Nucleic acid detection method, reagent, and kit

Abstract

Provided are a method, a reagent, and a kit that enable simultaneous and efficient detection of alleles of rs10490924 and rs800292 in nucleic acid in a sample.　This method comprises a detection step for simultaneously amplifying and detecting, in the same system, nucleic acid regions including rs10490924 and rs800292. In the detection step, a first nucleic acid probe and a second nucleic acid probe that respectively hybridize to a region including allele G and allele T of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe that respectively hybridize to a region including allele A and allele G of rs800292 are used. Said nucleic acid probes each have the following characteristics: 1) the length of the probe is 8-29 mer; 2) the number of artificial nucleic acid is 1-12 nucleotides; and 3) one of the terminal regions has a fluorophore and the other terminal region has a quencher.

Description

Nucleic acid detection method, reagent and kit

[0001] The present invention relates to a method for detecting a single nucleotide polymorphism associated with age-related macular degeneration, as well as a reagent and kit for detecting the single nucleotide polymorphism.

[0002] Age-related macular degeneration (hereinafter referred to as AMD) is a neurodegenerative disease caused by factors such as aging, smoking, and genetics, which leads to degeneration and neovascularization in the macula, the central part of the retina at the back of the eye, resulting in symptoms such as decreased vision, central scotoma, and metamorphopsia. The number of AMD patients is increasing year by year. A typical treatment for AMD is known to be the administration of VEGF inhibitors, but these are expensive and require continuous administration, which places a heavy economic and physical burden on patients. It is also known that excessive drug administration can cause retinal atrophy, leading to decreased vision.

[0003] It has been reported that single nucleotide polymorphisms (SNPs) of multiple genes are involved in the onset of AMD. Patent Documents 1 and 2 disclose multiple SNPs as markers for assessing susceptibility to AMD. In particular, SNP (rs10490924) in the ARMS2 gene and SNP (rs800292) in the CFH gene are known to be frequently found in Japanese AMD patients (Non-Patent Document 1), and reagents for detecting each SNP in nucleic acids purified from samples are also commercially available.

[0004] JP-T-2008-545438A JP-A-2011-135838A

[0005] A. Goto, et al., J. Ocul. Biol. Dis. Inform., (2009) Vol. 2, pp. 164-175

[0006] As mentioned above, reagents capable of detecting each SNP associated with AMD individually are already commercially available. It is expected that detecting multiple SNPs closely related to AMD in combination will enable more sensitive and accurate assessment of AMD susceptibility than using the detection results of each SNP alone. However, a test system capable of simultaneously and stably detecting multiple SNPs associated with AMD has not yet been established.

[0007] An object of the present invention is to provide a method, reagent, and kit capable of simultaneously and efficiently detecting the alleles of rs10490924 and rs800292 of nucleic acid in a sample, which are AMD susceptibility markers common in Asians.

[0008] The present invention provides the following: [1] A method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids in a sample, comprising a detection step of simultaneously amplifying and detecting nucleic acid regions containing each SNP in the same system, wherein the detection step uses a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, and which have the following characteristics 1) to 3): 1) the probe length is 8 to 29 mer; 2) the artificial nucleic acids are 1 to 12; and 3) the probe has a fluorophore at one terminal region and a quencher at the other terminal region. [2] The method of [1], wherein the detection step involves multiplex PCR using a first primer set for amplifying the ARMS2 gene or a fragment thereof containing s10490924, and a second primer set for amplifying the complement factor H (CFH) gene or a fragment thereof containing rs800292. [3] The method of [1] or [2], wherein the artificial nucleic acid is a locked nucleic acid (LNA). [4] The method of [3], wherein at least one base adjacent to the binding site of the SNP to be detected in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe is LNA. [5] The method of any of [1] to [4], wherein the sample is a blood sample, saliva, oral mucosal scraping, tissue sample, or other body fluid sample. [6] The method according to any one of [1] to [5], wherein the sample is saliva or oral mucosal scraping, does not include a nucleic acid purification step, and includes a step of amplifying and detecting multiple SNPs including rs10490924 and rs800292.[7] A reagent or kit for detecting single nucleotide polymorphisms (SNPs) of rs800292 and rs10490924, comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof containing rs10490924; a second primer set for amplifying the CFH gene or a fragment thereof containing rs800292; and a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, and have the following characteristics 1) to 3): 1) the probe length is 8 to 29 mer; 2) the artificial nucleic acid is 1 to 12; and 3) the reagent or kit has a fluorophore at one terminal region and a quencher at the other terminal region. [8] The reagent or kit according to [7], wherein the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe are contained in the same container and are used for multiplex PCR. [9] The reagent or kit according to [7] or [8], wherein the artificial nucleic acid is LNA.

[10] The reagent or kit according to any of [7] to [9], wherein the reagent or kit is used to detect the SNPs rs800292 and rs10490924 in nucleic acids in a sample.

[11] The reagent or kit according to

[10] , wherein the sample is a blood sample, saliva, oral mucosal scraping, tissue sample, or other body fluid sample.

[12] The reagent or kit according to any of [9] to

[11] , wherein at least one base adjacent to the binding site of the SNP to be detected in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe is LNA. This specification incorporates the disclosure of Japanese Patent Application No. 2023-149783, from which the present application claims priority.

[0009] According to the present invention, it is possible to provide a method and a reagent that can simultaneously and efficiently detect the rs10490924 and rs800292 alleles of a nucleic acid in a sample.

[0010] 5-1 is a graph showing the results of SNP detection of purified DNA fragments in Example 1. The numbers in the figure indicate Cq values. This is a continuation of Figure 5-1. Fig. 5-2 is a graph showing the results of SNP detection by multiplex PCR of saliva samples in Example 2. The numbers in the figure indicate Cq values. Fig. 5-3 is a graph showing the results of SNP detection by multiplex PCR of saliva samples in Example 2. The numbers in the figure indicate Cq values. Fig. 5-4 is a graph showing the results of SNP detection by commercially available SNP detection reagents in saliva samples in Example 2. The numbers in the figure indicate Cq values.

[0011] 1. Definitions The terms used herein are defined below. In this specification, "%" indicating a concentration refers to "% by weight" unless otherwise specified. In this specification, "subject" refers to a human unless otherwise specified. In this specification, "sample" includes all samples containing nucleic acids that can be used for genome analysis. As used herein, the term "nucleic acid" generally includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), but in this specification, it refers to DNA unless otherwise specified.

[0012] As used herein, a "reagent" refers to a single component, and may be in the form of a single composition housed in a single container, for example. As used herein, a "kit" refers to a multiple component, and may be in the form of multiple compositions housed separately in multiple containers, for example. Hereinafter, unless otherwise required, "reagent" and "kit" will also be referred to as "reagents, etc."

[0013] As used herein, a single nucleotide polymorphism (SNP) is a mutation in which only one nucleotide differs between individuals of the same species, and includes a major allele present in many individuals and a minor allele present in a small number of individuals. Since human chromosomes are typically diploid, there are two alleles per SNP. Therefore, there are individuals with major / major or minor / minor homozygotes and individuals with major / minor heterozygotes.

[0014] The rs number is a globally recognized SNP ID assigned by the US National Center for Biotechnology Information (NCBI) to identify variants in the human genome.

[0015] As used herein, "rs10190924" refers to a SNP located at position 122454932 of human chromosome 10 (reference genome GRCh38.p14). rs10190924 is located at position 280 of the base sequence of the human AMD susceptibility locus 2 (ARMS2 gene) (SEQ ID NO: 2 (NCBI Reference Sequence: NG_011725.1, Gene ID: 387715)), which corresponds to the 69th amino acid substitution (A69S) of the amino acid sequence of age-related maculopathy susceptibility protein 2 (SEQ ID NO: 5).

[0016] As used herein, "rs800292" refers to a SNP present at position 196673103 of human chromosome 1 (Reference Genome GRCh38.p14). rs800292 is present at position 21226 of the gene encoding human complement factor H (CFH) (NCBI Reference Sequence: NG_007259.1, GeneID:3075). The base sequence from positions 20226 to 22225 of the CFH gene is shown in SEQ ID NO: 4. The amino acid sequence of the CFH protein (UniProtKB / Swiss-Prot: P08603.4) is shown in SEQ ID NO: 6. The SNP of rs800292 corresponds to the amino acid substitution at position 62 of the amino acid sequence of SEQ ID NO: 6 (I62V).

[0017] 2. Method for detecting AMD-associated SNPs 2-1. Overview A first embodiment of the present invention is a method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292. The method of this embodiment is a method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids in a sample, and is characterized in that the method includes a detection step of simultaneously amplifying and detecting nucleic acid regions containing each SNP in the same system, and the detection step uses a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, and that have the following characteristics 1) to 3). 1) The probe length is 8 to 29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

[0018] The method of this embodiment enables the simultaneous amplification and detection of two SNPs associated with AMD in the same system, thereby enabling simpler, faster, and more accurate analysis of the association between a subject and AMD. The association with AMD referred to here is not limited to, but includes, for example, the subject's risk of developing AMD, resistance to AMD treatment, etc.

[0019] 2-2. Sample The sample to be detected by the method of this embodiment is preferably a sample taken from a human subject outside the body. Examples of "samples" include blood (whole blood, blood cell components, etc.), saliva, oral mucosal scrapings, tissue samples, and other body fluid samples. In particular, blood samples (whole blood, blood cell components), saliva, and oral mucosal scrapings, which are likely to contain the target genomic nucleic acid, are preferably used. When using a blood sample, it is preferable to separate the blood sample into blood cell components and plasma components by centrifugation or the like, wash and lyse the blood cell components, and then purify the nucleic acid. Nucleic acid purification from blood cell components can be performed using commercially available kits such as QIAamp DNA Blood Mini Kit (Qiagen), NucleoSpin (registered trademark) Blood (Takara Bio Inc.), and Blood Genomic DNA Isolation Mini Kit (Norgen). When saliva or oral mucosal scrapings are used, they may be lysed and nucleic acid purified in the same manner as blood samples. However, since saliva and oral mucosal scrapings contain fewer types and amounts of components other than the target nucleic acid than blood cells, and in particular, contain less nuclease, they can be subjected to the amplification and detection steps without undergoing the lysis and purification steps.

[0020] 2-3. Multiplex PCR The method of this embodiment requires simultaneous amplification of two regions on the genome. The target regions may be amplified by any nucleic acid amplification method, such as PCR, LAMP, or SDA. More specifically, the method is carried out using multiplex PCR. The components required for multiplex PCR are described below.

[0021] 2-3-1. Primers In the method of this embodiment, a primer set for amplifying a region containing rs10490924 (hereinafter referred to as the first primer set) and a primer set for amplifying a region containing rs800292 (hereinafter referred to as the second primer set) are used simultaneously in the same system. The first primer set is preferably a primer set for amplifying the ARMS2 gene (SEQ ID NO: 1 or 2) or a fragment thereof containing rs10490924. The second primer set is preferably a primer set for amplifying the CFH gene or a fragment thereof containing rs800292 (e.g., SEQ ID NO: 3 or 4). The nucleotide sequences of the G allele (SEQ ID NO: 1) and T allele (SEQ ID NO: 2) of the ARMS2 gene, and the A allele (SEQ ID NO: 3) and G allele (SEQ ID NO: 4) of the CFH gene fragment are shown in Table 1. SEQ ID NO: 3 and SEQ ID NO: 4 represent fragments from bases 20226 to 22225 of the CFH gene. The nucleotide sequences listed in Table 1 also include intron sequences. Table 2 also shows the amino acid sequence of age-related maculopathy susceptibility protein 2 (SEQ ID NO: 5) and the amino acid sequence of CFH (SEQ ID NO: 6).

[0022]

[0023]

[0024] The primer set for amplifying the ARMS2 gene or a fragment thereof is not particularly limited as long as it has a sequence capable of amplifying a region containing rs10490924, but is preferably designed to amplify a region of approximately 40 to 1000 bases in length. For example, the following primer set can be used: Forward primer: AAGCAGAGGGAGCAAACTGTC (SEQ ID NO: 7) Reverse primer: GGCTGGTTAAAATGCAAGCTG (SEQ ID NO: 8)

[0025] The primer set for amplifying the CFH gene or a fragment thereof is not particularly limited as long as it has a sequence that amplifies a region containing rs800292, but it is preferable to design it so as to amplify a region of about 40 to 1000 bases in length. For example, the following primer set can be used: Forward primer: GCAATGAACTTCCTCCAAG (SEQ ID NO: 9) Reverse primer: GGATTAAGAGCAACCCATTC (SEQ ID NO: 10)

[0026] The primer set may be bound to a labeling substance or may contain an artificial nucleic acid, as long as it does not inhibit nucleic acid amplification or interfere with the labeling of the nucleic acid probe described below.

[0027] 2-3-2. Nucleic Acid Probes In the method of this embodiment, at least four types of nucleic acid probes are used: a probe for detecting the ARMS2 G allele (also referred to herein as the "first nucleic acid probe"), a probe for detecting the ARMS2 T allele (also referred to herein as the "second nucleic acid probe"), a probe for detecting the CFH A allele (also referred to herein as the "third nucleic acid probe"), and a probe for detecting the CFH G allele (also referred to herein as the "fourth nucleic acid probe"). Each nucleic acid probe has the following characteristics: 1) the probe length is 8 to 29 mer; 2) it contains 1 to 12 artificial nucleic acids; and 3) it has a fluorophore at one terminal region and a quencher at the other terminal region. The present inventors have found that by using nucleic acid probes having characteristics 1) to 3) in multiplex PCR, SNPs can be detected with high sensitivity and alleles can be identified with high accuracy. If the probe length is too short, sensitivity decreases, and if the probe length is too long, alleles cannot be identified with high accuracy. Furthermore, if the amount of artificial nucleic acid (specifically, artificial nucleic acid having higher stability than normal) is too small or too large, SNP detection and identification cannot be performed with high accuracy.

[0028] Each nucleic acid probe preferably has a site that binds to the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a 3- to 14-mer nucleic acid sequence on both sides of the SNP-binding site. The nucleic acid probe has a fluorophore at one end region and a quencher at the other end region. Examples of fluorophores include fluorescent dyes such as FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. The quencher used is a fluorescent dye that emits fluorescence at a wavelength that interferes with the fluorescence wavelength emitted from the fluorophore. This ensures that when the fluorophore and quencher are in close proximity, the fluorophore signal remains in an interfered state. For example, when the fluorophore is ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, SY-21, etc. are used; when the fluorophore is FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, TQ2, etc. are used. The types of fluorophores and quenchers are not particularly limited as long as the above relationship is satisfied, and any known fluorophores can be used. However, when using four types of probes as in the method of this embodiment, it is necessary to select fluorescent dyes so that the fluorescent signal of each fluorophore does not interfere with the fluorescent signal of other fluorophores and so that the fluorescent wavelengths do not overlap. The quencher bound to the nucleic acid probe does not need to be only one at the terminal region; additional quenchers may be bound to regions other than the terminal region.

[0029] When a probe having a fluorophore or quencher at each terminal region is placed in a PCR reaction system, it is degraded by the endonuclease activity of DNA polymerase during nucleic acid amplification, thereby increasing the distance between the fluorophore and quencher bound to the probe and making the fluorescent signal from the fluorophore detectable. Such probes are also referred to in the art as TaqMan® probes.

[0030] In this embodiment, the length of the nucleic acid probe is 8 to 29 mer, preferably 12 to 25 mer, more preferably 14 to 20 mer.

[0031] The nucleic acid probe used in the method of this embodiment has 1 to 12, preferably 2 to 10, and more preferably 3 to 7, artificial nucleic acids among its constituent nucleic acids. It is preferable that the artificial nucleic acid has higher stability (e.g., higher nuclease resistance) and higher binding affinity to the target nucleic acid than ordinary nucleic acids. Examples of such artificial nucleic acids include locked nucleic acids (LNA), 2'-fluorinated nucleic acids, 2'-ethoxyethyl (MOE) nucleic acids, 2'-OMe nucleic acids, and peptide nucleic acids. Preferably, the artificial nucleic acid is LNA.

[0032] In the nucleic acid probe, it is preferable that at least one of the bases adjacent to the SNP binding site is LNA. Furthermore, it is preferable that the SNP binding site is LNA. It is preferable that other artificial nucleic acids (preferably LNA) are arranged at regular intervals.

[0033] 1 to 4 show the detection results of each target nucleic acid under various conditions in which the length of the nucleic acid probe and the number of LNAs were changed when multiplex PCR was performed using samples containing four types of template DNA fragments: the G allele and T allele of the ARMS gene, and the A allele and G allele of the CFH gene. The conditions indicated by "◯" are conditions under which the target alleles can be identified.

[0034] Figure 1 shows the conditions for the probe (first nucleic acid probe) for detecting the ARMS2 G allele and the results of detection of the ARMS2 G allele. From Figure 1, it can be seen that the probe for detecting the ARMS2 G allele preferably has a probe length of 8 to 21 mer and contains 1 to 10 LNAs. The first nucleic acid probe can be, for example, a nucleic acid probe having the following sequences: CAGCTGCTAAAA (SEQ ID NO: 11) CCAGCTGCTAAAATC (SEQ ID NO: 12) TCCCAGCTGCTAAAATCC (SEQ ID NO: 13)

[0035] The first nucleic acid probe may have the base sequence of SEQ ID NO: 11, of which 4 to 9 bases are LNA. The first nucleic acid probe may have, for example, the following structure: CAG+C+T+G+CTAAAA CAG+C+T+G+C+TAAAA CAG+C+T+G+C+T+AAAA CAG+C+T+G+C+T+A+AAA CA+G+C+T+G+C+T+A+AAA C+A+G+C+T+G+C+T+A+AAA The "+" above indicates the LNA portion.

[0036] The first nucleic acid probe may have the base sequence of SEQ ID NO: 12, of which 3 to 7 bases are LNA. The first nucleic acid probe may have, for example, the following structure: CCAGCT+G+CTAAAA+TC CCAGC+T+G+CTAAAA+TC CCA+GC+T+G+CTAAAA+TC CCA+GC+T+G+CTAA+AA+TC CCA+GC+T+G+C+TAA+AA+TC The "+" in the above indicates the LNA portion.

[0037] The first nucleic acid probe may have the base sequence of SEQ ID NO: 13, of which 1 to 3 bases are LNA. The first nucleic acid probe may have, for example, the following structures: TCCCAGCT+GCTAAAATCC TCCC+AGCT+GCTAAAA+TCC TCCCAGCT+GCTA+AAATCC The "+" above indicates the LNA portion.

[0038] Figure 2 shows the conditions for the probe (second nucleic acid probe) for detecting the ARMS2 T allele and the results of detection of the ARMS2 T allele. From Figure 2, it can be seen that the probe for detecting the ARMS2 T allele preferably has a probe length of 10 to 22 mer and contains 1 to 12 LNAs. The second nucleic acid probe can be, for example, a nucleic acid probe having the following sequences: CAGCTTCTAAAA (SEQ ID NO: 14) CCAGCTTCTAAAATC (SEQ ID NO: 15) TCCCAGCTTCTAAAATCC (SEQ ID NO: 16)

[0039] The second nucleic acid probe may have the base sequence of SEQ ID NO: 14, of which 6 to 12 bases are LNA. The second nucleic acid probe may have, for example, the following structure: CAG+C+T+T+C+T+AAAA CA+GC+T+T+C+T+AA+AA +CA+GC+T+T+C+T+AA+AA +CA+G+C+T+T+C+T+AA+AA +CA+G+C+T+T+C+T+A+A+AA +C+A+G+C+T+T+C+T+A+A+AA +C+A+G+C+T+T+C+T+A+A+A+A The "+" above indicates the LNA portion.

[0040] The second nucleic acid probe may have the base sequence of SEQ ID NO: 15, of which 4 to 9 bases are LNA. The second nucleic acid probe may have, for example, the following structure: CCAG+CT+T+CTAAAA+TC CCAG+C+T+T+CTAAAA+TC CCAG+C+T+T+CTAA+AA+TC CCA+G+C+T+T+CTAA+AA+TC CCA+G+C+T+T+C+TAA+AA+TC CC+AG+C+T+T+C+T+AA+AAT+C The "+" above indicates the LNA portion.

[0041] The second nucleic acid probe may have the base sequence of SEQ ID NO: 16, of which 1 to 5 bases are LNA. The second nucleic acid probe may have, for example, the following structure: TCCCAGCT+TCTAAAATCC TCCCAGCT+T+CTAAAATCC TCCCAGC+T+T+CTAAAATCC TCCCAGC+T+T+CTAAA+ATCC TCC+CAGC+T+T+CTAAA+ATCC The "+" in the above indicates the LNA portion.

[0042] 3 shows the conditions for the probe (third nucleic acid probe) for detecting the CFH A allele and the results of detecting the CFH A allele. From FIG. 3, it can be seen that the probe for detecting the CFH A allele preferably has a probe length of 12 to 25 mer and contains 3 to 12 LNAs. The third nucleic acid probe can be, for example, a nucleic acid probe having the following sequences: ATTATTATATTTCCA (SEQ ID NO: 17) ACCATTATTATATTTCCA (SEQ ID NO: 18) CATACCATTATTATATTTCCAAGAG (SEQ ID NO: 19)

[0043] The third nucleic acid probe may have the base sequence of SEQ ID NO: 17, with 10 to 12 of these bases being LNA. The third nucleic acid probe may have, for example, the following structure: AT+T+A+T+T+A+T+A+T+T+TCCA AT+T+A+T+T+A+T+A+T+T+T+CCA A+T+T+A+T+T+A+T+A+T+T+T+CCA The "+" above indicates the LNA portion.

[0044] The third nucleic acid probe may have the base sequence of SEQ ID NO: 18, of which 6 to 10 bases are LNA. The third nucleic acid probe may have, for example, the following structure: ACCA+TTAT+T+A+T+ATT+TCCA ACCA+TT+AT+T+A+T+ATT+TCCA ACCA+TT+AT+T+A+T+ATT+TC+CA ACCAT+T+A+T+T+A+T+A+T+TTCCA ACCAT+T+A+T+T+A+T+A+T+T+TCCA The "+" in the above indicates the LNA portion.

[0045] The third nucleic acid probe may have the base sequence of SEQ ID NO: 19, of which 3 to 4 bases are LNA. The third nucleic acid probe may have, for example, the following structure: CATACCATTA+TTA+TATT+TCCAAGAG CATACCATTAT+T+A+T+ATT+TCCAAGAG The "+" above indicates the LNA portion.

[0046] 4 shows the conditions for the probe (fourth nucleic acid probe) for detecting the CFH G allele and the results of detecting the CFH G allele. From FIG. 4, it can be seen that the probe for detecting the CFH G allele preferably has a probe length of 11 to 29 mer and 1 to 12 LNAs. The fourth nucleic acid probe can be, for example, a nucleic acid probe having the following sequence: ATTATTACATTTCCA (SEQ ID NO: 20) CCATTATTACATTTCCAAG (SEQ ID NO: 21) CATACCATTATTACATTTCCAAGAG (SEQ ID NO: 22)

[0047] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 20, of which 7 to 12 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure: ATTA+T+T+A+C+A+T+TTCCA ATT+A+T+T+A+C+A+T+TTCCA ATT+A+T+T+A+C+A+T+T+TCCA ATT+A+T+T+A+C+A+T+T+T+CCA AT+T+A+T+T+A+C+A+T+T+T+CCA A+T+T+A+T+T+A+C+A+T+T+T+CCA The "+" above indicates the LNA portion.

[0048] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 21, of which 4 to 9 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure: CCAT+TATTA+C+ATTTCCA+AG CCAT+TATT+A+C+ATTTCCA+AG CCA+T+TATT+A+C+ATTTCCA+AG CCA+T+TATT+A+C+ATTT+CCA+AG CCA+T+TA+TT+A+C+ATTT+CCA+AG CCA+T+TA+TT+A+C+ATTT+CCA+AG The "+" in the above indicates the LNA portion.

[0049] The fourth nucleic acid probe may have the base sequence of SEQ ID NO: 22, of which 1 to 5 bases are LNA. The fourth nucleic acid probe may have, for example, the following structure: CATACCATTATTA+CATTTCCAAGAG CATACCATTATTA+CATT+TCCAAGAG CATACCA+TTATTA+CATT+TCCAAGAG C+ATACCA+TTATTA+CATT+TCCAAGAG C+ATACCA+TTAT+TA+CATT+TCCAAGAG The "+" above indicates an LNA portion.

[0050] 2-3-3. Other Components In addition to the above primers and nucleic acid probes, the multiplex PCR system contains components used in conventional PCR. Specifically, these include DNA polymerase, deoxyribonucleotide triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), and pH buffers. Other components may also be included as needed, such as KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, and UNG.

[0051] 2-4. Steps The method of this embodiment includes the detection step, but may also include a sample pretreatment step prior to the detection step. It may also include an evaluation step of evaluating the relevance of the subject to AMD based on the detection results. Each step is outlined below.

[0052] 2-4-1. Pretreatment Step The method of this embodiment may include a sample pretreatment step. In the case of samples such as blood or tissue, since they contain many components other than nucleic acids, such as proteins and lipids, it is desirable to extract and purify nucleic acids from the sample as a pretreatment. The method for nucleic acid extraction is not particularly limited, and any known method may be used. For example, the phenol-chloroform method, spin column method, alkaline extraction method, ion exchange column method, magnetic bead method, etc. are known.

[0053] When the sample is saliva or oral mucosal scraping, the above extraction and purification steps may be omitted. In this case, pretreatment such as dilution with a buffer solution (e.g., Tris-EDTA buffer solution) may be performed.

[0054] 2-4-2. Amplification and Detection Step The nucleic acids in the pretreated sample are amplified and detected using the primer set and nucleic acid probe. Preferably, the amplification and detection are performed using multiplex PCR. In multiplex PCR, in order to detect the G allele and T allele of rs10490924 and the A allele and G allele of rs800292 in a single system, the following components are present in a single system: - sample (pretreated sample if pretreatment is performed) - the two primer sets (first primer set, second primer set) - the four nucleic acid probes (first nucleic acid probe, second nucleic acid probe, third nucleic acid probe, and fourth nucleic acid probe) - DNA polymerase (DNA polymerase having reverse transcription activity if the nucleic acid to be detected is RNA) - dNTPs (dATP, dTTP or dUTP, dGTP, and dCTP) - divalent metal ions (for example, magnesium ions) - pH buffer solution (for example, Tris-EDTA buffer solution) - others, for example, KCl, UNG (when dUTP is used)

[0055] The equipment used for multiplex PCR is not particularly limited, and any known thermal cycler for real-time PCR can be used. For example, CronoSTAR 96 (manufactured by Clontech), LightCycler (registered trademark) 96 (manufactured by Roche Diagnostics), CFX Opus (registered trademark) 96 Real-Time PCR System (manufactured by Bio-Rad), QuantStudio (registered trademark) 5 Real-Time PCR System (manufactured by Thermo Fisher Scientific), etc. can be used. The temperature settings of the thermal cycler can be appropriately set according to conventional methods within the range of 90 to 99°C for the denaturation temperature and 50 to 70°C for the annealing temperature. The number of temperature cycles can be appropriately set to about 30 to 50 cycles. Multiplex PCR can be used to determine the presence or absence of the G allele and T allele of rs10490924 and the A allele and G allele of rs800292 in a sample.

[0056] The detection results of the G allele and T allele of rs10490924 and the A allele and G allele of rs800292 obtained in the amplification and detection step can assist in the evaluation of the association between a subject and AMD. The association between a subject and AMD can assist in the evaluation of, for example, the subject's risk of developing AMD and the subject's resistance to AMD treatment.

[0057] 2-4-4. Other Steps If the nucleic acid to be detected in the sample is DNA, the sample after pretreatment can be amplified and detected, but if the nucleic acid is RNA, a reverse transcription reaction step must be performed before amplification and detection. The form of the reverse transcription reaction is not particularly limited, but typically, in the same system as the amplification and detection, a reverse transcriptase (e.g., M-MLV Reverse Transcriptase, AMV Reverse Transcriptase, etc.) or a DNA polymerase with reverse transcription activity (e.g., Tth polymerase) is used, and the RNA is reacted at a temperature of about 37 to 72°C for several minutes to 10 minutes before the amplification and detection cycle, thereby obtaining cDNA complementary to the RNA.

[0058] To prevent carryover contamination of PCR products, uracil DNA glycosylase (UNG) may be added to the amplification and detection system. In this case, dUTP is used instead of dTTP as the dNTP, and an UNG reaction step is performed before the amplification and detection cycle (or before the reverse transcription reaction if a reverse transcription reaction is performed). The UNG reaction step can be performed at a temperature of approximately 37°C for several minutes to 10 minutes. The UNG reaction can degrade PCR products that have been contaminated into the sample due to carryover before the amplification and detection step. UNG is then inactivated by heating to the denaturation temperature, so it does not degrade the newly generated target PCR product.

[0059] The method of this embodiment provides optimal conditions for simultaneously detecting two SNPs, and therefore, the method of this embodiment makes it possible to easily detect, in one tube, two important SNPs that are useful indicators for preventing or treating AMD in a subject.

[0060] 3. Reagent or Kit for Detecting AMD-Associated SNPs A second embodiment of the present invention is a reagent or kit for detecting single nucleotide polymorphisms (SNPs) rs800292 and rs10490924. The reagent or kit of this embodiment is characterized by comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof containing rs10490924; a first primer set for amplifying the CFH gene or a fragment thereof containing rs800292; and a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, having the following characteristics 1) to 3): 1) The probe length is 8 to 29 mer; 2) The artificial nucleic acid is 1 to 12; and 3) It has a fluorophore at one end region and a quencher at the other end region.

[0061] The reagent or kit (reagent, etc.) of this embodiment is preferably a reagent, etc. that is applied to multiplex PCR in which rs800292 and rs10490924 are simultaneously amplified and detected in the same system. In the reagent, etc. of this embodiment, the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe may be stored separately in multiple containers, but are preferably stored in the same container. By storing the primer set and the nucleic acid probes in the same container as a single composition, the complicated process of quantifying and mixing each primer set and nucleic acid probe can be omitted.

[0062] The reagent etc. of this embodiment includes a primer set (first primer set) for amplifying a region containing rs10490924 and a primer set (second primer set) for amplifying a region containing rs800292. The first primer set is preferably a primer set for amplifying the ARMS2 gene (SEQ ID NO: 1 or 2) or a fragment thereof containing rs10490924. The second primer set is preferably a primer set for amplifying the CFH gene or a fragment thereof containing rs800292 (SEQ ID NO: 3 or 4).

[0063] The first primer set is not particularly limited, and for example, the following primer set can be used: Forward primer: AAGCAGAGGGAGCAAACTGTC (SEQ ID NO: 7) Reverse primer: GGCTGGTTAAAATGCAAGCTG (SEQ ID NO: 8) The second primer set is not particularly limited, and for example, the following primer set can be used: Forward primer: GCAATGAACTTCCTCCAAG (SEQ ID NO: 9) Reverse primer: GGATTAAGAGCAACCCATTC (SEQ ID NO: 10)

[0064] The reagents etc. of this embodiment include at least four types of nucleic acid probes: a probe for detecting the ARMS2 G allele (first nucleic acid probe), a probe for detecting the ARMS2 T allele (second nucleic acid probe), a probe for detecting the CFH A allele (third nucleic acid probe), and a probe for detecting the CFH G allele (fourth nucleic acid probe). Each nucleic acid probe has the following characteristics: 1) a probe length of 8 to 29 mer; 2) 1 to 12 artificial nucleic acids; and 3) a fluorophore at one terminal region and a quencher at the other terminal region.

[0065] Each nucleic acid probe preferably has a site that binds to the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a 3- to 14-mer nucleic acid sequence on both sides of the SNP-binding site at the center. The nucleic acid probe has a fluorophore at one end region and a quencher at the other end region. Examples of fluorophores include fluorescent dyes such as FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. As the quencher, a fluorescent dye that emits fluorescence at a wavelength that interferes with the fluorescence wavelength emitted from the fluorophore is used. For example, when the fluorophore is ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, or SY-21 is used, and when the fluorophore is FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, TQ2, or the like is used. The types of fluorophore and quencher are not particularly limited as long as the above relationship is satisfied, and any known fluorophore and quencher can be used.

[0066] In the reagent etc. of this embodiment, the length of the nucleic acid probe is 8 to 29 mer, preferably 12 to 25 mer, more preferably 14 to 20 mer.

[0067] In this embodiment, the nucleic acid probe has 1 to 12, preferably 2 to 10, and more preferably 3 to 7, of its constituent nucleic acids being artificial nucleic acids. Examples of such artificial nucleic acids include locked nucleic acid (LNA), 2'-fluorinated nucleic acid, 2'-ethoxyethyl (MOE) nucleic acid, 2'-OMe nucleic acid, and peptide nucleic acid. Preferably, the artificial nucleic acid is LNA.

[0068] In the nucleic acid probe, it is preferable that at least one of the bases adjacent to the SNP binding site is LNA. Furthermore, it is preferable that the SNP binding site is LNA. It is preferable that other artificial nucleic acids (preferably LNA) are arranged at regular intervals.

[0069] The reagents of this embodiment are used to detect the SNPs rs800292 and rs10490924 in nucleic acids in a sample. The kit of this embodiment may also include a reagent solution for pretreating the sample before nucleic acid amplification. The sample is not particularly limited as long as it contains nucleic acids, but a sample (biological sample) taken from a human subject is preferred. Examples of biological samples include, but are not limited to, blood samples (whole blood, blood cell components, etc.), saliva, oral mucosal scrapings, tissue samples, and other body fluid samples. When using a blood sample, it is preferable to purify nucleic acids according to conventional methods. On the other hand, when using saliva or oral mucosal scrapings, they can be subjected to the amplification and detection process without undergoing a lysis and purification process.

[0070] The reagents and the like of this embodiment may contain other components necessary for multiplex PCR, such as DNA polymerase, deoxyribonucleotide triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), pH buffers, KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, UNG, and the like.

[0071] Unless otherwise specified, or unless otherwise contradicted, each component contained in the reagents of this embodiment has the same composition as each component described in Section "2-3. Multiplex PCR." The reagents of this embodiment can be applied to the method of the first embodiment of the present invention.

[0072] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0073] Example 1: Investigation of SNP detection system using purified DNA fragments I (1) Preparation of template DNA The template DNA fragments shown in Table 3 were chemically synthesized. Each template DNA was mixed to prepare a template DNA solution so that the ARMS2 gene and the CFH gene each had a concentration of 1,000 copies / μL. Table 4 shows the genotypes contained in each template DNA solution (samples 1 to 9).

[0074]

[0075]

[0076] (2) Preparation of primer-probe mix Two primer sets and four types of nucleic acid probes shown in Table 5 were chemically synthesized and prepared into 50 μM solutions in 0.5×TE buffer, and then mixed in the proportions shown in Table 6 to prepare primer-probe mixes.

[0077]

[0078]

[0079] (3) Multiplex PCR A PCR reaction solution was prepared by mixing 6 μL of a commercially available master mix containing Taq DNA polymerase, 5 μL of the primer-probe mix, 5 μL of each template DNA solution for Samples 1 to 9, and 9 μL of water (nuclease-free). A blank solution was also prepared by substituting water (nuclease-free) for the template DNA solution. The final concentration of template DNA was 5,000 copies / test, the final concentration of primers was 200 nM, and the final concentration of probe was 100 nM. The PCR reaction solution was placed in a LightCycler 96 (Roche Diagnostics) and heated at 95°C for 1 minute, followed by 45 cycles of 95°C for 5 seconds and 58°C for 30 seconds.

[0080] The amplification results for each template DNA are shown in Figures 5-1 and 5-2. It was confirmed that all genotypes could be detected with high accuracy.

[0081] Example 2: Examination of SNP detection system using purified DNA fragments II (1) Preparation of template DNA A template DNA solution was prepared in the same manner as in Example 1.

[0082] (2) Preparation of primer-probe mix Two primer sets and four types of nucleic acid probes shown in Table 7 were chemically synthesized and prepared into 50 μM solutions in 0.5×TE buffer, and then mixed in the proportions shown in Table 6 to prepare primer-probe mixes.

[0083]

[0084] (3) Multiplex PCR: A PCR reaction solution was prepared by mixing 25 μL of Multiplex PCR Mix 2 from a Multiplex PCR Assay Kit (manufactured by Takara Bio Inc.), 0.25 μL of Multiplex PCR Mix 1, 10 μL of the primer-probe mix, 5 μL of each template DNA solution from Samples 1 to 9, and 9.75 μL of water (nuclease-free). A blank solution was also prepared by substituting water (nuclease-free) for the template DNA solution. The final concentration of template DNA was 5,000 copies / test, the final concentration of primers was 200 nM, and the final concentration of probes was 100 nM. The PCR reaction solution was placed in a CronoSTAR 96 (Clontech) and heated at 95°C for 1 minute, followed by 45 cycles of 95°C for 5 seconds and 58°C for 30 seconds.

[0085] As a result of amplifying each template DNA, it was confirmed that all genotypes could be detected with high accuracy, as in Example 1.

[0086] Example 3: Investigation of SNP detection system using saliva samples I

[0087] (1) Sample Preparation SNP detection was performed using three saliva samples collected from humans. The SNP genotypes of each sample were identified in advance by sequencing. The saliva samples were diluted and heat-treated.

[0088] (2) Preparation of Primer-Probe Mix The primer-probe mix was prepared in the same manner as in Example 1.

[0089] (3) Multiplex PCR A PCR reaction solution was prepared by mixing 6 μL of a commercially available master mix containing Taq DNA polymerase, 5 μL of the primer-probe mix, 5 μL of pretreated saliva sample, and 9 μL of water (nuclease-free). A blank solution was also prepared by substituting nuclease-free water for the saliva sample. The final primer concentration was 200 nM, and the final probe concentration was 100 nM. The PCR reaction solution was loaded into a LightCycler 96 and heated at 95°C for 1 minute, followed by 45 cycles of 95°C for 5 seconds and 58°C for 30 seconds.

[0090] (4) SNP detection using commercially available SNP detection reagents SNP detection of saliva samples was performed using TaqMan SNP Genotyping Assays (manufactured by Roche Diagnostics) corresponding to rs10490924 and rs800292 according to the manufacturer's instructions. The structures of each SNP detection probe are shown in Table 8.

[0091]

[0092] A PCR reaction mixture was prepared by mixing 12.5 μL of 2x TaqMan Genotyping Master Mix, 5 μL of TaqMan SNP Genotyping Assays corresponding to each SNP, 5 μL of the pretreated saliva sample (1), and 6.25 μL of water (nuclease-free). A blank solution was also prepared by substituting water (nuclease-free) for the saliva sample. The PCR reaction mixture was not a multiplex PCR, but rather a one-tube detection system for one SNP. The PCR reaction mixture was placed in a LightCycler 96 and heated at 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute.

[0093] Figure 6 shows the results of the multiplex PCR in (3), and Figure 7 shows the results of the PCR in (4). It was confirmed that the multiplex PCR in (3), performed according to the method of the present invention, could accurately measure the genotypes of the three saliva samples, specimens 1 to 3. On the other hand, in SNP detection using a commercially available product, a G signal was detected in a sample with an ARMS2 / CFH genotype of TT / AA. Furthermore, compared with the method of the present invention, the Cq values ​​were generally higher, suggesting lower sensitivity. From the above, it was confirmed that the method of the present invention can also be applied to the measurement of clinical specimens and is capable of simultaneously detecting two SNPs highly associated with AMD. It was also shown that the method of the present invention has higher sensitivity and accuracy than conventional products.

[0094] Example 4: Study of SNP detection system using saliva samples II

[0095] (1) Sample Preparation SNP detection was performed using three saliva samples collected from humans. The SNP genotypes of each sample were identified in advance by sequencing. The saliva samples were diluted and heat-treated.

[0096] (2) Preparation of Primer-Probe Mix The primer-probe mix was prepared in the same manner as in Example 2.

[0097] (3) Multiplex PCR: A PCR reaction solution was prepared by mixing 25 μL of Multiplex PCR Mix 2, 0.25 μL of Multiplex PCR Mix 1, 10 μL of the primer-probe mix, 5 μL of pretreated saliva sample, and 9.75 μL of water (nuclease-free) from a Multiplex PCR Assay Kit (manufactured by Takara Bio Inc.). A blank solution was also prepared by substituting nuclease-free water for the saliva sample. The final primer concentration was 200 nM, and the final probe concentration was 100 nM. The PCR reaction solution was loaded into a LightCycler 96 and heated at 95°C for 1 minute, followed by 45 cycles of 95°C for 5 seconds and 58°C for 30 seconds.

[0098] Similar to the results of the multiplex PCR in Example 2 (3), it was confirmed that the genotypes of the saliva samples from three subjects, Samples 1 to 3, could be accurately measured. All publications, patents, and patent applications cited in this specification are incorporated herein by reference in their entirety.

Claims

1. A method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in a nucleic acid in a sample, comprising a detection step of simultaneously amplifying and detecting a nucleic acid region containing each SNP in the same system, wherein the detection step uses a first nucleic acid probe and a second nucleic acid probe that hybridize to a region containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to a region containing the A allele and G allele of rs800292, respectively, and which have the following characteristics 1) to 3): 1) the probe length is 8 to 29 mer; 2) there are 1 to 12 artificial nucleic acids; and 3) there is a fluorophore at one terminal region and a quencher at the other terminal region.

2. The method of claim 1, wherein the detection step involves multiplex PCR using a first primer set for amplifying the ARMS2 gene or a fragment thereof comprising s10490924, and a second primer set for amplifying the complement factor H (CFH) gene or a fragment thereof comprising rs800292.

3. The method of claim 1, wherein the artificial nucleic acid is a locked nucleic acid (LNA).

4. The method according to claim 3, wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first, second, third and fourth nucleic acid probes is LNA.

5. The method of claim 1, wherein the sample is a blood sample, saliva, buccal scraping, tissue sample or other bodily fluid sample.

6. The method of claim 1, wherein the sample is saliva or an oral mucosal scraping, does not include a nucleic acid purification step, and includes a step of amplifying and detecting multiple SNPs including rs10490924 and rs800292.

7. A reagent or kit for detecting single nucleotide polymorphisms (SNPs) of rs800292 and rs10490924, comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof containing rs10490924; a second primer set for amplifying the CFH gene or a fragment thereof containing rs800292; and a first nucleic acid probe and a second nucleic acid probe that hybridize to regions containing the G allele and T allele of rs10490924, respectively, and a third nucleic acid probe and a fourth nucleic acid probe that hybridize to regions containing the A allele and G allele of rs800292, respectively, and have the following characteristics 1) to 3): 1) the probe length is 8 to 29 mer; 2) there are 1 to 12 artificial nucleic acids; and 3) there is a fluorophore at one terminal region and a quencher at the other terminal region.

8. The reagent or kit according to claim 7, wherein the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe and the fourth nucleic acid probe are contained in the same container and are applicable to multiplex PCR.

9. The reagent or kit according to claim 7, wherein the artificial nucleic acid is an LNA.

10. The reagent or kit according to claim 7, which is used to detect the SNPs rs800292 and rs10490924 in a nucleic acid in a sample.

11. The reagent or kit of claim 10, wherein the sample is a blood sample, saliva, oral mucosal scraping, tissue sample or other body fluid sample.

12. The reagent or kit according to claim 9, wherein at least one of the bases adjacent to the binding site of the SNP to be detected in the first, second, third and fourth nucleic acid probes is LNA.

Images