Exosomes comprising mirna pool based on inhibition of TGF-β signaling involved in cancer growth and metastasis, and composition comprising same for inhibiting cancer metastasis

Abstract

The present invention relates to exosomes comprising an miRNA pool based on the inhibition of TGF-β signaling involved in cancer growth and metastasis. The exosomes, which are derived from tripartite motif containing 40 (TRIM40) transformed cells treated with staurosporine, comprise a pool of miRNAs that inhibit the expression of ECM- and EMT-related genes, the miRNAs include miR-1343-3p (which inhibits the expression of TGBR1 and TGFBR2), miR-4285 (which inhibits the expression of the TGFB1 gene), and miR-194-3p (which inhibits the TGF-beta signaling pathway), which inhibit the TGF-beta signaling pathway in cancer cells, thereby comprehensively blocking the expression of EMT- and ECM-related genes by surpassing a one-dimensional method of loading one specific miRNA or a small molecule that exhibits anticancer activity so as to inhibit TGF-beta signaling pathways when the miRNAs are absorbed and delivered into cancer cells, and thus the cancer microenvironment is modulated such that strong anticancer responses can be induced in preclinical settings.

Description

Exosomes comprising a MIRNA POOL based on inhibition of TGF-β signaling involved in cancer growth and metastasis, and a composition for inhibiting cancer metastasis comprising the same

[0001] The present invention relates to an exosome having a miRNA pool based on suppression of TGF-β signaling involved in cancer growth and metastasis, and more particularly, to a composition for preventing, improving or treating cancer comprising the exosome.

[0002]

[0003] Cancer is the leading cause of death in Korea. The primary cause of death from cancer is metastasis, which is cancer that has spread to other organs, with a much higher mortality rate than the primary cancer.

[0004] Metastatic cancer refers to a new tumor formed when cancer cells that have dislodged from the primary tumor invade surrounding blood vessels or lymphatic vessels and travel long distances to other parts of the body. Since metastases from the primary tumor account for over 90% of cancer deaths, suppressing metastases is as crucial as treating the primary tumor to improve mortality rates.

[0005] The mechanism by which cancer cells acquire motility during metastasis is explained by the epithelial-to-mesenchymal transition (EMT), in which tumor epithelial cells acquire mesenchymal characteristics through genetic mutations. These epithelial cells, now possessing mesenchymal characteristics, weaken intercellular junctions, displace their original sites, and migrate toward blood vessels. These cells, having migrated through the blood vessels, then regain their original epithelial characteristics (MET), colonizing secondary sites and contributing to tumor growth.

[0006] Furthermore, the tumor microenvironment (ECM) of cancer produces excessive amounts of TGF-β, which causes excessive changes in the signaling pathways of cancer cells, adversely affecting the interactions between cancer cells and the tumor-stroma. If cross-talk between cells is not performed normally, a permissive stroma is created, creating an environment in which cancer cells can easily spread. TGF-β secreted from cancer cells induces cancer cells to undergo EMT and cells with cancer stem cell-like phenotypes, facilitating metastasis. TGF-β activates various transcriptional regulators, including SNAI1 / 2, Twist, and ZEB1 / 2 (Massague 2012).

[0007] As explained above, the entire metastatic process of cancer cells has not been clearly identified, but it is known that metastatic progression of cancer is promoted by mutations in the TGF-β (regulating growth, migration, differentiation, and apoptosis of epithelial and hematopoietic cells) signaling pathway (TGF-β paradox), and therapeutic agents that consider this as a target to prevent cancer growth and metastasis are being developed. For example, treatments based on TGF-β signal inhibition, such as Galunisertib (LY2157299), a small molecule that inhibits the activity of TGF-β type 1 receptor kinase, have been developed. However, due to the complex mechanism of action of the TGF-β signaling pathway, it has been confirmed that simply inhibiting the expression or function of a single factor does not produce sufficient effects or shows limited efficacy.

[0008] To solve these problems, the present invention attempted to develop an exosome having a miRNA pool that suppresses the TGF-beta signaling pathway in cancer cells, and as a result, the present invention was completed.

[0009]

[0010] The present invention has been conceived in consideration of the above-described problems, and an object of the present invention is to provide an exosome derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine and a method for producing the same.

[0011] Another object of the present invention is to provide a composition for improving, preventing or treating cancer, which contains the exosome as an active ingredient.

[0012]

[0013] To achieve the above object, the present invention provides exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0014] According to an embodiment of the present invention, the exosome may inhibit the formation of a tumor microenvironment (ECM) and epithelial-mesoderm transition (EMT) of cancer cells.

[0015] Additionally, the exosomes may contain TRIM40 protein and miRNAs associated with inhibition of TGF-β signaling.

[0016] According to another embodiment of the present invention, the miRNAs associated with the inhibition of TGF-β signaling may include miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, miR-652-5p, miR-107, and miR-331-3p.

[0017] According to another embodiment of the present invention, the exosomes may have expression levels of miR-411-5p and miR-183-3p that are 10 to 16 times lower than those of STS-treated TRIM40-untransformed cells.

[0018] In order to achieve the above other purposes, the present invention provides a pharmaceutical composition for preventing or treating cancer, which contains the exosome as an active ingredient.

[0019] According to another embodiment of the present invention, the composition may inhibit cancer metastasis by inhibiting the TGF-β signaling pathway of cancer cells, thereby forming a tumor microenvironment (ECM) and an epithelial-mesoderm transition (EMT).

[0020] According to another embodiment of the present invention, the cancer may be at least one selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, skin or ocular melanoma, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, leukemia, uterine sarcoma, anal cancer, fallopian tube cancer, small intestine cancer, endocrine cancer, parathyroid cancer, kidney cancer, soft tissue tumor, urethral cancer, bronchial cancer, and bone marrow cancer.

[0021] In order to achieve the above-described further object, the present invention provides a food composition for improving or preventing cancer, which comprises the exosome as an effective ingredient.

[0022] In order to achieve the above-described further object, the present invention provides a method for producing the exosome, comprising the following steps.

[0023] A. Step of producing a cell line transformed with TRIM40 (Tripartite Motif Containing 40);

[0024] B. A step of treating the transformed cell line with staurosporine; and

[0025] C. A step of extracting and isolating exosomes from the culture medium of the above staurosporine-treated cells.

[0026] According to another embodiment of the present invention, the staurosporine may be treated at a concentration of 1 to 100 nM.

[0027]

[0028] According to the present invention, exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine contain a pool of miRNAs that suppress the expression of ECM and EMT-related genes, such as miR-1343-3p (which suppresses the expression of TGBR1 and TGFBR2), miR-4285 (which suppresses the expression of TGFB1 gene), and miR-194-3p (which suppresses the TGF-beta signaling pathway), which suppress the TGF-beta signaling pathway in cancer cells. Therefore, beyond the one-dimensional method of loading a single specific miRNA or a small molecule having anticancer activity, when these are absorbed and delivered to cancer cells, they suppress the TGF-beta signaling pathway, thereby blocking the expression of EMT and ECM-related genes overall, thereby modulating the cancer microenvironment and inducing a strong anticancer response in preclinical studies.

[0029]

[0030] Figure 1 shows the immunofluorescence staining results for STS (Staurosporine)-treated / untreated TRIM40-overexpressing HT29 cell lines and HEK293T cell lines (GFP-TRIM40, +STS, no treat) and STS-treated / untreated HT29 cell lines and HEK293T cell lines (Mock).

[0031] Figure 2 shows the MS analysis performed on proteins binding to TRIM40 protein from TRIM40 overexpressing HT29 cell line (GFP-TRIM40), and the results are displayed as a histogram.

[0032] FIG. 3 is a schematic diagram illustrating a method for producing exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine according to the present invention.

[0033] Figure 4 shows the results of Western blotting for GFP, CD63, and vinculin in exosomes and whole cell lysates (WCL) isolated from STS-untreated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40 +) and HT29 cell lines (GFP-TRIM40 -).

[0034] Figure 5 shows the results of Western blotting for GFP, CD63, CD9, HSP70, and GM130 in exosomes and whole cell lysates (WCL) isolated from STS-treated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40 +) and HT29 cell lines (GFP-TRIM40 -).

[0035] Figure 6 shows the immunofluorescence staining results for STS-treated / untreated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40) and STS-treated / untreated HT29 cell lines (Mock).

[0036] Figure 7 shows the results of various immunofluorescence staining observed by enlarging the STS-treated TRIM40 overexpressing HT29 cell line (GFP-TRIM40).

[0037] Figure 8 shows the results of optical and fluorescence microscopy images taken at 0, 3, 6, and 9 hours after treatment of HT29 cells with PKH26-labeled STS-untreated TRIM40-containing exosomes (GFP-TRIM40_exo_treatment).

[0038] Figure 9 is an experimental design diagram for analyzing changes in gene expression of cancer cells to confirm changes in cancer cells after exosomes derived from STS-treated / untreated TRIM40-overexpressing HT29 cell lines are absorbed into cancer cells (Experimental Example 5).

[0039] Figure 10 shows the results of genetic analysis when HT29 cells were treated with exosomes derived from TRIM40-overexpressing HT29 cell lines treated / untreated with STS (TRIM40+STS_exo, TRIM40_exo) and exosomes derived from HT29 cell lines treated / untreated with STS (Mock+STS_exo, Mock_exo), respectively. HT29 cells that were not treated with anything were used as the normal group (No treat).

[0040] Figure 11 shows the results of Gene Ontology analysis using the DAVID program, an online analysis database, of genes that showed significant expression changes in HT29 cells treated with TRIM40-overexpressing HT29 cell line-derived exosomes (TRIM40_exo) and HT29 cells treated with HT29 cell line-derived exosomes (Mock_exo).

[0041] Figure 12 is a heat map analyzing the expression levels of ECM and EMT-related genes when HT29 cells were treated with exosomes derived from TRIM40-overexpressing HT29 cell lines treated / untreated with STS (TRIM40+STS_exo, TRIM40_exo) and exosomes derived from HT29 cell lines treated / untreated with STS (Mock+STS_exo, Mock_exo), respectively. HT29 cells that were not treated with anything were used as the normal group (No treat).

[0042] Figure 13 is a graph comparing miRNA gene expression of STS-treated Mock-derived exosomes (Mock+STS_exo) and STS-treated TRIM40-overexpressing HT29 cell line-derived exosomes (T40+STS_exo).

[0043] Figure 14 shows the results of analyzing mRNAs targeted by miRNAs present in exosomes derived from STS-treated TRIM40-overexpressing HT29 cell lines.

[0044]

[0045] Below, various aspects and various implementation examples of the present invention will be examined in more detail.

[0046] The purposes, other objectives, features, and advantages of the present invention will be readily understood through the following preferred embodiments, illustrated in the accompanying drawings. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the embodiments introduced herein are provided to ensure that the disclosure is thorough and complete, and to sufficiently convey the spirit of the present invention to those skilled in the art.

[0047] In this specification, terms such as “include” or “have” are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood not to exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0048] In this specification, when a range is described for a variable, the variable will be understood to include all values ​​within the described range including the described endpoints of the range. For example, the range "5 to 10" will be understood to include the values ​​5, 6, 7, 8, 9, and 10, as well as any subranges such as 6 to 10, 7 to 10, 6 to 9, 7 to 9, etc., and any value between integers that fall within the described range, such as 5.5, 6.5, 7.5, 5.5 to 8.5, and 6.5 to 9. Also, for example, a range of "10% to 30%" would be understood to include all integers up to and including 30%, as well as any subranges such as 10% to 15%, 12% to 18%, 20% to 30%, etc., and any value between reasonable integers within the stated range, such as 10.5%, 15.5%, 25.5%, etc.

[0049] Hereinafter, the present invention will be described in detail.

[0050] One aspect of the present invention relates to exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0051] The above staurosporine may be treated at a concentration that does not affect cell death and cell growth. For example, it may be treated at a concentration of 100 nM or less, 50 nM or less, or 30 nM or less, and more specifically, it may be treated at a low concentration of 1 nM to 100 nM.

[0052] In the present invention, "exosome" refers to a small membrane-structured vesicle secreted from various cells, which is released into the extracellular environment through the fusion of a multivesicular body and the plasma membrane. The exosome may be derived from or isolated from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0053] The exosomes may have a diameter of 50 to 150 nm. Additionally, the exosomes may be included at a concentration of 1 to 50 μL / ml.

[0054] The above exosomes may contain proteins and nucleic acids capable of suppressing the expression of genes associated with tumor microenvironment (ECM) formation and epithelial-mesoderm transition (EMT) formation in cancer cells. Specifically, the exosomes suppress tumor microenvironment (ECM) formation and epithelial-mesoderm transition (EMT) formation in cancer cells, and are characterized by overexpression of TRIM40 protein and miRNA expression levels associated with inhibition of TGF-β signaling.

[0055] In the present invention, “overexpression” means that the expression level of TRIM40 protein and miRNA related to inhibition of TGF-β signaling is at least twice that of a comparison target cell (e.g., normal cells in the organ or cancer cells not treated with anything) when the expression level is measured using a suitable expression analysis method.

[0056] The miRNA associated with the above TGF-β signaling inhibition may be at least one selected from the group consisting of miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, miR-652-5p, miR-107, and miR-331-3p, and may include all of the above miRNAs.

[0057] Among the miRNAs related to the inhibition of the above TGF-β signaling, the expression levels of miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, and miR-652-5p are 4 to 11 times higher in exosomes derived from STS-treated TRIM40-transformed cells than in exosomes derived from STS-treated non-TRIM40-transformed cells, and the expression levels of miR-411-5p and miR-183-3p are 10 to 16 times lower in exosomes derived from STS-treated non-TRIM40-transformed cells than in exosomes derived from STS-treated non-TRIM40-transformed cells.

[0058] That is, even if staurosporine is treated in the same manner, it was confirmed that a miRNA pool is not formed in exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells in the case of normal cells. In addition, even if cells are transformed to overexpress TRIM40 (Tripartite Motif Containing 40) protein, if staurosporine is not treated, a sufficient cancer metastasis inhibition effect cannot be obtained because the miRNA pool that suppresses the TGF-β signaling pathway is not included. Therefore, it is most preferable that the exosomes according to the present invention are derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0059] Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating cancer comprising the exosome as an active ingredient.

[0060] "Cancer," the subject disease of the present invention, is a general term for diseases caused by cells that have aggressive characteristics, such as dividing and growing while ignoring normal growth limits, invasive characteristics, such as infiltrating surrounding tissues, and metastatic characteristics, such as spreading to other parts of the body. In this specification, the term "cancer" may also be used with the same meaning as "malignant tumor" or "malignant ascites."

[0061] The cancer of the present invention is breast cancer, endometrial carcinoma, esophageal cancer, gastric cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, cutaneous or intraocular melanoma, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testis cancer, laryngeal cancer, oral cavity cancer, head or neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, leukemia, bone cancer, uterine sarcoma, anal cancer, At least one selected from the group consisting of fallopian tube carcinoma, small intestine cancer, endocrine cancer, parathyroid cancer, adrenal cancer, soft tissue tumor, urethral cancer, bronchogenic cancer, and bone marrow tumor, but preferably, colon cancer.

[0062] The above colon cancer may include a malignant tumor occurring in one or more sites selected from the group consisting of the ascending colon, transverse colon, descending colon, sigmoid colon, and rectal mucosa. The above colon cancer may be one or more selected from the group consisting of, but is not limited to, adenocarcinoma, lymphoma, malignant carcinoid tumor, leiomyosarcoma, Kaposi's sarcoma, and squamous cell carcinoma.

[0063] The exosomes included as an active ingredient in the composition according to the present invention may be manufactured using cancer cells and normal cells of a cancer patient, i.e., may be autologous, allogenic or xenogenic, and preferably may be autologous.

[0064] The exosome according to the present invention can suppress cancer metastasis by inhibiting the TGF-β signaling pathway of cancer cells, forming a tumor microenvironment (ECM) and an epithelial-mesoderm transition (EMT), reducing cancer proliferation, or preventing cancer drug resistance by lowering cancer resistance to anticancer drugs.

[0065] In the present invention, “treatment” means any act of improving or beneficially changing the symptoms of cancer by administering the composition of the present invention.

[0066] In the present invention, “prevention” means any act in which the possibility of cancer onset is suppressed or delayed by administration of the composition of the present invention.

[0067] The composition can prevent, treat, or improve cancer by inhibiting TGF-β signaling, which induces tumor microenvironment (ECM) and epithelial-mesoderm transition (EMT) of cancer. Specifically, the composition can prevent, treat, or improve cancer by including a miRNA pool that inhibits the expression of genes associated with tumor microenvironment (ECM) formation and epithelial-mesoderm transition (EMT) formation.

[0068] The exosome, which is an effective ingredient of the above composition, contains miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, and miR-652-5p, thereby inhibiting the expression of genes that inhibit TGF-β signaling, such as TGFB1, TGFBR1, and TGFBR2, and preferably inhibiting the expression of TGF-β. As a result, cancer can be prevented, treated, or improved.

[0069] The above composition can prevent, treat or improve cancer by inhibiting the formation of a cancer microenvironment or inhibiting the transformation of cancer cells into mesenchymal cell characteristics.

[0070] In the present invention, 'comprising as an active ingredient' means including an amount sufficient to achieve the efficacy or activity of exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine according to the present invention.

[0071] The above composition may be a pharmaceutical composition. The pharmaceutical composition may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, at least one selected from the group consisting of binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, and flavoring agents for oral administration. In the case of injections, a buffer, preservative, analgesic, solubilizer, isotonic agent, or stabilizer may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, or preservative may be mixed and used.

[0072] The pharmaceutical composition according to the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit dose ampoules or multiple doses, and can also be formulated in the form of solutions, suspensions, tablets, capsules, sustained-release preparations, etc.

[0073] Meanwhile, examples of carriers, excipients or diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate or mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be additionally included.

[0074] Routes of administration for the pharmaceutical composition according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred. The administration may be systemic or local.

[0075] The above "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition according to the present invention may also be administered in the form of a suppository for rectal administration. The above administration may be to administer 0.1 mg to 1,000 mg of the exosome according to the present invention at a single administration, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 20 mg to 100 mg, or 50 mg to 100 mg.

[0076] The dosage of the composition may be, for example, about 0.001 mg / kg to about 1000 mg / kg for adults, for example, about 0.01 mg / kg to about 100 mg / kg, or for example, about 0.1 mg / kg to about 100 mg / kg. The dosage may be administered once a day, multiple times a day, 2 to 3 times a week, 1 to 4 times a month, or 1 to 12 times a year.

[0077] In addition, the pharmaceutical composition may be used in combination with drugs related to cancer prevention or treatment together with exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0078] The above drug may be any one selected from the group consisting of chemotherapeutic agents, targeted anticancer agents, anticancer viruses, antibody therapeutic agents, immunotherapeutic agents (hereinafter, "immune checkpoint inhibitors" can be used interchangeably), and combinations thereof for chemotherapy that can be used in combination with exosomes according to the present invention. Specifically, the chemotherapeutic agent is also called an antitumor drug (Antineoplastic agent) or a cytotoxic agent. It is a general term for drugs that exhibit anticancer activity mainly by directly acting on DNA to block DNA replication, transcription, and translation processes, or by interfering with the synthesis of nucleic acid precursors in metabolic pathways and inhibiting cell division.

[0079] The above chemotherapeutic agents include paclitaxel, doxorubicin, 5-fluorouracil, cisplatin, carboplatin, oxaliplatin, tegafur, irinotecan, docetaxel, cyclophosphamide, cemcitabine, ifosfamide, mitomycin C, vincristine, etoposide, methotrexate, topotecan, tamoxifen, vinorelbine, camptothecin, danuorubicin, Chlorambucil, bryostatin-1, calicheamicin, mayatansine, levamisole, DNA recombinant interferon alfa-2a, mitoxantrone, nimustine, interferon alfa-2a, doxifluridine, formestane, leuprolide acetate, megestrol acetate, carmofur, teniposide, bleomycin, carmustine, heptaplatin, exemestane, anastrozole, Estramustine, capecitabine, goserelin acetate,Polysaccharide potassium, medroxypogesterone acetate, epirubicin, letrozole, pirarubicin, topotecan, altretamine, toremifene citrate, BCNU, taxotere, actinomycin D, anasterozole, belotecan, imatinib, floxuridine, gemcitabine, hydroxyurea, zoledronate, vincristine, flutamide, valrubicin, It may be at least one substance selected from the group consisting of streptozocin, polyethylene glycol conjugated anticancer agents and synthetic analogs thereof, and substances that are modified or exhibit the same pharmacological effect.

[0080] The targeted anticancer drugs include abciximab, adalimumab, basiliximab, bezlotoxumab, canakinumab, daclizumab, denosumab, efalizumab, golimumab, inflectra, natalizumab, and olaratumab. It may be any one selected from the group consisting of omalizumab, palipizumab, panitumumab, trastuzumab, pertuzumab, cetuximab, rituximab, tocilizumab, secukinumab, ustekinumab, bevacizumab, avelumab, CDNs, SB11285, and DMXAA.

[0081] Another aspect of the present invention relates to a food composition for improving or preventing cancer, comprising the exosome as an active ingredient.

[0082] The above 'food composition' includes, in addition to exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine as an active ingredient, food raw materials that can be used as food as described in the Food Code ('Food Code') and food additives described in the Food Additive Code that are commonly used in food manufacturing.

[0083] Although not particularly limited, examples thereof include proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. The carbohydrates may include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, lactose, etc.; oligosaccharides or polysaccharides such as dextrin, corn syrup, cyclodextrin, etc.; and sugar alcohols such as xylitol, sorbitol, erythritol, etc. The flavoring agent may include natural flavoring agents [thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.]) and synthetic flavoring agents (saccharin, aspartame, etc.).

[0084] When preparing a food composition using exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine as an active ingredient, the exosomes do not need to be particularly limited as long as they exhibit cancer prevention or improvement effects, but may be included in amounts of, for example, 0.1 to 99 wt%, 0.5 to 95 wt%, 1 to 90 wt%, 2 to 80 wt%, 3 to 70 wt%, 4 to 60 wt%, and 5 to 50 wt%.

[0085] In the above food composition, the exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with the active ingredient staurosporine may vary depending on the condition, weight, presence or severity of the disease, and duration of the ingestion, but may be appropriately selected by a person skilled in the art. For example, based on the daily dosage, it may be 1 to 5,000 mg, preferably 5 to 2,000 mg, more preferably 10 to 1,000 mg, still more preferably 20 to 800 mg, and most preferably 50 to 500 mg. The number of administrations need not be particularly limited, but may be adjusted by a person skilled in the art within the range of 3 times a day to once a week. In the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

[0086] The above food composition need not be particularly limited, but may be, for example, a powder, granule, tablet, capsule, pill, extract, jelly formulation, tea bag formulation, or beverage formulation.

[0087] In addition, exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine can be added to general foods to prevent or improve cancer, and the foods to which they can be added are not particularly limited, but can be added to, for example, confectionery, bread or rice cakes, cocoa products or chocolates, meat or egg products, fish products, tofu or jelly, noodles, tea, coffee, beverages, special-purpose foods, soy sauce, seasonings, dressings, kimchi, salted seafood, pickled foods, braised foods, alcoholic beverages, dried foods, and other foods exemplified in the Food Codex ('Food Code') according to Article 7 of the Food Sanitation Act. Additionally, it can be added to dairy products, processed meat products, packaged meat, and egg products as exemplified in the processing standards and ingredient specifications for livestock products ('Livestock Products Code') according to Article 4 of the Livestock Products Sanitation Management Act.

[0088] Meanwhile, a food composition containing exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine as an active ingredient can be used alone as a “health functional food that helps prevent or improve cancer,” and can be used as a “health functional food that helps suppress cancer metastasis,” a “health functional food that helps suppress cancer resistance to anticancer drugs,” or a “health functional food that helps improve cancer.”

[0089] The above "health functional food" refers to a food manufactured (including processed) in accordance with legal standards using raw materials or ingredients with beneficial functions for the human body (Article 3, Paragraph 1 of the Health Functional Food Act). While the terminology and scope of the above "health functional food" may vary by country, it can be defined as a "dietary supplement" in the United States, a "food supplement" in Europe, a "health functional food" or "food for special health use (FoSHU)" in Japan, or a "health food" in China.

[0090] The above food composition or health functional food may additionally contain food additives, and its suitability as a food additive shall be determined in accordance with the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the ‘Food Additives Code’, unless otherwise provided.

[0091] In addition, the health functional food may be used in combination with a health functional food material related to cancer prevention or improvement, together with exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

[0092] Another aspect of the present invention relates to a method for preparing the exosome, comprising the following steps:

[0093] A. Step of producing a cell line transformed with TRIM40 (Tripartite Motif Containing 40);

[0094] B. A step of treating the transformed cell line with staurosporine; and

[0095] C. A step of extracting and isolating exosomes from the culture medium of the above staurosporine-treated cells.

[0096] In order to secure exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine according to the present invention, they may be prepared through means known in the art, but preferably, they may be prepared through steps A, B, and C.

[0097] First, in step A of producing a cell line transformed with TRIM40 (Tripartite Motif Containing 40), “transformation” means a method of delivering foreign DNA or RNA to a cell to mutate the genetic characteristics of the cell, and this may be a method known in the art, for example, a method of producing a transformed host cell by transducing a gene encoding TRIM40 protein through a physical method, a chemical method, or a genetic method, and then culturing the transformed host cell in the presence of STS, and then obtaining exosomes from the culture medium.

[0098] The above transformation method may be a genetic engineering method using plasmid DNA, RNA, or virus, and may include all generally known methods as well as calcium phosphate transfection, lipofection, electroporation, microinjection, and microprojectile. In the case of eukaryotes, a method of treating cells by mixing DNA with commercially available reagents such as DNA calcium phosphate precipitation or lipofection, PEI, etc. may be used.

[0099] In the present invention, "TRIM40 (Tripartite Motif Containing 40)" is a protein that is an E3 ligase that directly targets ROCK1 (Rho Associated Coiled-Coil Containing Protein Kinase 1), which is involved in promoting cell-cell adhesion, and plays a role in significantly reducing the phosphorylation of key signaling factors important for cortical actin formation and stabilization. TRIM40 expression acts as a pathological cause of chronic intestinal inflammation, and is therefore known as a potential biomarker or therapeutic target for IBD (inflammatory bowel disease).

[0100] In a specific embodiment of the present invention, the inventors inserted a gene (SEQ ID NO: 3) encoding the 258th amino acid from the first amino acid of the human TRIM40 protein into a pMSCV retroviral vector to produce a vector, introduced the vector into HEK293T cells to obtain a retrovirus, and cultured the retrovirus produced therefrom with cancer cells to establish a TRIM40-overexpressing HT29 cell line.

[0101] Cells transformed to overexpress the above TRIM40 protein have overexpression of TRIM40 protein within the cells.

[0102] The above cells may be normal cells or cancer cells. In the case of normal cells, they may be, for example, kidney cells, intestinal epithelial cells, liver cells, uterine cells, gastric cells, skin cells, etc., and in the case of cancer cells, they may be, for example, one or more cancer cells selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, skin or ocular melanoma, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, leukemia, uterine sarcoma, anal cancer, fallopian tube cancer, small intestine cancer, endocrine cancer, parathyroid cancer, kidney cancer, soft tissue tumor, urethral cancer, bronchial cancer, and bone marrow cancer, and preferably, colon cancer cells.

[0103] Next, there is step B, which treats the transformed cell line with staurosporine.

[0104] The above transformed cell line is a cell transformed to overexpress the TRIM40 protein, and is treated with staurosporine.

[0105] The above staurosporine may be administered at a concentration that does not affect cell death or cell growth. This is to optimize exosome formation from TRIM40 (Tripartite Motif Containing 40)-transformed cells. Exosomes derived from TRIM40 (Tripartite Motif Containing 40)-transformed cells that do not induce apoptosis and exhibit normal cell growth due to staurosporine treatment can sufficiently form a pool of miRNAs targeting cancer cells.

[0106] The above-described staurosporine treatment dose may be, for example, a concentration of 100 nM or less, 50 nM or less, or 30 nM or less, and more specifically, a low concentration of 1 nM to 100 nM.

[0107] It is preferable to replace the above step B with a medium that does not contain fetal bovine serum, add STS, and then isolate exosomes after culturing for 2 to 5 days.

[0108] Finally, step C is to extract and isolate exosomes from the culture medium of the staurosporine-treated cells.

[0109] The step of obtaining exosomes from the culture medium of the above-mentioned staurosporine-treated cells may be performed by centrifugation, but is not particularly limited thereto, and may be obtained by any method known in the art. Preferably, the exosomes may be obtained from a pellet obtained by centrifuging the culture medium of the cells in which apoptosis has been induced at least once at 100 g to 20,000 g, and further centrifuging the supernatant after centrifugation at 100,000 g. The method may further include a step of filtering the supernatant using a 0.1 to 0.5 μm filter.

[0110] Hereinafter, the present invention will be described in more detail through examples and the like. However, the scope and content of the present invention should not be construed as being limited or reduced by the examples and the like. Furthermore, based on the disclosure of the present invention, including the examples below, it is clear that those skilled in the art can easily implement the present invention, even though specific experimental results are not presented. It is also natural that such variations and modifications fall within the scope of the appended claims.

[0111] Example: Production of TRIM40-overexpressing colon cancer cell line (GFP-TRIM40-HT29) and normal kidney tissue-derived cell line (HEK293T) and exosome isolation

[0112] DNA construct

[0113] A vector for overexpressing TRIM40 protein was constructed. C-terminally GFP-tagged human TRIM40 was amplified by PCR using the following primers, and the amplified fragment was inserted into the XhoI / BamHI sites downstream of the LTR of MSCV in the pMSCV retroviral vector to generate pMSCV-TRIM40-eGFP: 5'-ATT CTC GAG CCA CCA TGA TCC CTT TGC AGA AGG ACA AC-3' (XhoI-TRIM40; forward; sequence 1) and 5'-AAT GGA TCC GAG CTT CTG AGG GGG CTG AAG-3' (BamHI-TRIM40; reverse; sequence 2). All constructs were verified by sequencing.

[0114] TRIM40 gene: sequence number 3

[0115] 5'-ATGATCCCTTTGCAGAAGGACAACCAGGAGGAGGGTGTCTGCCCCATCTGCCAGGAGAGCCTGAAGGAGGCCGTGAGCACCAACTGCGGACATCTCTTCTGTCGAGTGTGCCTGACACAGCATGTGGAGAAGGCCTCAGCCTCTGGGGTCTTCTGCTGCCCCCTCTGCCGGAAGCCCTGTTCTGAGGAGGTGCTAGGGACAGGCTATATCTGCCCCAACCACCAGAAGAGGGTGTGCAGGTTCTGTGAGGAGAGCAGACTTCTTCTATGTGTGGAATGCCTGGTGTCCCCTGAACACATGTCTCATCATGAACTGACCATTGAAAATGCCCTCAGCCACTACAAGGAACGACTCAATCGCCGGAGCAGGAAGCTCAGAAAGGACATTGCAGAACTTCAGCGGCTCAAGGCTCAGCAGGAGAAGAAACTGCAGGCTCTGCAGTTTCAGGTAGACCACGGGAACCACAGGCTGGAGGCTGGGCCGGAGAGCCAGCACCAAACCAGGGAACAGCTGGGTGCCCTCCCTCAGCAGTGGCTGGGCCAGCTGGAGCACATGCCAGCAGAAGCGGCCAGAATCCTTGACATCTCCAGGGCAGTAACACAGCTCAGAAGCCTGGTCATTGATCTGGAAAGGACGGCCAAGGAATTAGACACCAACACACTGAAGAATGCTGGTGACTTACTGAACAGGAGTGCTCCACAGAAATTAGAGGTTATTTATCCCCAGTTGGAGAAAGGAGTCAGTGAATTGCTTCTTCAGCCCCCTCAGAAGCTC-3'

[0116] *C-말단 GFP 태그 발현을 위해서 TRIM40의 종결코돈은 제거함.

[0117] 레트로바이러스 형질주입

[0118] To produce retroviruses, HEK293T cells were simultaneously transduced with 2.7 ㎍ and 0.3 ㎍ of the retroviral vector pMSCV-TRIM40-eGFP (experimental group) and Gag-Pol and VSVG vectors, respectively, using Omicfect (OmicsBio). After 48 hours, the cell culture medium was collected, filtered using a 0.45 ㎛ filter, and then used in the experiment.

[0119] Cell culture and transfection

[0120] HT-29 cells (HTB-38, American Type Culture Collection; ATCC, Manassas, VA, USA), a human colon cancer cell line, and HEK293T (Human Embryonic Kidney) cells, a human embryonic kidney cell line, were cultured in RPMI-1640 medium and DMEM medium containing 10% heat-inactivated fetal bovine serum (FBS) and penicillin / streptomycin (HyClone, Logan, UT, USA). Cells were cultured in a humidified atmosphere of 5% CO2 at 37°C and passaged every 2–3 days.

[0121] Establishment of TRIM40-overexpressing HT29 and HEK293T cell lines

[0122] HT-29 cells, a human colon cancer cell line, were seeded in 24-well plates until approximately 60% confluent, and the pMSCV-TRIM40-eGFP retrovirus was added together with polybrene and transduced by centrifugation (2200 rpm, 45 min). After incubation for 3–4 hours in a humidified atmosphere of 37°C and 5% CO2, the virus solution was removed, replaced with fresh medium, and the culture was continued. Transduced cells were selected by treatment with 2 μg / ml puromycin. In addition, the expression of GFP (green fluorescent protein) in the transduced cells was confirmed through a fluorescence microscope (LSM 900 confocal laser scanning microscope (Carl Zeiss)), or the expression of TRIM40 was confirmed through Western blotting, qPCR, etc.

[0123] MSCV-Mock HT29 cell lines were prepared in the same manner as described above, except that the MSCV-MOCK retrovirus was prepared using pMSCV-MOCK (empty vector; control) instead of pMSCV-TRIM40-eGFP as a control. In addition, human kidney cells, HEK293T cells, were transduced with pMSCV-TRIM40-eGFP using liposomes when maintained at approximately 60% confluency. GFP (green fluorescent protein) expression was confirmed and intracellular protrusions were formed under a fluorescence microscope (LSM 900 confocal laser scanning microscope (Carl Zeiss)).

[0124] Isolation and purification of exosomes (TRIM40-GFP exo)(+STS, -STS)

[0125] To investigate whether TRIM40 protein exists in exosomes of TRIM40-overexpressing HT29 cells, exosomes were isolated. Exosomes were isolated from the supernatant of TRIM40-overexpressing HT29 cells. Specifically, TRIM40-overexpressing HT29 cells were seeded at 1 × 10^6 to 2 × 10^6 in 100pi cell culture dishes and cultured for 24 h in RPMI 1640 medium (WelGENE lnc., Seul, Korea) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS, HyClone) at 37°C in a 95% air / 5% CO2 incubator. After replacing the culture medium with serum-free media containing less than 100 nM Staurosporine (STS), the cells were cultured for an additional 24 hours. The culture medium was collected, and the cells were removed by centrifugation (500 g, 10 min) to collect the first supernatant. To remove cell debris and extracellular vesicles larger than exosomes, such as microvesicles and apoptotic bodies, from the first supernatant, the cells were centrifuged again at 12,000 g, 20 min to collect the second supernatant. Afterwards, the secondary supernatant was subjected to ultracentrifugation at 100,000 g for 70 minutes to collect the pellet, washed once with PBS (phosphate buffered saline, pH 7.2), and then subjected to ultracentrifugation at 100,000 g for 70 minutes to discard the supernatant and treat with STS to collect the exosomes (TRIM40-GFP exo, +STS) (Fig. 3).

[0126] At this time, exosomes (TRIM40-GFP exo, no treat) were collected in the same manner as above, except that a serum-free medium containing no STS was used as a control group.

[0127] In addition, exosomes (Mock exo, no treat) isolated in the same manner as above were collected, except that the MSCV-Mock HT29 cell line and serum-free medium not containing STS were used as a control, and exosomes (Mock exo, +STS) isolated in the same manner as above were collected, except that the MSCV-Mock HT29 cell line was used as a second comparative group.

[0128] Experimental example

[0129] Experimental Example 1: Functional Analysis of TRIM40 Protein

[0130] In order to confirm TRIM40 protein expression in TRIM40-overexpressing HT29 cell lines, TRIM40-overexpressing HT29 and HEK293T cell lines were seeded at 2 × 10 per well in a 6-well plate (Falcon) with a cover slip. 5Cells were seeded to the required number and cultured for 24 hours in a 95% air / 5% CO2 incubator at 37℃, then treated with Staurosporine (STS) at 100 nM or less, and further cultured for 24 hours for HT29 and 6 hours for HEK293T. The cells were washed once with PBS (phosphate buffered saline, pH 7.2), and fixed for 10 minutes at room temperature with 3.7% formaldehyde solution diluted in PBS. After washing the fixative three times with PBS, permeabilization was performed for 10 minutes at room temperature with 0.2% Triton X-100 solution diluted in PBS, and then washed three times with PBS. Afterwards, the cells were blocked with 2% bovine serum albumin (PBA) diluted in PBS for 1 hour at room temperature, washed once with PBS, and then reacted with anti-α-tubulin (Santa Cruz Biotechnology, sc-23948) antibody diluted in PBA at a concentration of 1:200 for 1 hour at room temperature. After the reaction, the cells were washed three times with PBS and reacted again with Alexa Fluor 488-conjugated secondary mouse antibody (ThermoFisher, A-11029) diluted in PBA at a concentration of 1:200 for 1 hour at room temperature. For nuclear staining, DAPI (1:1000, Sigma-Aldrich) was stained for 1 minute at room temperature. Cells were observed using an LSM 900 confocal laser scanning microscope (Carl Zeiss).

[0131] Figure 1 shows the results of immunofluorescence staining for STS (Staurosporine)-treated / untreated TRIM40-overexpressing HT29 and HEK293T (GFP-TRIM40, +STS, no treat) and STS-treated / untreated HT29 and HEK293T (Mock).

[0132] As shown in Fig. 1, when treated with STS, TRIM40-overexpressing HT29 and HEK293T cell lines (GFP-TRIM40) showed normal cell growth and proliferation without cell death, and, unlike HT29 or HEK293T cell lines (Mock), a new type of protruding body (lamellipodia) was observed to be formed that specifically extended from the center of the cell.

[0133] In addition, when the location of TRIM40 protein was confirmed within the cell, it was confirmed that the location of TRIM40 protein was mainly cytoplasmic in TRIM40-overexpressing HT29 and HEK293T cell lines, but it was confirmed that TRIM40 protein was present in large quantities within protrusion bodies in TRIM40-overexpressing HT29 and HEK293T cell lines treated with STS.

[0134] The above results confirmed that TRIM40 protein induces the formation of a new type of protrusion body within cells under STS treatment conditions.

[0135] Figure 2 shows the results of analyzing the proteins analyzed using Gene Ontology, after performing Co-immunoprecipitation (Co-IP) from TRIM40 overexpressing HT29 cell line (GFP-TRIM40), silver staining was performed, and the band fragments showing differences from the HT29 cell line (Mock) were cut from the SDS-PAGE gel and subjected to MS analysis.

[0136] As shown in Figure 2, binding of proteins associated with extracellular vesicles, particularly extracellular exosomes, was observed. Therefore, the TRIM40 protein is thought to have a function related to exosomes.

[0137] Experimental Example 2: Presence or absence of TRIM40 protein in exosomes

[0138] TRIM40-containing exosomes (TRIM40-GFP exo) (+STS, no treat) and mock exosomes (Mock exo) (+STS, no treat) were prepared. Western blot was performed to confirm whether exosomes were properly isolated.

[0139] To extract proteins from the exosomes, 30 μl of RIPA lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1% NP-40, 0.1% SDS, 1 mM Ethylenediaminetetraacetic acid [EDTA], 2 mM MgCl2, 50 mM N-Ethylmaleimide [NEM]) containing protease inhibitors was treated per sample, centrifuged at 13,000 rpm, 4 °C for 10 minutes, and the supernatant was collected and quantified. After that, the sample was loaded onto a 10% polyacrylamide gel, electrophoresis was performed, and the protein was transferred to a polyvinylidene difluoride (PVDF) membrane (Milipore). Then, the membrane was blocked with 5% skim milk containing 0.1% Tween 20 diluted in PBS (PBS-T). Then, the primary antibodies against CD63, CD9, HSP70, GM130, and GFP were diluted 1:1,000 and treated overnight at 4°C. After washing three times for 10 minutes with PBS-T buffer, the membrane was reacted with the secondary antibody for 1 hour at room temperature. Next, the membrane was washed three times for 10 minutes with PBS-T buffer, and the protein bands were confirmed using enhanced chemiluminescence (ECL) detection reagent (Advansta).

[0140] Figure 4 shows the results of Western blotting for GFP, CD63, and vinculin in exosomes and whole cell lysates (WCL) isolated from STS-untreated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40 +) and HT29 cell lines (GFP-TRIM40 -).

[0141] As shown in Fig. 4, TRIM40 protein was observed in WCL of TRIM40 overexpressing HT29 cell line (GFP-TRIM40 +), and in particular, TRIM40 protein was also observed in exosomes.

[0142] Figure 5 shows the results of Western blotting for GFP, CD63, CD9, HSP70, and GM130 in exosomes and whole cell lysates (WCL) isolated from STS-treated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40 +) and HT29 cell lines (GFP-TRIM40 -).

[0143] As shown in Fig. 5, the bands of CD9, CD63, and HSP70, which are markers of exosomes, were confirmed in the exosomes of both TRIM40-overexpressing HT29 cell lines (GFP-TRIM40 +) and HT29 cell lines (GFP-TRIM40-), and the band of GM130, a negative marker of exosomes, was not confirmed, confirming that exosomes were successfully isolated from both cell lines. At this time, since TRIM40 protein was observed in the exosomes of the TRIM40-overexpressing HT29 cell line (GFP-TRIM40+), it was confirmed that TRIM40 protein was contained in the exosomes derived from the TRIM40-overexpressing HT29 cell line (GFP-TRIM40+) in both STS-treated and untreated situations.

[0144] We confirmed that TRIM40 protein was not observed anywhere in the HT29 cell line (GFP-TRIM40 -).

[0145] Experimental Example 3: Induction of a Novel Type of Protrusion Body Formation and Exosome Biogenesis by TRIM40 Protein

[0146] TRIM40 overexpressing HT29 cell line (GFP-TRIM40) and HT29 cell line (GFP-TRIM40) were seeded at 2 × 10 per well in a 6-well plate (Falcon) with a cover slip. 5 Cells were seeded to the number of dogs, cultured for 24 hours in a 37℃, 95% air / 5% CO2 incubator, and then treated / untreated with 100 nM of STS (Staurosporine), cultured for an additional 24 hours, washed once with PBS (phosphate buffered saline, pH 7.2), and fixed for 10 minutes at room temperature with 3.7% formaldehyde solution diluted in PBS. After washing the fixative three times with PBS, permeabilization was performed for 10 minutes at room temperature with 0.1% Triton X-100 solution diluted in PBS, and then washed three times with PBS. Afterwards, the cells were blocked with 2% bovine serum albumin (PBA) diluted in PBS for 1 hour at room temperature, washed once with PBS, and then reacted with α-ceramide and α-EEA-1 antibodies diluted in PBA at a concentration of 1:200 for 1 hour at room temperature. After the reaction, the cells were washed three times with PBS and reacted with Alexa Fluor 568 / 647-conjugated secondary mouse / rabbit antibodies diluted in PBA at a concentration of 1:200 for 1 hour at room temperature. For nuclear staining, DAPI (1:1000, Sigma Aldrich) was stained for 1 minute at room temperature. Cells were observed using an LSM 900 confocal laser scanning microscope (Carl Zeiss).

[0147] Figure 6 shows the immunofluorescence staining results for STS-treated / untreated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40) and STS-treated / untreated HT29 cell lines (Mock), and Figure 7 shows the immunofluorescence staining results observed in various ways by enlarging the STS-treated TRIM40-overexpressing HT29 cell lines (GFP-TRIM40).

[0148] As shown in Figures 6 and 7, the STS-treated TRIM40-overexpressing HT29 cell line (GFP-TRIM40) did not affect cell death or cell growth, and it was confirmed that the content of EEA-1 (early endosome), which forms exosomes, was present in large quantities within newly formed protrusions together with TRIM40 protein. In addition, it was confirmed that ceramide, which is involved in exosome formation, was present in large quantities within the protrusions compared to other control cells.

[0149] In STS-treated TRIM40-overexpressing HT29 cell line (GFP-TRIM40), ceramide, EEA-1, and TRIM40 proteins were all colocalized within the protrusions, suggesting that the biogenesis of exosomes (apoptotic exosomes) occurs actively within the protrusions formed by TRIM40 protein without affecting cell death or proliferation.

[0150] Experimental Example 4: Analysis of intracellular distribution of exosomes derived from STS-treated TRIM40-overexpressing HT29 cell lines.

[0151] We aimed to determine whether exosomes (GFP-TRIM40_exo_treatment) isolated from TRIM40-overexpressing HT29 cell lines were transported and taken up into HT29 cells. To this end, exosomes (GFP-TRIM40_exo_treatment) isolated from TRIM40-overexpressing HT29 cell lines were labeled with PKH26 (Sigma, St. Louis, USA) according to the manufacturer's protocol.

[0152] After treating HT29 cells with PKH26-labeled TRIM40-containing exosomes (GFP-TRIM40_exo_treatment), the cells were photographed using an optical microscope and a fluorescence microscope at 0, 3, 6, and 9 hours.

[0153] Figure 8 shows the results of optical and fluorescence microscopy images taken at 0, 3, 6, and 9 hours after treatment of HT29 cells with PKH26-labeled TRIM40-containing exosomes (GFP-TRIM40_exo_treatment).

[0154] As shown in Fig. 8, red fluorescence (PKH26-labeled TRIM40-containing exosomes (GFP-TRIM40_exo_treatment)) was observed within HT-29 cells over time. This confirmed that PKH26-labeled TRIM40-containing exosomes (GFP-TRIM40_exo_treatment) were successfully transported and taken up into colon cancer cells.

[0155] Experimental Example 5: Anticancer effect of exosomes derived from HT29 cell lines overexpressing TRIM40 treated / untreated with STS.

[0156] To determine the changes in cancer cells after exosomes from STS-treated / untreated TRIM40-overexpressing HT29 cells were taken up by cancer cells, we analyzed changes in gene expression in cancer cells. To this end, we analyzed Gene Ontology using RNA sequencing.

[0157] HT29 cells were seeded at a density of 2x10^5 cells / well in 6-well plates and cultured for 24 hours. STS-treated / untreated TRIM40-containing exosomes (GFP-TRIM40_exo) and STS-treated / untreated Mock-derived exosomes (Mock_exo) were added to each well and cultured for 20 hours.

[0158] After harvesting each of the above cells, total RNA was extracted using an RNA preparation kit (Enzynomics), and DNA was removed from the extracted RNA using an RNeasy mini kit (Qiagen) to remove DNA contamination. The library was synthesized using the TruSeq Stranded mRNA Library Prep Kit according to the manufacturer's protocol, and sequencing was performed using the Illumina platform. To reduce the bias of the analysis results, a preprocessing step was performed to remove adapter sequences, contaminant DNA, etc., and the expression profile was extracted using the FPKM (Fragments Per Kilobase of transcript per Million mapped reads) / RPKM (Reads Per Kilobase of transcript per Million mapped reads) and TPM (Transcripts Per Kilobase Million) values, which are normalized values ​​that consider the read count value and transcript length of each sample. The log2 (TPM) value was used to compare gene expression levels, and the biological process was analyzed using Gene Ontology.

[0159] Figure 9 is an experimental design diagram for analyzing changes in gene expression of cancer cells to confirm changes in cancer cells after exosomes derived from STS-treated / untreated TRIM40-overexpressing HT29 cell lines are absorbed into cancer cells (Experimental Example 5).

[0160] Figure 10 shows the results of genetic analysis when HT29 cells were treated with exosomes derived from TRIM40-overexpressing HT29 cell lines treated / untreated with STS (TRIM40+STS_exo, TRIM40_exo) and exosomes derived from HT29 cell lines treated / untreated with STS (Mock+STS_exo, Mock_exo), respectively. HT29 cells that were not treated with anything were used as the normal group (No treat).

[0161] As shown in Fig. 10, the significant difference in gene expression observed in HT-29 cells treated with exosomes (Mock_exo) derived from the normal group (No treat) and STS-untreated HT29 cell line was set as background noise because it was caused by the exosome itself.

[0162] HT29 cells treated with exosomes derived from STS-treated / untreated TRIM40-overexpressing HT29 cell lines (TRIM40+STS_exo, TRIM40_exo) and STS-treated HT29 cell line-derived exosomes (Mock+STS_exo) showed significant changes in gene expression compared to HT-29 cells treated with exosomes derived from STS-untreated HT29 cell lines (Mock_exo).

[0163] Figure 11 shows the results of Gene Ontology analysis using the DAVID program, an online analysis database, to determine significant gene expression changes in HT-29 cells treated with exosomes derived from STS-untreated TRIM40-overexpressing HT29 cell lines (TRIM40_exo) and HT-29 cells treated with exosomes derived from STS-untreated HT29 cell lines (Mock_exo).

[0164] As shown in Fig. 11, it was confirmed that in HT29 cells treated with exosomes (TRIM40_exo) derived from STS-untreated TRIM40-overexpressing HT29 cell lines, there was a significant change in the expression of genes related to extracellular structure organization and extracellular matrix organization, which are essential for cancer cell growth and metastasis.

[0165] Figure 12 is a heat map analyzing the expression levels of ECM and EMT-related genes when HT29 cells were treated with exosomes derived from TRIM40-overexpressing HT29 cell lines treated / untreated with STS (TRIM40+STS_exo, TRIM40_exo) and exosomes derived from HT29 cell lines treated / untreated with STS (Mock+STS_exo, Mock_exo), respectively. HT29 cells that were not treated with anything were used as the normal group (No treat).

[0166] As shown in Fig. 12, it was confirmed that specifically, exosomes derived from TRIM40 overexpressing HT29 cell lines that were not treated with STS (TRIM40_exo) selectively inhibited the expression of ECM and EMT-related genes in colon cancer cells, and in particular, it was confirmed that this phenomenon appeared similarly when treated with STS (Mock+STS_exo, TRIM40+STS_exo). Therefore, it was confirmed that, compared to cases where nothing was treated or HT29 cell line-derived exosomes (Mock_exo) were treated, the expression of extracellular matrix (ECM)-related genes and EMT marker genes expressed in cancer cells was significantly reduced when the exosomes according to the present invention were treated.

[0167] Cancer cells are known to increase the overall expression of extracellular matrix (ECM) components such as collagen, glycoproteins, and metalloproteases (MMPs) to abnormally accelerate the process of extracellular matrix (ECM) remodeling. Furthermore, in cancer cells, the epithelial-mesenchymal transition (EMT) is activated, a reversible cellular program that transforms epithelial cells from an E (epithelial) state closer to an M (mesenchymal) state, which is known to cause cancer metastasis and anticancer drug resistance.

[0168] Most conventional anticancer drugs target specific enzymes in cancer cells and aim to kill them, but do not target the fundamental cause, which has led to problems such as relapse or difficulty in achieving actual efficacy due to resistance.

[0169] Accordingly, the 'exosome' according to the present invention suppresses the formation of extracellular matrix around cancer cells, which is the support base for cancer cell growth, and suppresses the expression of ECM and EMT-related genes themselves to prevent activation as E-state epithelial cells, thereby suppressing cancer cell proliferation and metastasis and even cell death. In addition, if the cancer cell barrier is not formed by the exosome according to the present invention, the degree of infiltration of immune cells into cancer tissue is improved, and resistance to anticancer drugs is suppressed, so that they can be delivered deep into cancer cells and increase the anticancer effect.

[0170] Furthermore, it is expected that the 'exosome' according to the present invention can be used as a cancer treatment agent, as an anticancer treatment agent and drug delivery vehicle, as well as a combination drug with an anticancer agent.

[0171] Experimental Example 6: Gene Expression in Exosomes

[0172] To identify miRNAs contained in exosomes derived from STS-treated TRIM40-overexpressing HT29 cell lines, small RNA sequencing analysis was performed.

[0173] After obtaining exosomes derived from STS-treated TRIM40-overexpressing HT29 cell lines (T40+STS) and STS-treated mock-derived exosomes (M+STS), small RNAs (less than 200 nucleotides) were extracted from total RNA using the miRNeasy Micro Kit (Qiagen), which can efficiently extract small RNAs (less than 200 nucleotides) according to the manufacturer's protocol. A library was constructed using the SMARTer smRNA-Seq for Illumina Kit, which selectively generated only RNAs with a size of 0 to 300 nucleotides. Afterwards, sequencing was performed using the Illumina platform, and rRNA (ribosomal RNA) that could interfere with data analysis was removed. miRNAs were analyzed using miRBase v22.1, a non-coding RNA database, RNAcentral 14.0, and miRDeep2.

[0174] Figure 13 is a graph comparing miRNA gene expression of STS-treated Mock-derived exosomes (M +STS) and STS-treated TRIM40-overexpressing HT29 cell line-derived exosomes (T40 + STS).

[0175] As shown in Figure 13, a total of 9 miRNAs were identified that showed significant expression differences in STS-treated TRIM40-overexpressing HT29 cell line-derived exosomes (T40+STS_exo) compared to STS-treated Mock-derived exosomes (Mock+STS_exo).

[0176] Specifically, the expression of seven miRNAs, miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, miR-652-5p, miR-107, and miR-331-3p, increased, while the expression of two miRNAs, miR-411-5p and miR-183-3p, decreased.

[0177] Since it was confirmed through previous experiments that exosomes derived from STS-treated TRIM40-overexpressing HT29 cell lines suppress the expression of ECM-related genes in cancer cells, it was expected that the miRNA also has the activity of suppressing the expression of ECM genes.

[0178] To confirm this, we analyzed the function of miRNAs whose expression levels were increased in exosomes derived from STS-treated TRIM40-overexpressing HT29 cells. miRNAs have the ability to suppress gene expression by binding to the 3'UTR region of target mRNAs through complementary base sequences. Therefore, we analyzed them using sites that predict target genes through miRNA base sequences (miRTarBase, TargetScan, miRDB) (Fig. 14).

[0179] As a result, miR-1343-3p was analyzed to target TGFB1, TGFBR1, and TGFBR2, and miR-4286 was confirmed to target TGFB1. Since the TGF-β signaling pathway is a key pathway that increases the expression of ZEB, SNAIL, and TWIST, which are transcription factors that induce EMT as described above, it was confirmed that the reduction in the expression of ECM and EMT-related genes in cancer cells by exosomes derived from the STS-treated TRIM40-overexpressing HT29 cell line was due to miRNAs that suppress TGF-β signaling.

[0180] That is, the exosomes derived from the STS-treated TRIM40-overexpressing HT29 cell line manufactured according to the present invention form a miRNA pool that suppresses ECM and EMT of cancer cells, thereby suppressing cancer metastasis or proliferation and lowering cancer resistance to anticancer drugs, thereby inducing cancer death.

[0181] The primary cause of cancer death is secondary cancer, which has a much higher mortality rate than the primary cancer. Therefore, the development of therapeutics that inhibit cancer cell metastasis is essential. While the mechanism of cancer cell metastasis is not clearly understood, it is believed to involve mutations in the TGF-β signaling pathway (which regulates the growth, migration, differentiation, and apoptosis of epithelial and hematopoietic cells) and the resulting ECM and EMT. Most therapeutics developed thus far only inhibit the expression or function of a single factor in the TGF-β signaling pathway, resulting in limited efficacy against cancer.

[0182] On the other hand, the exosomes derived from the TRIM40-overexpressing HT29 cell line treated with STS according to the present invention contain a pool of miRNAs that suppress the expression of ECM and EMT-related genes, such as miR-1343-3p (which suppresses the expression of TGBR1 and TGFBR2), miR-4285 (which suppresses the expression of TGFB1 gene), and miR-194-3p (which suppresses the TGF-β signaling pathway), which suppress the TGF-β signaling pathway in cancer cells. Therefore, they can overcome the limitations of existing TGF-β inhibitors by comprehensively blocking the expression of EMT and ECM-related genes by suppressing the TGF-β signaling pathway when they are absorbed and delivered to cancer cells, thereby controlling the cancer microenvironment and inducing a strong anticancer response in preclinical studies.

Claims

1. Exosomes derived from TRIM40 (Tripartite Motif Containing 40) transformed cells treated with staurosporine.

2. In paragraph 1, The above exosome is characterized by inhibiting the formation of a tumor microenvironment (ECM) and epithelial-mesoderm transition (EMT) of cancer cells.

3. In paragraph 1, An exosome characterized in that the exosome comprises a TRIM40 protein and a miRNA associated with inhibition of TGF-β signaling.

4. In paragraph 3, An exosome characterized in that the miRNAs associated with the above TGF-β signaling inhibition include miR-1343-3p, miR-4286, miR-194-3p, miR-3200-3p, miR-652-5p, miR-107, and miR-331-3p.

5. In paragraph 1, The above exosomes are characterized in that the expression levels of miR-411-5p and miR-183-3p are 10 to 16 times lower than in STS-treated TRIM40 non-transformed cells.

6. A pharmaceutical composition for preventing or treating cancer, comprising the exosome according to Article 1 as an active ingredient.

7. In paragraph 6, The composition is a pharmaceutical composition for preventing or treating cancer, characterized in that it inhibits cancer metastasis through the formation of a tumor microenvironment (ECM) and epithelial-mesoderm transition (EMT) by inhibiting the TGF-β signaling pathway of cancer cells.

8. In paragraph 6, A pharmaceutical composition for preventing or treating cancer, characterized in that the cancer is at least one selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, skin or ocular melanoma, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, leukemia, uterine sarcoma, anal cancer, fallopian tube cancer, small intestine cancer, endocrine cancer, parathyroid cancer, kidney cancer, soft tissue tumor, urethral cancer, bronchial cancer, and bone marrow cancer.

9. A food composition for improving or preventing cancer, comprising the exosome according to Article 1 as an active ingredient.

10. Regarding the method for producing exosomes according to Article 1, A. Step of producing a cell line transformed with TRIM40 (Tripartite Motif Containing 40); B. A step of treating the transformed cell line with staurosporine; and C. A method for producing exosomes, comprising the step of extracting and isolating exosomes from a culture medium of cells treated with staurosporine.

11. In paragraph 10, A method for producing exosomes, characterized in that the above staurosporine is treated at a concentration of 1 to 100 nM.

Images