0078] Double emulsions may also be generated with or without the use of microfluidic devices using methods known in the art, A double emulsion includes droplets contained within droplets, e.g., an aqueous phase fluid surrounded by an immiscible phase shell in an aqueous phase carrier fluid (e.g., water-in oil-in water) or an immiscible phase fluid surrounded by an aqueous phase shell in an immiscible phase carrier fluid (e.g., oil-in water-in oil). The second mixture described herein, which includes single- emulsion droplets in the second fluid, is combined with a third fluid to produce a third mixture, wherein the third fluid is immiscible with at least the second fluid. The third mixture is then sheared to encapsulate the particles and beads in doubleemulsion droplets in the third fluid. The third fluid may be immiscible with both the first and second fluids.

[0079] A particularly useful kind of double emulsion includes an aqueous droplet encapsulated within a slightly larger oil droplet, itself dispersed in a carrier aqueous phase. Double emulsions are valuable because the inner “core” of the structure can be used to provide active compounds, like dissolved solutes or biological materials, where they are shielded from the external environment by the surrounding oil shell. A benefit of generating double emulsions using hydrogel particles is similar to that for the generation of single emulsions, in that the double emulsion dimensions (inner and outer droplet sizes) can be controlled over a wide range and the droplets can be formed with a high degree of uniformity. As discussed herein, in suitable embodiments the aggregate matrices can be dissolved and / or melted within the droplets. Accordingly, in some embodiments multiple emulsions, e.g., double emulsions, may be prepared from droplets which no longer contain an intact aggregate matrix yet retain their original size.

[0080] Encapsulation in droplets of aggregate matrices, their precursors and / or reagents, e.g., nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents), barcode labels, and the like can be achieved via a number of methods, including microfluidic and non-microfluidic methods. In the context of microfluidic methods, there are a number of techniques that can be applied, including glass microcapillary emulsification or emulsification using sequential droplet generation in wettability patterned devices.

[0081] Microcapillary techniques form droplets by generating coaxial jets of the immiscible phases that are induced to break into droplets via coaxial flow focusing through a nozzle.Sequential drop formation in spatially patterned droplet generation junctions can be achieved in devices fabricated lithographically.

[0082] In some aspects the present disclosure provides methods for generating an emulsion which encapsulates an aggregate matrix containing a single cell, a plurality of beads, and / or reagents, e.g., nucleic acids and / or nucleic acid synthesis reagents (e.g., isothermal nucleic acid amplification reagents and / or nucleic acid amplification reagents) without the use of a microfluidic device.

[0083] In some embodiments described herein, the first fluid is an aqueous phase fluid; the second fluid is a fluid which is immiscible with the first fluid, such as a non-aqueous phase, e.g., a fluorocarbon, silicone oil, oil, or a hydrocarbon oil, or a combination thereof; and the third fluid may be an aqueous phase fluid. Alternatively, in some embodiments the first fluid is a nonaqueous phase, e.g., a fluorocarbon oil, silicone oil, or a hydrocarbon oil, or a combination thereof; the second fluid is a fluid which is immiscible with the first fluid, e.g., an aqueous phase fluid; and the third fluid is a fluorocarbon oil, silicone oil, or a hydrocarbon oil or a combination thereof.

[0084] The non-aqueous phase may serve as a carrier fluid forming a continuous phase that is immiscible with water, or the non-aqueous phase may be a dispersed phase. The non- aqueous phase may be referred to as an oil phase including at least one oil, but may include any liquid (or liquefiable) compound or mixture of liquid compounds that is immiscible with water. The oil may be synthetic or naturally occurring. The oil may or may not include carbon and / or silicon, and may or may not include hydrogen and / or fluorine. The oil may be lipophilic or lipophobic. In other words, the oil may be generally miscible or immiscible with organic solvents. Exemplary oils may include at least one silicone oil, mineral oil, fluorocarbon oil, vegetable oil. or a combination thereof, among others.

[0085] In exemplary embodiments, the oil is a fluorinated oil, such as a fluorocarbon oil, which may be a perfluorinated organic solvent.

[0086] In certain aspects, the first fluid includes a plurality of aggregate matrices with captured single cells or captured biomolecules from lysed single cells.

[0087] In certain aspects, a surfactant may be included in the first fluid, second fluid, and / or third fluid. Accordingly, a droplet may involve a surfactant stabilized emulsion, e.g., a surfactant stabilized single emulsion or a surfactant stabilized double emulsion, where the surfactant is soluble in the first fluid, second fluid, and / or third fluid. Any convenient surfactant that allows for the desired reactions to be performed in the droplets may be used, including, but not limited to, octylphenol ethoxylate (Triton X-100), polyethylene glycol (PEG), C26H50010 (Tween 20) and / or octylphenoxypolyethoxyethanol (IGEPAL). In other aspects, a droplet is not stabilized by surfactants.

[0088] The surfactant used depends on a number of factors such as the oil and aqueous phases (or other suitable immiscible phases, e.g., any suitable hydrophobic and hydrophilic phases) used for the emulsions. For example, when using aqueous droplets in a fluorocarbon oil, the surfactant may have a hydrophilic block (PEG-PPO) and a hydrophobic fluorinated block (Krytox® FSH). If, however, the oil was switched to a hydrocarbon oil. for example, the surfactant may instead be chosen such that it had a hydrophobic hydrocarbon block, like the surfactant AB IL EM90.

[0089] Other surfactants can also be envisioned, including ionic surfactants. Other additives can also be included in the oil to stabilize the droplets, including polymers that increase droplet stability at temperatures above 35°C.

[0090] Exemplary surfactants which may be utilized to provide thermostable emulsions are the “biocompatible” surfactants that include PEG-PFPE (polyethyleneglycol- perflouropolyether) block copolymers, e.g., PEG-Krytox®, surfactants that include ionic Krytox® in the oil phase and Jeffamine® (poly etheramine) in the aqueous phase. Additional and / or alternative surfactants may be used provided they form stable interfaces. Many suitable surfactants will thus be block copolymer surfactants (like PEG-Krytox®) that have a high molecular weight. These examples include fluorinated molecules and solvents, but it is likely that non-fluorinated molecules can be utilized as well. The presently disclosed methods are not limited to a particular surfactant. A variety of surfactants are contemplated including, but not limited to, nonionic and ionic surfactants (e.g., TRITON X-100; TWEEN 20; and TYLOXAPOL) or combinations thereof.

[0091] To generate emulsion, the disclosed methods include a step of shearing the second mixture provided by combining the first mixture with a third fluid immiscible with the first fluid. Any suitable method or technique may be utilized to apply a sufficient shear force to the secondmixture. For example, the second mixture may be sheared by flowing the second mixture through a pipette tip. Other methods include, but are not limited to, shaking the second mixture with a homogenizer (e.g., vortexer), or shaking the second mixture with large mixing beads, e.g., sapphire beads. The application of a sufficient shear force breaks the second mixture into droplets that encapsulate one of a plurality of hydrogel particles along with a plurality of barcoded beads, as described herein.

[0092] Generally, if the shear is increased, the average droplet size generated will be lower than that of the size of the particles. However, since the particles are in solid form, the droplets containing them will not be any smaller in size, thereby generating an emulsion. If the shear rate is substantially higher than the modulus of the hydrogel particle, then the shear can squeeze liquid out of the particles.

[0093] As shown in FIG. 4, Each bead 307 contains barcoded capture sequences or primers 415, with a barcode that contains at least a bead-specific sequence. Captured nucleic acids from the single cell and the barcodes of the barcoded protein binders are captured by the barcoded sequences of the beads.

[0094] In certain aspects, the aqueous mixture inside the droplets from the first fluid also includes additional components, e.g., buffers and reagents. In some methods, the capture sequences on the plural ily of beads bind to captured nucleic acids, cDNA, and / or the barcodes of captured proteins.

[0095] Nucleic acid molecules or protein binder barcodes hybridized to capture oligonucleotides or captured proteins may be released from the aggregate for binding to barcoded beads, for example by dissolving the aggregate or by using a reducing reagent to reduce oligonucleotide modifications or linkages in a capture oligonucleotide / peptide binder linker region.

[0096] In an exemplary method, the released biological components include one or more mRNA. The released mRNA is captured by a capture oligonucleotide of the aggregate matrix, reverse transcribed and, along with the barcode labels of the captured protein barcode binders, amplified and analyzed by, for example, using nucleic acid sequencing to identify one or more target sequences and / or target proteins from a single cell. In aspects of the invention, capture oligonucleotides are not attached to particles and are free within droplets. The capture

[0099] Aspects of the invention provide methods, compositions, and systems for multi-omic analyses of cells, including individual cells, using capture particles that aggregate together. Thesystems, methods, and compositions provide the ability to characterize and quantify, for example, the transcriptome and / or proteome of single cells.

[0100] As shown in FIG. 6, the aggregate matrices described herein may be formed by aggregating one or more type of particle / precursor. In the exemplary method of FIG. 6, a plurality of functionalized particles are encapsulated within a droplet with single cells. Such functionalized particles may include, for example, nano to micron sized particles, including magnetic and non-magnetic beads, proteins, cells, hydrogel, polymer, collagen like peptides, antibodies, binders (as described herein) and the like.

[0101] The particles may include one or more of a protein capture binder, a capture oligonucleotide, an orthogonal moiety (e.g., such as that which can attach other molecules via an attachment or linker means such as click chemistry), and combinations thereof. In certain aspects, the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, antibodies, mini binders or a combination thereof. The matrix 113 may include a porous matrix in which a single cell is captured 103. In certain aspects, the matrix is made using particles. In certain aspects, the particles are nano to micron sized particles, e.g., magnetic and non-magnetic beads known in the art. In certain aspects, the particles can have different composition (e.g., capture reagents such as primers, protein binders, gene specific primers, fluorophores for optical barcoding and screening etc). In certain aspects, the particles are one or more of a protein(s), a cell(s), a bead(s), a hydrogel, a polymer, a collagen like peptide and / or precursors thereof. In certain aspects, the hydrogel matrix further comprises a plurality of beads.

[0102] In some methods of the disclosure, the particles are cross linked or otherwise attached to form the aggregate matrix used to capture single cells and / or other biomolecules as described herein. In certain aspects, the particles are crosslinked into an aggregate via a stimulus. A stimulus may be, for example, and depending on the particles used, electromagnetic radiation (e.g., UV light exposure), heat, a protein-DNA crosslinker (e.g., g formaldehyde, bis sulfosuccinimidyl suberate), biomolecular interactions (e.g., nucleic acid hybridization / ligation and protein-protein interaction / binding, such as biotin-streptavidin interaction, antibody / antigen interactions, superantigen, de novo binders and mini binders), sugar mediated collagen polymerization, a change in pH, and polymer crosslinkers (e.g., ethylene glycol, methacrylicacid, and methyl methacrylate). In certain aspects, one or more of the stimulus is provided in a fluid stream during droplet formation.

[0103] Collagen and / or collagen-like peptides can mediate aggregate formation, for example through sugar mediated collagen polymerization. Where pH is used to mediate aggregate formation, a pH responsive microgel particle coated with a vinyl functional group may be used that cross-links with pH change. Method that may be used for pH mediated cross-linking are described in U.S. Patent No. 10,695,465, the entirety of the contents of which are incorporated by reference herein. An initiator may be added or coated to a particle to provide a crosslinked polymer network with differing properties, for example ethylene glycol, methacrylic acid, or methylmethacrylate may be added to alter the properties of aggregate formation.

[0104] The cross linker may be provided by particles or added to particles. For example, the cross-linking agent may be added in the oil phase of droplet formation or diffused into droplets.

[0105] In some aspects, related to cross-linking in methods and compositions of the disclosure, collapsed or slightly swollen vinyl is functionalized on the microgel particles. Cross-linking monomers are added to the particles and an initiator / accelerator mediates the addition of monomers to the surface of particles. Once particles are saturated with a chosen cross-linking agent, particle swelling followed by a stimulus (e.g., heat, light, or UV) are used to initiate and mediate crosslinking. Particles may be double cross-linked resulting in an interpenetrating network and particle peripheries.

[0106] As shown in FIG. 6, in step 3, a stimulus causes aggregation of the particles in the droplet to form the aggregate matrix, which includes biomolecules from the lysed cells. Particles within the plurality of particles may display an antigen to facilitate coupling with particles displaying an antigen binder. In some aspects of the invention, the particles aggregate only when a cell is present in the droplet. For example, as described, an antigen may be released by a cell upon lysis. For example, the antigen may be a highly expressed protein, such as actin. An antiactin binder may be displayed on the particles for coupling. Advantageously, particles will then aggregate only in the presence of a cell expressing actin, making subsequent steps easier, including re-encapsulation and barcoding of aggregates allowing for increased scale of analysis.

[0107] In certain aspects, the method further includes lysing the cells encapsulated within the aggregate network to release one or more target intracellular protein and / or one or more target nucleic acid,.. The target molecules (nucleic acids and / or proteins) are captured, e.g., proteins via a protein capture binders and oligonucleotides to capture the target nucleic acids.

[0108] Aggregation of the invention methods increase scale, throughput, cell capture efficiency, and enable multi-omic profiling at single-cell resolution including intracellular protein capture. Aggregation methods greatly improve multi-omic analysis, include single-cell multi-omics and sample archiving.

[0109] In certain aspects, quantification and / or identification of mRNA, DNA, and / or proteins from a single cell may provide information that the cell from which the nucleic acids and proteins were released. For example, the methods of the disclosure may be used to show an increased expression of mRNA / protein(s) associated with cancer or decreased expression of mRNA / protein(s) associated with cancer in response to a candidate compound. Since each nucleic acid molecule / protein may be tagged with a bead-specific barcode and thus single cell from which it was released, gene expression levels may be traced back to the droplet, aggregate, and cell from which the nucleic acid / protein was released. This allows for determination of the cell type, cell line, epitope, expression profiles and response to drug candidate for the captured single cells. Because methods of the present disclosure allow any number of single cells to be captured in aggregate particles and encapsulated in droplets, without the stringent requirements of Poisson loading, any number of cell types and cell lines may be screened against any number of candidate compounds simultaneously. By using barcodes and UMIs nucleic acids, proteins, and their expression levels can be traced back to each bead, droplet, hydrogel particle, and thus cell, allowing for minimal to no loss of information.

[0110] For RNA or mRNA sequencing, sequencing may first comprise the step of preparing a barcoded cDNA library from released RNA, through reverse transcription, and sequencing the cDNA. RNA sequencing may advantageously allow for the quantification of gene expression within the single cell, and can be used to identify characteristics of the single cell that can be used to, for example, make a diagnosis, prognosis, or determine drug effectiveness. Reverse transcription of cDNA molecules from RNA can be performed both within the droplet or after barcoded RNA molecules have been captured by the aggregates and released from each droplet.

[0111] Reverse transcription may be performed using without limitation dNTPs (mix of the nucleotides dATP, dCTP, dGTP and dTTP), buffer / s, detergent / s, or solvent / s, as required, and suitable enzyme such as polymerase or reverse transcriptase. The polymerase used may be a DNA polymerase, and may be selected from Taq DNA polymerase, Phusion polymerase (Thermo Fisher Scientific, Waltham, Massachussetts), or Q5 polymerase. Nucleic acid amplification reagents are commercially available, and may be purchased from, for example, New England Biolabs, Ipswich, MA, USA. The reverse transcriptase used in the presently disclosed targeted library preparation method may be for example, maxima reverse transcriptase. In some embodiments, the general parameters of the reverse transcription reaction comprise an incubation of about 15 minutes at 25 degrees and a subsequent incubation of about 90 minutes at 52 degrees.

[0112] Sequencing nucleic acid molecules may be performed by methods known in the art. For example, see. generally, Quail, et al., 2012, A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers, BMC Genomics 13:341. Nucleic acid molecule sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, or preferably, next generation sequencing methods. For example, sequencing may be performed according to technologies described in U.S. Pub. 2011 / 0009278, U.S. Pub. 2007 / 0114362, U.S. Pub. 2006 / 0024681, U.S. Pub. 2006 / 0292611, U.S. Pat. 7,960,120, U.S. Pat. 7,835,871, U.S. Pat. 7,232,656, U.S. Pat. 7,598,035, U.S. Pat. 6,306,597, U.S. Pat. 6,210,891, U.S. Pat. 6,828.100, U.S. Pat. 6,833,246, and U.S. Pat. 6.911,345, each incorporated by reference.

[0113] The conventional pipeline for processing sequencing data includes generating FASTQ- format files that contain reads sequenced from a next generation sequencing platform, aligning these reads to an annotated reference genome, optionally devoncoluting barcodes in the case of single-cell RNA-seq, and quantifying expression of genes. These steps are routinely performed using known computer algorithms, which a person skilled in the art will recognize can be used for executing steps of the present invention. For example, see Kukurba, Cold Spring Harb Protoc, 2015 ( 11 ):951 -969, incorporated by reference.

[0114] Bead-bound nucleic acid molecules may advantageously be amplified prior to sequencing, preferably within the droplets when bound to the beads. Amplification may comprise methods for creating copies of nucleic acids by using isothermal methods or thermal cycling to expose reactants to repeated cycles of heating and cooling, and to permit different temperature-dependent reactions (e.g., by Polymerase chain reaction (PCR). Any suitable PCR method known in the art may be used in connection with the presently described methods. Non limiting examples of PCR reactions include real-time PCR, nested PCR, multiplex PCR, quantitative PCR or touchdown PCR. Notably, each amplified copy of tire nucleic acid molecule will comprise the barcode unique to a bead for identifying the droplet and cell form which the nucleic acid molecule was released.

[0115] Primer sequences may comprise a binding site, for example a primer sequence that would be expected to hybridize to a complementary sequence, if present, on any nucleic acid molecule or protein barcode that is captured by a barcoded bead and provide an initiation site for a reaction, for example an elongation or polymerization reaction. The primer sequence may also be a “universal” primer sequence, i.e., a sequence that is complimentary to nucleotide sequences that are very common for a particular' set of nucleic acid fragments. The primer sequences used may be P5 and P7 primers as provided by Illumina, Inc., San Diego, California. The primer sequence may also allow the capture probe to bind to a solid support, such as flow cell of a DNA sequencing machine.

[0116] A feature of certain methods as described herein is the use of a polymerase chain reaction (PCR)-based assay to detect the presence of certain nucleic acids or binder barcodes. Examples of PCR-based assays of interest include, but are not limited to, quantitative PCR (qPCR), quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), digital droplet PCR (ddPCR) single cell PCR, PCR-RFLP / real time-PCR-RFLP, hot start PCR, nested PCR. in situ polony PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR, emulsion PCR and reverse transcriptase PCR (RT-PCR). Other suitable amplification methods include the ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR). arbitrarily primed polymerase chain reaction (AP-PCR),degenerate oligonucleotide-primed PCR (DOP- PCR) and nucleic acid based sequence amplification (NABSA),

[0117] A PCR-based assay may be used to detect the presence of certain nucleic acids (e.g., genes. mRNA, viral-associated nucleic acids) and / or protein barcodes. In such assays, one or more primers specific to each sequence of interest are reacted with the nucleic acids captured by the plurality of barcoded beads in each droplet. These primers have sequences specific to a sequence of interest, so that they will only hybridize and initiate PCR when they are complementary to the sequence of the cell / barcode. If the sequence of interest is present and the primer is a match, many copies of the sequence are created. To determine whether a particular sequence is present, the PCR products may be detected through an assay probing the liquid of the droplet, such as by staining the solution with an intercalating dye, like SybrGreen or ethidium bromide, or detecting them through an intermolecular reaction, such as FRET. These dyes, beads, and the like are each example of a “detection component.” a term that is used broadly and generically herein to refer to any component that is used to detect the presence or absence of nucleic acid amplification products, e.g., PCR products.

[0118] The presence of certain nucleic acids / proteins in cells may be used to produce a bioarchive of cells, which may be used to determine and compare signatures of different cell types, cells under certain stimuli, and / or signatures indicative of certain pathologies.

[0119] In some aspects, the captured cells include cells obtained from, for example, a sample (tissue of bodily fluid) of a patient. The sample may include a fine needle aspirate, a biopsy, or a bodily fluid from the patient. Upon being isolated from the sample, the cells may be processed by, for example, generating a suspension with an appropriate solution. Such solution will generally be a balanced salt solution, e.g., normal saline, PBS. Hank's balanced salt solution, etc., and in certain instances supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from 5-25 mM. Convenient buffers include HEPES, phosphate buffers, lactate buffers, etc. The separated cells can be collected in any appropriate medium that maintains the viability of the cells, usually having a cushion of serum at the bottom of the collection tube. Various media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Iscove's medium, etc., frequently supplemented with fetal calf serum.

[0120] For proteomic analysis, captured proteins from single cells in aggregate matrices from samples can be incubated with a mixture comprising one or more index barcoded labeled antibody conjugates, aptamers, de novo binders or mini binders as a barcoded binder. Antibody conjugates and processes for their use in multi-omic analysis along with mRNA gene expression profiling can be found in descriptions of CITE-seq including Stoeckius. et al., 2017.Simultaneous epitope and transcriptome measurement in single cells, Nature Methods, 14:865- 868.

[0121] The protein binder barcode and / or bead barcode may include an index sequence that may comprise various sequence portions. For example, the index oligonucleotide sequence may include a PCR handle or universal primer site used for subsequent PCR amplification. The sequence may include a barcode that is specific to the captured protein / capture barcode to which it is linked and can be used to subsequently identify the captured protein by sequence analysis.

[0122] Additional components may include a UM1 which can be used where multiple copies of a single type of barcoded binder or barcoded bead capture sequence are used in order to collapse sequencing reads and remove amplification or sequencing or errors in quantifying protein expression. The barcode sequence may also include a capture portion that is complementary to the capture sequence on the barcoded beads for subsequent amplification and the potential addition of further adapter sequences. In preferred methods and systems, the capture portion comprises a poly A sequence to allow poly T capture probes to be used to hybridize both mRNA and antibody conjugates / aptamers for multi-omic analysis.

[0123] In certain aspects, aggregate particles may be washed with a wash buffer to remove any unbound binders that did not bind to a captured protein released from the cell. The aggregate matrices can then be incubated with a mixture of barcoded binder(s). washed again, and then reencapsulated with barcoded beads.

[0124] In certain methods, protein binder barcodes are captured by sequences on barcoded beads as described herein. In certain aspects, the aggregate may be incubated with the barcoded protein binders and barcoded beads alongside mRNA from the lysed cell. Emulsions can then be broken, the particles washed, and cDNA generated by reverse transcription. The cDNA can then be amplified which should generate the profile of captured mRNA while concurrently generating a significant population of sequences that contain barcode binder sequences.

[0125] In certain methods, additive primers are added to the cDNA PCR amplification to increase yield of the barcode binder sequences from the same cell. In certain aspects, barcode binder sequences are identified by qPCR as a control check for the cDNA amplification. The PCR products can then be purified and sequenced using known sequencing techniques (e.g., Illumina sequencing).

[0126] In certain methods and systems, specific capture oligonucleotides and / or capture protein binders are conjugated directly to the aggregate matrices in order to allow for selective nucleic acid and protein capture. In such cases, a library of specific labeled aggregate matrix particles can be used to capture single cells or biomolecules,

[0127] Other capture probes may also be included on particles forming the aggregate matrix depending on the desired application, including small molecule drugs to select for particular receptors, RNA derived aptamers, or DNA sequences for specific hybridization of targeted DNA sequences, and / or antibodies or antigens.

[0128] In preferred embodiments, quantifying nucleic acids and protein binder barcodes comprises sequencing, which may be performed by methods known in the art. For example, see, generally, Quail, et al., 2012, A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers, BMC Genomics 13:341. Nucleic acid sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, or preferably, next generation sequencing methods. For example, sequencing may be performed according to technologies described in U.S. Pub. 2011 / 0009278, U.S. Pub. 2007 / 0114362, U.S. Pub. 2006 / 0024681, U.S. Pub. 2006 / 0292611, U.S. Pat. 7,960,120, U.S. Pat. 7.835,871, U.S. Pat. 7,232.656, U.S. Pat. 7,598,035, U.S. Pat. 6,306,597. U.S. Pat. 6,210,891, U.S. Pat. 6,828,100. U.S. Pat. 6,833,246, and U.S. Pat. 6,911,345, each incorporated by reference.

[0129] The conventional pipeline for processing sequencing data includes generating FASTQ- format files that contain reads sequenced from a next generation sequencing platform, aligning these reads to an annotated reference genome, deconvoluted barcodes, and quantifying expression of genes. These steps are routinely performed using known computer algorithms, which a person skilled in the art will recognize can be used for executing steps of the presentinvention. For example, see Kukurba. Cold Spring Harb Protoc, 2015 (111:951-969. incorporated by reference.

[0130] In certain aspects, the resulting sequence reads include barcodes from the capture oligonucleotides of the plurality of beads, which are used to ascertain whether a particular nucleic acid or protein was included in a particular droplet. Quantification and / or identification of these barcodes can provide the identity or state of a cell from which a particular nucleic acid or protein were captured in a particular aggregate matrix.

[0131] The presently disclosed methods for high-throughput, single cell, multi-omic analysis that enable detection and classification of cells, epitope discovery, and biomarker screening amongst cells in various states. The presently disclosed methods and systems provide the ability to analyze individual cells and link individual nucleic acid and protein markers, providing previously inaccessible insight into the diversity of cellular behavior in disease, and links in proteins and nucleic acid expression.Sample Preparation

[0132] Aspects of the invention allow for the improved analysis of nucleic acid molecules. Nucleic acid molecules may be acquired from a sample or a subject. Nucleic acid molecules include DNA and RNA. Methods of the invention are applicable to DNA from whole cells, portions of genetic or proteomic material obtained from one or more cells, artificial nucleic acid molecules, or viral DNA or RNA. Nucleic acid molecules may be extracted from a sample by any method. The nucleic acid molecule may include DNA, RNA, cDNA, PNA, ssDNA, LNA and others that are contained within a sample.

[0133] Biological samples for use in the present invention include viral particles or preparations. Nucleic acid molecules can be obtained directly from an organism or from a biological sample obtained from an organism, e.g., from blood, urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool and tissue. Any tissue or body fluid specimen may be used as a source for nucleic acid for use in the invention. Nucleic acid molecules can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which template nucleic acids are obtained can be infected with a virus or other intracellular pathogen. In addition,nucleic acids can be obtained from non-cellular or non-tissue samples, such as viral samples, or environmental samples.

[0134] In certain embodiments, the nucleic acid molecules are bound as to other target molecules such as proteins, enzymes, substrates, antibodies, binding agents, heads, small molecules, peptides, or any other molecule and serve as a surrogate for quantifying and / or detecting the target molecule. Nucleic acid molecules may be single-stranded, double-stranded, or doublestranded with single-stranded regions (for example, stem- and loop-structures). Proteins or portions of proteins (amino acid polymers) that can bind to high affinity binding moieties, such as antibodies or aptamers, are target molecules for oligonucleotide labeling, for example, in droplets.

[0135] In aspects of the invention, molecules may be compartmentalized. A compartment may be an aqueous droplet in a water-in-oil emulsion. Said droplets may be formed using microfluidic devices according to known techniques in the art. Other methods for generating droplets as described herein may be used as appropriate, including, but not limited to, high speed vortex, ultrasonic waves, extrusion, filtering, microsieve chips, or the like. Individual oligonucleotides may be loaded into separate droplets according to known methods in the art.

[0136] Nucleic acid templates can be obtained directly from an organism or from a biological sample obtained from an organism, e.g., from blood, urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool and tissue. In a particular embodiment, nucleic acid is obtained from fresh frozen plasma (FFP). In a particular embodiment, nucleic acid is obtained from formalin-fixed, paraffin-embedded (FFPE) tissues. Any tissue or body fluid specimen may be used as a source for nucleic acid for use in the invention. Nucleic acid templates can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which template nucleic acids are obtained can be infected with a virus or other intracellular pathogen. A sample can also be total RNA extracted from a biological specimen, a cDNA library, viral, or genomic DNA.

[0137] A biological sample may be homogenized or fractionated in the presence of a detergent or surfactant. Cells within a sample may also be lysed by a lysing agent to release nucleic acid molecules and cell components. Lysis or homogenization solutions may further contain other agents, such as reducing agents or lytic enzymes. Examples of such reducing agents includedithiothreitol (DTT). beta.-mercaptoethanol, DTE, GSH, cysteine, cysteamine, tricarboxyethyl phosphine (TCEP), or salts of sulfurous acid. Once obtained, the nucleic acid is denatured by any method known in the art to produce single stranded nucleic acid templates and a pair of first and second oligonucleotides is hybridized to the single stranded nucleic acid template such that the first and second oligonucleotides flank a target region on the template.EXPERIMENTAL EXAMPLESBead formation and aggregation

[0138] FIG. 7 shows a schematic showing the formation bead aggregation of the invention. Single cell droplet formation with beads and cells frequently results in the formation of empty droplets, droplets with a cell but without beads, or droplets with a bead without a cell. As a consequence, cells from the sample remain uncounted. Oversaturation with beads can solve the problem by ensuring that all droplets encapsulate at least one bead. However, this results in overcounting of cells that are encapsulated with multiple beads. Oversaturating with bead aggregation of the invention solves this problem by allowing all beads within a droplet to be counted as a “single bead.” As a result, each droplet with a cell also comprises just one “single bead” aggregate, allowing for efficient multi-omic analysis.

[0139] FIG. 8 show bright field and fluorescent images of bead aggregation of the invention. DBCO beads (magnetic beads coated with dibenzocycloctyne functional groups on their surface) and azide coated beads at a ratio of 1 : 10 were mixed in a phosphate-buffered saline (PBS) buffer and incubated overnight at room temperature. Multiple DBCO / azide aggregates (via alkyneazide cycloaddition click-chemistry) were observed.

[0140] FIG. 9 shows a schematic of poly dT functionalization of DMCO beads. DBCO beads were partially functionalized with poly dT. Poly dT was labeled with TAMRA (red fluorescence) to show functionalization. DBCO beads and azide-poly dT-TAMRA were incubated overnight and excess azide were removed afterwards. The molar ratio of DBCO functional groups to azides was 1: 0.07.

[0141] FIG. 10A-B show bright field and fluorescent images of functionalized beads of the invention.RNA quantification

[0142] FIG. 11 shows a schematic of functionalized bead aggregation of the invention. DBCO beads with or without oligo dT25 functionalization were mixed with azide beads and encapsulated into droplets right after mixing and incubated at room temperature 4 hours.Average droplet size was 65~70um. The molar ratios of DBCO functional groups to azides were 1:0, 1:0.1, and 1:0.5. Bead concentration was 5 DBCO beads / droplet and 25 azide beads / droplet.

[0143] FIG. 12A-C shows images of droplets encapsulating functionalized beads.

[0144] Droplets were broken and the bead aggregates in droplets were collected after incubation. Bulk RNA capture by bead-aggregates was conducted together with reverse transcriptase and qPCR detection.

[0145] The table below shows sample details for analysis.

[0146] FIG. 13-A-B show graphs of relative quantification from aggregates of the invention. 5 x 105Jurkat cells were lysed by the lysis / binding buffer from the NEB Magnetic mRNA Isolation Kit (NEB, S155OS). The pre-aggregated beads were mixed with the Jurkat cell lysate to capture cellular poly-A RNA in bulk. The captured RNA on bead aggregates were reverse transcribed by the SuperScript IV First-Strand Synthesis System (as sold by Invitrogen, 18091050). qPCR was conducted on different numbers of bead-aggregate particle by the PowerUp SYBR Green Master Mix (as sold by Applied Biosystems, A25742) on a QuantStudio Real-Time PCR instrument (as sold by Applied Biosystems). Human ACTB gene (ACT) were amplified using primer set GCCTTCATACATCTCAAGTTGGG (F) and GAATGATGAGCCTTCGTGCC (R). Human TRBC1 gene (TRBC) were amplified using primer set GGTCGCTGTGTTTGAGCCAT (F) and ACCAGTGTGGCCTTTTGGGTG (R).

[0147] Quantitative polymerase chain reaction (qPCR) showing relative quantifications of human ACTB sequence (ACT) and human TRBC1 sequence (TRBC) were plotted for Jurkat bulk poly-A RNA captured by bead aggregates produced using DBCO bead / azide poly dT oligos at ratio of 1:0, 1:0.1, or 1:0.5, normalized to sample 2 on 200 bead-aggregate particles, n.s. indicates no specific qPCR signal. Mean values of two duplicates were calculated and plotted. DCBO bead / azide poly dT oligos at ratios of 1:01 and 1:0.5 produced robust quantification of ACT and TRBC RNA at all bead numbers used for qPCR.

[0148] FIG. 14A shows a schematic of bead / cell encapsulation with a microfluidic chip.

[0149] FIG. 14B shows an image of bead / cell encapsulation with a microfluidic chip. The oil phase comprised IIFE7500 together with a surfactant. The cell suspension comprised Jurkat cells in PBS sold under the trade name DULB ECCO’S PHS (DPBS). A lysis buffer was used. Beads comprised oligo dT25 functionalized DBCO beads as described with azide beads. Droplets were collected and incubated for cell lysis, particle aggregation, and RNA capture.

[0150] Cells were lysed in 30 mins. Intracellular RNA was released and captured by the functionalized DBCO beads. DBCO beads and azide beads aggregate together through click chemistry. Afterwards, droplets in oil were broken by a droplet breaking reagent and beads were collected. Unbound azide beads were removed during the washing process.

[0151] FIG. 15A-B shows images of droplets encapsulating functionalized beads in droplets with cell lysates. Droplet diameter was approximately 45pm.

[0152] RT-qPCR on droplet captured cellular RNA by aggregates was conducted.

[0153] The table below shows sample details for analysis.

[0154] FIG. 13-A-B show graphs of relative quantification from aggregates of the invention.

[0155] The captured RNA on bead aggregates were reverse transcribed by the SuperScript IV First-Strand Synthesis System (as sold by Invitrogen, 18091050). qPCR was conducted on different numbers of bead-aggregate particle by the PowerUp SYBR Green Master Mix (as soldby Applied Biosystems, A25742) on a QuantStudio Real-Time PCR instrument (as sold by Applied Biosystems). Human ACTB gene (ACT) were amplified using primer set GCCTTCATACATCTCAAGTTGGG (F) and GAATGATGAGCCTTCGTGCC (R). Human TRBC1 gene (TRBC) were amplified using primer set GGTCGCTGTGTTTGAGCCAT (F) and ACCAGTGTGGCCTTTTGGGTG (R).

[0156] Quantitative polymerase chain reaction (qPCR) showing relative quantifications of human ACTB sequence (ACT) and human TRBC1 sequence (TRBC) were plotted for Jurkat cells lysed and captured by bead aggregates formed in droplets and incubated overnight at room temperature (sample 1) or at 4 degree Celsius (sample 2). Results were normalized to sample 2 on 200 bead-aggregate particles, n.s. indicates no specific qPCR signal. Mean values of two duplicates were calculated and plotted.

[0157] Bead aggregates of the invention were successful and capturing and quantifying RNA from single cells.INCORPORATION BY REFERENCE

[0158] References and citations to other documents, such as patents, patent applications, patent publications, journals, books, papers, web contents, have been made throughout this disclosure. All such documents are hereby incorporated herein by reference in their entirety for all puiposes.EQUIVALENTS

[0159] Various modifications of the invention and many further embodiments thereof, in addition to those shown and described herein, will become apparent to those skilled in the art from the full contents of this document, including references to the scientific and patent literature cited herein. The subject matter herein contains important information, exemplification and guidance that can be adapted to the practice of this invention in its various embodiments and equivalents thereof.

Claims

CLAIMSWhat is claimed is:1 A method for capturing cellular content, the method comprising: forming a droplet comprising at least one cell and a plurality of particles; causing the plurality of particles to attach via bonding or coupling to each other to form an aggregate that comprises the nucleic acids and proteins: and lysing the cell in the droplet to release nucleic acid and proteins from the cell; capturing the nucleic acids and proteins on the plurality of particles; releasing the aggregate from the droplet.2 The method of claim 1, wherein each of the plurality of particles comprises at least a protein capture binder, a capture oligonucleotide, an orthogonal moiety or a combination thereof.3 The method of claim 1, wherein each of the plurality of particles is of nanometer size or micrometer size.4 The method of claim 1, wherein each of the plurality of particles is magnetic or non-magnetic.5 The method of claim 1, wherein the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.6 The method of claim 1, wherein coupling is accomplished by at least one technique selected from the group consisting of: exposure to ultraviolet light, exposure to heat, induction via protein / nucleic acid crosslinkers, pH change, antigen / antigen-binder mediated coupling, collagen-mediated coupling, addition of a cross-linking initiator to the droplets, click-chemistry mediated coupling, and / or an initiator that coats the particles.7 The method of claim 1, wherein the plurality of particles are controllable self-annealing particles.8 The method of claim 1, wherein the droplet further comprises a plurality of barcoded beads that also couple to the plurality of particles to form part of the aggregate.9 The method of claim 1, wherein the method further comprises attaching molecular barcodes to the aggregate.10 The method of claim 1. further comprising separating one or more individual particles from the aggregate and performing a discrete assay on the proteins and / or nucleic acids captured on the one or more individual particles.11 A method for cellular analysis, the method comprising: encapsulating in a droplet, a single cell with a plurality of particles, each particle of the plurality comprising a plurality of protein capture binders and / or capture oligonucleotides; lysing said encapsulated single cell within said droplet to release one or more target intracellular proteins and one or more target nucleic acid within said droplet; capturing within said droplet the target intracellular proteins with the protein capture binders and capturing the one or more target nucleic acid with the capture oligonucleotide; binding and / or coupling the plurality of particles to each other to form an aggregate within said droplet; and releasing the aggregate from the droplet.12 The method of claim 11, wherein the encapsulating step comprises merging a fluidic stream comprising single cells with a fluidic stream comprising particles to produce a merged stream, and flowing said merged stream into a flow of immiscible fluid, thereby forming a plural ily of droplets, wherein at least one of the plurality of the droplets comprises the single cell and the plurality of particles.13 The method of claim 11, wherein each of the plurality of particles is of nanometer size or micrometer size.

14. The method of claim 11, wherein each of the plurality of particles is magnetic or nonmagnetic.

15. The method of claim 11, wherein the plurality of particles is of a same composition or a different composition and selected from the group consisting of proteins, cells, beads, a hydrogel, a polymer, or a combination thereof.

16. The method of claim 11, wherein binding and / or coupling is accomplished by at least one technique selected from the group consisting of: exposure to ultraviolet light, exposure to heat, induction via protein / nucleic acid crosslinkers, antigen / antigen-binder mediated coupling, pH change, addition of a cross-linking initiator to the droplets, click-chemistry mediated coupling, and / or an initiator that coats the particles.

17. The method of claim 11, wherein the plurality of particles are controllable self-annealing particles.

18. The method of claim 11, wherein the droplet further comprises a plurality of barcoded beads that also couple to the plurality of particles to form part of the aggregate.

19. The method of claim 11, wherein the method further comprises attaching molecular barcodes to the release aggregate.

20. The method of claim 11, further comprising separating one or more individual particles from the aggregate and performing a discrete assay on the proteins and / or nucleic acids captured on the one or more individual particles.

Images