Methods and compositions for treating or preventing cancer

Abstract

The present application provides methods and compositions that involve BRCA1 agents (e.g., BRCA1 mRNA, proteins, genome editing agents) for treating, preventing or delaying diseases such as cancer. In some cases, the BRCA1 agents correspond to only a fragment of BRCA1 wildtype protein.

Description

METHODS AND COMPOSITIONS FOR TREATING OR PREVENTING CANCERCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 538,068, filed on September 12, 2023, which are hereby incorporated by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (737372001540SEQLIST.xml; Size: 366,826 bytes; and Date of Creation: September 11, 2024) is herein incorporated by reference in its entirety.FIELD OF THE APPLICATION

[0003] The present application relates to methods and compositions that involve BRCA1 agents (e.g., BRCA1 mRNA, proteins, genome editing agents) for treating, preventing or delaying diseases such as cancer.BACKGROUND OF THE APPLICATION

[0004] BRCA1 and BRCA2 proteins are involved in the repair of DNA damage such as double-strand breaks during S and G2 phases, by intervening in homologous recombination (HR) steps. Breast cancers arising from BRCA-1 / 2 mutation carriers, up to 10% of BC, are associated with a lack of expression and / or function of the corresponding protein, which induces genomic instability. Considering the major role of BRCA1 / 2 genes in DNA repair process, therapeutic approaches using cytotoxic agents such as the platinum and poly(ADP- ribose) polymerase inhibitors (PARPi) are used as treatments. However, hypersensitivity to PARPi is limited in the clinic by acquired resistance after restoration of HR.

[0005] The disclosures of all publications, patents, patent applications and published patent applications referred to herein are hereby incorporated herein by reference in their entirety.BRIEF SUMMARY OF THE APPLICATION

[0006] The present application in one aspect provides a pharmaceutical composition comprising a) an mRNA encoding a full length human BRCA1 protein or a portion thereof and b) a carrier, wherein the portion of human BRCA1 protein is less than a full length human BRCA1 protein.

[0007] In some embodiments, the full length human BRCA1 protein comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the mRNA encodes a portion of the full-length human BRCA1 protein, optionally wherein the mRNA has a length of no more than about 5000bp, and / or the portion of human BRCA1 protein has a length of no more than about 1500 amino acids.

[0008] In some embodiments, the mRNA is chemically modified.

[0009] In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 11 domain or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof comprises a nuclear location sequence (“NLS”). In some embodiments, the portion of human BRCA1 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 6, 8, 9, and 11-14 or a functional variant thereof, optionally wherein the portion of human BRCA1 comprises the amino acid sequence set forth in any one of SEQ ID Nos: 6, 9, and 13. In some embodiments, the Exon 11 domain comprises the nuclear location sequence 2 (“NLS2”) or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof comprises the amino acid sequence of the binding region for one or more of MSH2, GADD45, Rad50, BRCC36, and Rad51 or a portion thereof, and / or the Exon 11 domain or a portion thereof does not comprise the full amino acid sequence of the binding region for one or more of Rb, Myc, and Rad50.

[0010] In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 12 domain, an Exon 13 domain, and / or a coiled-coil domain, or a portion thereof.

[0011] In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence of the binding region of PALB2.

[0012] In some embodiments, the mRNA encodes a portion of human BRCA1 comprising a serine containing domain or a portion thereof.

[0013] In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any one of SEQ ID NOs: 2-14 or a functional variant thereof.

[0014] In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a Really Interesting New Gene (“RING”) domain; or the mRNA encodes a portion of human BRCA1 comprising a Really Interesting New Gene (“RING”) domain. In some embodiments, the RING domain comprises the amino acid sequence encoded by a nuclear export sequence (“NES”) or a functional variant thereof; and / or the RING domain comprisesan amino acid sequence set forth in SEQ ID NO: 2 or 5 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise an Exon 11 domain. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a BRCA1 C-terminal (“BRCT”) domain. In some embodiments, the mRNA encodes a portion of human BRCA1 domain that does not comprise one or both of the BRCT1 and BTCT2 domains. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise the amino acid sequence of a binding region (e.g., a full amino acid sequence of the binding region) for p53, CtIP and / or BACH1.

[0015] In some embodiments, the mRNA encodes an amino acid sequence set forth in any of SEQ ID Nos: 1-14. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any of SEQ ID NOs 2, 5-6, and 9-13 or a functional variant thereof.

[0016] In some embodiments, the carrier is selected from a lipid, a polymer, a virus, and a cell-penetrating peptide (“CPP”). In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”). In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier further comprises one or more moieties covalently linked to N-terminus of the cell-penetrating peptide, and wherein the one or more moieties are selected from the group consisting of an acetyl group, a fatty acid, a cholesterol, a poly-ethylene glycol, a nuclear localization signal, a nuclear export signal, an antibody, a polysaccharide, a linker moiety, and a targeting moiety. In some embodiments, a) the carrier comprises an acetyl group covalently linked to the N- terminus of the cell-penetrating peptide, b) the carrier comprises a targeting peptide covalently linked to the N-terminus of the cell-penetrating peptide. IN some embodiments, the targeting peptide is selected from the group consisting of SEQ ID NOs: 196-205 and 235- 241, c) the carrier comprises a linker moiety selected from the group consisting of a poly glycine linker moiety, a PEG moiety (e.g., (PEG)3), Aun, Ava, and Ahx, d) the carrier comprises, from N-terminus, an acetyl group, a targeting moiety and a linker moiety covalently linked to the N-terminus of the cell-penetrating peptide, e) the carrier further comprises a carbohydrate moiety, and / or f) the cell-penetrating peptide is a retro-inversopeptide. In some embodiments, the carrier comprises a lipid or a polymer. In some embodiments, the carrier comprises a lipid.

[0017] In some embodiments, the cell-penetrating peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285.

[0018] The present application in one aspect provides a pharmaceutical composition comprising a) an mRNA encoding an amino acid sequence set forth in any of SEQ ID NOs: 1-14 or a functional variant thereof and b) a cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43. In some embodiments, the mRNA encodes an amino acid sequence set forth in any of SEQ ID NOs: 1-2, 5-6, and 9-13.

[0019] In some embodiments, the present application provides a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition.

[0020] In some embodiments, the individual or cancer comprises an aberration in BRCA1, and / or b) the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1.

[0021] In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration.

[0022] In some embodiments, the individual or cancer comprises an aberration in P53.

[0023] In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment.

[0024] In some embodiments, the method further comprises administering a second therapy into the individual. In some embodiments, the second therapy comprises a PARP inhibitor or a hormone therapy.

[0025] In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer, further optionally wherein the cancer is a triple negative breast cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.BRIEF DESCRIPTION OF THE DRAWINGS

[0026] FIG. 1A depicts a list of cancer cell lines with mutations on BRCA-1 and / or p53 genes and their sensitivity to PARP inhibitors.

[0027] FIG. IB depicts antiproliferative activity of ADGN-BRC-1A, ADGN-BRC-1B; ADGN-BRC-1F, ADGN-BRC-1I and ADGN-BRC-1J nanoparticles on various breast cancer cell lines.

[0028] FIGs. 2A-2B depict the effect of various BRCA1 mRNAs on proliferation and toxicity of various cell lines.

[0029] FIGs. 3A-3F depict the effect of various BRCA1 mRNAs at different concentrations on the proliferation of various cell lines.

[0030] FIG. 4 depicts percentage of RAD-51 foci positive cells and RAD51 protein level of the various cell lines treated with various BRCA1 mRNAs.

[0031] FIG. 5 depicts effects of on various BRCA1 mRNAs in reversing resistance against veliparib on various cell lines.

[0032] FIG. 6 depicts anti-tumor effects of various BRCA1 mRNAs and veliparib on deficient triple negative Hl 937 tumors.

[0033] FIG. 7 depicts anti-tumor effects of various BRCA1 mRNAs and veliparib on deficient triple negative Hl 937 large tumors.DETAILED DESCRIPTION OF THE APPLICATION

[0034] The present application provides compositions comprising a BRCA1 nucleic acid (e.g., a BRCA1 mRNA), a BRCA1 protein or a genome editing agent for introducing a BRCA1 transgene. The present application is at least partly based upon the striking findings of the inventors that these agents (e.g., various BRCA1 mRNAs, including those only encode or have a fragment of the BRCA1 wildtype protein), can effectively inhibit proliferation ofcancer cells and tumor growth that have various kinds of BRCA1 aberrations including various BRCA1 mutations, epigenetic dysregulation, and a deficient homology recombination (z.e., “BRCAness”) in both in vitro and in vivo settings. See e.g., Examples 1-4 and FIG. IB. It was also found that exemplary BRCA1 mRNAs can also reverse the sensitivity of the cancer cells to a PARP inhibitor. See e.g., Examples 5-6 and FIG. 5. Such anti-tumor effects were also observed in an animal model for a triple negative breast cancer, which is the mostly difficult to treat breast cancer. See e.g., Examples 7-8 and FIGs. 7-8.

[0035] The present application therefore in one aspect provides a pharmaceutical composition comprising a BRCA1 nucleic acid (e.g., an mRNA), a BRCA1 protein or a genome editing agent for introducing a BRCA1 transgene, optionally and a carrier. In another aspect, there are provided methods of treating, preventing, delaying, or reducing a risk of a disease or condition e.g., a cancer) that is associated with a BRCA1 aberration.

[0036] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises a NLS2 sequence (position 607-614 according to SEQ ID NO: 1) and at least a portion of exon 11 (e.g., from position 615-907 according to SEQ ID NO: 1). In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full-length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 9 or a functional variant thereof. In some embodiments, the carrier comprises a cell-penetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing therisk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 507-907 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 9. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0037] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 2 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided amethod of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 1-507 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 2. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0038] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 3 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided amethod of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 347-697 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 3. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0039] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 4 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided amethod of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 1388-1863 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 4. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0040] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 5 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipidnanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 1-247 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 5. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0041] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 6 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipidnanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 507-1247 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 6. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0042] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 7 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipidnanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 1247-1647 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 7. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0043] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 8 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 737-1167 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 8. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0044] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 10 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 1047-1837 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 10. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0045] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 11 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally theCPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 407-1112 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 11. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0046] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 12 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally theCPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 347-1190 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 12. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0047] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 13 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally theCPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 410-1310 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 13. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0048] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a portion of wildtype human BRCA1 protein that is less than a full- length wildtype BRCA1 protein, b) the portion of wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the portion of wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the portion of wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 14 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally theCPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111- 195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration is in the sequence location of 610-1067 according to SEQ ID NO: 1 or in an amino acid sequence according to SEQ ID NO: 14. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function.

[0049] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding a wildtype human BRCA1 protein, b) the wildtype human BRCA1 protein, or c) a genome editing agent for introducing a BRCA1 transgene encoding the wildtype human BRCA1 protein, wherein the composition further comprises a carrier, wherein the wildtype human BRCA1 protein comprises the amino acid sequences of SEQ ID NO: 1 or a functional variant thereof. In some embodiments, the carrier comprises a cellpenetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier comprises a lipid (e.g., lipid nanoparticle), a virus (e.g., AAV), or a polymer. In some embodiments, there is provided a method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition. In some embodiments, the individual or cancer comprises an aberration in BRCA1. In some embodiments, the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1. In some embodiments, the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration. In some embodiments, the individual or cancer comprises an aberration in P53. In some embodiments, the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment. In some embodiments, the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer. In some embodiments, the cancer has a damaged homologous recombination (“HR”) function. In some embodiments, the method further comprises administering a second therapy into the individual, optionally wherein the second therapy comprises a PARP inhibitor or a hormone therapy.

[0050] In some embodiments, there is provided a pharmaceutical composition comprising a) an mRNA encoding an ornithine transcarbamylase (OTC) protein, b) the OTC protein, or c) a genome editing agent for introducing an OTC transgene encoding the OTC protein, wherein the composition further comprises a carrier. In some embodiments, the carrier is selected from a lipid, a polymer, a virus, and a cell-penetrating peptide (“CPP”). In some embodiments, the OTC protein is a human OTC protein (e.g., a human wildtype OTC protein). See sequence table for exemplary OTC proteins. In some embodiments, the mRNA encoding the OTC protein is codon optimized. In some embodiments, the carrier is a CPP. In some embodiments, the CPP is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides,and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285. In some embodiments, the carrier further comprises one or more moieties covalently linked to N-terminus of the cellpenetrating peptide, and wherein the one or more moieties are selected from the group consisting of an acetyl group, a fatty acid, a cholesterol, a poly-ethylene glycol, a nuclear localization signal, a nuclear export signal, an antibody, a polysaccharide, a linker moiety, and a targeting moiety, optionally wherein: a) the carrier comprises an acetyl group covalently linked to the N-terminus of the cell-penetrating peptide, b) the carrier comprises a targeting peptide covalently linked to the N-terminus of the cell-penetrating peptide, wherein optionally the targeting peptide is selected from the group consisting of SEQ ID NOs: 196- 205 and 235-241, c) the carrier comprises a linker moiety selected from the group consisting of a poly glycine linker moiety, a PEG moiety (e.g. , (PEG)3), Aun, Ava, and Ahx, d) the carrier comprises, from N-terminus, an acetyl group, a targeting moiety and a linker moiety covalently linked to the N-terminus of the cell-penetrating peptide, e) the carrier further comprises a carbohydrate moiety, and / or f) the cell-penetrating peptide is a retro-inverso peptide. In some embodiments, the cell-penetrating peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153- 175 and 272-285. In some embodiments, there is provided a method of treating a disease or condition in an individual in need thereof, comprising administering the pharmaceutical composition. In some embodiments, the disease or condition is associated with a deficiency or aberration in OTC. In some embodiments, the disease or condition is Ornithine transcarbamylase deficiency (OTCD). OTCD is an X-linked liver disorder caused by mutations in the OTC gene. In some embodiments, the individual has hyperammonemia or severe hyperammonemia. In soame embodiments, the individual has neurological damage, or coma. In some embodiments, the individual has an early-onset OTCD form. In some embodiments, the individual has a late stage OTCD. In some embodiments, the individual is a human.I. Definitions

[0051] As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.

[0052] The terms “non-naturally occurring,” “synthetic,” or “engineered” are used interchangeably and indicate the involvement of the hand of man. The terms, when referringto nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.

[0053] "Polynucleotide," or "nucleic acid," as used interchangeably herein, refers to polymers of nucleotides of any length, and includes DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. The term "nucleic acid" as used herein refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double-stranded form and includes DNA and RNA. DNA may be in the form of, e.g., antisense molecules, plasmid DNA, pre-condensed DNA, a PCR product, vectors (PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. RNA may be in the form of siRNA, asymmetrical interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, RNA, viral RNA (vRNA), and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, including for example locked nucleic acid (LNA), unlocked nucleic acid (UNA), and zip nucleic acid (ZNA), which can be synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2’-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed- base and / or deoxyinosine residues (Batzer e al., Nucleic Acid Res., 19:5081 ( 1991); Ohtsuka et a ., j . Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)). "Nucleotides" contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups. "Bases"include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylases, and alkylhalides. "Oligonucleotide," as used herein, generally refers to short, generally synthetic polynucleotides that are generally, but not necessarily, less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides.

[0054] As used herein, “administering” is meant a method of giving a dosage of a compound or a composition (e.g., a pharmaceutical composition to a subject. The compounds and / or compositions utilized in the methods described herein can be administered, for example, orally, intramuscularly, intravenously (e.g., by intravenous infusion), subcutaneously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumor ally, peritoneally, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, in creams, or in lipid compositions. The method of administration can vary depending on various factors (e.g., the compound or composition being administered and the severity of the condition, disease, or disorder being treated).

[0055] The term “endocrine therapy” refers to a therapy or treatment useful for modulating (e.g. regulating, reducing, blocking, or inhibiting) the effects of the expression, a level, or an amount of one or more hormones found to cause or otherwise cause progression of a breast cancer as described herein. Endocrine therapy as described herein includes nonhormone and hormone therapies such as, for example, a selective estrogen receptor modulator (SERM) as described herein and understood in the art, a selective estrogen receptor degrader (SERD) as described herein and understood in the art, a gonadotropin-releasing hormone (GnRH) agonist as described herein and understood in the art, a Selective Estrogen Receptor Covalent Antagonist (SERCA) as described herein and understood in the art, a Selective Human Estrogen Receptor Partial Agonist (ShERPA) as described herein and understood in the art; an aromatase inhibitor (Al) as described herein, or a combination thereof. In oneembodiment, an endocrine therapy comprises one or more compounds from Section IV- A herein.

[0056] Additional exemplary endocrine therapies for use in the methods described herein include, but are not limited to: anti-estrogens, for example, tamoxifen (including NOLVADEX® tamoxifen), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, FARESTON® (toremifene citrate), nafoxidine, clomifene, anordrin, bazedoxifene, broparestrol, cyclofenil, lasofoxifene, ormeloxifene, acolbifene, elacestrant (RAD1901), clomifenoxide, etacstil, ospemifene, fulvestrant (FASLODEX®), EM800, brilanestrant (GDC-0810), LX-039, AZ9496, GDC-0927 (SRN- 0927); GDC-9545, G1T48 (G1 Therapeutics), H3B 6545 (H3 Biomedicine), SAR439859 (Sanofi), aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE® megestrol acetate, AROMASIN® (exemestane), formestanie, fadrozole, RIVISOR® (vorozole), FEMARA® (letrozole), and ARIMIDEX® (anastrozole); antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); and antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, as well as combinations of two or more of the above.

[0057] Examples of chemotherapeutic agents (and as applicable non-endrocrine therapies) include, but are not limited to, mammalian target of rapamycin (mTOR) inhibitors such as sirolimus (also known as rapamycin), temsirolimus (also known as CCI-779 or TORISEL®), everolimus (also known as RAD001 or AFINITOR®), ridaforolimus (also known as AP- 23573, MK-8669, or deforolimus), OSL027, AZD8055, and INK128; phosphatidylinositol 3- kinase (PI3K) inhibitors such as idelalisib (also known as GS-1101 or CAL-101), BKM120, and perifosine (also known as KRX-0401); dual phosphatidylinositol 3-kinase (PI3K) / mTOR inhibitors such as XL765, GDC-0980, BEZ235 (also known as NVP-BEZ235), BGT226, GSK2126458, PF-04691502, and PF-05212384 (also known as PKI-587); and cyclin- dependent kinase (CDK)4 / 6 inhibitors such as abemaciclib (VERZENIO®), palbociclib (IBRANCE®), ribociclib (KISQALI®), trilaciclib (G1T28); anthracyclines such as daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin; taxanes, including paclitaxel and docetaxel; podophyllo toxin; gemcitabine (GEMZAR®); 5- fluorouracil (5-FU); cyclophosphamide (CYTOXAN®); platinum analogs such as cisplatin and carboplatin; vinorelbine (NAVELBINE®); capecitabine (XELODA®); ixabepilone(IXEMPRA®); and eribulin (HALAVEN®); ribozymes such as a VEGF expression inhibitor (e.g., ANGIOZYME® ribozyme) and a HER2 expression inhibitor; vaccines such as gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; PROLEUKIN® rIL-2; LURTOTECAN® topoisomerase 1 inhibitor; ABARELIX® rmRH; Vinorelbine and Esperamicins (see U.S. Pat. No. 4,675,187), any of the compounds described in Section IV-A, below, and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above.

[0058] Further exemplary chemotherapeutic agents (and non-endocrine therapies) include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN©); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); delta-9- tetrahydrocannabinol (dronabinol, MARINOL®); beta-lapachone; lapachol; colchicines; betulinic acid; a camptothecin (including the synthetic analogue topotecan (HYCAMTIN©), CPT-11 (irinotecan, CAMPTOSAR®), acetylcamptothecin, scopolectin, and 9- aminocamptothecin); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); podophyllo toxin; podophyllinic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin yi1and calicheamicin omegall (see, e.g., Nicolaou et al., Angew. Chem Inti. Ed Engl., 33: 183-186 (1994)); CDP323, an oral alpha-4 integrin inhibitor; dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including ADRIAMYCIN®, morpholino-doxorubicin, cyanomorpholinodoxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HC1 liposome injection (DOXIL®),liposomal doxorubicin TLC D-99 (MYOCET®), peglylated liposomal doxorubicin (CAELYX®), and deoxy doxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur (UFTORAL®), capecitabine (XELODA®), an epothilone, and 5-fluorouracil (5-FU); combretastatin; folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2'-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine (ELDISINE®, FILDESIN®); dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); thiotepa; taxoid, e.g., paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.J.), albumin-engineered nanoparticle formulation of paclitaxel (ABRAXANE™), and docetaxel (TAXOTERE®, Rhome-Poulene Rorer, Antony, France); chloranbucil; 6- thioguanine; mercaptopurine; methotrexate; platinum agents such as cisplatin, oxaliplatin e.g., ELOXATIN®), and carboplatin; vincas, which prevent tubulin polymerization from forming microtubules, including vinblastine (VELBAN®), vincristine (ONCOVIN®), vindesine (ELDISINE®, FILDESIN®), and vinorelbine (NAVELBINE®); etoposide (VP- 16); ifosfamide; mitoxantrone; leucovorin; novantrone; edatrexate; daunomycin; aminopterin; ibandronate; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid, including bexarotene (TARGRETIN®); bisphosphonates such as clodronate (for example, BONEFOS® or OSTAC®), etidronate (DIDROCAL®), NE-58095, zoledronic acid / zoledronate (ZOMETA®), alendronate (FOSAMAX®), pamidronate(AREDIA®), tiludronate (SKELID®), or risedronate (ACTONEL®); troxacitabine (a 1,3- dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those that inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R) (e.g., erlotinib (TARCEVA™)); and VEGF-A that reduce cell proliferation; vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELIX®); BAY439006 (sorafenib; Bayer); SU-11248 (sunitinib, SUTENT®, Pfizer); perifosine, COX-2 inhibitor (e.g., celecoxib or etoricoxib), proteosome inhibitor (e.g., PS341); bortezomib (VELCADE®); CCI-779; tipifamib (R11577); orafenib, ABT510; Bcl-2 inhibitor such as oblimersen sodium (GENASENSE®); pixantrone; EGFR inhibitors; tyrosine kinase inhibitors; serine-threonine kinase inhibitors such as rapamycin (sirolimus, RAPAMUNE®); farnesyltransferase inhibitors such as lonafarnib (SCH 6636, SARASAR™); and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above such as CHOP, an abbreviation for a combined therapy of cyclophosphamide, doxorubicin, vincristine, and prednisolone; and FOLFOX, an abbreviation for a treatment regimen with oxaliplatin (ELOXATIN™) combined with 5-FU and leucovorin, and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above.

[0059] In some embodiments, “functional variant” of an agent described herein refer to a variant of the agent that demonstrates a comparable functional property (e.g., a desired functional property) of the agent. In some embodiments, the functional variant achieves a comparable functional property when it achieves a functional property that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, or 98% of a measurement for the functional property. In the context of NES or NLS, in some embodiments, the desired functional property comprises or is exporting a molecule out of a nucleus or importing a molecule into a nucleus. In the context of various agents described herein (e.g., a BRCA1 nucleic acid, e.g., a BRCA1 mRNA, e.g., a BRCA1 protein, e.g., a BRCA1 genome editing agent), in some embodiments, the desired functional property comprises or is inhibiting the proliferation of target cells. In some embodiments, the desired functional property comprises or is inhibiting tumor growth or treating a tumor in an individual (e.g., a human). 1

[0060] An “article of manufacture” is any manufacture (e.g., a package or container) or kit comprising at least one reagent, e.g., a medicament for treatment of a disease or disorder (e.g., a cancer, e.g., a breast cancer, e.g., an HR+ breast cancer (e.g., anER+ breast cancer (e.g., luminal A breast cancer or luminal B breast cancer)), DCIS, and / or a metastatic or a locally advanced breast cancer), and / or a probe for specifically detecting a biomarker described herein. In certain embodiments, the manufacture or kit is promoted, distributed, or sold as a unit for performing the methods described herein.

[0061] The term “guide RNA” refers to a polynucleotide that cleaves, inserts, or links a target DNA in a cell via RNA editing. The guide RNA may be a single-chain guide RNA (sgRNA). The guide RNA may be a CRISPR RNA (crRNA) specific to the target nucleotide sequence. The guide RNA may further include a trans-activating crRNA (tracrRNA) interacting with Cas9 nuclease. The tracrRNA may include a polynucleotide forming a loop structure. The guide RNA may have a length of 10 nucleotides to 30 nucleotides. The guide RNA may have a length of, for example, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides.

[0062] The guide RNA may include RNA, DNA, PNA, or a combination thereof. The guide RNA may be chemically modified.

[0063] The guide RNA may be a component of molecular scissors (programmable nuclease). The molecular scissor refers to all types of nucleases capable of recognizing and cleaving a specific site on the genome. The molecular scissors may be, for example, transcription activator-like effector nuclease (TALEN), zinc-finger nuclease, meganuclease, RNA-guided engineered nuclease (RGEN), Cpfl, and Ago homolog (DNA-guided endonuclease). The RGEN refers to a nuclease including a guide RNA specific to a target DNA and Gas protein as components. The polynucleotide may be, for example, a component of RGEN.

[0064] In aspects of the application the term “single guide RNA” or “sgRNA” refers to a polynucleotide sequence comprising a guide sequence, a tracr sequence and a tracr mate sequence. The term “guide sequence” refers to the about 20 bp sequence within the guide RNA that specifies the target site. The term “tracr mate sequence” may also be used interchangeably with the term “direct repeat(s)”.

[0065] In general, “CRISPR system” refers collectively to proteins, transcripts and other molecules involved in the activity of CRISPR-associated (“Cas”) nucleases (such as RNA- guided endonucleases, or “RGENs”), including Cas gene products, Cas gene sequences, tracr (trans-activating CRISPR) sequences (e.g. tracrRNA or an active partial tracrRNA), tracr- mate sequences (including a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences, transcripts, and products derived from a CRISPR locus. In some embodiments, one or more molecules of a CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more molecules of a CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by molecules that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is present in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template,” “editing polynucleotide,” “editing sequence,” “donor sequence,” or “donor nucleic acid”. In aspects of the application, an exogenous template polynucleotide may be referred to as an editing template. In an aspect of the application the recombination is homologous recombination.

[0066] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. The tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of awild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more molecules of a CRISPR system are introduced into a host cell such that formation of a CRISPR complex at one or more target sites can occur. For example, a Cas nuclease, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be introduced into a host cell to allow formation of a CRISPR complex at a target sequence in the host cell complementary to the guide sequence.

[0067] “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80% / , 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0068] As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993). Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter“Overview of principles of hybridization and the strategy of nucleic acid probe assay”.Elsevier, N.Y.

[0069] “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.

[0070] The “expression level,” “amount,” or “level,” or used herein interchangeably, of a biomarker is a detectable level in a biological sample. “Expression” generally refers to the process by which information (e.g., gene-encoded and / or epigenetic) is converted into the structures present and operating in the cell. Therefore, as used herein, “expression” may refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and / or polypeptide modifications (e.g., posttranslational modification of a polypeptide). Fragments of the transcribed polynucleotide, the translated polypeptide, or polynucleotide and / or polypeptide modifications (e.g., posttranslational modification of a polypeptide) shall also be regarded as expressed whether they originate from a transcript generated by alternative splicing or a degraded transcript, or from a post-translational processing of the polypeptide, e.g., by proteolysis. Expression levels can be measured by methods known to one skilled in the art and also disclosed herein.

[0071] Expression levels can be measured using assays and techniques suitable for measuring RNA levels. For example, a RNA-Seq kit can be used to measure expression levels and is suitable for kits as described herein. Exemplary technologies useful in measuring expression levels herein include, but are not limited to, RNA ACCESS® protocol or TRUSEQ® RIBOZERO® protocol (ILLUMINA®)), RT-qPCR, qPCR, multiplex qPCR (e.g. fluidigm), nanostring technologies, RT-qPCR, microarray analysis, SAGE, or MassARRAY.

[0072] ‘ ‘Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acid residues in a candidate sequence that are identical with the nucleic acids or amino acid residues in thereference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % sequence identity values are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or may be compiled from the source code. The ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0073] An “isolated” nucleic acid (e.g., mRNA), polypeptide or protein refers to a nucleic acid molecule (e.g., mRNA), a polypeptide, protein that has been separated from a component of its natural environment.

[0074] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0075] The terms “therapeutic agent”, “therapeutic capable agent” or “treatment agent” are used interchangeably and refer to a molecule or compound that confers some beneficial effect upon administration to a subject. The beneficial effect includes enablement of diagnostic determinations; amelioration of a disease, symptom, disorder, or pathological condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and generally counteracting a disease, symptom, disorder or pathological condition.

[0076] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of this application, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease), preventing or delaying the spread (e.g., metastasis) of the disease, preventing or delaying the recurrence of the disease, delay or slowing the progression of the disease, ameliorating the disease state, providing a remission (partial or total) of the disease, decreasing the dose of one or more other medications required to treat the disease, delaying the progression of the disease, increasing the quality of life, and / or prolonging survival. Also encompassed by “treatment” is a reduction of a pathological consequence of a cancer. The methods of the application contemplate any one or more of these aspects of treatment.

[0077] As used herein, “delaying” the development of a cancer means to defer, hinder, slow, retard, stabilize, and / or postpone development of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that “delays” development of a cancer is a method that reduces probability of disease development in a given time frame and / or reduces the extent of the disease in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a statistically significant number of subjects. Cancer development can be detectable using standard methods, including, but not limited to, computerized axial tomography (CAT Scan), Magnetic Resonance Imaging (MRI), abdominal ultrasound, clotting tests, arteriography, or biopsy. Development may also refer to cancer progression that may be initially undetectable and includes occurrence, recurrence, and onset.

[0078] The term “effective amount” or “therapeutically effective amount” refers to the amount of an agent that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will provide an image for detection by any one of the imaging methods described herein. The specific dose may vary depending on one or more of: the particular agent chosen, the dosing regimen to be followed, whether it isadministered in combination with other compounds, timing of administration, the tissue to be imaged, and the physical delivery system in which it is carried.

[0079] The term “simultaneous administration,” as used herein, means that a first therapy and second therapy in a combination therapy are administered with a time separation of no more than about 15 minutes, such as no more than about any of 10, 5, or 1 minutes. When the first and second therapies are administered simultaneously, the first and second therapies may be contained in the same composition (e.g., a composition comprising both a first and second therapy) or in separate compositions (e.g., a first therapy in one composition and a second therapy is contained in another composition).

[0080] As used herein, the term “sequential administration” means that the first therapy and second therapy in a combination therapy are administered with a time separation of more than about 15 minutes, such as more than about any of 20, 30, 40, 50, 60, or more minutes. Either the first therapy or the second therapy may be administered first. The first and second therapies are contained in separate compositions, which may be contained in the same or different packages or kits.

[0081] As used herein, the term “concurrent administration” means that the administration of the first therapy and that of a second therapy in a combination therapy overlap with each other.

[0082] As used herein, by “pharmaceutically acceptable” or “pharmacologically compatible” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients have preferably met the required standards of toxicological and manufacturing testing and / or are included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration.

[0083] A BRCA1 mRNA, a BRCA1 protein, and a BRCA1 transgene are meant to include mRNAs, proteins, and transgenes that correspond to full length BRCA1 (such as a wildtype human BRCA1 protein) or a portion thereof. They also include mRNAs, proteins, and transgenes that are functional variants of the mRNAs, proteins, and transgenes corresponding to the full length or a portion of the BRCA1 wildtype proteins. In some embodiments, the functional variant has a sequence identity of at least 80%, 85%, 90%, 95%, 97%, 98%, or99% as compared to an mRNA, protein or transgene corresponding to the full length or a portion of the BRCA1 wildtype protein.

[0084] It is understood that aspect and embodiments of the application described herein include “consisting” and / or “consisting essentially of’ aspects and embodiments.

[0085] As used herein, the singular form “a”, “an”, and “the” includes plural references unless indicated otherwise.

[0086] Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0087] The term “about X-Y” used herein has the same meaning as “about X to about Y.”

[0088] The compositions and methods of the present application may comprise, consist of, or consist essentially of the essential elements and limitations of the application described herein, as well as any additional or optional ingredients, components, or limitations described herein or otherwise useful.

[0089] Unless otherwise noted, technical terms are used according to conventional usage.II. Compositions

[0090] The present application in one aspect provides compositions (e.g., pharmaceutical compositions) comprising a BRCA1 mRNA encoding a full length or a portion of human BRCA1 protein and a carrier, wherein the portion of human BRCA1 protein is less than a full length human BRCA1 protein, optionally wherein the full length human BRCA1 protein comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the mRNA has a length of no more than about 5000bp, optionally wherein the mRNA has a length of no more than about 4500 bp, 4000 bp, 3500 bp, 3000 bp, 2500 bp, or 2000 bp, optionally wherein the mRNA has been chemically modified e.g., for added stability, lower toxicity e.g., lower immunogenicity), and / or better transfection. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 11 domain or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises a nuclear location sequence (“NLS”). In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 1-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acidsequence set forth in SEQ ID NO: 2-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 11- 13. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 13 or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the nuclear location sequence 2 (“NLS2”) or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence of the binding region for one or more of MSH2, GADD45, Rad50, BRCC36, and Rad51 or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 does not comprise the full amino acid sequence of the binding region for one or more of Rb, Myc, and Rad50. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 12 domain, an Exon 13 domain, and / or a coiled-coil domain, or a portion thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence of the binding region of PALB2. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising a serine containing domain or a portion thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in SEQ ID NO: 10 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a Really Interesting New Gene (“RING”) domain. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising a Really Interesting New Gene (“RING”) domain. In some embodiments, the RING domain comprises the amino acid sequence encoded by a nuclear export sequence (“NES”) or a functional variant thereof. In some embodiments, the RING domain comprises an amino acid sequence set forth in SEQ ID NO: 2 or 5 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise an Exon 11 domain. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a BRCA1 C-terminal (“BRCT”) domain, optionally wherein the mRNA encodes a portion of human BRCA1 domain that does not comprise one or both of the BRCT1 and BTCT2 domains. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise the amino acid sequence of a binding region (e.g., a full amino acid sequence of the binding region) for p53, CtIP and / or BACH1. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any of SEQ ID NOs 2, 5-6, and 9-10 or a functional variant thereof. Insome embodiments, the carrier is selected from a lipid, a polymer, a virus, and a cellpenetrating peptide.

[0091] The present application in another aspect provides compositions (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising a full length or a portion of human BRCA1 protein and a carrier, wherein the portion of human BRCA1 protein is less than a full length human BRCA1 protein, optionally wherein the full length human BRCA1 protein comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the BRCA1 protein has a length of no more than about 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, or 250 amino acids. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 11 domain or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises a nuclear location sequence (“NLS”). In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 1-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 2-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 11- 13. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 13 or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the nuclear location sequence 2 (“NLS2”) or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence of the binding region for one or more of MSH2, GADD45, Rad50, BRCC36, and Rad51 or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 does not comprise the full amino acid sequence of the binding region for one or more of Rb, Myc, and Rad50. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 12 domain, an Exon 13 domain, and / or a coiled-coil domain, or a portion thereof. In some embodiments, the portion of human BRCA1 comprise an amino acid sequence of the binding region of PALB2. In some embodiments, the portion of human BRCA1 comprise a serine containing domain or a portion thereof. In some embodiments, the portion of human BRCA1 comprise an amino acid sequence set forth in SEQ ID NO: 10 or a functional variant thereof.In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a Really Interesting New Gene (“RING”) domain. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising a Really Interesting New Gene (“RING”) domain. In some embodiments, the RING domain comprises the amino acid sequence encoded by a nuclear export sequence (“NES”) or a functional variant thereof. In some embodiments, the RING domain comprises an amino acid sequence set forth in SEQ ID NO: 2 or 5 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise an Exon 11 domain. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a BRCA1 C-terminal (“BRCT”) domain, optionally wherein the BRCA1 domain does not comprise one or both of the BRCT1 and BTCT2 domains. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise the amino acid sequence of a binding region (e.g., a full amino acid sequence of the binding region) for p53, CtIP and / or BACH1. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any of SEQ ID NOs 2, 5-6, and 9-10 or a functional variant thereof.

[0092] The present application in another aspect provides compositions (e.g., pharmaceutical compositions) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the BRCA1 transgene encodes a full length or a portion of human BRCA1 protein and a carrier, wherein the portion of human BRCA1 protein is less than a full length human BRCA1 protein, optionally wherein the full length human BRCA1 protein comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the BRCA1 transgene encodes a BRCA1 protein having a length of no more than about 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, or 250 amino acids. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 11 domain or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises a nuclear location sequence (“NLS”). In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 1-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portionof human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 2-3, 6-9, or 11-14. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 11-13. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence set forth in SEQ ID NO: 6, 9, or 13 or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the nuclear location sequence 2 (“NLS2”) or a functional variant thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 comprises the amino acid sequence of the binding region for one or more of MSH2, GADD45, Rad50, BRCC36, and Rad51 or a portion thereof. In some embodiments, the Exon 11 domain or a portion thereof or the portion of human BRCA1 does not comprise the full amino acid sequence of the binding region for one or more of Rb, Myc, and Rad50. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an Exon 12 domain, an Exon 13 domain, and / or a coiled-coil domain, or a portion thereof. In some embodiments, the portion of human BRCA1 comprise an amino acid sequence of the binding region of PALB2. In some embodiments, the portion of human BRCA1 comprise a serine containing domain or a portion thereof. In some embodiments, the portion of human BRCA1 comprise an amino acid sequence set forth in SEQ ID NO: 10 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a Really Interesting New Gene (“RING”) domain. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising a Really Interesting New Gene (“RING”) domain. In some embodiments, the RING domain comprises the amino acid sequence encoded by a nuclear export sequence (“NES”) or a functional variant thereof. In some embodiments, the RING domain comprises an amino acid sequence set forth in SEQ ID NO: 2 or 5 or a functional variant thereof. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise an Exon 11 domain. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise a BRCA1 C-terminal (“BRCT”) domain, optionally wherein the BRCA1 domain does not comprise one or both of the BRCT1 and BTCT2 domains. In some embodiments, the mRNA encodes a portion of human BRCA1 that does not comprise the amino acid sequence of a binding region (e.g., a full amino acid sequence of the binding region) for p53, CtIP and / or BACH1. In some embodiments, the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any of SEQ ID NOs 2, 5-6, and 9-10 or a functional variant thereof. Insome embodiments, the carrier is selected from a lipid, a polymer, a virus, and a cellpenetrating peptide.

[0093] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 1 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1, and b) a carrier comprising a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43. In some embodiments, the functional

[0094] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2, and b) a carrier (e.g., a lipid, a polymer, a virus agent, a cell penetrating peptide). In some embodiments, the carrier is a cell-penetrating peptide. In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the carrier comprises a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43.

[0095] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 5 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5, and b) a carrier (e.g., a lipid, a polymer, a virus agent, a cell penetrating peptide). In some embodiments, the carrier is a cell-penetrating peptide. In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the carrier comprises a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175and 272-285. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43.

[0096] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 6 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6, and b) a carrier (e.g., a lipid, a polymer, a virus agent, a cell penetrating peptide). In some embodiments, the carrier is a cell-penetrating peptide. In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the carrier comprises a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43.

[0097] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 9 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9, and b) a carrier (e.g., a lipid, a polymer, a virus agent, a cell penetrating peptide). In some embodiments, the carrier is a cell-penetrating peptide. In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the carrier comprises a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43.

[0098] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a) a BRCA1 mRNA encoding a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 10 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10, and b) a carrier (e.g., a lipid, a polymer, a virus agent, a cell penetrating peptide). In some embodiments, the carrier is a cell-penetrating peptide. In some embodiments, the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides,PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the carrier comprises a cell-penetrating peptide selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285. In some embodiments, the cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43.

[0099] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 1 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety. In some embodiments, the second moiety is linked to the first BRCA1 protein via a linker (such as any of the linkers described herein, e.g., a peptide linker, e.g., a non-peptide linker, e.g., a GS linker).

[0100] In some embodiments, there is provided a composition e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0101] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0102] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 4 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0103] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 5 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises atargeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0104] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 6 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0105] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 7 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0106] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 8 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0107] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 9 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0108] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 10 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises atargeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0109] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 11 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO:11. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0110] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 12 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO:12. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0111] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 13 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO:13. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0112] In some embodiments, there is provided a composition (e.g., pharmaceutical compositions) comprising a construct comprising a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 14 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO:14. In some embodiments, the construct further comprises a second moiety. In some embodiments, the second moiety comprises a half-life extending moiety (e.g., a Fc fragment, e.g., an albumin binding domain). In some embodiments, the second moiety comprises a targeting moiety that binds to or preferentially binds to a cell (e.g., a cancer cell, e.g., a breast cancer cell, e.g., an ovarian tissue cell) or a tissue (e.g., a breast tissue, an ovary tissue). In some embodiments, the targeting moiety comprises an antibody targets the cell or tissue, and optionally promotes an internalization of the construct into the cell. In some embodiments, the construct comprises both a half-life extending moiety (e.g., a Fc fragment) and a targeting moiety.

[0113] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 1 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotidesequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0114] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 2 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0115] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0116] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 4 or afunctional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0117] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 5 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0118] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 6 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0119] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 7 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0120] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 8 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0121] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 9 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 9; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, thesafe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0122] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 10 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0123] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 11 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0124] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 12 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 12; ii) two nucleotide sequences comprising twonon-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0125] In some embodiments, there is provided a composition (e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 13 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 13; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0126] In some embodiments, there is provided a composition e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising: (i) a BRCA1 transgene cassette comprising a BRCA1 transgene corresponding to a BRCA1 protein comprising the amino acid sequence set forth in SEQ ID NO: 14 or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14; ii) two nucleotide sequences comprising two non-overlapping, homologous portions of a safe harbor locus, wherein the nucleotide sequences are located at the 5’ and 3’ ends of the BRCA1 transgene cassette; and b) a DNA nuclease or a nucleotide sequence encoding the DNA nuclease. In some embodiments, the safe harbor locus is CCR5 or AAVS1. In some embodiments, the DNA nuclease comprises a CRISPR-associated protein (Cas) nuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALENs), or a meganuclease.

[0127] The present application also contemplates compositions and methods other than described above that can promote the introduction of the BRCA1 transgene such as prime editing. Prime editors do not require double-strand DNA breaks and can make virtually anysubstitution, small insertion and small deletion within the DNA of living cells. Prime editing minimally requires a programmable nickase fused to a polymerase enzyme, and an extended guide RNA that both specifies the target site and templates the desired genome edit. See e.g., Nature Reviews Genetics volume 24, pagesl61-177 (2023).

[0128] In some embodiments, there is provided a composition e.g., pharmaceutical composition) comprising a genome editing agent comprising (a) a donor template comprising a BRCA1 transgene cassette comprising a BRCA1 transgene (such as any of the BRCA1 transgene described herein), b) a nickase (e.g., a programmable nickase fused to a polymerase enzyme), and c) a guide RNA (e.g., an extended guide RNA that both specifies the target site and templates the desired genome edit).A. BRCA1

[0129] BRCA1, a multi-domain protein, is mutated in a large percentage of hereditary breast and ovarian cancers. The cellular function of BRCA1 is heavily reliant on its interaction with other proteins. The domains in BRCA1 include BARD1 (BRCA1 -associated RING domain protein 1) PALB2 (partner and localizer of BRCA2), CTIP (C-terminal binding protein interacting protein), ABRAXAS (BRCA1 A complex subunit), BACH1 (BTB domain and CNC homolog 1) and BRCT (BRCA1 C-terminus).

[0130] BRCAl's involvement in the maintenance of genomic integrity mainly relies on its central role in protein complexes that are required for the repair of DSB and stalled replication forks. It is a central component of several protein complexes that are required for these tasks. Via its BRCA1 C-terminus domains — highly conserved motifs expressed in several proteins involved in DSB repair — BRCA1 facilitates assembly of complexes with proteins including BTB domain and CNC homolog 1, retinoblastoma binding protein 8 and BRCA1 A complex subunit that have distinct functions in the recognition and initiation of DSB repair. The BRCAl-BRCAl-associated RING domain protein 1 (BARD1) complex acts as an E3-ubiquitin ligase, an enzyme capable of transferring ubiquitin molecules from E2 ligases onto specific substrates. BRCA1-BARD1 complex-mediated ubiquitination of histone H2A has been suggested to be necessary for the repositioning of tumor-suppressor p53- binding protein 1 from the sites of DSB. This is thought to favor homologous recombination (HR)-mediated repair of DSBs instead of the error prone alternative non-homologous end joining. The BRCAl-partner and localizer of BRCA2-BRCA2 complex is necessary for the recruitment of RAD51 recombinase (RAD51) to the site of DSBs. RAD51 itself forms aprotein complex that mediates the search for homologous DNA sequences and consequent strand invasion initiating the repair process. The BRCA1 BRCT domain binds to phosphoproteins with specific sequences recognized by both BRCA1 and ATM / ATR kinases. See e.g., J Breast Cancer. 2019 Mar; 22(1): 1-14.

[0131] In addition to DSB repair, BRCA1 serves an important role in the regulation of transcription. Since BRCA1 lacks any specific DNA binding domains, this function is mediated indirectly via either the modulation of transcription regulating pathways or direct protein-protein-interaction with transcription factors. For example, BRCA1 directly interacts with the estrogen receptor ([ER]; although this mostly refers to the a-subtype, participation of ERP cannot be ruled out because some references have not provided distinctions between the different subtypes) inhibiting its transcriptional activity. See e.g., J Breast Cancer. 2019 Mar; 22(1): 1-14.

[0132] BRCA1 is most often mutated in three domains or regions: the N-terminal RING domain, exons 11-13, and the BRCT domain. Structural studies of the RING and BRCT domains have revealed the molecular basis by which cancer causing mutations impact the functions of BRCA1. While no structural data is available for the amino acids encoded by exons 11-13, multiple binding sites and functional domains exist in this region. Many mutations in exons 11-13 have deleterious effects on the function of these domains.1. RING domain

[0133] The RING (Really Interesting New Gene) domain of BRCA1 consists of a RING finger and two flanking alpha helices encompassing amino acids 1-109 (exons 2-7). Through seven conserved cysteine residues and one conserved histidine residue, the RING finger coordinates two Zn2+ atoms which stabilize the RING structure. The RING finger forms a globular structure with a core three strand P-sheet and a central helix, while the flanking helices align perpendicular to the RING finger. The RING finger, which is a highly conserved domain found in a large number of proteins, is responsible for the E3-ubiquitin ligase activity of BRCA1. The N and C-terminal helices are responsible for the interaction of BRCA1 with BARD1 (BRCA1 Associated RING Domain protein 1), a major BRCA1 binding partner that also contains a RING domain. The ubiquitin ligase activity of BRCA1 is dramatically increased by formation of the BRCA1 / BARD1 heterodimer. As with all E3- ubiquitin ligases, ubiquitination of a substrate can only occur through interaction with an E2 ubiquitin-conjugating enzyme. UbcH5, as well as other E2 enzymes, binds to the surface ofBRCA1 opposite the binding interface with BARD1. The large number of cancer predisposing mutations that affect the interaction of BRCA1 / BARD1 or BRCAl / UbcH5 as well as the RING E3 ligase function suggest that the ubiquitin ligase activity of BRCA1 is essential for its tumor suppressor function.

[0134] Mutation of the cysteine residues that coordinate the Zn2+ atoms have been reported as clinically important, indicating that they result in altered function and an increased risk of cancer. Mutation of residues in Site I result in altered folding of the RING domain. A more complete study of Site II residue mutations found altered structure by mass spectrometry and reduced Zn2+ binding at Site II . This study reported that BRCA1 / BARD1 heterodimerization was not affected by Site II mutations, however a later study by the same group reported that several Site I and Site II mutations caused not only a decrease in ubiquitin ligase activity, but also a decrease in co -immunoprecipitation of BRCA1 and BARD1. These studies suggest that mutation of Site I and Site II residues may affect BRCA1 ubiquitin ligase activity by either decreasing BRCA1 / BARD1 heterodimerization or BRCAl / UbcH5 interaction. Another study has shown that the E3-ubiquitin ligase activity of BRCA1 is inhibited by platinum (Pt)-based alkylating chemotherapeutic drugs. Cisplatin forms adducts through its Pt atom with His 117 of BRCA1, causing conformational changes and inhibiting the E3-ubiquitin ligase activity in vitro. Other Pt-based drugs had similar functional effects. Transplatin, carboplatin and oxaliplatin all reduced the E3 ligase activity of BRCA1 at therapeutically relevant concentrations. The large number of RING domain mutations that result in increased risk of breast cancer and the effect of chemotherapeutic drugs on RING domain activity suggest an important role for the RING domain in tumor suppression.2. Exon 11-13

[0135] Exons 11-13 cover over 65% of the sequence of BRCA1 and comprise two nuclear localization sequences (NLS) and binding sites for several proteins including retinoblastoma protein (RB), cMyc, Rad50 and Rad51. The amino acids encoded by these exons also contain portions of a coiled-coil domain which mediates interactions with PALB2, as well as a portion of a serine containing domain (SCD) that is phosphorylated by ATM. No atomic- level structures have been determined for exons 11-13 of BRCA1. Despite the fact that exons 11-13 contain a large percentage of the clinically relevant mutations, very little is known about the structure or function of this region when compared to the RING or BRCT domains. Interestingly, BRCA1 Exon 11-13 binding partners are involved in a wide range of cellular pathways. Myc is a transcription factor for a large number of genes. Rad50, Rad51 andPALB2 are involved in DNA repair. RB controls cell cycle progression. The large number of mutations occurring in this region, many with loss of large portions of sequence, suggests that this region is important for the tumor suppressor function of BRCA1.

[0136] The phosphoprotein RB is a well-known tumor suppressor that controls growth by regulating progression through the cell cycle. BRCA1 interacts with the hypo-phosphorylated form of RB via BRCA1 Exon 11. Specifically, amino acids 304-394 were found to be responsible for binding to the ABC domain of RB. Over-expression of BRCA1 in cells expressing wild type RB causes suppression of cell cycle progression. Deletion of the region of BRCA1 that mediates BRCA1 / RB binding inhibits BRCA1- dependent suppression of cell cycle progression. This suggests that the Exon 11 -mediated interaction between BRCA1 and RB causes cell cycle arrest through actions of RB. This finding also indicates that Exon 11 is responsible for BRCA1 -dependent cell cycle arrest, and this may also be dependent on the BRCA1 / RB interaction.

[0137] Rad50 and Rad51 are two proteins involved in DNA repair. Rad50 functions in a complex that includes Mrell and Nbsl. This complex is involved in both non-homologous end joining (NHEJ) as well as homologous recombination (HR). An interaction between BRCA1 and Rad50, and therefore with the Rad50 / MrcII / Nbs I complex, has been established. This interaction requires BRCA1 Exon 11 amino acids 341-748. BRCA1 recruits the Rad50 / MrcII / Nbs I complex to sites of DNA double strand breaks to facilitate DNA repair. BRCAl-null mouse embryonic fibroblast cells exhibit decreased levels of NHEJ activity, which suggest that BRCA1 is involved in the NHEJ process through interaction with the Rad50 / MrcII / Nbs I complex. Rad51 is a homologue of the yeast protein RecA and binds to ssDNA, facilitating homologous recombination (HR). BRCA1 is associated with Rad51 during both mitotic and meiotic cells via amino acids 758-1064. BRCA1 association with Rad50 and Rad51 suggests a role for Exon 11 in both NHEJ and HR processes of DNA repair.

[0138] The transcription factor c-Myc also interacts with BRCA1. Reports have indicated that c-Myc promotes transcription of up to 15% of the genome, making it a major hub for transcriptional activation. BRCA1 has two c-Myc binding sites (known as MB1 and MB2). MB1 is located only in Exon 11 (a.a. 433-511) while MB2 is located in exons 8-11 (a.a. 175- 303). In SVD-P5 cells co-transformed with c-Myc / Ras, transfection with BRCA1 significantly decreased the ability of these cells to form transformed foci. This suggests that the transformation activity of c-Myc / Ras is inhibited by BRCA1 expression. Additionally, thetranscriptional activity of Myc is decreased by BRCA1. Thus, suppression of the oncogenic activities of c-Myc may account for some of the tumor suppressor activity of BRCA1.

[0139] Exon 11 contains two nuclear localization sequences (NLS). Amino acids 501-507 (NLS1) and 607-614 (NLS2) are both recognized by importin-a machinery to mediate BRCA1 transport from the cytosol to the nucleus. While both sequences are recognized by importin- alpha, NLS1 is the most critical sequence because mutation of this sequence inhibits all interactions between BRCA1 and importin-alpha. Mutation of the NLS sequences results in altered subcellular localization of BRCA1, with a shift toward cytosolic localization. Clearly, mutations of BRCA1 NLSs causing cytosolic expression of BRCA1 would decrease the tumor suppressor activity of BRCA1 due to the loss of BRCAl’s DNA repair activity and subsequent increase in unrepaired mutations and chromosomal abnormalities.

[0140] A putative coiled-coil domain spanning exons 11-13 in BRCA1 (a.a. 1364-1437) contains the binding site for PALB2. At this site, PALB2 acts as a scaffold to bring together BRCA1 and BRCA2 to form a complex of the three proteins which is involved in HR during DNA repair. Both BRCA1 and PALB2 contain coiled-coil domains that mediate the interaction of the two proteins. Through modeling of the coiled-coil domain of BRCA1 and PALB2, the interaction sites were mapped to the predicted a-face of the PALB2 helix containing Lysl4, Leu21, Tyr28, Leu35, and Glu42 and the predicted a and d-faces of BRCA1. Mutations in the coiled-coil region of BRCA1 led to the discovery of the PALB2 binding site on BRCA1, since mutations reported in this region (Metl400Val, Leul407Pro, and Met 141 IThr) inhibit interaction between BRCA1 and PALB2.

[0141] BRCA1 contains a domain called the serine cluster domain (SCD). A portion of the SCD of BRCA1 is located in exons 11-13, and spans from amino acids 1280-1524. The region has a concentrated amount of putative phosphorylation sites and is phosphorylated by ATM / ATR kinases in vitro and in vivo. ATM and ATR are kinases activated by DNA damage. Phosphorylation of BRCA1 causes recruitment of BRCA1 to sites of double strand breaks. SCDs are common in ATM / ATR targets including multiple DNA damage response proteins. Serines 1189, 1457, 1524, and 1542 can all be phosphorylated in vivo, while additional serines can be phosphorylated in vitro. Mutation of these serine residues are seen clinically and may affect localization of BRCA1 to sites of DNA damage and DNA damage response function.3. BRCT domain

[0142] The BRCA1 C-terminal (BRCT) domain was originally identified in BRCA1, but it is also a conserved domain in multiple other proteins (most being involved in DNA damage repair). BRCT domains can occur as a single BRCT domain, as a tandem repeat (as found in BRCA1), multiple repeats, or fusions between two domains. The BRCA1 BRCT domain mediates phosphoprotein interactions between BRCA1 and proteins phosphorylated by ATM and ATR, two kinases activated by DNA damage. BRCT domains are classified into two categories based on their ability to recognize phosphoproteins. Class-I BRCT domains can recognize phosphoserine (pSer) residues, while Class-II BRCT domains can recognize both pSer and phospho threonine (pThr) residues. The BRCA1 BRCT domain recognizes the sequence pSer-X-X-Phe in its phosphorylated binding partners and is therefore a Class-I BRCT domain. Binding partners for the BRCA1 BRCT domain include BACH1, CtIP, and CCDC98 / abraxas. While the main function of the BRCA1 BRCT domain is modulating interactions between BRCA1 and phosphoproteins, BRCT domains, including the BRCT domain of BRCA1, can also mediate DNA binding and non-phosphoprotein interactions.

[0143] Amino acids 1650-1863 of BRCA1 consist of two tandem BRCT repeats connected by a 22 amino acid linker. Each BRCT repeat consists of three a-helices packed around a four strand P-sheet. The two BRCT repeats interact in a head-to-tail fashion through the interaction between a-helix 2 of BRCT1, and a-helices 1 and 3 of BRCT2 through mainly hydrophobic residues. The architecture of the tandem BRCT allows the BRCA1 BRCT to recognize both a pSer and the 3+ aromatic residue in a bipartite manner in two separate recognition pockets in the cleft between BRCT1 and BRCT2. The pSer residue forms hydrogen bonds with Serl655 and Lysl702 and the backbone amine group of Glyl656, all within the N-terminal BRCT1. The 3+ phenylalanine residue fits into the hydrophobic core created by the two BRCT repeats, while the main chain backbone of the 3+ phenylalanine forms hydrogen bonds with R1699 of a-helix 1 of the N-terminal BRCT domain. The size and subsequent rigidity of the hydrophobic core of the interface between the two BRCT repeats dictates the strict consensus sequence required for substrate recognition by the BRCA1 BRCT domain. The consensus sequence pSer-X-X-Phe facilitates recognition of targets such as CtIP, BACH1, and abraxas which are all phosphorylated in response to DNA damage.

[0144] The BRCA1 BRCT domain has also been shown to bind directly to DNA double strand breaks (DSB) by electron microscopy. However, the in vivo relevance of thisinteraction is unknown. While structural studies of the interaction between the BRCA1 BRCT domain and double strand breaks have yet to be carried out, models have been developed with predicted interactions between the BRCT of replication factor RFCpl40 and DNA double strand breaks. The BRCT domain of RFCpl40 recognizes the terminal 5’ phosphate of a 3’ overhanging DNA double strand break, as well as the major groove of the DNA adjacent to the double strand break. It is unknown whether or not the BRCT domain of BRCA1 binds to DNA in a similar manner. BRCT domains have also been shown to interact with some proteins in a phosphorylation-independent manner, however this has been much less studied and not well characterized in BRCA1.

[0145] Multiple studies have found mutations in the BRCT domain of BRCA1 in breast and / or ovarian cancers. Specifically, mutation of hydrophobic residues within the hydrophobic core of the BRCT domain inhibits the ability of BRCA1 to recognize phospholigands. This would suggest that mutation of a residue required for recognition of a substrate would impede the ability of BRCA1 to carry out its role in the DNA damage repair pathway. An interesting example causes BRCA1 to fall into a “similarity trap”. Typically, phosphorylated p53 has a much higher binding affinity for 53BP1 (p53 binding protein 1), than BRCA1. Both 53BP1 and BRCA1 interact with p53 through their tandem BRCT domains, however with different affinities. Two cancer causing mutations in BRCA1, Phel695Leu and Aspl733Gly cause BRCA1 to bind p53 with similar affinity to 53BP1. This suggests that these mutations of BRCA1 in the BRCT domain could force BRCA1 into a similarity trap, causing 1) BRCA1 to bind p53 with higher affinity than wild-type BRCA1, and 2) competition for 53BP1 binding to p53. Thus, it is likely that these mutations in the BRCA1 BRCT domain lead to altered p53 function possibly contributing to the cancer phenotype. Another study has shown that cancer causing mutations in other areas of the BRCA1 BRCT domain can alter the backbone structure of the BACH1 binding pocket. This suggests that mutations that affect the BACH1 binding pocket are not limited to just the residues in direct contact with the phosphopeptide. The number of cancer-causing mutations in this region suggests that this domain is critical for tumor suppression. See e.g., Comput Struct Biotechnol J. 2012; 1: e201204005.

[0146] As a summary, Table 1 below lists the corresponding amino acid sequence of different domains.Table 1. Mapping of BRCA-1

[0147] The present application provides BRCA1 mRNAs described below, BRCA1 proteins (e.g., BRCA1 fragments including one or more domains) encoded by the BRCA1 mRNAs described herein, and genome editing agents that facilitate or promote BRCA1 proteins or mRNAs described herein. BRCA1 mRNA and proteins herein refer to polynucleotides (e.g.,mRNA) or proteins that comprise BRCA1 mRNAs or BRCA1 proteins in full length or fragments.

[0148] The present application further comprises a composition (e.g., pharmaceutical composition) comprising any of the BRCA1 agents such as BRCA1 mRNAs (e.g., isolated BRCA1 mRNAs), BRCA1 proteins (e.g., isolated BRCA1 proteins) and genome editingagents described herein, methods of producing these agents, and pharmaceutical compositions, and methods of treatments involving use of these agents, and pharmaceutical compositions for treating a disease that involves a BRCA1 aberration.B. BRCA1 mRNAs

[0149] In some embodiments, the BRCA1 mRNA encodes the full-length BRCA1 protein (e.g., an amino acid sequence set forth in SEQ ID NO: 1) or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the full-length BRCA1 protein. In some embodiments, the functional variant comprises an amino acid sequence of a length of at least 80%, 85%, 90%, 95%, 97%, 98%, 99% of the length of the amino acid sequence set forth in SEQ ID NO: 1.

[0150] The functional variant described herein refers to a variant that has comparable efficacy (e.g., exhibiting at least 80%, 85%, 90%, or 95% of the efficacy measurement). In some embodiments, the efficacy measurement comprises or is the inhibition effect of cell proliferation of a cell comprising a BRCA1 aberration (e.g., any one or more of the aberrations) described herein. In some embodiments, the cell is a cancer cell (e.g., a cancer cell line). In some embodiments, the cell is or comprises one or more of SUM149PT, MDA- MB436, UWB1-289, SUM1315, HCC1937, HS578T, and HCC1143.

[0151] In some embodiments of any of the BRCA1 mRNAs described herein, the BRCA1 mRNA encodes a contiguous amino acid sequence comprised in SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence comprised in SEQ ID NO: 1).

[0152] In some embodiments, the BRCA1 mRNAs encodes at least a portion of the N- terminus fragment of BRCA1 protein, optionally wherein the portion of the N-terminus fragment comprises a contiguous amino acid sequence comprised in SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence comprised in SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 109 amino acids (i.e., amino acid 1-109 of SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 247 amino acids (i.e., amino acid 1-247 of SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 507 amino acids (i.e., amino acid 1-507 of SEQ ID NO: 1).

[0153] In some embodiments, the BRCA1 mRNA encodes the full domain of RING domain. In some embodiments, the BRCA1 mRNA further encodes NLS1 and / or NLS2. In some embodiments, the BRCA1 mRNA encodes a) the full domain of RING domain and b) NLS1. In some embodiments, the BRCA1 mRNA encodes an amino acid sequence of amino acid 1- 507 of SEQ ID NO: 1. In some embodiments, the BRCA1 mRNA does not encode NLS2. In some embodiments, the BRCA1 mRNA encodes at least a portion of the RAD50 binding domain, optionally wherein the BRCA1 mRNA does not encode the full length of the RAD50 binding domain. In some embodiments, the BRCA1 mRNA does not encode any one or more of the Rad51, PALB2, SCD, and BRCT domains. In some embodiments, the N-terminus fragment comprises at least 507 amino acids (z.e., amino acid 1-507 of SEQ ID NO: 1).

[0154] In some embodiments, the BRCA1 mRNA encodes the full domain of RING domain, optionally wherein the BRCA1 mRNA does not encode any one or more of the RB, MB1, NLS1, NLS2, Rad50, Rad51, PALB2, SCD, and BRCT domains. In some embodiments, the BRCA1 mRNA does not encode Exon 11 domain. In some embodiments, the BRCA1 mRNA does not encode Exon 11-13 domains. In some embodiments, the N-terminus fragment comprises at least 247 amino acids (z.e., amino acid 1-247 of SEQ ID NO: 1).

[0155] In some embodiments, the BRCA1 mRNA encodes the full length of the Exon 11 or a portion of Exon 11. In some embodiments, the portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof. In some embodiments, the portion of Exon 11 comprises a contiguous amino acid sequence of amino acid 507-1247 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-1247 of SEQ ID NO: 1). In some embodiments, the BRCA1 mRNA comprises a contiguous amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-907 of SEQ ID NO: 1). In some embodiments, the BRCA1 mRNA encodes the full NLS2 region. In some embodiments, the BRCA1 mRNA encodes the NLS1 region. In some embodiments, the BRCA1 mRNA does not encode the NLS1 region.

[0156] In some embodiments, the BRCA1 mRNA encodes at least a portion of the RAD50 binding domain and / or at least a portion of a RAD51 binding domain. In some embodiments, the at least a portion of a RAD51 binding domain comprises a contiguous amino acidsequence of the N-terminus of the RAD51 binding domain. In some embodiments, the contiguous amino acid sequence of the N-terminus of the RAD51 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids at the N-terminus of the RAD51 binding domain. In some embodiments the portion of RAD50 binding domain comprise a contiguous amino acid sequence of the C-terminus of the RAD50 binding domain. In some embodiments, the contiguous amino acid sequence of the C-terminus of the RAD50 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 240 amino acids at the C-terminus of the RAD50 binding domain.

[0157] In some embodiments, the at least a portion of a RAD51 binding domain comprises a contiguous amino acid sequence of amino acid 758-907 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 758- 907 of SEQ ID NO: 1).

[0158] In some embodiments, the BRCA1 mRNA encodes the full length of a RAD51 binding domain. In some embodiments, the BRCA1 mRNA further encodes a portion of RAD50 binding domain. In some embodiments the portion of RAD50 binding domain comprise a contiguous amino acid sequence of the C-terminus of the RAD50 binding domain. In some embodiments, the contiguous amino acid sequence of the C-terminus of the RAD50 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 240 amino acids at the C-terminus of the RAD50 binding domain. In some embodiments, the portion of the RAD50 binding domain comprises at least a contiguous amino acid sequence of amino acid 507-748 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-748 of SEQ ID NO: 1).

[0159] In some embodiments, the BRCA1 mRNA encodes at least a portion of the C- terminus fragment of BRCA1 protein, optionally wherein the portion of the C-terminus fragment comprises a contiguous C-terminus amino acid sequence comprised in SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous C-terminus amino acid sequence comprised in SEQ ID NO: 1). In some embodiments, the contiguous C-terminus amino acid sequence has a length of at least about 500, 600, 700, or 800 amino acids.

[0160] In some embodiments, the BRCA1 mRNA encodes a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1).

[0161] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) at least a portion of the RAD50 binding domain (e.g., a contiguous amino acid sequence of about 240 amino acids of the C-terminus of the RAD 50 binding domain) and / or at least a portion of a RAD51 binding domain (e.g., a contiguous amino acid sequence of about 150 amino acids of the C-terminus of the RAD 50 binding domain).

[0162] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a full length of Exon 11.

[0163] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof.

[0164] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a portionof Exon 11 comprises the amino acid sequence of amino acid 507-1247 of SEQ ID NO: 1 or a functional variant thereof.

[0165] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a contiguous amino acid sequence of the C-terminus fragment of the BRCA1 protein set forth in SEQ ID NO: 1, wherein the contiguous amino acid sequence comprising a length of at least about 800 amino acids.

[0166] In some embodiments, the BRCA1 mRNA encodes a) a portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or amino acid 507-1247 of SEQ ID NO: 1 or a functional variant thereof, and b) a contiguous amino acid sequence of the C-terminus fragment of the BRCA1 protein (e.g., the amino acid sequence of SEQ ID NO: 1), wherein the contiguous amino acid sequence comprises a length of at least about 800 amino acids.

[0167] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047- 1837 of SEQ ID NO: 1).

[0168] In some embodiments, the BRCA1 mRNA encodes a) a portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof, and b) a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1). In some embodiments, the BRCA1 mRNAencodes the amino acid sequence of amino acid 507-1837 of SEQ ID NO: 1 or a functional variant thereof.

[0169] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), b) at least a portion of the RAD50 binding domain (e.g., a contiguous amino acid sequence of about 240 amino acids of the C-terminus of the RAD 50 binding domain) and / or at least a portion of a RAD51 binding domain (e.g., a contiguous amino acid sequence of about 150 amino acids of the C-terminus of the RAD 50 binding domain), and c) a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1).

[0170] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a full length of Exon 11, and c) a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1).

[0171] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) a portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof, and c) a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1).

[0172] In some embodiments, the BRCA1 mRNA encodes a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1), and b) a portion of Exon 11 comprises the amino acid sequence of amino acid 507-1837 of SEQ ID NO: 1 or a functional variant thereof.

[0173] In some embodiments, the BRCA1 mRNA comprises any one or more of sequences with accession number of NM_007294, NM_007297, NM_007298, NM_007304, NM_007299, NM_007300, BC046142, BC062429, BC072418, AY354539, AY751490, BC085615, BC106746, BC106745, BC114511, BC115037, U14680, AK293762, U68041, BC030969, BC012577, AK316200, DQ363751, DQ333387, DQ333386, Y08864, JN686490, AB621825, BC038947, U64805, and AF005068 in NCBI GenBank. In some embodiments, the BRCA1 mRNA does not comprise any one or more of sequences with accession number of NM_007294, NM_007297, NM_007298, NM_007304, NM_007299, NM_007300, BC046142, BC062429, BC072418, AY354539, AY751490, BC085615, BC106746, BC106745, BC114511, BC115037, U14680, AK293762, U68041, BC030969, BC012577, AK316200, DQ363751, DQ333387, DQ333386, Y08864, JN686490, AB621825, BC038947, U64805, and AF005068 in NCBI GenBank.

[0174] In some embodiments, the BRCA1 mRNA encodes any of the BRCA1 proteins described herein under the section “BRCA1 proteins.”

[0175] In some embodiments, the BRCA1 mRNA has a length of at least about 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1100 bp, 1200 bp, 1300 bp, 1400 bp, 1500 bp, 1600 bp, 1700 bp, 1800 bp, 1900 bp, 2000 bp, 2100 bp, or 2200 bp. In some embodiments, the BRCA1 mRNA has a length of no more than about 5000 bp, 4500 bp, 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2300 bp, 2000 bp, 1900 bp, 1800 bp, 1700 bp, 1600 bp, 1500 bp, 1400 bp, 1300 bp, 1200 bp, 1100 bp, 1000 bp, 900 bp, or 800 bp.1. mRNA modification

[0176] After over a decade of development, mRNA has recently matured into a potent modality for therapeutics. The advantages of mRNA therapeutics, including their rapid development and scalability, have been highlighted due to the SARS-CoV-2 pandemic, in which the first two clinically approved mRNA vaccines have been spotlighted. Thesevaccines, as well as multiple other mRNA therapeutic candidates, are modified to modulate their immunogenicity, stability, and translational efficiency.

[0177] In some embodiments, the mRNA described herein is modified. Exemplary modification includes but not limited to cap and tail modifications, nucleoside substitutions, and chimeric mRNAs. See e.g., Front Cell Dev Biol. 2022 Jul 13; 10:901510.

[0178] In some embodiments, the mRNA is subject to a 5’-cap modification (e.g., phosphodiester analogs, anti-reverse caps (2’- and 3’OH modification), first nucleotide identity and methylation status (cap 0, 1, 2)). The 5’-cap modifications can increase translational efficiency via binding affinity to elF4E, improves lifespan of mRNA by resisting decapping, and / or avoids detection by innate immune sensors.

[0179] In some embodiments, the mRNA is subject to a mRNA body modification (e.g., full nucleotide replacement (y, m’y, s2U), context-dependent modified nucleosides (ac4C, 5- moU), phosphodiester analogs). mRNA body modifications can suppress immune detection, particularly through uridine substitution, and / or improve stability and translational yield as well.

[0180] In some embodiments, the mRNA has been subject to poly(A) tail modification (e.g., exonuclease resistant backbones, conjugated fluorescent reporters). Poly(A) tail modifications can increase mRNA lifespan by resisting exonucleolytic digestion and / or improving translational efficacy.

[0181] In some embodiments, the mRNA has been subject to a chimeric ligation (e.g., chemically synthesized oligonucleotides). Chimeric ligation can support wide range of modification. It can significantly increase diversity of synthetic transcripts and / or mRNA lifespan.

[0182] In some embodiments, the mRNA is modified on the first base (A’s), triphosphate (B’s), or second base (C’s).

[0183] In some embodiments, the mRNA is modified via one or more bases selected from the group consisting of uridine, adenosine, and cytosine. In some embodiments, the mRNA is modified via one or more bases selected from the group consisting of 2-thiouridine (s2U), pseudouridine ( ), N '-mcthylpscudouridinc (mlvP), N6-methyladenosine (m6A) and 5- methylcytosine (m5C).

[0184] In some embodiments, the mRNA is modified via backbone (e.g., phosphate backbone, e.g., 2’ -OH backbone).

[0185] In some embodiments, the mRNA comprises at least one modification which confers increased or enhanced stability to the nucleic acid, including, for example, improved resistance to nuclease digestion in vivo. As used herein, the terms “modification” and “modified” as such terms relate to the nucleic acids provided herein, include at least one alteration which preferably enhances stability and renders the mRNA more stable (e.g., resistant to nuclease digestion) than the wild-type or naturally occurring version of the mRNA. As used herein, the terms “stable” and “stability” as such terms relate to the nucleic acids of the present application, and particularly with respect to the mRNA, refer to increased or enhanced resistance to degradation by, for example nucleases (i.e., endonucleases or exonucleases) which are normally capable of degrading such mRNA. Increased stability can include, for example, less sensitivity to hydrolysis or other destruction by endogenous enzymes (e.g., endonucleases or exonucleases) or conditions within the target cell or tissue, thereby increasing or enhancing the residence of such mRNA in the target cell, tissue, subject and / or cytoplasm. The stabilized mRNA molecules provided herein demonstrate longer half-lives relative to their naturally occurring, unmodified counterparts (e.g. the wild-type version of the mRNA). Also contemplated by the terms “modification” and “modified” as such terms related to the mRNA of the present application are alterations which improve or enhance translation of mRNA nucleic acids, including for example, the inclusion of sequences which function in the initiation of protein translation (e.g., the Kozak consensus sequence). (Kozak, M., Nucleic Acids Res 15 (20): 8125-48 (1987)).

[0186] In some embodiments, the mRNAs used in the compositions of the application have undergone a chemical or biological modification to render them more stable. Exemplary modifications to an mRNA include the depletion of a base (e.g., by deletion or by the substitution of one nucleotide for another) or modification of a base, for example, the chemical modification of a base. The phrase “chemical modifications” as used herein, includes modifications which introduce chemistries which differ from those seen in naturally occurring mRNA, for example, covalent modifications such as the introduction of modified nucleotides, (e.g., nucleotide analogs, or the inclusion of pendant groups which are not naturally found in such mRNA molecules).

[0187] In addition, suitable modifications include alterations in one or more nucleotides of a codon such that the codon encodes the same amino acid but is more stable than the codonfound in the wild-type version of the mRNA. For example, an inverse relationship between the stability of RNA and a higher number of cytidines (C's) and / or uridines (U's) residues has been demonstrated, and RNA devoid of C and U residues have been found to be stable to most RNases (Heidenreich, et al. J Biol Chem 269, 2131-8 (1994)). In some embodiments, the number of C and / or U residues in an mRNA sequence is reduced. In another embodiment, the number of C and / or U residues is reduced by substitution of one codon encoding a particular amino acid for another codon encoding the same or a related amino acid. Contemplated modifications to the mRNA nucleic acids of the present application also include the incorporation of pseudouridines. The incorporation of pseudouridines into the mRNA nucleic acids of the present application may enhance stability and translational capacity, as well as diminishing immunogenicity in vivo. See, e.g., Kariko, K., et al., Molecular Therapy 16 (11): 1833-1840 (2008). Substitutions and modifications to the mRNA of the present application may be performed by methods readily known to one of ordinary skill in the art.

[0188] The constraints on reducing the number of C and U residues in a sequence may be greater within the coding region of an mRNA, compared to an untranslated region, (z.e., it will likely not be possible to eliminate all of the C and U residues present in the message while still retaining the ability of the message to encode the desired amino acid sequence). The degeneracy of the genetic code, however, presents an opportunity to allow the number of C and / or U residues that are present in the sequence to be reduced, while maintaining the same coding capacity (z.e., depending on which amino acid is encoded by a codon, several different possibilities for modification of RNA sequences may be possible). For example, the codons for Gly can be altered to GGA or GGG instead of GGU or GGC.

[0189] Other suitable polynucleotide modifications that may be incorporated into the mRNA used in the compositions of the application include, but are not limited to, 4'-thio- modified bases: 4'-thio-adenosine, 4'-thio-guanosine, 4 '-thio-cytidine, 4 '-thio-uridine, 4'-thio- 5-methyl-cytidine, 4'-thio-pseudouridine, and 4'-thio-2-thiouridine, pyridin-4-one ribonucleoside, 5-aza- uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2- thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-l -methylpseudouridine, 2-thio-l-methyl-pseudouridine, 1 -methyl- 1-deaza-pseudouridine, 2-thio-l-methyl- 1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 5 -aza-cytidine, pseudoisocytidine, 3-methyl- cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2- thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio- 1-methyl-pseudoisocytidine, 4-thio- 1 -methyl- 1-deaza-pseudoisocytidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy- 1-methyl- pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza- adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza- guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine, and combinations thereof. The term modification also includes, for example, the incorporation of non-nucleotide linkages or modified nucleotides into the mRNA sequences of the present application (e.g., modifications to one or both of the 3' and 5' ends of an mRNA molecule encoding a functional protein or enzyme). Such modifications include the addition of bases to an mRNA sequence (e.g., the inclusion of a poly A tail or a longer poly A tail), the alteration of the 3' UTR or the 5' UTR, complexing the mRNA with an agent (e.g., a protein or a complementary nucleic acid molecule), and inclusion of elements which change the structure of an mRNA molecule (e.g., which form secondary structures). i. Cap Structure

[0190] In some embodiments, mRNAs include a 5' cap structure. A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) isthen added to the terminal phosphates via a guanylyl transferase, producing a 5'5'5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G.

[0191] Naturally occurring cap structures comprise a 7-methyl guanosine that is linked via a triphosphate bridge to the 5 '-end of the first transcribed nucleotide, resulting in a dinucleotide cap of m7G(5')ppp(5')N, where N is any nucleoside. In vivo, the cap is added enzymatically. The cap is added in the nucleus and is catalyzed by the enzyme guanylyl transferase. The addition of the cap to the 5' terminal end of RNA occurs immediately after initiation of transcription. The terminal nucleoside is typically a guanosine and is in the reverse orientation to all the other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0192] A common cap for mRNA produced by in vitro transcription is m7G(5')ppp(5')G, which has been used as the dinucleotide cap in transcription with T7 or SP6 RNA polymerase in vitro to obtain RNAs having a cap structure in their 5 '-termini. The prevailing method for the in vitro synthesis of capped mRNA employs a pre-formed dinucleotide of the form m7G(5')ppp(5')G (“m7GpppG”) as an initiator of transcription.

[0193] To date, a usual form of a synthetic dinucleotide cap used in in vitro translation experiments is the Anti-Reverse Cap Analog (“ARCA”) or modified ARCA, which is generally a modified cap analog in which the 2' or 3' OH group is replaced with — OCH3.

[0194] Additional cap analogs include, but are not limited to, a chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analog (e.g., m2,7GpppG), trimethylated cap analog (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or anti reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m72'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al., “Novel ‘anti-reverse’ cap analogs with superior translational properties”, RNA, 9: 1108-1122 (2003)).

[0195] In some embodiments, a suitable cap is a 7-methyl guanylate (“m7G”) linked via a triphosphate bridge to the 5 '-end of the first transcribed nucleotide, resulting in m7G(5')ppp(5')N, where N is any nucleoside. A preferred embodiment of a m7G cap utilized in embodiments of the application is m7G(5')ppp(5')G.

[0196] In some embodiments, the cap is a CapO structure. CapO structures lack a 2'-O-methyl residue of the ribose attached to bases 1 and 2. In some embodiments, the cap is a Caplstructure. Capl structures have a 2'-O-methyl residue at base 2. In some embodiments, the cap is a Cap2 structure. Cap2 structures have a 2'-O-methyl residue attached to both bases 2 and 3.

[0197] A variety of m7G cap analogs are known in the art, many of which are commercially available. These include the m7GpppG described above, as well as the ARCA 3' — OCH3 and 2' — OCH3 cap analogs (Jemielity, J. et al., RNA, 9: 1108-1122 (2003)). Additional cap analogs for use in embodiments of the application include N7-benzylated dinucleoside tetraphosphate analogs (described in Grudzien, E. et al., RNA, 10: 1479-1487 (2004)), phosphorothioate cap analogs (described in Grudzien-Nogalska, E., et al., RNA, 13: 1745- 1755 (2007)), and cap analogs (including biotinylated cap analogs) described in U.S. Pat. Nos. 8,093,367 and 8,304,529, incorporated by reference herein. ii. Tail Structure

[0198] Typically, the presence of a “tail” serves to protect the mRNA from exonuclease degradation. A poly A or poly U tail is thought to stabilize natural messengers and synthetic sense RNA. Therefore, in certain embodiments a long poly A or poly U tail can be added to an mRNA molecule thus rendering the RNA more stable. Poly A or poly U tails can be added using a variety of art-recognized techniques. For example, long poly A tails can be added to synthetic or in vitro transcribed RNA using poly A polymerase (Yokoe, et al. Nature Biotechnology. 1996; 14: 1252-1256). A transcription vector can also encode long poly A tails. In addition, poly A tails can be added by transcription directly from PCR products. Poly A may also be ligated to the 3' end of a sense RNA with RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0199] Typically, the length of a poly A or poly U tail can be at least about 10, 50, 100, 200, 300, 400 at least 500 nucleotides. In some embodiments, a poly-A tail on the 3' terminus of mRNA typically includes about 10 to 300 adenosine nucleotides (e.g., about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). In some embodiments, mRNAs include a 3' poly(C) tail structure. A suitable poly-C tail on the 3' terminus of mRNA typically includes about 10 to 200 cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). Thepoly-C tail may be added to the poly-A or poly U tail or may substitute the poly-A or poly U tail.

[0200] In some embodiments, the length of the poly A or poly C tail is adjusted to control the stability of a modified sense mRNA molecule of the application and, thus, the transcription of protein. For example, since the length of the poly A tail can influence the half-life of a sense mRNA molecule, the length of the poly A tail can be adjusted to modify the level of resistance of the mRNA to nucleases and thereby control the time course of polynucleotide expression and / or polypeptide production in a target cell. iii. Signal Peptide Sequence

[0201] In some embodiments, an mRNA according to the present application incorporates a nucleotide sequence encoding a signal peptide. As used herein, the term “signal peptide” refers to a peptide present at a newly synthesized protein that can target the protein towards the secretory pathway. In some embodiments, the signal peptide is cleaved after translocation into the endoplasmic reticulum following translation of the mRNA. Signal peptide is also referred to as signal sequence, leader sequence or leader peptide. Typically, a signal peptide is a short (e.g., 5-30, 5-25, 5-20, 5-15, or 5-10 amino acids long) peptide. A signal peptide may be present at the N-terminus of a newly synthesized protein. Without wishing to be bound by any particular theory, the incorporation of a signal peptide encoding sequence on an mRNA may facilitate the secretion and / or production of the encoded protein in vivo.

[0202] A suitable signal peptide for the present application can be a heterogeneous sequence derived from various eukaryotic and prokaryotic proteins, in particular secreted proteins. In some embodiments, a suitable signal peptide is a leucine-rich sequence. See Yamamoto Y et al. (1989), Biochemistry, 28:2728-2732, which is incorporated herein by reference. A suitable signal peptide may be derived from a human growth hormone (hGH), serum albumin preproprotein, Ig kappa light chain precursor, Azurocidin preproprotein, cystatin-S precursor, trypsinogen 2 precursor, potassium channel blocker, alpha conotoxin Ip 1.3, alpha conotoxin, alfa-galactosidase, cellulose, aspartic proteinase nepenthesin- 1, acid chitinase, K28 prepro- toxin, killer toxin zygocin precursor, and Cholera toxin. Exemplary signal peptide sequences are described in Kober, et al., Biotechnol. Bioeng., 110: 1164-73, 2012, which is incorporated herein by reference.

[0203] In some embodiments, an mRNA according to the present application may incorporate a sequence encoding a signal peptide derived from human growth hormone(hGH), or a fragment thereof. A non-limiting nucleotide sequence encoding a hGH signal peptide is show below.5' human growth hormone (hGH) sequence(SEQ ID NO: 11): AUGGCCACUGGAUCAAGAACCUCACUGCUGCUCGCUUUUGGACUGCUUUG CCUGCCCUGGUUGCAAGAAGGAUCGGCUUUCCCGACCAUCCCACUCUCC Alternative 5' human growth hormone (hGH) sequence (SEQ ID NO: 12): AUGGCAACUGGAUCAAGAACCUCCCUCCUGCUCGCAUUCGGCCUGCUCUG UCUCCCAUGGCUCCAAGAAGGAAGCGCGUUCCCCACUAUCCCCCUCUCG

[0204] In some embodiments, an mRNA according to the present application may incorporate a signal peptide encoding sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity to SEQ ID NO: 11 or SEQ ID NO: 12. iv. 5 ' and 3 ' Untranslated Region

[0205] In one embodiment, an mRNA can be modified by the incorporation of 3' and / or 5' untranslated (UTR) sequences that are not naturally found in the wild-type mRNA. In one embodiment, a 3' and / or 5' flanking sequence that naturally flanks an mRNA and encodes a second, unrelated protein can be incorporated into the nucleotide sequence of an mRNA molecule encoding a therapeutic or functional protein in order to modify it. For example, 3' or 5' sequences from mRNA molecules that are stable (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) can be incorporated into the 3' and / or 5' region of a sense mRNA nucleic acid molecule to increase the stability of the sense mRNA molecule. See, e.g., US2003 / 0083272.

[0206] In some embodiments, the mRNA in the compositions of the application include modification of the 5' end of the mRNA to include a partial sequence of a CMV immediate- early 1 (IE1) gene, or a fragment thereof (e.g., SEQ ID NO:1) to improve the nuclease resistance and / or improve the half-life of the mRNA. In addition to increasing the stability of the mRNA nucleic acid sequence, it has been surprisingly discovered that the inclusion of a partial sequence of a CMV immediate-early 1 (IE1) gene enhances the translation of the mRNA and the expression of the functional protein or enzyme. Also contemplated is the inclusion of a human growth hormone (hGH) gene sequence, or a fragment thereof (e.g., SEQ ID NO:2) to the 3' ends of the nucleic acid (e.g., mRNA) to further stabilize the mRNA.Generally, preferred modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA relative to their unmodified counterparts, and include, for example modifications made to improve such mRNA's resistance to in vivo nuclease digestion.

[0207] In some embodiments, the composition can comprise a stabilizing reagent. The compositions can include one or more formulation reagents that bind directly or indirectly to, and stabilize the mRNA, thereby enhancing residence time in the target cell. Such reagents preferably lead to an improved half-life of the mRNA in the target cells. For example, the stability of an mRNA and efficiency of its translation may be increased by the incorporation of “stabilizing reagents” that form complexes with the mRNA that naturally occur within a cell (see e.g., U.S. Pat. No. 5,677,124). Incorporation of a stabilizing reagent can be accomplished for example, by combining the poly A and a protein with the mRNA to be stabilized in vitro before loading or encapsulating the mRNA within a transfer vehicle. Exemplary stabilizing reagents include one or more proteins, peptides, aptamers, translational accessory protein, mRNA binding proteins, and / or translation initiation factors.

[0208] Stabilization of the compositions may also be improved by the use of opsonizationinhibiting moieties, which are typically large hydrophilic polymers that are chemically or physically bound to the transfer vehicle (e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids). These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system and reticulo-endothelial system (e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference). Transfer vehicles modified with opsonization-inhibition moieties thus remain in the circulation much longer than their unmodified counterparts.

[0209] When RNA is hybridized to a complementary nucleic acid molecule (e.g., DNA or RNA) it may be protected from nucleases. (Krieg, et al. Melton. Methods in Enzymology. 1987; 155, 397-415). The stability of hybridized mRNA is likely due to the inherent single strand specificity of most RNases. In some embodiments, the stabilizing reagent selected to complex an mRNA is a eukaryotic protein, (e.g., a mammalian protein). In yet another embodiment, the mRNA can be modified by hybridization to a second nucleic acid molecule. If an entire mRNA molecule were hybridized to a complementary nucleic acid molecule translation initiation may be reduced. In some embodiments the 5' untranslated region and theAUG start region of the mRNA molecule may optionally be left unhybridized. Following translation initiation, the unwinding activity of the ribosome complex can function even on high affinity duplexes so that translation can proceed. (Liebhaber. J. Mol. Biol. 1992; 226: 2- 13; Monia, et al. J Biol Chem. 1993; 268: 14514-22.)

[0210] In some embodiments, the mRNA modification comprises any one or more of N6- methyladenosine (m6A), N6,2'-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine ( ), 5 -methylcytidine (m5C), and N4-acetylcytidine (ac4C). see e.g., Experimental & Molecular Medicine volume 52, pages400-408 (2020). Exemplary capping strategies include enzymatic capping and co-transcriptional capping (e.g., 3’OMe).

[0211] Additional exemplary mRNA modification, manufacture, and delivery see e.g., W0200724708, W02012045082, WO2012138453, US20140206752, US20150017211, WO2013052523, US11090367B2, WO2013151666, W02013090648, US20130237593, W02013071047, WO2014028429, WO2012135805, WO2012116714, WO2013106496, WO2013101690, WO2013151672, WO2014164253, WO2014093924, WO2014159813, W02014 / 081507, WO2014152027, WO2014152211, WO2014160243, W02014152030, WO2012116715 and US20130336998, US20080025944 and US20050250723, W02014152031, US20050059624 and US20080171711, EP1083232, US20080025944, US20050250723, US20190388563A1 and W02012019780, all of which are incorporated by reference in their full entirety.

[0212] It will be understood that any of the above-described methods for enhancing the stability of mRNA may be used either alone or in combination with one or more of any of the other above-described methods and / or compositions.

[0213] The mRNAs of the present application may be optionally combined with a reporter gene (e.g., upstream or downstream of the coding region of the mRNA) which, for example, facilitates the determination of mRNA delivery to the target cells or tissues. Suitable reporter genes may include, for example, Green Fluorescent Protein mRNA (GFP mRNA), Renilla Luciferase mRNA (Luciferase mRNA), Firefly Luciferase mRNA, or any combinations thereof. For example, GFP mRNA may be fused with an mRNA encoding a secretable protein to facilitate confirmation of mRNA localization in the target cells that will act as a depot for protein production.V. Self-amplifying RNA (saRNA)

[0214] In some embodiments, self-amplifying mRNA (saRNA) is used as the BRCA1 mRNA to amplify ectopic expression of BRCA-1 in a host cell (e.g., cancer cells). Selfamplifying mRNA (saRNA) is a form of synthetic mRNA used in RNA vaccine design to drive high expression of a protein of interest in a target cell. saRNA is based on the genome of positive-sense, single stranded RNA (ssRNA) viruses, and incorporates both the mRNA coding sequence of the protein of interest and viral elements that drive the replication of the mRNA akin to viral genome replication. By leveraging the natural replication machinery of positive-sense, single stranded RNA viruses, saRNA based vaccines have the potential to elicit a stronger innate and adaptive immune response than standard mRNA-based vaccines with a relatively smaller vaccine dosage. See e.g., Current Topics in Microbiology and Immunology, 2022437: 31-70; Vaccines, 2021, 9, 97: 1-26.

[0215] In some embodiments, the mRNA encoding a full length human BRCA-1 protein or portion thereof is a self- amplifying RNA (saRNA). In some embodiments, the saRNA comprises a viral element (e.g., a viral element derived from positive-sense, single stranded RNA (ssRNA) viruses). In some embodiments, the viral element encodes for a protein capable of driving replication of the saRNA. In some embodiments, the viral element encodes for a protein capable of making more a copy of the saRNA. In some embodiments, the saRNA is delivered to a target cell by a carrier (e.g., any of the carriers discussed herein). In some embodiments, saRNA delivered to a target cell is translated by the target cell. In some embodiments, full length human BRCA-1 protein translated from the saRNA is expressed in the target cell. In some embodiments, a variant protein form of human BRCA-1 translated from the saRNA is expressed in the target cell.

[0216] Examples of positive-sense, single stranded RNA viruses include, but are not limited to, alphaviruses, flaviviruses, or picomaviruses. In some embodiments, the viral elements are derived from alphaviruses. In some embodiments, alphaviruses are selected from the group comprising Venezuelan Equine Encephalitis Virus (VEEV), Sindbis Virus (SINV), and Semliki Forest Virus (SFV).

[0217] In some embodiments, the saRNA is an mRNA molecule. In some embodiments, the saRNA is an mRNA molecule that can be translated by ribosomes.

[0218] In some embodiments, the saRNA comprises a 5’ cap.

[0219] In some embodiments, the 5’ cap is a type 0 cap (N7mGppp). In some embodiments, the type 0 cap is sensed by cellular innate sensors. In some embodiments, the cellular innate sensors are a part of the type IFN pathway. In some embodiments, the cellular sensors elicit an innate immune response. In some embodiments, the cellular innate sensors activate sensor-effectors. In some embodiments, the cellular innate sensors are RIG-I or MDA5. In some embodiments, the sensor-effectors are IFIT1 or IFIT5.

[0220] In some embodiments, the 5’ cap is a type 1 cap. In some embodiments, the type 1 cap can facilitate immune evasion of the saRNA.

[0221] In some embodiments, the saRNA comprises a poly(A) tail at the 3’ end.

[0222] In some embodiments, the viral element of the saRNA comprises a replicase complex. In some embodiments, the replicase complex comprises a single ORF. In some embodiments, the single ORF comprises four nonstructural proteins (nsPs). In some embodiments, the single ORF encodes for nsPl, nsP2, nsP3, and nsP4. In some embodiments, the single ORF is translated as a polyprotein. In some embodiments, the polyprotein is processed post-translationally. In some embodiments, the polyprotein is processed to form individual proteins. In some embodiments, the polyprotein is processed to form nsPl, nsP2, nsP3, and nsP4. In some embodiments, the replicase complex comprises nsPl, nsP2, nsP3, and nsP4. In some embodiments, the replicase complex replicates the saRNA.

[0223] In some embodiments, the saRNA comprises a 5’UTR. In some embodiments, the 5’UTR is located between the 5’ cap and the replicase complex on the saRNA. In some embodiments, the 5’UTR is 27-85 nucleotides in length. In some embodiments, the 5’UTR controls translation of the replicase complex. In some embodiments, the 5’UTR comprises a primer for (-) and / or (+) RNA synthesis. In some embodiments, the 5’UTR interacts with viral and host factors required for amplification of the saRNA. In some embodiments, the 5’UTR helps the saRNA evade innate sensor recognition.

[0224] In some embodiments, the saRNA comprises a protein coding region. In some embodiments, the protein coding region comprises an ORF. In some embodiments, the protein coding region encodes a target protein. In some embodiments, the protein coding region encodes a target protein to be expressed in a target cell. In some embodiments, the target protein is BRCA-1. In some embodiments, the target protein is human BRCA-1. Insome embodiments, the target protein is full length human BRCA-1 or a portion thereof (such as any of the BRCA1 proteins described herein).

[0225] In some embodiments, the saRNA comprises a 3’UTR. In some embodiments, the 3’UTR is located between the protein coding region and the poly(A) tail. In some embodiments, the 3’ UTR is between 87-723 nucleotides in length. In some embodiments, the 3’UTR interacts with cellular miRNA. In some embodiments, the interacts with cellular miRNA modulates innate activation and host adaptation to the saRNA. In some embodiments, the 3’UTR interacts with cellular protein to stabilize the saRNA in the cytoplasm. In some embodiments, the 3’UTR stabilizes the saRNA in the cytoplasm by preventing deadenylation and RNA decay. In some embodiments, the 3’UTR comprises a conserved sequence element (CSE). In some embodiments, the CSE comprised in the 3’UTR is 19 nucleotides in length. In some embodiments, the CSE comprised in the 3’UTR is upstream of the poly(A) tail. In some embodiments, the CSE comprised in the 3’UTR serves as a promoter for (-) strand synthesis.

[0226] In some embodiments, the saRNA comprises a conserved sequence element (CSE). In some embodiments, the CSE is 5’ of the replicase complex on the saRNA. In some embodiments, the CSE enhances amplification of the saRNA. In some embodiments, the CSE interacts an element selected from the group consisting of 5 ’UTR, nsP2, and nsP3, or any combination thereof.

[0227] In some embodiments, the saRNA comprises a subgenomic promoter. In some embodiments, the subgenomic promoter is located between the replicase complex and the protein coding region on the saRNA. In some embodiments, the subgenomic promoter is used to transcribe (+) strand subgenomic RNA encoding the target protein encoded in the protein coding region.2. mRNA Synthesis

[0228] mRNAs according to the present application may be synthesized according to any of a variety of known methods. For example, mRNAs according to the present application may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary according to the specific application.

[0229] In some embodiments, for the preparation of mRNA according to the application, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter, for example a T3, T7 or SP6 promoter, for in vitro transcription, followed by desired nucleotide sequence for desired mRNA and a termination signal.

[0230] Desired mRNA sequence(s) according to the application may be incorporated into a DNA template using standard methods. For example, starting from a desired amino acid sequence (e.g., an enzyme sequence), a virtual reverse translation is carried out based on the degenerated genetic code. Optimization algorithms may then be used for selection of suitable codons. Typically, the G / C content can be optimized to achieve the highest possible G / C content on one hand, taking into the best possible account the frequency of the tRNAs according to codon usage on the other hand. The optimized RNA sequence can be established and displayed, for example, with the aid of an appropriate display device and compared with the original (wild-type) sequence. A secondary structure can also be analyzed to calculate stabilizing and destabilizing properties or, respectively, regions of the RNA.C. mRNA delivery vehicles (e.g., a carrier)

[0231] A variety of mRNA delivery methods have been developed, such as direct injection of naked mRNA, lipid-based carriers, polymers and protein derivatives. The utility of lipid nanoparticles to deliver mRNA has been successfully demonstrated with COVID-19 vaccines, such as mRNA-1273 and BNT162b. It is expected that these vehicles such as lipid nanoparticles can successfully deliver the mRNAs discussed here.

[0232] As provided herein, the compositions may include a transfer vehicle. As used herein, the terms “transfer vehicle,” “delivery vehicle,” “carrier” and the like refer to variant agents, pharmaceutical carriers, diluents, excipients and the like which are generally intended for use in connection with the administration of biologically active agents, including nucleic acids. The compositions and in particular the transfer vehicles described herein are capable of delivering mRNA to the target cell. In certain embodiments, the transfer vehicle is a lipid nanoparticle. In other embodiments, the transfer vehicle is a polymeric carrier, such as, e.g., polyethyleneimine. In some embodiments, the transfer vehicle comprises a cell-penetrating peptide.

[0233] In certain embodiments, the mRNA molecules of the application may be administered as naked or unpackaged mRNA. In some embodiments, the administration of the mRNA in the compositions of the application may be facilitated by inclusion of a suitable carrier. Incertain embodiments, the carrier is selected based upon its ability to facilitate the transfection of a target cell with one or more mRNAs. As used herein, the terms “transfect” or “transfection” mean the intracellular introduction of an mRNA (e.g., a BRCA1 mRNA) encoding a protein (e.g., a BRCA1 protein) into a cell, and preferably into a target cell. The introduced mRNA may be stably or transiently maintained in the target cell. The term “transfection efficiency” refers to the relative amount of mRNA taken up by the target cell which is subject to transfection. In practice, transfection efficiency can be estimated by the amount of a reporter nucleic acid product expressed by the target cells following transfection. The mRNA in the compositions of the application may be introduced into target cells with or without a carrier or transfer vehicle.

[0234] In certain embodiments, the carriers employed in the compositions of the application may comprise a liposomal vesicle, or other means to facilitate the transfer of a mRNA to target cells and / or tissues. Preferred embodiments include compositions with high transfection efficacies and in particular those compositions that minimize adverse effects which are mediated by transfection of non-target cells. The compositions of the present application that demonstrate high transfection efficacies improve the likelihood that appropriate dosages of the mRNA will be delivered to the target cell, while minimizing potential systemic adverse effects.

[0235] The mRNA can be formulated with one or more acceptable reagents, which provide a vehicle for delivering such mRNA to target cells. Appropriate reagents are generally selected with regard to a number of factors, which include, among other things, the biological or chemical properties of the mRNA, the intended route of administration, the anticipated biological environment to which such mRNA will be exposed and the specific properties of the intended target cells. In some embodiments, transfer vehicles, such as liposomes, encapsulate the mRNA without compromising biological activity. In some embodiments, the transfer vehicle demonstrates preferential and / or substantial binding to a target cell relative to non-target cells. In a preferred embodiment, the transfer vehicle delivers its contents to the target cell such that the mRNA is delivered to the appropriate subcellular compartment, such as the cytoplasm.

[0236] In some embodiments, the compositions of the application employ a polymeric carrier alone or in combination with other carriers. Suitable polymers may include, for example, poly acrylates, polyalkycyanoacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins,protamine, PEGylated protamine, PLL, PEGylated PLL, polyethylenimine (PEI), including, but not limited to branched PEI (25 kDa) and multi-domain-block polymers. Alternatively, suitable carriers include, but are not limited to, lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, both natural and synthetically-derived exosomes, natural, synthetic and semi-synthetic lamellar bodies, nanoparticulates, calcium phosphor-silicate nanoparticulates, calcium phosphate nanoparticulates, silicon dioxide nanoparticulates, nanocrystalline particulates, semiconductor nanoparticulates, dry powders, nanodendrimers, starch-based delivery systems, micelles, emulsions, sol-gels, niosomes, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, peptide conjugates, small-molecule targeted conjugates, and other vectorial tags. Also contemplated is the use of bionanocapsules and other viral capsid proteins assemblies as a suitable carrier. (Hum. Gene Ther. 2008 September; 19(9): 887-95).1. Lipid Nanoparticles

[0237] In certain embodiments, the transfer vehicle in the compositions of the application is a liposomal transfer vehicle, e.g. a lipid nanoparticle or a lipidoid nanoparticle. In one embodiment, the transfer vehicle may be selected and / or prepared to optimize delivery of the mRNA to a target cell. For example, if the target cell is a hepatocyte the properties of the transfer vehicle (e.g., size, charge and / or pH) may be optimized to effectively deliver such transfer vehicle to the target cell, reduce immune clearance and / or promote retention in that target cell.

[0238] Liposomes (e.g., liposomal lipid nanoparticles) are known to be particularly for their use as transfer vehicles of diagnostic or therapeutic compounds in vivo (Lasic, Trends Biotechnol., 16: 307-321, 1998; Drummond et al., Pharmacol. Rev., 51: 691-743, 1999) and are usually characterized as microscopic vesicles having an interior aqua space sequestered from an outer medium by a membrane of one or more bilayers. Bilayer membranes of liposomes are typically formed by amphiphilic molecules, such as lipids of synthetic or natural origin that comprise spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16: 307-321, 1998). Bilayer membranes of the liposomes can also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.).

[0239] In the context of the present application, a liposomal transfer vehicle typically serves to transport the mRNA to the target cell. For the purposes of the present application, the liposomal transfer vehicles are prepared to contain mRNA (e.g., a BRCA1 mRNA) encoding aprotein (e.g., a BRCA1 protein). The process of incorporation of the desired mRNA into a liposome is referred to as “loading” and is described in Lasic, et al., FEBS Lett., 312: 255- 258, 1992. The liposome-incorporated nucleic acids may be completely or partially located in the interior space of the liposome, within the bilayer membrane of the liposome, or associated with the exterior surface of the liposome membrane. The incorporation of a nucleic acid into liposomes is also referred to herein as “encapsulation” wherein the nucleic acid is entirely contained within the interior space of the liposome.

[0240] The purpose of incorporating an mRNA into a transfer vehicle, such as a liposome, is often to protect the nucleic acid from an environment which may contain enzymes or chemicals that degrade nucleic acids and / or systems or receptors that cause the rapid excretion of the nucleic acids. Accordingly, in a preferred embodiment of the present application, the selected transfer vehicle is capable of enhancing the stability of the mRNA contained therein. The liposome can allow the encapsulated mRNA to reach the target cell and / or may preferentially allow the encapsulated mRNA to reach the target cell, or alternatively limit the delivery of such mRNA to other sites or cells where the presence of the administered mRNA may be useless or undesirable. Furthermore, incorporating the mRNA into a transfer vehicle, such as for example, a cationic liposome, also facilitates the delivery of such mRNA into a target cell.

[0241] Ideally, liposomal transfer vehicles are prepared to encapsulate mRNA (e.g., a BRCA1 mRNA) encoding a protein (e.g., a BRCA1 protein) such that the compositions demonstrate high transfection efficiency and enhanced stability. While liposomes can facilitate introduction of nucleic acids into target cells, the addition of polycations (e.g., poly L-lysine and protamine), as a copolymer can facilitate, and in some instances markedly enhance, the transfection efficiency of several types of cationic liposomes by 2-28 fold in a number of cell lines both in vitro and in vivo. (See N. J. Caplen, et al., Gene Ther. 1995; 2: 603; S. Li, et al., Gene Ther. 1997; 4, 891.) Thus, in certain embodiments of the present application, the transfer vehicle is formulated as a lipid nanoparticle.

[0242] In certain embodiments, the mRNA (e.g., a BRCA1 mRNA) encoding a protein (e.g., a BRCA1 protein) is combined with a multi-component lipid mixture of varying ratios employing one or more cationic lipids, non-cationic lipids, helper lipids, and PEG-modified or PEGylated lipids designed to encapsulate various nucleic acid-based materials. As used herein, the phrase “cationic lipid” refers to any of a number of lipid species that carry a netpositive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, many of which are commercially available.

[0243] Cationic lipids may include, but are not limited to ALNY-100 ((3aR,5s,6aS)-N,N- dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyetetrahydro-3aH-cyclopenta[d][l,3]dioxol-5- amine)), DODAP (l,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO 2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001(cis or trans) (Provisional Patent Application No. 61 / 617,468), aminoalcohol lipidoids such as those disclosed in W02010 / 053572, DOTAP (l,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O- octadecenyl- 3 -trimethylammonium propane), DLinDMA (l,2-dilinoleyloxy-N,N-dimethyl-3- aminopropane) (Heyes, et al., J. Contr. Rel. 107:276-287 (2005)), DLin-KC2-DMA (Semple, et al., Nature Biotech. 28:172-176 (2010)), C12-200 (Love, et al., Proc. Nat'l. Acad. Sci. 107:1864-1869 (2010)).

[0244] In some embodiments, DOTMA can be formulated alone or can be combined with the neutral lipid, DOPE (dioleoylphosphatidyl-ethanolamine), or other cationic or non-cationic lipids into a liposomal transfer vehicle or a lipid nanoparticle, and such liposomes can be used to enhance the delivery of nucleic acids into target cells. Other suitable cationic lipids include, for example, DOGS (5-carboxyspermyl glycinedioctadecylamide), DOSPA (2,3- dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium) (Behr et al. Proc. Nat'l Acad. Sci. 86, 6982 (1989); U.S. Pat. Nos. 5,171,678; 5,334,761), DOTAP (1,2- Dioleoyl-3-Trimethylammonium- Propane). Contemplated cationic lipids also include DSDMA (l,2-distearyloxy-N,N-dimethyl-3-aminopropane, DODMA (l,2-dioleyloxy-N,N- dimethyl-3-aminopropane), DLenDMA ( 1 ,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane), DODAC (N-dioleyl-N,N-dimethylammonium chloride), DDAB (N,N-distearyl-N,N- dimethylammonium bromide), DMRIE (N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxyethyl ammonium bromide), CLinDMA (3-dimethylamino-2-(cholest-5-en-3-beta- oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane), CpLinDMA (2-[5'-(cholest-5-en- 3-beta-oxy)-3'-oxapentoxy)-3-dimethy 1- l-(cis,cis-9', l-2'-octadecadienoxy)propane), DMOBA (N,N-dimethyl-3,4-dioleyloxybenzylamine), DOcarbDAP (1,2-N,N'- dioleylcarbamyl-3-dimethylaminopropane), DLinDAP (2,3-Dilinoleoyloxy-N,N- dimethylpropylamine), DLincarbDAP (l,2-N,N'-Dilinoleylcarbamyl-3- dimethylaminopropane) , DLinCD AP ( 1 ,2-Dilinoleoylcarbamyl-3-dimethylaminopropane,DLin-K-DMA (2,2-dilinoleyl-4-dimethylaminomethyl-[l ,3]-dioxolane), DLin-K-XTC2- DMA (2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane), or mixtures thereof.

[0245] Specific biodegradable lipids suitable for use in the compositions and methods of the application include:Compound 1and their salts.

[0246] Additional specific cationic lipids for use in the compositions and methods of the application are XTC (2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane) and MC3 (((6Z,9Z,28Z,3 lZ)-heptatriaconta-6,9,28,31-tetraen- 19-yl 4-(dimethylamino) butanoate):both of which are described in detail in US 20100267806.

[0247] Another cationic lipid that may be used in the compositions and methods of the application is NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-Nl,N16-diundecyl- 4,7, 10, 13-tetraazahexadecane- 1 , 16-diamide):which is described in WO06138380A2.

[0248] Suitable helper lipids include, but are not limited to DSPC (1,2-distearoyl-sn-glycero- 3 -phosphocholine), DPPC (l,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2- dioleyl-sn-glycero-3-phosphoethanolamine), DPPE (l,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine), DMPE (l,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(l'-rac-glycerol)), and cholesterol. Cholesterol-based cationic lipids can be used, either alone or in combination with other cationic or non-cationic lipids. Suitable cholesterol-based cationic lipids include, for example, DC-Chol (N,N- dimethyl-N-ethylcarboxamidocholesterol), 1 ,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Pat. No. 5,744,335), or ICE (3S, 10R, 13R, 17R)-10, 13-dimethyl-17-((R)-6- methylheptan-2-yl)-2, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17-tetradecahydro-lH- cyclopenta[a]phenanthren-3-yl 3-(lH-imidazol-4-yl)propanoate)(WO / 2011 / 068810).

[0249] Non-cationic lipids may also be used in the compositions of the application. As used herein, the phrase “non-cationic lipid” refers to any neutral, zwitterionic or anionic lipid. “Anionic lipid” refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, DSPC (distearoylphosphatidyl-choline), DOPC (dioleoylphosphatidylcholine), DPPC (dipalmitoylphosphatidyl-choline), DOPG (dioleoylphosphatidylglycerol), DPPG (dipalmitoylphosphatidyl-glycerol), DOPE (dioleoylphosphatidylethanolamine), POPC (palmitoyloleoyl-phosphatidylcholine), POPE (palmitoyloleoyl-phosphatidylethanolamine), DOPE-mal (dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate), DDPE (dipalmitoyl phosphatidyl ethanolamine), DMPE (dimyristoylphosphoethanolamine), DSPE (distearoylphosphatidylethanolamine), SOPE (16-0- monomethyl PE, 16-0-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphatidy ethanolamine), cholesterol, or a mixture thereof. Such non-cationic lipids may be used alone, but are preferably used in combination with other excipients, for example, cationic lipids. When used in combination with a cationic lipid, the non-cationic lipid may comprise a molar ratio of 5% to about 90%, or preferably about 10% to about 70% of the total lipid present in the transfer vehicle.

[0250] Polyethylene glycol (PEG)-modified phospholipids and derivatized lipids for use in nanoparticle formulations include, but are not limited to a poly(ethylene) glycol chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of C6-C20 length, DMG- PEG2K, PEG-DSG, PEG-DMG, and PEG-derivatized ceramides (PEG-CER), including N- Octanoyl-Sphingosine-l-[Succinyl(Methoxy Polyethylene Glycol)-2000], (C8 PEG-2000 ceramide). The use of PEG-modified lipids is contemplated for use the compositions of the application, either alone or preferably in combination with other lipids which together comprise the transfer vehicle (e.g., a lipid nanoparticle). The addition of such components may prevent complex aggregation and may also provide a means for increasing circulation lifetime and increasing the delivery of the lipid-nucleic acid composition to the target cell, (Klibanov et al. (1990) FEBS Letters, 268 (1): 235-237), or they may be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides having shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipid and derivatized lipids of the present application may comprise a molar ratio from about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipid present in the liposomal transfer vehicle.

[0251] In addition, several reagents are commercially available to enhance transfection efficacy. Suitable examples include LIPOFECTIN (DOTMA:DOPE) (Invitrogen, Carlsbad, Calif.), LIPOFECT AMINE (DOSPA:DOPE) (Invitrogen), LIPGFECTAMINE2000. (Invitrogen), FUGENE, TRANSFECTAM (DOGS), and EFFECTENE.

[0252] Preferably, the transfer vehicle (e.g., a lipid nanoparticle) is prepared by combining multiple lipid and / or polymer components. For example, a transfer vehicle may comprise C12-200, DSPC, CHOL, and DMG-PEG or MC3, DSPC, chol, and DMG-PEG or C12-200, DOPE, chol, DMG-PEG2K. The selection of cationic lipids, non-cationic lipids and / or PEG-modified lipids which comprise the lipid nanoparticle, as well as the relative molar ratio of such lipids to each other, is based upon the characteristics of the selected lipid(s), the nature of the intended target cells, the characteristics of the mRNA to be delivered. For example, a transfer vehicle may be prepared using C 12-200, DOPE, cholesterol, DMG-PEG2K at a molar ratio of 40:30:25:5; or DODAP, DOPE, cholesterol, DMG-PEG2K at a molar ratio of 18:56:20:6; or HGT5000, DOPE, cholesterol, DMG-PEG2K at a molar ratio of 40:20:35:5; or HGT5001, DOPE, cholesterol, DMG-PEG2K at a molar ratio of 40:20:35:5; or XTC, DSPC, cholesterol, PEG-DMG at a molar ratio of 57.5:7.5:31.5:3.5 or a molar ratio of 60:7.5:31:1.5; or MC3, DSPC, cholesterol, PEG-DMG in a molar ratio of 50:10:38.5:1.5 or a molar ratio of 40:15:40:5; or MC3, DSPC, cholesterol, PEG-DSG / GalNAc-PEGDSG in a molar ratio of 50:10:35:4.5:0.5; or ALNY-100, DSPC, cholesterol, PEG-DSG.

[0253] Additional considerations include, for example, the saturation of the alkyl chain, as well as the size, charge, pH, pKa, fusogenicity and toxicity of the selected lipid(s). Thus, the molar ratios may be adjusted accordingly. For example, in embodiments, the percentage of cationic lipid in the lipid nanoparticle may be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. The percentage of non-cationic lipid in the lipid nanoparticle may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. The percentage of cholesterol in the lipid nanoparticle may be greater than 10%, greater than 20%, greater than 30%, or greater than 40%. The percentage of PEG-modified lipid in the lipid nanoparticle may be greater than 1%, greater than 2%, greater than 5%, greater than 10%, or greater than 20%.

[0254] In certain preferred embodiments, the lipid nanoparticles of the application comprise at least one of the following cationic lipids: XTC, MC3, NC98-5, ALNY-100, C12-200, DLin-KC2-DMA, DODAP, HGT4003, ICE, HGT5000, or HGT5001. In some embodiments, the transfer vehicle comprises cholesterol and / or a PEG-modified lipid. In some embodiments, the transfer vehicles comprise DMG-PEG2K.

[0255] The liposomal transfer vehicles for use in the compositions of the application can be prepared by various techniques which are presently known in the art. Multi-lamellar vesicles (MLV) may be prepared via conventional techniques, for example, by depositing a selected lipid on the inside wall of a suitable container or vessel by dissolving the lipid in an appropriate solvent, and then evaporating the solvent to leave a thin film on the inside of the vessel or by spray drying. An aqueous phase may then be added to the vessel with a vortexing motion which results in the formation of MLVs. Uni-lamellar vesicles (ULV) can then beformed by homogenization, sonication or extrusion of the multi-lamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.

[0256] In certain embodiments of this application, the compositions of the present application comprise a transfer vehicle wherein the mRNA is associated on both the surface of the transfer vehicle and encapsulated within the same transfer vehicle. For example, during preparation of the compositions of the present application, cationic liposomal transfer vehicles may associate with the mRNA through electrostatic interactions.

[0257] Selection of the appropriate size of a liposomal transfer vehicle must take into consideration the site of the target cell or tissue and to some extent the application for which the liposome is being made. In some embodiments, it may be desirable to limit transfection of the mRNA to certain cells or tissues. For example, to target hepatocytes a liposomal transfer vehicle may be sized such that its dimensions are smaller than the fenestrations of the endothelial layer lining hepatic sinusoids in the liver; accordingly, the liposomal transfer vehicle can readily penetrate such endothelial fenestrations to reach the target hepatocytes. Alternatively, a liposomal transfer vehicle may be sized such that the dimensions of the liposome are of a sufficient diameter to limit or expressly avoid distribution into certain cells or tissues. For example, a liposomal transfer vehicle may be sized such that its dimensions are larger than the fenestrations of the endothelial layer lining hepatic sinusoids to thereby limit distribution of the liposomal transfer vehicle to hepatocytes. Generally, the size of the transfer vehicle is within the range of about 25 to 250 nm, preferably less than about 250 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, 25 nm or 10 nm.

[0258] A variety of alternative methods known in the art are available for sizing of a population of liposomal transfer vehicles. One such sizing method is described in U.S. Pat. No. 4,737,323, incorporated herein by reference. Sonicating a liposome suspension either by bath or probe sonication produces a progressive size reduction down to small ULV less than about 0.05 microns in diameter. Homogenization is another method that relies on shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLV are recirculated through a standard emulsion homogenizer until selected liposome sizes, typically between about 0.1 and 0.5 microns, are observed. The size of the liposomal vesicles may be determined by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-450 (1981), incorporated herein by reference. Average liposome diameter may be reduced by sonication of formed liposomes.Intermittent sonication cycles may be alternated with QELS assessment to guide efficient liposome synthesis.2. Cell-penetrating peptides (CPP)

[0259] Cell Penetrating Peptides (CPP) are one of the promising non- viral strategies that can be used to as carrier vehicles to deliver various cargos. In some embodiments the CPPs are used to deliver a nucleic acid (e.g., any of the BRCA1 mRNAs described herein). In some embodiments the CPPs are used to deliver a protein construct (e.g., any of the BRCA1 proteins described herein). In some embodiments the CPPs are used to deliver a genome editing agent (e.g., any of the BRCA1 genome editing agents described herein).

[0260] Although definition of CPPs is constantly evolving, they are generally described as short peptides of less than 30 amino acids either derived from proteins or from chimeric sequences. They are usually amphipathic and possess a net positive charge (Langel U (2007) Handbook of Cell-Penetrating Peptides (CRC Taylor & Francis, Boca Raton); Heitz et al. (2009) Br J Pharmacol 157, 195-206). CPPs are able to penetrate biological membranes, to trigger the movement of various biomolecules across cell membranes into the cytoplasm and to improve their intracellular routing, thereby facilitating interactions with the target. CPPs can be subdivided into two main classes, the first requiring chemical linkage with the cargo and the second involving the formation of stable, non-covalent complexes. CPPs from both strategies have been reported to favour the delivery of a large panel of cargos (plasmid DNA, oligonucleotide, siRNA, PNA, protein, peptide, liposome, nanoparticle...) into a wide variety of cell types and in vivo models (Langel U (2007) Handbook of Cell-Penetrating Peptides (CRC Taylor & Francis, Boca Raton); Heitz et al. (2009) Br J Pharmacol 157, 195-206; Mickan et al. (2014) Curr Pharm Biotechnol 15, 200-209; Shukla et al. (2014) Mol Pharm 11, 3395-3408).

[0261] The concept of protein transduction domain (PTD) was initially proposed based on the observation that some proteins, mainly transcription factors, could shuttle within cells and from one cell to another (for review see Langel U (2007) Handbook of Cell-Penetrating Peptides (CRC Taylor & Francis, Boca Raton); Heitz et al. (2009) Br J Pharmacol 157, 195- 206). The first observation was made in 1988, by Frankel and Pabo. They showed that the transcription-transactivating (Tat) protein of HIV-1 could enter cells and translocate into the nucleus. In 1991, the group of Prochiantz reached the same conclusions with the Drosophila Antennapedia homeodomain and demonstrated that this domain was internalized by neuronalcells. These works were at the origin of the discovery in 1994 of the first Protein Transduction Domain: a 16 mer-peptide derived from the third helix of the homeodomain of Antennapedia named Penetratin. In 1997, the group of Lebleu identified the minimal sequence of Tat required for cellular uptake, and the first proofs-of-concept of the application of PTD in vivo were reported by the group of Dowdy for the delivery of small peptides and large proteins (Gump JM, and Dowdy SF (2007) Trends Mol Med 13, 443-448.). Historically, the notion of Cell Penetrating Peptide (CPP) was introduced by the group of Langel, in 1998, with the design of the first chimeric peptide carrier, the Transportan, which derived from the N-terminal fragment of the neuropeptide galanin, linked to mastoparan, a wasp venom peptide. Transportan has been originally reported to improve the delivery of PNAs (peptide nucleic acids) both in cultured cells and in vivo (Langel U (2007) Handbook of Cell- Penetrating Peptides (CRC Taylor & Francis, Boca Raton)). In 1997, the group of Heitz and Divita proposed a new strategy involving CPP in the formation of stable but non-covalent complexes with their cargo (Morris et al. (1997) Nucleic Acids Res 25, 2730-2736). The strategy was first based on the short peptide carrier (MPG) consisting of two domains: a hydrophilic (polar) domain and a hydrophobic (apolar) domain. MPG was designed for the delivery of nucleic acids. The primary amphipathic peptide Pep-1 was then proposed for non- covalent delivery of proteins and peptides (Morris et al. (2001) Nat Biotechnol 19, 1173- 1176). Then the groups of Wender and of Futaki demonstrated that polyarginine sequences (Arg8) are sufficient to drive small and large molecules into cells and in vivo (Nakase et al. (2004) Mol Ther 10, 1011-1022; Rothbard et al. (2004) J Am Chem Soc 126, 9506-9507). Ever since, many CPPs derived from natural or unnatural sequences have been identified and the list is constantly increasing. Peptides have been derived from VP22 protein of Herpes Simplex Virus, from calcitonin, from antimicrobial or toxin peptides, from proteins involved in cell cycle regulation, as well as from polyproline-rich peptides (Heitz et al. (2009) Br J Pharmacol 157, 195-206). More recently, a new non-covalent strategy based on secondary amphipathic CPPs has been described. These peptides such as CADY and VEPEP-families are able to self-assemble in a helical shape with hydrophilic and hydrophobic residues on different side of the molecule. WO2014 / 053879 discloses VEPEP-3 peptides;WO2014 / 053881 discloses VEPEP-4 peptides; WO2014 / 053882 discloses VEPEP-5 peptides; W02012 / 137150 discloses VEPEP-6 peptides; W02014 / 053880 discloses VEPEP- 9 peptides; WO 2016 / 102687 discloses ADGN-100 peptides; US2010 / 0099626 discloses CADY peptides; and. U.S. Pat. No. 7,514,530 discloses MPG peptides; the disclosures of which are hereby incorporated herein by reference in their entirety.

[0262] The cell-penetrating peptides in the composition of the present application in some embodiments are capable of forming stable complexes and nanoparticles with various cargos (e.g., a BRCA1 nucleic acid, e.g., a BRCA1 mRNA, e.g., a BRCA1 protein construct, e.g., a BRCA1 genome-editing agent), such as nucleases (e.g., ZFNs, TALENs, and CRISPR- associated nucleases (such as Cas9 and Cpfl)), integrases (such as bacteriophage integrases, e.g., C31), and nucleic acids (e.g., guide RNAs, guide DNAs, and donor nucleic acids). Any of the cell-penetrating peptides in compositions described herein may comprise or consist of any of the cell-penetrating peptide sequences described in this section.

[0263] In some embodiments, the carrier vehicle described herein comprises a cellpenetrating peptide selected from the group consisting of CADY, PEP-1, MPG, VEPEP-3 peptides, VEPEP-4 peptides, VEPEP-5 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the cell-penetrating peptide is present in a complex present in the core of a nanoparticle. In some embodiments, the cell-penetrating peptide is present in the core of a nanoparticle. In some embodiments, the cell-penetrating peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRIS PR-associated endonuclease, such as Cas9). In some embodiments, the cellpenetrating peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the cell-penetrating peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the cell-penetrating peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the cell-penetrating peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the cell-penetrating peptide is present in the surface layer of a nanoparticle. In some embodiments, the cell-penetrating peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. WO2014 / 053879 discloses VEPEP-3 peptides; WO2014 / 053881 discloses VEPEP-4 peptides; WO2014 / 053882 discloses VEPEP-5 peptides; W02012 / 137150 discloses VEPEP-6 peptides;W02014 / 053880 discloses VEPEP-9 peptides; WO 2016 / 102687 discloses ADGN-100 peptides; US2010 / 0099626 discloses CADY peptides; and. U.S. Pat. No. 7,514,530 discloses MPG peptides; the disclosures of which are hereby incorporated herein by reference in their entirety. i. VEPEP-3 peptides

[0264] In some embodiments, the cell-penetrating peptide described herein comprises aVEPEP-3 cell-penetrating peptide comprising the amino acid sequenceX1X2X3X4X5X2X3X4X6X7X3X8X9X10X11X12X13 , wherein Xi is beta-A (“beta-alanine) or S, X2 is K, R or L (independently from each other), X3 is F or W (independently from each other), X4 is F, W or Y (independently from each other), X5 is E, R or S, Xf> is R, T or S, X7 is E, R, or S, Xs is none, F or W, X9 is P or R, X10 is R or L, Xu is K, W or R, X12 is R or F, and X13 is R or K. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence X1X2WX4EX2WX4X6X7X3PRX11RX13 (SEQ ID NO: 45), wherein Xi is beta-A or S, X2is K, R or L, X3is F or W, X4is F, W or Y, X5is E, R or S, X6is R, T or S, X7is E, R, or S, Xs is none, F or W, X9 is P or R, X10 is R or L, Xu is K, W or R, X12 is R or F, and X13 is R or K. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence XiKWFERWFREWPRKRR (SEQ ID NO: 46), XiKWWERWWREWPRKRR (SEQ ID NO: 47), XiKWWERWWREWPRKRK (SEQ ID NO: 48), XiRWWEKWWTRWPRKRK (SEQ ID NO: 49), or XiRWYEKWYTEFPRRRR (SEQ ID NO: 50), wherein Xi is beta-A or S. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7, wherein the cell-penetrating peptide is modified by replacement of the amino acid in position 10 by a non-natural amino acid, addition of a non-natural amino acid between the amino acids in positions 2 and 3, and addition of a hydrocarbon linkage between the two non-natural amino acids. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence X1KX14WWERWWRX14WPRKRK (SEQ ID NO: 51), wherein Xi is beta-A or S and X 14 is a non-natural amino acid, and wherein there is a hydrocarbon linkage between the two non-natural amino acids. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence X1X2X3WX5X10X3WX6X7WX8X9X10WX12R (SEQ ID NO: 52), wherein Xi is beta-A or S, X2 is K, R or L, X3 is F or W, X5 is R or S, Xf> is R or S, X7 is R or S, Xs is F or W, X9 is R or P, X10 is L or R, and X12 is R or F. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence XiRWWRLWWRSWFRLWRR (SEQ ID NO: 53), XiLWWRRWWSRWWPRWRR (SEQ ID NO: 54), XiLWWSRWWRSWFRLWFR (SEQ ID NO: 55), or XiKFWSRFWRSWFRLWRR (SEQ ID NO: 56), wherein Xi is beta-A or S. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence of any one of SEQ ID NOs: 52-56, wherein the cell-penetrating peptide is modified by replacement of the amino acids in position 5 and 12 by non-natural amino acids, and addition of a hydrocarbon linkage between the two non-natural amino acids. In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence X1RWWX14LWWRSWX14RLWRR (SEQ ID NO: 57), wherein Xi is a beta-alanine or a serine and X14 is a non-natural amino acid, and wherein there is a hydrocarbon linkage between the two non-natural amino acids. In someembodiments, the VEPEP-3 peptide comprises the amino acid sequence beta- AKWFERWFREWPRKRR (SEQ ID NO: 58). In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence beta-AKWWERWWREWPRKRR (SEQ ID NO: 59). In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence ASSLNIA- Ava-KWWERWWREWPRKRR (SEQ ID NO: 60). In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence LSSRLDA-Ava-KWWERWWREWPRKRR (SEQ ID NO: 61). In some embodiments, the VEPEP-3 peptide comprises the amino acid sequence Ac-SYTSSTM-ava-KWWERWWREWPRKRR (SEQ ID NO: 62). In some embodiments, the VEPEP-3 peptide comprises an amino acid sequence PEG2 / 3- KWWERWWREWPRKRR(SEQ ID NO: 285). In some embodiments, the VEPEP-3 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the VEPEP-3 peptide is present in the core of a nanoparticle. In some embodiments, the VEPEP-3 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-3 peptide is present in the core of a nanoparticle and is associated with a guide RNA. In some embodiments, the VEPEP-3 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-3 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the VEPEP-3 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the VEPEP-3 peptide is present in the surface layer of a nanoparticle. In some embodiments, the VEPEP-3 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. ii. VEPEP-6 peptides (i.e.. ADGN-106 peptides)

[0265] In some embodiments, the cell-penetrating peptide described herein comprises a VEPEP-6 cell-penetrating peptide. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence selected from the group consisting of X1LX2RALWX9LX3X9X4LWX9LX5X6X7X8 (SEQ ID NO: 63), X1LX2LARWX9LX3X9X4LWX9LX5X6X7X8 (SEQ ID NO: 64) and X1LX2ARLWX9LX3X9X4LWX9LX5X6X7X8 (SEQ ID NO: 65), wherein Xi is beta-A or S, X2is F or W, X3is L, W, C or I, X4is S, A, N or T, X5is L or W, X6is W or R, X7is K or R, Xs is A or none, and X9 is R or S. In some embodiments, the VEPEP-6 peptide comprises the amino acid sequence X1LX2RALWRLX3RX4LWRLX5X6X7X8 (SEQ ID NO: 66), wherein Xi is beta-A or S, X2is F or W, X3is L, W, C or I, X4is S, A, N or T, X5is L or W, X6is W or R, X7 is K or R, and Xs is A or none. In some embodiments, the VEPEP-6 peptidecomprises the amino acid sequence X1LX2RALWRLX3RX4LWRLX5X6KX7 (SEQ ID NO: 67), wherein Xi is beta-A or S, X2 is F or W, X3 is L or W, X4 is S, A or N, X5 is L or W, Xf> is W or R, X7 is A or none. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence selected from the group consisting of X1LFRALWRLLRX2LWRLLWX3 (SEQ ID NO: 68), X1LWRALWRLWRX2LWRLLWX3A (SEQ ID NO: 69), X1LWRALWRLX4RX2LWRLWRX3A (SEQ ID NO: 70), X1LWRALWRLWRX2LWRLWRX3A (SEQ ID NO: 71), X1LWRALWRLX5RALWRLLWX3A (SEQ ID NO: 72), and X1LWRALWRLX4RNLWRLLWX3A (SEQ ID NO: 73), wherein Xi is beta-A or S, X2is S or T, X3 is K or R, X4 is L, C or I and X5 is L or I. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence selected from the group consisting of Ac- XiLFRALWRLLRSLWRLLWK-cysteamide (SEQ ID NO: 74), Ac- XiLWRALWRLWRSLWRLLWKA-cysteamide (SEQ ID NO: 75), Ac- XiLWRALWRLLRSLWRLWRKA-cysteamide (SEQ ID NO: 76), Ac- XiLWRALWRLWRSLWRLWRKA-cysteamide (SEQ ID NO: 77), Ac- XiLWRALWRLLRALWRLLWKA-cysteamide (SEQ ID NO: 78), and Ac- XiLWRALWRLLRNLWRLLWKA-cysteamide (SEQ ID NO: 79), wherein Xi is beta-A or S. In some embodiments, the VEPEP-6 peptide comprises the amino acid sequence of any one of SEQ ID NOs: 63-79, further comprising a hydrocarbon linkage between two residues at positions 8 and 12. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence selected from the group consisting of Ac-XiLFRALWRsLLRSsLWRLLWK- cysteamide (SEQ ID NO: 80), Ac-XiLFLARWRsLLRSsLWRLLWK-cysteamide (SEQ ID NO: 81), Ac-XiLFRALWSsLLRSsLWRLLWK-cysteamide (SEQ ID NO: 82), Ac- XiLFLARWSsLLRSsLWRLLWK-cysteamide (SEQ ID NO: 83), Ac- XiLFRALWRLLRsSLWSsLLWK-cysteamide (SEQ ID NO: 84), Ac- XiLFLARWRLLRsSLWSsLLWK-cysteamide (SEQ ID NO: 85), Ac- XiLFRALWRLLSsSLWSsLLWK-cysteamide (SEQ ID NO: 86), Ac- XiLFLARWRLLSsSLWSsLLWK-cysteamide (SEQ ID NO: 87), and Ac- XiLFARsLWRLLRSsLWRLLWK-cysteamide (SEQ ID NO: 88), wherein Xi is beta-A or S and wherein the residues followed by an inferior "S" are those which are linked by said hydrocarbon linkage. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence beta-ALWRALWRLWRSLWRLLWKA (SEQ ID NO: 89). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence set forth in any one of SEQ ID NOs 90-117. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence beta-ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 90). In some embodiments, the VEPEP-6 peptide comprises a retro-inverso amino acid sequence AKWLLRWLSRWLRWLARWLR (SEQ ID NO: 91). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-(PEG)7-PALWRALWRLWRSLWRLLWKA- NH2 (SEQ ID NO: 92) or Ac-(PEG)2-PALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 93). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence set forth in any one of SEQ ID NOS: 94-103. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence beta- A- Ac-YIGSR-Ava- ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 96). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence beta-A-Ac-YIGSR-Aun- ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 98). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-YIGSR-Ahx- ALWRALWRLWRSLWRLLWK-NH2 (SEQ ID NO: 100) or Ac-YIGSR-Ahx- ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 101). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence beta- Ac-GYVS-Ahx- ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 102) or Ac-YIGSR- PALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 103). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Stearyl-PA- ALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 104). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence set forth in any one of SEQ ID NOS: 105-107. In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence ALWRA(GalNac)LWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 111). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-SYTSSTM-ava- PALWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 112). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac- THRPPNWSPVWPRALWRLWRSLWRLRWKA-NH2 (SEQ ID NO: 113). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-CKTRRVPWRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 114). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-CKTRRVP-ava- WRALWRLWRSLWRLLWKA-NH2 (SEQ ID NO: 115). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac-CARPAR-ava- WRALWRLWRSLWRLLWK-NH2 (SEQ ID NO: 116). In some embodiments, the VEPEP- 6 peptide comprises an amino acid sequence Ac-THRPPNWSPV- ava- WRALWRLWRSLWRLRWK-NH2 (SEQ ID NO: 117). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence PEG2 / PEG3- LWRALWRLWRSLWRLLWKA(SEQ ID NO: 273). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence LWRALWRLWRSLWRLLWKR(SEQ ID NO: 274). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence Ac- YIGSR-Ava-LWRALWRLLRSLWRLLWKR(SEQ ID NO: 275). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence KTTATDIKGKEV-ava- KWRALWRLLRSLWRLLWK(SEQ ID NO: 276). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence YHWYGYTHQN-PEG3- LWRALWRLWRSLWRLLWK(SEQ ID NO: 277). In some embodiments, the VEPEP-6 peptide comprises an amino acid sequence KTFLDKFNHEVEDL-PEG3- WRALWRLWRSLWRLLWK(SEQ ID NO: 278). In some embodiments, the VEPEP-6 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the VEPEP-6 peptide is present in the core of a nanoparticle. In some embodiments, the VEPEP- 6 peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRIS PR-associated endonuclease, such as Cas9). In some embodiments, the VEPEP-6 peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the VEPEP-6 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-6 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the VEPEP-6 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the VEPEP-6 peptide is present in the surface layer of a nanoparticle. In some embodiments, the VEPEP-6 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. iii. VEPEP-9 peptides

[0266] In some embodiments, the cell-penetrating peptide described herein comprises a VEPEP-9 cell-penetrating peptide comprising the amino acid sequence X1X2X3WWX4X5WAX6X3X7X8X9X10X11X12WX13R (SEQ ID NO: 118), wherein Xi is beta- A or S, X2 is L or none, X3 is R or none, X4 is L, R or G, X5 is R, W or S, Xf> is S, P or T, X7 is W or P, Xs is F, A or R, X9 is S, L, P or R, X10 is R or S, Xu is W or none, X12 is A, R or none and X13 is W or F, and wherein if X3 is none, then X2, Xu and X12 are none as well. In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence X1X2RWWLRWAX6RWX8X9X10WX12WX13R (SEQ ID NO: 119), wherein Xi is beta-A or S, X2 is L or none, Xf> is S or P, Xs is F or A, X9 is S, L or P, X10 is R or S, X12 is A or R, andX13 is W or F. In some embodiments, the VEPEP-9 peptide comprises an amino acid sequence selected from the group consisting of XiLRWWLRWASRWFSRWAWWR (SEQ ID NO: 120), XiLRWWLRWASRWASRWAWFR (SEQ ID NO: 121), XiRWWLRWASRWALSWRWWR (SEQ ID NO: 122), XiRWWLRWASRWFLSWRWWR (SEQ ID NO: 123), XiRWWLRWAPRWFPSWRWWR (SEQ ID NO: 124), and XiRWWLRWASRWAPSWRWWR (SEQ ID NO: 125), wherein Xi is beta-A or S. In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence of X1WWX4X5WAX6X7X8RX10WWR (SEQ ID NO: 126), wherein Xi is beta-A or S, X4 is R or G, X5 is W or S, Xf> is S, T or P, X7 is W or P, Xs is A or R, and X10 is S or R. In some embodiments, the VEPEP-9 peptide comprises an amino acid sequence selected from the group consisting of XiWWRWWASWARSWWR (SEQ ID NO: 127), XiWWGSWATPRRRWWR (SEQ ID NO: 128), and XiWWRWWAPWARSWWR (SEQ ID NO: 129), wherein Xi is beta-A or S. In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence beta-ALRWWLRWASRWFSRWAWWR (SEQ ID NO: 130). In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence KSYDTY-ava-ALRWLRWASRWFSRWAWR (SEQ ID NO: 131). In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence ac- CKRAVRWWLRWASRWFSRWAWWR (SEQ ID NO: 132). In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence beta-A-RWWLRWASRWFSRWAWR (SEQ ID NO: 133). In some embodiments, the VEPEP-9 peptide comprises the amino acid sequence KSYDTYAAETRRWASRWFSRWAWWR (SEQ ID NO: 134). In some embodiments, the VEPEP-9 peptide comprises an amino acid sequence PEG3 / 2- LRWWLRWASRWFSRWAWWR(SEQ ID NO: 284). In some embodiments, the VEPEP-9 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the VEPEP-9 peptide is present in the core of a nanoparticle. In some embodiments, the VEPEP- 9 peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRIS PR-associated endonuclease, such as Cas9). In some embodiments, the VEPEP-9 peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the VEPEP-9 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-9 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the VEPEP-9 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the VEPEP-9 peptide is present in the surface layer of a nanoparticle. In some embodiments, theVEPEP-9 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. iv. ADGN-100 peptides

[0267] In some embodiments, the cell-penetrating peptide described herein comprises an ADGN-100 cell-penetrating peptide comprising the amino acid sequence X1KWRSX2X3X4RWRLWRX5X6X7X8SR (SEQ ID NO: 135), wherein Xi is any amino acid or none, and X2-X8 are any amino acid. In some embodiments, the ADGN-100 peptide comprises the amino acid sequence X1KWRSX2X3X4RWRLWRX5X6X7X8SR (SEQ ID NO: 136), wherein Xi is PA, S, or none, X2 is A or V, X3 is or L, X4 is W or Y, X5 is V or S, Xf> is R, V, or A, X7 is S or L, and Xs is W or Y. In some embodiments, the ADGN-100 peptide comprises the amino acid sequence KWRSAGWRWRLWRVRSWSR (SEQ ID NO: 137), KWRSALYRWRLWRVRSWSR (SEQ ID NO: 138), KWRSALYRWRLWRSRSWSR (SEQ ID NO: 139), or KWRSALYRWRLWRSALYSR (SEQ ID NO: 140). In some embodiments, the ADGN-100 peptide comprises two residues separated by three or six residues that are linked by a hydrocarbon linkage. In some embodiments, the ADGN-100 peptide comprises the amino acid sequence KWRSsAGWRsWRLWRVRSWSR (SEQ ID NO: 141), KWRsSAGWRWRsLWRVRSWSR (SEQ ID NO: 142), KWRSAGWRsWRLWRVRsSWSR (SEQ ID NO: 143), KWRSsALYRsWRLWRSRSWSR (SEQ ID NO: 144), KWRsSALYRWRsLWRSRSWSR (SEQ ID NO: 145), KWRSALYRsWRLWRSRsSWSR (SEQ ID NO: 146), KWRSALYRWRsLWRSsRSWSR (SEQ ID NO: 147), KWRSALYRWRLWRSsRSWSsR (SEQ ID NO: 148), KWRsSALYRWRsLWRSALYSR (SEQ ID NO: 149), KWRSsALYRsWRLWRSALYSR (SEQ ID NO: 150), KWRSALYRWRsLWRSsALYSR (SEQ ID NO: 151), or KWRSALYRWRLWRSsALYSsR (SEQ ID NO: 152), wherein the residues marked with a subscript “S” are linked by a hydrocarbon linkage. In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of any one of SEQ ID NOs: 153-171. In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of beta- AKWRSAGWRWRLWRVRSWSR-NH2 (SEQ ID NO: 153). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of beta- AKWRSAGWRWRLWRVRSWSR (SEQ ID NO: 154) or beta- AKWRSALYRWRLWRVRSWSR (SEQ ID NO: 155). In some embodiments, the ADGN- 100 peptide comprises a retro-inverso amino acid sequence ofRSWSRVRWLRWRWGASRWK (SEQ ID NO: 156). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of Ac-(PEG)7-bA- KWRSALWRWRLWRVRSWSR-NH2 (SEQ ID NO: 157) or beta- Ac-(PEG)2-pA- KWRSALWRWRLWRVRSWSR-NH2 (SEQ ID NO: 158). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of Stearyl-PA- KWRSALWRWRLWRVRSWSR-NH2 (SEQ ID NO: 159). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence of any one of SEQ ID NOS: 160-169. In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac- YIGSR-Ava-KWRSALWRWRLWRVRSWSR-NH2 (ava is a 5-amino pentanoic acid) (SEQ ID NO: 162). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac-YIGSR-Ahx-KWRSALWRWRLWRVRSWSR-NH2 (SEQ ID NO: 167). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac-YIGSR- (PEG)n-pA-KWRSALWRWRLWRVRSWSR-NH2 (n = 2, 4, or 7) (SEQ ID NO: 170). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac- KWRSA(GALNAC)LWRWRLWRVRSWSR-NH2 (SEQ ID NO: 172). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac- CARPARWRSAGWRWRLWRVRSWSR-NH2 (SEQ ID NO: 173). In some embodiments, the ADGN-100 peptide comprises a core motif comprising an amino acid sequence of RWRLWRWSR (SEQ ID NO: 168). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence TGNYKALHPDHNGWRSALRWRLWRWSR-NH2 (SEQ ID NO: 174) or Ac-TGNYKALHPDHNG-ava-WRSALRWRLWRWSR-NH2 (SEQ ID NO: 175). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence PEG2 / PEG3-KWRSAGWRWRLWRVRSWSR(SEQ ID NO: 279). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence Ac-YIGSR-Ava- KWRSAGWRWRLWRVRSWSR(SEQ ID NO: 280). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence YHWYGYTHQN-PEG3-KWRSAGWRWRLWRVRSWSR(SEQ ID NO: 281). In some embodiments, the ADGN-100 peptide comprises an amino acid sequence KTFLDKFNHEVEDL-PEG3- KWRSAGWRWRLWRVRSWSR(SEQ ID NO: 282). In some embodiments, the ADGN-100 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the ADGN-100 peptide is present in the core of a nanoparticle. In some embodiments, the ADGN-100 peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRIS PR-associated endonuclease, such as Cas9). In some embodiments, the ADGN-100 peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the ADGN-100 peptide is present in the core of a nanoparticleand is associated with the guide RNA. In some embodiments, the ADGN-100 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the ADGN-100 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the ADGN-100 peptide is present in the surface layer of a nanoparticle. In some embodiments, the ADGN-100 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. v. VEPEP-4 peptides

[0268] In some embodiments, the cell-penetrating peptide described herein comprises a VEPEP-4 cell-penetrating peptide comprising the amino acid sequence XWXRLXXXXXX , wherein X in position 1 is beta-A or S; X in positions 3, 9 and 10 are, independently from each other, W or F; X in position 6 is R if X in position 8 is S, and X in position 6 is S if X in position 8 is R; X in position 7 is L or none; X in position 11 is R or none, and X in position 7 is L if X in position 11 is none. In some embodiments, the VEPEP-4 peptide comprises an amino acid sequence of any one of SEQ ID NOs: 177-180. In some embodiments, the VEPEP-4 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the VEPEP-4 peptide is present in the core of a nanoparticle. In some embodiments, the VEPEP-4 peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRIS PR-associated endonuclease, such as Cas9). In some embodiments, the VEPEP-4 peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the VEPEP-4 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-4 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the VEPEP-4 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the VEPEP-4 peptide is present in the surface layer of a nanoparticle. In some embodiments, the VEPEP-4 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent. vi. VEPEP-5 peptides

[0269] In some embodiments, the cell-penetrating peptide described herein comprises a VEPEP-5 cell-penetrating peptide comprising the amino acid sequence RXWXRLWXRLR (SEQ ID NO: 181), wherein X in position 2 is R or S; and X in positions 4 and 8 are, independently from each other, W or F. In some embodiments, the VEPEP-5 peptide comprises an amino acid sequence of any one of SEQ ID NOs: 182-187. In someembodiments, the VEPEP-5 peptide is present in a complex in the core of a nanoparticle. In some embodiments, the VEPEP-5 peptide is present in the core of a nanoparticle. In some embodiments, the VEPEP-5 peptide is present in the core of a nanoparticle and is associated with a DNA nuclease (such as a CRISPR-associated endonuclease, such as Cas9). In some embodiments, the VEPEP-5 peptide is present in the core of a nanoparticle and is associated with a gRNA. In some embodiments, the VEPEP-5 peptide is present in the core of a nanoparticle and is associated with the guide RNA. In some embodiments, the VEPEP-5 peptide is present in the core of a nanoparticle and is associated with a donor nucleic acid. In some embodiments, the VEPEP-5 peptide is present in an intermediate layer of a nanoparticle. In some embodiments, the VEPEP-5 peptide is present in the surface layer of a nanoparticle. In some embodiments, the VEPEP-5 peptide is linked to a targeting moiety. In some embodiments, the linkage is covalent.3. Cell-penetrating peptide modification

[0270] In some embodiments, the CPP described herein (e.g., VEPEP-3 peptide, VEPEP-6 peptide, VEPEP-9 peptide, or ADGN-100 peptide) further comprises one or more moieties linked to (e.g., covalently linked to) the N-terminus of the CPP. In some embodiments, the one or more moieties is covalently linked to the N-terminus of the CPP. In some embodiments, the one or more moieties are selected from the group consisting of an acetyl group, a stearyl group, a fatty acid, a cholesterol, a poly-ethylene glycol, a nuclear localization signal, a nuclear export signal, an antibody or antibody fragment thereof, a peptide, a polysaccharide, a linker moiety, and a targeting moiety. In some embodiments, the one or more moieties comprise an acetyl group covalently linked to the N-terminus of the CPP.

[0271] In some embodiments, the CPP described herein (e.g., VEPEP-3 peptide, VEPEP-6 peptide, VEPEP-9 peptide, or ADGN-100 peptide) further comprises one or more moieties linked to (e.g., covalently linked to) the C-terminus of the CPP. In some embodiments, the one or more moieties are selected from the group consisting of a cysteamide group, a cysteine, a thiol, an amide, a nitrilotriacetic acid, a carboxyl group, a linear or ramified Ci-Ce alkyl group, a primary or secondary amine, an osidic derivative, a lipid, a phospholipid, a fatty acid, a cholesterol, a poly-ethylene glycol, a nuclear localization signal, a nuclear export signal, an antibody or antibody fragment thereof, a peptide, a polysaccharide, a linker moiety, and a targeting moiety. In some embodiments, the one or more moieties comprises a cysteamide group.

[0272] In some embodiments, the CPP described herein (e.g., PEP-1, PEP-2, VEPEP-3 peptide, VEPEP-4 peptide, VEPEP-5 peptide, VEPEP-6 peptide, VEPEP-9 peptide, or ADGN-100 peptide) is stapled. “Stapled” as used herein refers to a chemical linkage between two residues in a peptide. In some embodiments, the CPP is stapled, comprising a chemical linkage between two amino acids of the peptide. In some embodiments, the two amino acids linked by the chemical linkage are separated by 3 or 6 amino acids. In some embodiments, two amino acids linked by the chemical linkage are separated by 3 amino acids. In some embodiments, the two amino acids linked by the chemical linkage are separated by 6 amino acids. In some embodiments, each of the two amino acids linked by the chemical linkage is R or S. In some embodiments, each of the two amino acids linked by the chemical linkage is R. In some embodiments, each of the two amino acids linked by the chemical linkage is S. In some embodiments, one of the two amino acids linked by the chemical linkage is R and the other is S. In some embodiments, the chemical linkage is a hydrocarbon linkage.

[0273] In some embodiments, the CPP is an L-peptide comprising L- amino acids. In some embodiments, the CPP is a retro-inverso peptide e.g., a peptide made up of D-amino acids in a reversed sequence and, when extended, assumes a side chain topology similar to that of its parent molecule but with inverted amide peptide bonds). In some embodiments, the retro- inverso peptide comprises a sequence of SEQ ID NO: 91 or 156.

[0274] In some embodiments, the CPP comprises, from N-terminus, an acetyl group, a targeting moiety and a linker moiety covalently linked to the N-terminus of the cellpenetrating peptide. i. Targeting moiety

[0275] In some embodiments, the CPP described herein comprises a targeting moiety. In some embodiments, the targeting moiety is conjugated to the N-terminus the CPP. In some embodiments, the targeting moiety is conjugated to the C-terminus the CPP. In some embodiments, a first targeting moiety is conjugated to the N-terminus of the CPP and a second targeting moiety is conjugated to the C-terminus of the CPP.

[0276] In some embodiments, the targeting moiety comprises a targeting peptide that targets one or more organs. In some embodiments, the one or more organs are selected from the group consisting of muscle, heart, brain, spleen, lymph node, liver, lung, and kidney. In some embodiments, the targeting peptide targets brain. In some embodiments, the targeting peptide targets muscle. In some embodiments, the targeting peptide targets heart.

[0277] In some embodiments, the targeting moiety comprises at least about 3, 4, or 5 amino acids. In some embodiments, the targeting moiety comprises no more than about 8, 7, 6, 5, or 4 amino acids. In some embodiments, the targeting moiety comprises about 3, 4, or 5 amino acids. In some embodiments, the targeting moiety comprises a sequence selected from the group consisting of GY, YV, VS, SK, GYV, YVS, VSK, GYVS, YVSK, YI, IG, GS, SR, YIG, IGS, GSR, YIGS, IGSR. In some embodiments, the sequence (e.g., a targeting sequence) is selected from the group consisting of GYVSK, GYVS, YIGS, and YIGSR.

[0278] In some embodiments, the targeting moiety comprises a targeting sequence selected from the group consisting of SEQ ID NOs: 196-205 and 235-240. In some embodiments, the targeting moiety comprises a targeting sequence SYTSSTM (SEQ ID NO: 196). In some embodiments, the targeting moiety comprises a targeting sequence CKTRRVP (SEQ ID NO: 197). In some embodiments, the targeting moiety comprises a targeting sequence THRPPNWSPV (SEQ ID NO: 198). In some embodiments, the targeting moiety comprises a targeting sequence TGNYKALHPDHNG (SEQ ID NO: 199). In some embodiments, the targeting moiety comprises a targeting sequence CARPAR (SEQ ID NO: 200). In some embodiments, the targeting moiety comprises a targeting sequence ASSLNIA (SEQ ID NO: 203). In some embodiments, the targeting moiety comprises a targeting sequence LSSRLDA (SEQ ID NO: 204). In some embodiments, the targeting moiety comprises a targeting sequence KSYDTY (SEQ ID NO: 205).

[0279] In some embodiments, the targeting moiety is conjugated to the CPP via a linker moiety such as any one of the linker moieties described herein. ii. Linker moiety

[0280] In some embodiments, the CPP comprise a linker moiety.

[0281] In some embodiments, the linker moiety comprises a polyglycine linker. In some embodiments, the linker comprises a P-Alanine. In some embodiments, the linker comprises at least about two, three, or four glycines, optionally continuous glycines. In some embodiments, the linker further comprises a serine. In some embodiments, the linker comprises a GGGGS or SGGGG sequence. In some embodiments, the linker comprises a Glycine-P-Alanine motif.

[0282] In some embodiments, the one or more moieties comprise a polymer (e.g., PEG, poly lysine, PET). In some embodiments, the polymer is conjugated to the N-terminus of the CPP. In some embodiments, the polymer is conjugated to the C-terminus of the CPP. In someembodiments, a first polymer is conjugated to the N-terminus of the CPP and a second polymer is conjugated to the C-terminus of the CPP. In some embodiments, the polymer is a PEG. In some embodiments, the PEG is a linear PEG. In some embodiments, the PEG is a branched PEG. In some embodiments, the molecular weight of the PEG is no more than about 5 kDa, 10 kDa, 15kDa, 20 kDa, 30 kDa, or 40 kDa. In some embodiments, the molecular weight of the PEG is at least about 5 kDa, 10 kDa, 15kDa, 20 kDa, 30 kDa, or 40 kDa. In some embodiments, the molecular weight of the PEG is about 5 kDa to about 10 kDa, about 10 kDa to about 15kDa, about 15 kDa to about 20 kDa, about 20kDa to about 30 kDa, or about 30 kDa to about 40 kDa. In some embodiments, the molecular weight of the PEG is about 5 kDa, 10 kDa, 20 kDa, or 40 kDa. In some embodiments, the molecular weight of the PEG is selected from the group consisting of 5 kDa, 10 kDa, 20 kDa or 40 kDa. In some embodiments, the molecular weight of the PEG is about 5 kDa. In some embodiments, the molecular weight of the PEG is about 10 kDa. In some embodiments, the PEG comprises at least about 1, 2, or 3 ethylene glycol units. In some embodiments, the PEG consists of no more than about 10, 9, 8 or 7 ethylene glycol units. In some embodiments, the PEG consists of about 1, 2, or 3 ethylene glycol units. In some embodiments, the PEG moiety consists of about one to eight, or about two to seven ethylene glycol units.

[0283] In some embodiments, the linker moiety is selected from the group consisting of beta alanine, cysteine, cysteamide bridge, poly glycine (such as G2 or G4), Aun (11-amino- undecanoic acid), Ava (5-amino pentanoic acid), and Ahx (aminocaproic acid). In some embodiments, the linker moiety comprises Aun (11-amino-undecanoic acid). In some embodiments, the linker moiety comprises Ava (5-amino pentanoic acid). In some embodiments, the linker moiety comprises Ahx (aminocaproic acid). iii. Carbohydrate moiety

[0284] In some embodiments, the cell-penetrating peptide further comprises a carbohydrate moiety. In some embodiments, the carbohydrate moiety is GalNAc. In some embodiments, the cell-penetrating peptide is an ADGN-106 peptide. In some embodiments, the cellpenetrating peptide is an ADGN-100 peptide. In some embodiments, the carbohydrate moiety modifies an alanine within the cell-penetrating peptide. In some embodiments, the cellpenetrating peptide is set forth in SEQ ID NO: 111 or 172.4. Cell-penetrating peptide mixture

[0285] In some embodiments, the cell-penetrating peptide in the composition is a mixture of a) a first peptide comprising a first cell-penetrating peptide (such as any of the cellpenetrating peptide described herein); b) a second peptide comprising a second cellpenetrating peptide (such as any of the cell-penetrating peptide described herein), optionally wherein the second peptide comprises a polyethylene glycol (PEG) moiety that is covalently linked to the second cell-penetrating peptide, and optionally wherein the first peptide does not have a PEG moiety. In some embodiments, the first and / or the second cell-penetrating peptide is a PTD-based peptide, an amphipathic peptide, a poly-arginine-based peptide, an MPG peptide, a CADY peptide, a PEP-1 peptide, a PEP-2 peptide, or a PEP-3 peptide. In some embodiments, the first and the second cell-penetrating peptides are selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-4 peptides, VEPEP-5 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, the molar ratio of the cell-penetrating peptide to the cargo (such as any of the BRCA1 nucleic acids, the BRCA1 mRNAs, the BRCA1 protein construct, the BRCA1 genome-editing agents described herein) is between about 1:1 and about 100:1 (such as about between about 1:1 and about 50:1, or about 2:1 to about 50:1). In some embodiments, the average diameter of the complex is between about 20 nm and about 1000 nm (such as about 20 to about 500 nm, about 50 to about 400 nm, about 60 to about 300 nm, about 80 to about 200 nm, or about 100 to about 160 nm). In some embodiments, the PEG moiety consists of about one to ten (such as about 1-8, 2-7, 1-5, or 6-10) ethylene glycol units. In some embodiments, the molecular weight of the PEG moiety is about 0.05 kDa to about 50 kDa. In some embodiments, the molecular weight of the PEG moiety is about 0.05 kDa to about 0.5 kDa (such as about 0.05-0.1, 0.05-0.4, 0.1-0.3, 0.05-0.25, 0.25-0.5 kDa). In some embodiments, the PEG moiety is conjugated to the N- or C-terminus of the second cellpenetrating peptide. In some embodiments, the PEG moiety is conjugated to a site within the second cell-penetrating peptide.

[0286] In some embodiments, the ratio of the first cell-penetrating peptide to the second cellpenetrating peptide is about 20:1 to about 1:1 (such as about 15:1 to about 2:1, about 10:1 to about 4:1).

[0287] In some embodiments, the first and / or the second cell-penetrating peptides are selected from VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100peptides. In some embodiments, the first and / or the second cell-penetrating peptide are selected from VEPEP-6 peptides, and ADGN-100 peptides.

[0288] In some embodiments, the PEG moiety is a linear PEG. In some embodiments, the PEG moiety is a branched PEG.5. Complexes comprising a CPP (“CPP-cargo complexes”)

[0289] In some embodiments, the cell-penetrating peptides described herein are complexed with the one or more cargo molecules (e.g., a BRCA1 mRNA described herein, a genome editing agent to inserting a BRCA1 transgene described herein). In some embodiments, the cell-penetrating peptides are non-covalently complexed with at least one of the one or more cargo molecules. In some embodiments, the cell-penetrating peptides are non-covalently complexed with each of the one or more cargo molecules. In some embodiments, the cellpenetrating peptides are covalently complexed with at least one of the one or more cargo molecule. In some embodiments, the cell-penetrating peptides are covalently complexed with each of the one or more cargo molecules.6. Nanoparticles comprising a CPP-cargo complex

[0290] In some embodiments, the CPP-cargo complexes described herein is in a nanoparticle.

[0291] In some embodiments, the nanoparticle comprises a core comprising a CPP-cargo complex described herein, wherein the cell-penetrating peptide in the complex is associated with the cargo. In some embodiments, the association is non-covalent. In some embodiments, the association is covalent.

[0292] In some embodiments, the nanoparticle further comprises a surface layer (e.g., a shell) comprising a peripheral cell-penetrating peptide (z.e., CPP), wherein the core is coated by the shell. In some embodiments, the peripheral CPP is the same as a CPP in the core. In some embodiments, the peripheral CPP is different than any of the CPPs in the core. In some embodiments, the peripheral CPP includes, but is not limited to, a PTD-based peptide, an amphipathic peptide, a poly-arginine-based peptide, an MPG peptide, a CADY peptide, a VEPEP peptide (such as a VEPEP-3, VEPEP-4, VEPEP-5, VEPEP-6, or VEPEP-9 peptide), an ADGN-100 peptide, a Pep-1 peptide, and a Pep-2 peptide. In some embodiments, the peripheral CPP is a VEPEP-3 peptide, a VEPEP-6 peptide, a VEPEP-9 peptide, or an ADGN- 100 peptide. IN some embodiments, the peripheral cell-penetrating peptide is selected from the group consisting of PEP- 1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides. In some embodiments, atleast some of the peripheral cell-penetrating peptides in the surface layer are linked to a targeting moiety. In some embodiments, the linkage is covalent. In some embodiments, the covalent linkage is by chemical coupling. In some embodiments, the covalent linkage is by genetic methods. In some embodiments, the nanoparticle further comprises an intermediate layer between the core of the nanoparticle and the surface layer. In some embodiments, the intermediate layer comprises an intermediate CPP. In some embodiments, the intermediate CPP is the same as a CPP in the core. In some embodiments, the intermediate CPP is different than any of the CPPs in the core. In some embodiments, the intermediate CPP includes, but is not limited to, a PTD-based peptide, an amphipathic peptide, a poly-arginine- based peptide, an MPG peptide, a CADY peptide, a VEPEP peptide (such as a VEPEP-3, VEPEP-6, or VEPEP-9 peptide), an ADGN-100 peptide, a Pep-1 peptide, and a Pep-2 peptide. In some embodiments, the intermediate CPP is a VEPEP-3 peptide, a VEPEP-6 peptide, a VEPEP-9 peptide, or an ADGN-100 peptide.

[0293] In some embodiments, the nanoparticle core comprises a plurality of CPP-cargo complexes. In some embodiments, the nanoparticle core comprises a plurality of CPP-cargo complexes present in a predetermined ratio. In some embodiments, the predetermined ratio is selected to allow the most effective use of the nanoparticle in any of the methods described below in more detail. In some embodiments, the nanoparticle core further comprises one or more additional BRCA1 mRNA, one or more additional cell-penetrating peptides, and / or one or more additional genome editing agent for introducing a BRCA1 transgene.

[0294] In some embodiments, according to any of the nanoparticles described herein, the mean size (diameter) of the nanoparticle is from about 20 nm to about 1000 nm, including for example from about 50 nm to about 800 nm, from about 75 nm to about 600 nm, from about 100 nm to about 600 nm, and from about 200 nm to about 400 nm. In some embodiments, the mean size (diameter) of the nanoparticle is no greater than about 1000 nanometers (nm), such as no greater than about any of 900, 800, 700, 600, 500, 400, 300, 200, or 100 nm. In some embodiments, the average or mean diameter of the nanoparticle is no greater than about 200 nm. In some embodiments, the average or mean diameters of the nanoparticles is no greater than about 150 nm. In some embodiments, the average or mean diameter of the nanoparticle is no greater than about 100 nm. In some embodiments, the average or mean diameter of the nanoparticle is about 20 nm to about 400 nm. In some embodiments, the average or mean diameter of the nanoparticle is about 30 nm to about 400 nm. In some embodiments, the average or mean diameter of the nanoparticle is about 40 nm to about 300 nm. In someembodiments, the average or mean diameter of the nanoparticle is about 50 nm to about 200 nm. In some embodiments, the average or mean diameter of the nanoparticle is about 60 nm to about 150 nm. In some embodiments, the average or mean diameter of the nanoparticle is about 70 nm to about 100 nm. In some embodiments, the nanoparticles are sterile-filterable.

[0295] In some embodiments, the zeta potential of the nanoparticle is from about -30 mV to about 60 mV (such as about any of -30, -25, -20, -15, -10, -5, 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 mV, including any ranges between these values). In some embodiments, the zeta potential of the nanoparticle is from about -30 mV to about 30 mV, including for example from about -25 mV to about 25 mV, from about -20 mV to about 20 mV, from about -15 mV to about 15 mV, from about -10 mV to about 10 mV, and from about -5 mV to about 10 mV. In some embodiments, the polydispersity index (PI) of the nanoparticle is from about 0.05 to about 0.6 (such as about any of 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, and 0.6, including any ranges between these values). In some embodiments, the nanoparticle is substantially non-toxic.D. Protein constructs comprising a BRCA1 proteins

[0296] The present application further provides protein constructs (e.g., therapeutic protein constructs) comprising a polypeptide comprising a BRCA1 protein and optionally a second moiety. These constructs can be manufactured in vitro and then delivered into an individual. Compositions comprising nucleic acids (e.g., DNA, e.g., mRNA) encoding any of these protein constructs (such as those described above) are also contemplated.1. BRCA1 proteins

[0297] In some embodiments, the BRCA1 protein comprises the full length of or a portion of the full-length BRCA1 protein e.g., an amino acid sequence set forth in SEQ ID NO: 1) or a functional variant, e.g., a functional variant having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the full length of or a portion of the full-length BRCA1 protein. In some embodiments, the functional variant comprises an amino acid sequence of a length of at least 80%, 85%, 90%, 95%, 97%, 98%, 99% of the length of the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the BRCA1 protein does not comprises a C- terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise a N-terminus fragment comprising the RING domain. In some embodiments, the BRCA1 protein does not comprise the full Exon 11 domain. In someembodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD5 1 domain, or c) both the full RAD50 and the full RAD51 domain.

[0298] In some embodiments, the BRCA1 protein has a length of no more than about 1800 amino acids, 1750 amino acids, 1700 amino acids, 1650 amino acids, 1600 amino acids, 1550 amino acids, 1500 amino acids, 1450 amino acids, 1400 amino acids, 1350 amino acids, 1300 amino acids, 1250 amino acids, 1200 amino acids, 1150 amino acids, 1100 amino acids, 1050 amino acids, 1000 amino acids, 950 amino acids, 900 amino acids, 850 amino acids, 800 amino acids, 750 amino acids, 700 amino acids, 650 amino acids, 600 amino acids, 550 amino acids, 500 amino acids, 450 amino acids, 400 amino acids, 350 amino acids, 300 amino acids, 250 amino acids, 200 amino acids, 150 amino acids, or 100 amino acids.

[0299] In some embodiments, the BRCA1 protein comprises at least a portion of the N- terminus fragment of BRCA1 protein, optionally wherein the portion of the N-terminus fragment comprises a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 109 amino acids (z.e., amino acid 1-109 of SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 247 amino acids (z.e., amino acid 1-247 of SEQ ID NO: 1). In some embodiments, the N-terminus fragment comprises at least 507 amino acids (z.e., amino acid 1-507 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein does not comprises a C-terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise the full Exon 11 domain. In some embodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD5 1 domain, or c) both the full RAD50 and the full RAD51 domain.

[0300] In some embodiments, the BRCA1 protein comprises the full domain of RING domain. In some embodiments, the BRCA1 protein further comprises NLS1 and / or NLS2. In some embodiments, the BRCA1 protein comprises a) the full domain of RING domain and b) NLS1. In some embodiments, the BRCA1 protein comprises an amino acid sequence of amino acid 1-507 of SEQ ID NO: 1. In some embodiments, the BRCA1 protein does not comprise NLS2. In some embodiments, the BRCA1 protein comprises at least a portion of the RAD50 binding domain, optionally wherein the BRCA1 protein does not comprises the full length of the RAD50 binding domain. In some embodiments, the BRCA1 protein does not comprise any one or more of the Rad51, PALB2, SCD, and BRCT domains. In someI llembodiments, the N-terminus fragment comprises at least 507 amino acids (z.e., amino acid 1-507 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein does not comprises a C- terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise the full Exon 11 domain. In some embodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD51 domain, or c) both the full RAD50 and the full RAD51 domain.

[0301] In some embodiments, the BRCA1 protein comprises the full domain of RING domain, optionally wherein the BRCA1 protein does not comprise any one or more of the RB, MB1, NLS1, NLS2, Rad50, Rad51, PALB2, SCD, and BRCT domains. In some embodiments, the BRCA1 protein does not comprise Exon 11 domain. In some embodiments, the BRCA1 protein does not comprise Exon 11-13 domains. In some embodiments, the N-terminus fragment comprises at least 247 amino acids (z.e., amino acid 1-247 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein does not comprises a C- terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD51 domain, or c) both the full RAD50 and the full RAD51 domain.

[0302] In some embodiments, the BRCA1 protein comprises the full length of the Exon 11 or a portion of Exon 11. In some embodiments, the portion of Exon 11 comprises the amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof. In some embodiments, the portion of Exon 11 comprises a contiguous amino acid sequence of amino acid 507-1247 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-1247 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein comprises a contiguous amino acid sequence of amino acid 507-907 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-907 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein comprises the full NLS2 region. In some embodiments, the BRCA1 protein comprises the NLS1 region. In some embodiments, the BRCA1 protein does not encode the NLS1 region. In some embodiments, the BRCA1 protein does not comprises a C-terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise a N-terminus fragment comprising the RING domain. In someembodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD5 1 domain, or c) both the full RAD50 and the full RAD51 domain.

[0303] In some embodiments, the BRCA1 protein comprises at least a portion of the RAD50 binding domain and / or at least a portion of a RAD51 binding domain. In some embodiments, the at least a portion of a RAD51 binding domain comprises a contiguous amino acid sequence of the N-terminus of the RAD51 binding domain. In some embodiments, the contiguous amino acid sequence of the N-terminus of the RAD51 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids at the N-terminus of the RAD51 binding domain. In some embodiments the portion of RAD50 binding domain comprise a contiguous amino acid sequence of the C-terminus of the RAD50 binding domain. In some embodiments, the contiguous amino acid sequence of the C-terminus of the RAD50 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 240 amino acids at the C-terminus of the RAD50 binding domain. In some embodiments, the BRCA1 protein does not comprises a C-terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise a N-terminus fragment comprising the RING domain.

[0304] In some embodiments, the at least a portion of a RAD51 binding domain comprises a contiguous amino acid sequence of amino acid 758-907 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 758- 907 of SEQ ID NO: 1).

[0305] In some embodiments, the BRCA1 protein comprises the full length of a RAD51 binding domain. In some embodiments, the BRCA1 protein further comprises a portion of RAD50 binding domain. In some embodiments the portion of RAD50 binding domain comprise a contiguous amino acid sequence of the C-terminus of the RAD50 binding domain. In some embodiments, the contiguous amino acid sequence of the C-terminus of the RAD50 binding domain comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230 or 240 amino acids at the C-terminus of the RAD50 binding domain. In some embodiments, the portion of the RAD50 binding domain comprises at least a contiguous amino acid sequence of amino acid 507-748 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 507-748 of SEQ ID NO: 1). In some embodiments, the BRCA1 protein does not comprises a C-terminus fragment comprising BRCT domain. In some embodiments, the BRCA1 protein does not comprise a N-terminus fragment comprising the RING domain. In some embodiments, the BRCA1 protein does not comprise the full RAD50 domain.

[0306] In some embodiments, the BRCA1 protein comprises at least a portion of the C- terminus fragment of BRCA1 protein, optionally wherein the portion of the C-terminus fragment comprises a contiguous C-terminus amino acid sequence comprised in SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous C-terminus amino acid sequence comprised in SEQ ID NO: 1). In some embodiments, the contiguous amino acid sequence has a length of at least about 500, 600, 700, or 800 amino acids. In some embodiments, the BRCA1 protein does not comprise a N-terminus fragment comprising the RING domain. In some embodiments, the BRCA1 protein does not comprise the full Exon 11 domain. In some embodiments, the BRCA1 protein does not comprise a) the full RAD50 domain, b) the full RAD51 domain, or c) both the full RAD50 and the full RAD51 domain.

[0307] In some embodiments, the BRCA1 protein comprises a contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1 or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous amino acid sequence of amino acid 1047-1837 of SEQ ID NO: 1).

[0308] In some embodiments, the BRCA1 protein comprises a) a contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1 (e.g., amino acid 1-247 of SEQ ID NO: 1, e.g., amino acid 1-507 of SEQ ID NO: 1,) or a functional variant thereof (e.g., a functional variant thereof having at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity to the contiguous N-terminus amino acid sequence comprised in SEQ ID NO: 1), and b) at least a portion of the RAD50 binding domain (e.g., a contiguous amino acid sequence of about 240 amino acids of the C-terminus of the RAD 5...

Claims

CLAIMS1. A pharmaceutical composition comprising a) an mRNA encoding a full length human BRCA1 protein or a portion thereof and b) a carrier, wherein the portion of human BRCA1 protein is less than a full length human BRCA1 protein.

2. The pharmaceutical composition of claim 1, wherein the full length human BRCA1 protein comprises the amino acid sequence set forth in SEQ ID NO: 1.

3. The pharmaceutical composition of claim 1 or claim 2, wherein the mRNA encodes a portion of the full-length human BRCA1 protein, optionally wherein: a) the mRNA has a length of no more than about 5000bp, and / or b) the portion of human BRCA1 protein has a length of no more than about 1500 amino acids.

4. The pharmaceutical composition of any of claims 1-3, wherein the mRNA is chemically modified.

5. The pharmaceutical composition of claim 3 or claim 4, wherein the mRNA encodes a portion of human BRCA1 comprising an Exon 11 domain or a portion thereof.

6. The pharmaceutical composition of claim 5, wherein the Exon 11 domain or a portion thereof comprises a nuclear location sequence (“NLS”).

7. The pharmaceutical composition of claim 5 or claim 6, wherein the portion of human BRCA1 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 6, 8, 9, and 11-14 or a functional variant thereof, optionally wherein the portion of human BRCA1 comprises the amino acid sequence set forth in any one of SEQ ID Nos: 6, 9, and 13.

8. The pharmaceutical composition of any one of claims 5-7, wherein the Exon11 domain comprises the nuclear location sequence 2 (“NLS2”) or a functional variant thereof.

9. The pharmaceutical composition of any one of claims 5-8, wherein:a) the Exon 11 domain or a portion thereof comprises the amino acid sequence of the binding region for one or more of MSH2, GADD45, Rad50, BRCC36, and Rad51 or a portion thereof, and / or b) the Exon 11 domain or a portion thereof does not comprise the full amino acid sequence of the binding region for one or more of Rb, Myc, and Rad50.

10. The pharmaceutical composition of any one of claims 3-9, wherein the mRNA encodes a portion of human BRCA1 comprising an Exon 12 domain, an Exon 13 domain, and / or a coiled-coil domain, or a portion thereof.

11. The pharmaceutical composition of any one of claims 3-10, wherein the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence of the binding region of PALB2.

12. The pharmaceutical composition of any one of claims 3-11, wherein the mRNA encodes a portion of human BRCA1 comprising a serine containing domain or a portion thereof.

13. The pharmaceutical composition of any one of claims 3-12, wherein the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any one of SEQ ID NOs: 2-14 or a functional variant thereof.

14. The pharmaceutical composition of any one of claims 3-13, wherein: c) the mRNA encodes a portion of human BRCA1 that does not comprise a Really Interesting New Gene (“RING”) domain; or d) the mRNA encodes a portion of human BRCA1 comprising a Really Interesting New Gene (“RING”) domain, optionally wherein: iii) the RING domain comprises the amino acid sequence encoded by a nuclear export sequence (“NES”) or a functional variant thereof; and / or iv) the RING domain comprises an amino acid sequence set forth in SEQ ID NO: 2 or 5 or a functional variant thereof.

15. The pharmaceutical composition of any one of claims 1-4 and 10-14, wherein the mRNA encodes a portion of human BRCA1 that does not comprise an Exon 11 domain.

16. The pharmaceutical composition of any one of claims 3-15, wherein the mRNA encodes a portion of human BRCA1 that does not comprise a BRCA1 C-terminal (“BRCT”) domain, optionally wherein the mRNA encodes a portion of human BRCA1 domain that does not comprise one or both of the BRCT1 and BTCT2 domains.

17. The pharmaceutical composition of any one of claims 3-16, wherein the mRNA encodes a portion of human BRCA1 that does not comprise the amino acid sequence of a binding region (e.g., a full amino acid sequence of the binding region) for p53, CtIP and / or BACH1.

18. The pharmaceutical composition of any one of claims 1-17, wherein the mRNA encodes an amino acid sequence set forth in any of SEQ ID Nos: 1-14; optionally the mRNA encodes a portion of human BRCA1 comprising an amino acid sequence set forth in any of SEQ ID NOs 2, 5-6, and 9-13 or a functional variant thereof.

19. The pharmaceutical composition of any one of claims 1-18, wherein the carrier is selected from a lipid, a polymer, a virus, and a cell-penetrating peptide (“CPP”).

20. The pharmaceutical composition of claim 19, wherein the carrier comprises a cell-penetrating peptide (“CPP”), optionally wherein the cell-penetrating peptide is selected from the group consisting of CADY, PEP-1 peptides, PEP-2 peptides, PEP-3 peptides, VEPEP-3 peptides, VEPEP-6 peptides, VEPEP-9 peptides, and ADGN-100 peptides, optionally the CPP comprises an amino acid sequence set forth in any one of SEQ ID NOs: 40-107, 111-195, 259-270 and 272-285.

21. The pharmaceutical composition of claim 20, wherein the carrier further comprises one or more moieties covalently linked to N-terminus of the cell-penetrating peptide, and wherein the one or more moieties are selected from the group consisting of an acetyl group, a fatty acid, a cholesterol, a poly-ethylene glycol, a nuclear localization signal, a nuclear export signal, an antibody, a polysaccharide, a linker moiety, and a targeting moiety, optionally wherein: a) the carrier comprises an acetyl group covalently linked to the N- terminus of the cell-penetrating peptide, b) the carrier comprises a targeting peptide covalently linked to the N-terminus of the cell-penetrating peptide, wherein optionally thetargeting peptide is selected from the group consisting of SEQ ID NOs: 196-205 and 235- 241, c) the carrier comprises a linker moiety selected from the group consisting of a poly glycine linker moiety, a PEG moiety (e.g., (PEG)3), Aun, Ava, and Ahx, d) the carrier comprises, from N-terminus, an acetyl group, a targeting moiety and a linker moiety covalently linked to the N-terminus of the cell-penetrating peptide, e) the carrier further comprises a carbohydrate moiety, and / or f) the cell-penetrating peptide is a retro-inverso peptide.

22. The pharmaceutical composition of claim 19 or claim 20, wherein the cellpenetrating peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40-43, 89-107, 111-117, 153-175 and 272-285.

23. The pharmaceutical composition of claim 19, wherein the carrier comprises a lipid or a polymer, optionally wherein the carrier comprises a lipid.

24. A pharmaceutical composition comprising a) an mRNA encoding an amino acid sequence set forth in any of SEQ ID NOs: 1-14 or a functional variant thereof and b) a cell-penetrating peptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 40-43, optionally wherein the mRNA encodes an amino acid sequence set forth in any of SEQ ID NOs: 1-2, 5-6, and 9-13.

25. A method of treating, preventing, delaying, or reducing the risk of a cancer in an individual in need thereof comprising administering to the individual the pharmaceutical composition of any one of claims 1-24.

26. The method of claim 25, wherein a) the individual or cancer comprises an aberration in BRCA1, and / or b) the method further comprises selecting the individual for treatment based upon the individual or cancer comprises an aberration in BRCA1.

27. The method of claim 26, wherein the aberration in BRCA1 a) is a loss of function aberration, b) comprises a N-terminus truncated form of BRCA1, c) comprises an epigenetic modification in BRCA1, d) comprises an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13 domain, BRCT1 / 2 domain, and RING domain, e) does not comprise an aberration in any one or more of Exon 11 domain, Exon 12 domain, Exon 13domain, BRCT1 / 2 domain, and RING domain, f) comprises an aberration in RAD51 binding domain, and / or g) comprises an inherited aberration.

28. The method of any one of claims 25-27, where the individual or cancer comprises an aberration in P53.

29. The method of any one of claims 25-28, wherein the cancer is sensitive to a PARP inhibitor and / or a hormone therapy prior to the treatment.

30. The method of any one of claims 25-28, wherein the cancer is resistant to a PARP inhibitor and / or a hormone therapy prior to the treatment.

31. The method of any one of claims 25-30, further comprising administering a second therapy into the individual, optionally wherein the second therapy comprises a PARP inhibitor or a hormone therapy.

32. The method of any one of claims 25-31, wherein the cancer is a breast cancer, an ovarian cancer, a fallopian tube cancer, a primary peritoneal cancer, a prostate cancer, or a pancreatic cancer, optionally wherein the cancer is a breast cancer or an ovarian cancer, further optionally wherein the cancer is a triple negative breast cancer.

33. The method of any one of claims 25-32, wherein the cancer has a damaged homologous recombination (“HR”) function.

Images