TREX-1 augmentation to attenuate genotoxic stress and exert cardioprotection

Abstract

Provided herein are methods of treating a condition associated with aging, atrophy, fibrosis, tissue senescence, inflammation, a heart condition, and / or a muscle disorder by administering to a subject an agent that enhances expression of a Trex1 gene product, where the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:3). Also provided herein are compositions for treating a condition associated with aging, atrophy, inflammation and / or fibrosis comprising a nucleic acid that anneals to the Trex1 5' UTR and enhances Trex1 expression, a nucleic acid encoding Trex1 that enhances Trex1 expression, a population of macrophages having enhanced expression of the Trex1 gene product or a combination thereof.

Description

TREX-1 AUGMENTATION TO ATTENUATE GENOTOXIC STRESS AND EXERTCARDIOPROTECTIONREFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 583007, filed September 15, 2023, the disclosure of which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under Grant No. R01 HL124074, awarded to Dr. Eduardo Marban, Grant No. R01 HL142579 awarded to Dr. Ahmed Ibrahim, and R01 HL164588 awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled SequenceListingCSMC022WO.xml created on September 12, 2024, which is approximately 17,593 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.BACKGROUND

[0004] The present disclosure relates to the Trexl-cGAS / STING pathway and its role in attenuating genotoxic stress.

[0005] Inflammation and tissue injury are main drivers of pathology in certain cardiac injury and other diseases. As crucial players in innate immunity, macrophages secrete inflammatory mediators, scavenge cellular debris (by efferocytosis), and remodel tissues after injury. Macrophages are key effectors of post-myocardial infarction (MI) cardioprotection induced by extracellular vesicles (EV) derived from cardiosphere-derived cells (CDC), and are implicated in enhanced efferocytosis. Consistent with this, macrophage depletion undermines cardioprotection.

[0006] Cardiac damage such as that associated with myocardial infarctions (MT) affects a large portion of people in the United States and around the world. Effective therapies are needed to protect the heart and reduce fibrosis, adverse remodeling, scarring, and / or ventricular dysfunction.SUMMARY

[0007] Provided herein is a method of treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). Also provided is a method of treating a condition, wherein the condition is associated with aging, atrophy, inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the condition associated with aging, atrophy, inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma. In some embodiments, the condition associated with inflammation comprises a symptom or sequelae of an infectious disease or is associated with immunotherapy. In some embodiments, the infectious disease comprises a viral infection. In some embodiments, the condition associated with inflammation comprises a cytokine storm. In some embodiments, the condition associated with inflammation comprises an autoimmune disorder. In some embodiments, the autoimmune disorder comprises scleroderma or systemic sclerosis. In some embodiments, the condition associated with aging, atrophy, and fibrosis comprises a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.

[0008] Provided herein is a method of treating a heart condition or symptom thereof, comprising administering to a subject in need of treating a heart condition or symptom thereof an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the heart condition comprises a symptom and / or sequelae of heart failure. In some embodiments, the heart condition comprises hypertrophic cardiomyopathy. In someembodiments, the heart condition comprises heart failure with preserved ejection fraction (HFpEF). In some embodiments, the heart condition comprises a symptom or sequelae of an infectious disease. In some embodiments, the infectious disease comprises a viral infection. In some embodiments, the subject has the heart condition. In some embodiments, the subject is at risk of developing the heart condition. In some embodiments,

[0009] Provided herein is a method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the muscle disorder comprises muscular dystrophy or a heart condition. In some embodiments, the muscle disorder comprises Duchenne muscular dystrophy. In some embodiments, the subject has the muscle disorder. In some embodiments, the subject is at risk of developing the muscle disorder. In some embodiments, the subject is genetically predisposed to developing the muscle disorder.

[0010] Provided herein is a method for treating diseases related to aging, tissue senescence, or atrophy, comprising administering to a subject in need of treating a disease related to aging, tissue senescence, or atrophy an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). The method of any one of the preceding claims, wherein the agent does not comprise the isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the Trexl gene product comprises a Trexl mRNA. In some embodiments, the agent comprises a nucleic acid that anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG, ( SEQ ID NO: 3) anneals. In some embodiments, the first sequence does not overlap with the second sequence. In some embodiments, the agent stabilizes the Trexl mRNA, or increases the half-life of the Trexl mRNA. In some embodiments, the agent comprises a nucleic acid that encodes the Trexl gene product, optionally wherein the Trexl gene product comprises a truncated form of TREX1protein having exonuclease activity. In some embodiments, the nucleic acid comprises a promoter operably connected to a nucleotide sequence encoding the Trcxl gene product, wherein the promoter drives expression of the Trexl gene product. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector, or a plasmid. In some embodiments, the nucleic acid is comprised in a macrophage. In some embodiments, the method comprises administering a population of the macrophages, wherein the effective amount of the agent that enhances expression of a Trexl gene product is comprised in the population. In some embodiments, the nucleic acid comprises a stabilized Trexl mRNA. In some embodiments, the stabilized Trexl mRNA comprises an engineered poly(A) tail. In some embodiments, the agent comprises one or more chemically-modified nucleotides. In some embodiments, the chemically-modified nucleotide comprises a backbone modification. In some embodiments, the backbone modification comprises a backbone sugar modification. In some embodiments, the one or more chemically-modified nucleotides comprise a locked nucleic acid (LNA) and / or a methylated nucleotide. In some embodiments, the agent attenuates DNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis. In some embodiments, the agent enhances expression of the Trexl gene product in macrophages when the effective amount of the agent is administered to the subject.

[0011] Provided herein is a method of treating a condition associated with inflammation and / or fibrosis, comprising upregulating Trexl in macrophages of a subject in need of treating a condition associated with inflammation and / or fibrosis.

[0012] Provided herein is a method of treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and / or fibrosis an effective amount of an agent that attenuates DNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the method comprises administering the effective amount of the agent intravenously, intramuscularly, intracardially, or orally.

[0013] Provided herein is a method of promoting anti-inflammatory activity of macrophages, comprising contacting a population of macrophages with an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising anucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3) to thereby promote an anti-inflammatory activity of macrophages of the population. In some embodiments, the contacting comprises administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount of the agent, to thereby promote an anti-inflammatory activity of macrophages in the subject. In some embodiments, the condition associated with aging, atrophy, inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the condition associated with aging, atrophy, inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma. In some embodiments, the nucleic acid comprises a promoter operably connected to a nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Trexl gene product. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector, or a plasmid. In some embodiments, the agent stabilizes a Trexl mRNA, or increases the half-life of the Trexl mRNA. In some embodiments, the population of macrophages comprises human macrophages.

[0014] Provided herein is a composition for treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising: a nucleic acid that anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3) anneals, wherein the nucleic acid enhances expression of a Trexl gene product; a nucleic acid that encodes the Trexl gene product, wherein the nucleic acid is configured to overexpress the Trexl gene product;a population of macrophages having elevated anti-inflammatory activity, wherein macrophages of the population have enhanced expression of the Trexl gene product and do not comprise an exogenous RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3) or a combination thereof. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the macrophages of the population are genetically modified to overexpress the Trexl gene product. In some embodiments, the macrophages of the population are genetically modified to comprise a nucleic acid comprising a promoter operably connected toa nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Trexl gene product in the macrophages. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector, or a plasmid. In some embodiments, the composition is used for treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof. In some embodiments, the composition is used for preparation of a medicament for treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof.

[0015] Also provided is an in vitro method of identifying an agent that enhances expression of a Trexl gene product in a target cell, comprising: contacting a candidate agent with a target cell; and measuring an expression level of a Trexl gene product in the target cell after the contacting, wherein the candidate agent is identified as an agent that enhances expression of a Trexl gene product when the measured expression level and / or measured activity level of the Trexl gene product is elevated compared to a suitable reference value.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1A is a non-limiting embodiment of a sequence alignment of EV- YF1 (SEQ ID NO: 1) and NT4 (SEQ ID NO: 2).

[0017] Figure IB is a non-limiting embodiment of a bar graph showing upregulation of IL10 expression by EV-YF1 and NT4 compared to vehicle control in rat bone marrow-derived macrophages (BMDM).

[0018] Figure 1C is a non-limiting embodiment of a schematic of a three-step screening of NT4-derived structural variants for optimization of activity.

[0019] Figure ID is a non-limiting embodiment of a bar graph evaluating step 1 of the screening (see, FIG. 1C) of different nucleotide substitutions of the most 5" nucleotide (a guanine; all groups compared to NT4) on IL- 10 expression.

[0020] Figure IE is a non-limiting embodiment of a bar graph evaluating step 2 of the screening (see, FIG. 1C) of variants including LNAs (all groups compared to NT41G-C) on IL- 10 expression.

[0021] Figure IF is a non-limiting embodiment of a bar graph evaluating step 3 of the screening (sec, FIG. 1C) evaluating the adenylation and methylation at the 3' end of TY 1 on IL- 10 expression in mouse macrophages with all groups compared to TY1.

[0022] Figure 1G is a non-limiting embodiment of a bar graph evaluating step 3 of the screening (see, FIG. 1C) evaluating the adenylation and methylation at the 3' end of TY1 on IL- 10 expression in human macrophages with all groups compared to TY1.

[0023] Figure 1H is a non-limiting embodiment of a sequence alignment of naturally-occurring NT4 (SEQ ID NO: 2), its optimized, bioinspired derivative (TY1, SEQ ID NOG), and a scrambled variant (Scr, SEQ ID NO. 4) with the same nucleotide content and LNAs, which serves as a control in Figures IF and 1G.

[0024] Figure II is a non-limiting embodiment of a line graph of TY 1, NT4, and EV-YF1 stability following exposure to increasing concentrations of the exonuclease RNAse R.

[0025] Figure 1J is a non-limiting embodiment of a bar graph of the levels of a marker of senescence (P21) in bone marrow-derived macrophages (BMDMs) pre-exposed to TY1, vehicle, or scrambled sequence before lipopolysaccharide (LPS) exposure.

[0026] Figure IK is a non-limiting embodiment of a bar graph of the levels of a marker of inflammation (NFkb) in bone marrow-derived macrophages (BMDMs) pre-exposed to TY1, vehicle, or scrambled sequence before lipopolysaccharide (LPS) exposure.

[0027] Figure IL is a non-limiting embodiment of a bar graph of the levels of a marker of inflammation (IL6) in bone marrow-derived macrophages (BMDMs) pre-exposed to TY1, vehicle, or scrambled sequence before lipopolysaccharide (LPS) exposure.

[0028] Figure 2A is a non-limiting embodiment of a heatmap of RNA sequencing data from rat bone marrow-derived macrophages (BMDM) exposed to vehicle (PBS) or TY1.

[0029] Figure 2B is a non-limiting embodiment of an Ingenuity Pathway Analysis (IPA) identifying DNA repair as major implicated pathway in TY1 -exposed macrophages.

[0030] Figure 2C is a non-limiting embodiment of a heatmap of the TY1- differentially expressed DNA repair genes including unique enrichment of Trexl signaling.

[0031] Figure 2D is a non-limiting embodiment of a bar graph comparing TY1- induced and PBS-induced expression of the genes identified in FIG. 2C (see, dashed box).

[0032] Figure 2E is a non-limiting embodiment of a bar graph of the downregulation of inflammatory genes by TY 1.

[0033] Figure 2F is a non-limiting embodiment of a bar graph of the downregulation of unfolded protein response (UPR) genes by TY 1.

[0034] Figure 2G is a non-limiting embodiment of a graph showing the levels of misfolded protein aggregates (aggresomes) in LPS-stressed macrophages exposed to TY1, scramble, and vehicle as measured by the amyloid aggregate dye, ProteoStat.

[0035] Figure 2H is a non-limiting embodiment of immunofluorescence images of LPS-stressed macrophages stained with the amyloid aggregate dye, ProteoStat, and DAPI. Scale bars: 100 pm.

[0036] Figure 21 is a non-limiting embodiment of bar graphs of ubiquitination pathway gene expression levels in cells exposed to TY 1 and vehicle.

[0037] Figure 2J is a non-limiting embodiment of a bar graph of MAP-ERK signaling in cells exposed to TY 1 or vehicle.

[0038] Figure 2K is a non-limiting embodiment of a bar graph measuring TY 1 nuclear and cytoplasmic localization at baseline (vehicle) and under LPS-stressed conditions.

[0039] Figure 2L is a non-limiting embodiment of a schematic of a study design for a Mass Spectrometry analysis of protein pull downs from incubating macrophage lysates with biotinylated TY1.

[0040] Figure 2M is a non-limiting embodiment of a graph of Mass Spectrometry peptide hits from a protein pull down after incubating macrophage lysates with biotinylated TY1 demonstrating association with nucleoporin proteins, RAN GTPase proteins, and mRNA binding proteins

[0041] Figure 2N is a non-limiting embodiment of a schematic model illustrating that collectively, these finding suggest that TY 1 associates with proteins of the inner nuclear membrane.

[0042] Figure 3A is a non-limiting embodiment of a schematic diagram showing two orthogonal approaches to identifying RNA targets of TY1.

[0043] Figure 3B is a non-limiting embodiment of a Venn diagram showing some embodiments of the number of genes identified using the approaches outlined in FIG. 3A.

[0044] Figure 3C is a non-limiting embodiment of a bar graph of the levels of TY 1 RNA targets in macrophages exposed to TY1 as detected by RNA sequencing.

[0045] Figure 3D is a non-limiting embodiment of a bar graph of Trexl counts as detected by sequencing reads of RNA-RNA pulldown using the bait capture method.

[0046] Figure 3E is a non-limiting embodiment of a bar graph of Trexl counts as detected by sequencing reads of RNA-RNA pulldown using the probe-capture method.

[0047] Figure 3F is a non-limiting embodiment of a graph of an untranslated region (UTR)-luciferase assay demonstrating stabilization of luciferase signal via binding of TY1 to the 5’ UTR of Trexl.

[0048] Figure 3G is a non-limiting embodiment of a graph of an untranslated region (UTR)-luciferase assay demonstrating that TY1 does not stabilize Trexl by binding to its 3’ UTR.

[0049] Figure 3H is a non-limiting embodiment of a graph of Trexl levels in bone marrow-derived macrophages exposed to TY 1 as detected by QPCR.

[0050] Figure 31 is a non-limiting embodiment of a graph of Trexl levels in bone marrow-derived macrophages following suppression of TREX1 showing that TREX1 expression is partially rescued with TY1 exposure.

[0051] Figure 3J is a non-limiting embodiment of a graph of IL 10 levels in bone marrow-derived macrophages following suppression of TREXlshowing that 1110 expression is partially rescued with TY 1 exposure.

[0052] Figure 3K is a non-limiting embodiment of a graph showing Trexl over expression (OE) enhances 1110 expression in macrophages.

[0053] Figure 3L is a non-limiting embodiment of a graph of TREX1 levels, as detected by qPCR, in macrophages post treatment with the transcription inhibitor actinomycin D (10 pg / ml) showing that TY1 does not impact the stability of existing TREX1 mRNA as shown by comparable decay rates.

[0054] Figure 3M is a non-limiting embodiment of a graph of Trexl levels, as measured by QPCR, of mouse bone marrow-derived macrophages demonstrating dosedependent upregulation of Trexl with exposure to increasing concentration of TY 1

[0055] Figure 3N is a non-limiting embodiment of a bar graph showing TY1 increases TREX1 levels protein levels in a mouse monocyte line.

[0056] Figure 30 is a non-limiting embodiment of a western blot showing that TY 1 increases TREX1 protein expression in a mouse monocyte cell line.

[0057] Figure 3P a non-limiting embodiment of a bar graph showing results of a comet assay in cells pre-incubated with TY1.

[0058] Figure 3Q is a non-limiting embodiment of a immunofluorescent images of a comet assay showing cells pre-incubated with TY1 were protected against DNA damage induced by serum starvation.

[0059] Figure 4A is a non-limiting embodiment of a schematic of a study design for TY1 administration in a rat model of acute myocardial infarction. Rats received ischemia reperfusion injury (45 minutes of ischemia) followed by intravenous administration of TY1. Forty-eight hours post-injury, animals receiving TY 1 had lower circulating cardiac troponin

[0060] Figure 4B is a non-limiting embodiment of a graph of circulating cardiac troponin levels (cTnl) in rats 48 hours after receiving ischemia reperfusion injury (45 minutes of ischemia) followed by intravenous administration of TY1, TY 1 scramble control, or vehicle.

[0061] Figure 4C is a non-limiting embodiment of a graph of infarct mass in rats 48 hours after receiving ischemia reperfusion injury (45 minutes of ischemia) followed by intravenous administration of TY1, TY1 scramble control, or vehicle.

[0062] Figure 4D is a non-limiting embodiment of images of infarcts from rats 48 hours after receiving ischemia reperfusion injury (45 minutes of ischemia) followed by intravenous administration of TY1, TY1 scramble control, or vehicle.

[0063] Figure 4E is a non-limiting embodiment of immunofluorescence images of left ventricle sections of MI animals stained with DAPI, CD68, and Trexl. Scale bar: 100 pm.

[0064] Figure 4F is a non-limiting embodiment of a graph of CD68 (macrophage marker) levels in immunofluorescence images of left ventricle sections of MI animals showing comparable macrophage infiltration.

[0065] Figure 4G is a non-limiting embodiment of a graph of Trexl levels in immunofluorescence images of left ventricle sections of MI animals showing tissue Trexl levels were similar in all groups.

[0066] Figure 4H is a non-limiting embodiment of a graph of Trexl levels in macrophages (CD68+ cells) in hearts from MI that had received TY 1 versus Scr or vehicle.

[0067] Figure 41 is a non-limiting embodiment of images of the DNA damage marker phosphor H2AX (pH2AX) in post-MI myocardium tissue in TY1 -exposed animals (scale bar: 1 mm) compared to vehicle and scramble groups.

[0068] Figure 4J is a non-limiting embodiment of a graph of the levels of the DNA damage marker, phosphor H2AX (pH2AX) in post-MI myocardium tissue in TYl-exposed animals compared to vehicle and scramble groups.

[0069] Figure 4K is a non-limiting embodiment of a bar graph showing that fortyeight hours post-injury, animals receiving TY1 had reduced infarct size.

[0070] Figure 4L is a non-limiting embodiment of a bar graph showing that fortyeight hours post-injury, animals receiving TY1 had lower circulating cardiac troponin (cTNI).

[0071] Figure 4M is a non-limiting embodiment of a graph measuring TREX1 protein levels by western blotting in LV tissue from animals receiving TY1 compared to scramble or control groups showing an increase in TREX1. Lower panel is an embodiment of a western blot.

[0072] Figure 4N is a non-limiting embodiment of immunofluorescent images of heart tissue showing TYl-exposed animals had lower levels of genotoxic stress as measured by the DNA damage marker phosphor H2AX (pH2AX, scale bar: 1 mm) compared to vehicle and scramble groups.

[0073] Figure 40 is a non-limiting embodiment of a bar graph showing that TYl- exposed animals had lower levels of genotoxic stress as measured by the DNA damage marker phosphor H2AX (pH2AX) compared to vehicle and scramble groups.

[0074] Figure 4P is a non-limiting embodiment of a schematic of a study design for long term follow-up of MI animals receiving a single dose of TY1, Scr, or vehicle.

[0075] Figure 4Q is a non-limiting embodiment of a bar graph of ejection fraction (EF) percentage showing rats receiving TY1 preserved ejection fraction and exhibited increased left ventricular function.

[0076] Figure 4R is a non-limiting embodiment of a bar graph of fractional shortening (FS) percentage showing rats receiving TY1 preserved fractional shortening and exhibited increased left ventricular function.

[0077] Figure 4S is a non-limiting embodiment of a bar graph of end systolic volume (LVID s) showing rats receiving TY 1 preserved end systolic volume and exhibited attenuated chamber remodeling.

[0078] Figure 4T is a non-limiting embodiment of a bar graph of diastolic volume (LVID d) showing rats receiving TY 1 preserved end systolic volume and exhibited attenuated chamber remodeling.

[0079] Figure 4U is a non-limiting embodiment of a images of heart sections showing rats receiving TY 1 had reduced myocardial scarring.

[0080] Figure 4V is a non-limiting embodiment of a bar graph of fibrosis percentage showing rats receiving TY 1 had reduced myocardial scarring.

[0081] Figure 4W is a non-limiting embodiment of schematic of a study design for TY 1 administration in a porcine model of acute myocardial infarction. Pigs received ischemia reperfusion injury (90 minutes of ischemia) followed by intravenous infusion of TY1, TY1 scrambled control

[0082] Figure 4X is a non-limiting embodiment of a graph showing forty-eight hours post-injury, pigs receiving TY1 had reduced smaller infarct size compared to both scramble and vehicle.

[0083] Figure 4Y is a non-limiting embodiment of images of infarcts in pigs showing forty-eight hours post-injury, pigs receiving TY1 had reduced smaller infarct size compared to both scramble and vehicle.

[0084] Figure 4Z is a non-limiting embodiment of a schematic of a study design for chronic intravenous (retro-orbital) exposure toxicity.

[0085] Figure 4AA is a non-limiting embodiment of a graph of animal weight profiles over weeks of TY 1 exposure of animals at four weeks.

[0086] Figure 4BB is a non-limiting embodiment of a bar graph of complete blood count (CBC) percentages of animals at four weeks.

[0087] Figure 4CC is a non-limiting embodiment of a bar graph of organ weight / body weight percentages of animals at four weeks.

[0088] Figure 4DD is a non-limiting embodiment of a table of blood chemistry of animals at four weeks.

[0089] Figure 4EE is a non-limiting embodiment of immunofluorescence images of the left ventricles of MI animals stained with DAPI, CD68 and TREX1 (scale bar: 100 pm).

[0090] Figure 4FF is a non-limiting embodiment of a graph measuring CD68 demonstrating comparable macrophage infiltration.

[0091] Figure 4GG is a non-limiting embodiment of a graph showing TREX1 was also enriched in the macrophages in TY1 -exposed animals compared to vehicle or scramble groups

[0092] Figure 5A is a non-limiting embodiment of a schematic of a study design for depleting macrophages from rats through daily intravenous administration of clodronate prior to induction of myocardial infarction. Animals were given TY1, scramble, or control 20 minutes post reperfusion.

[0093] Figure 5B is a non-limiting embodiment of images of infarcts from animals in which macrophages were depleted (clodronate) or not depleted (vehicle) prior to induction of myocardial infarction followed by administration of TY1 or Ser (control).

[0094] Figure 5C is a non-limiting embodiment of a graph of scar size (compare vehicle to scramble groups) in animals with and without functioning macrophages.

[0095] Figure 5D is a non-limiting embodiment of a schematic of a study design in which rats with MI received tail vein infusions of macrophages (3x 106cells / animal) transfected with TY 1 , scramble, vehicle, or a Trex 1 activating plasmid.

[0096] Figure 5E is a non-limiting embodiment of images of infarcts from animals with MI showing animals given macrophages overexpressing TY1 or Trexl had significant reductions in scar size compared to animals given macrophages transfected with scramble or vehicle.

[0097] Figure 5F is a non-limiting embodiment of a graph of infarct mass in animals given macrophages overexpressing TY1 or Trexl or given macrophages transfected with scramble or vehicle.

[0098] Figure 5G is a non-limiting embodiment of a schematic of a study design in which rats with MI received tail vein infusions of macrophages (3x 106cells / animal) transfected with TY1, scramble, vehicle, or a TREX1 activating plasmid.

[0099] Figure 5H is a non-limiting embodiment of infarcts from animals with MI showing animals given macrophages overexpressing TY1 or TREX1 had significantreductions in scar size compared to animals given macrophages transfected with scramble or vehicle.

[0100] Figure 51 is a non-limiting embodiment of a bar graph of infarct percentage showing animals given macrophages overexpressing TY1 or TREX1 had significant reductions in scar size compared to animals given macrophages transfected with scramble or vehicle.

[0101] Figure 6 is a non-limiting embodiment of a graphical abstract showing that based on naturally-occurring small Y RNAs, TY1 was developed, which is a new chemical entity with impact on innate immunity and DNA damage pathways in macrophages through its binding to TREX1, a key regulator of genotoxic stress. In vivo, TY1 attenuates cardiac damage induced by ischemia / reperfusion in myocardial infarction.

[0102] Figure 7A is a non-limiting embodiment of a schematic of a pharmocodynamic study for TY 1.

[0103] Figure 7B is a non-limiting embodiment of a graph of TREX1 levels in peripheral blood mononuclear cells isolated at different time points after animals were fed.

[0104] Figure 8 is a non-limiting embodiment of a schematic of a model of TY 1 mechanism of action.DETAILED DESCRIPTION

[0105] TY 1 , a synthetic ncRNA bioinspired by a naturally occurring human small Y RNAs abundant in EVs derived from cardiac stromal / progenitor cells with immunomodulatory properties, interacts with the messenger RNA (mRNA) for Trexl, a DNA damage repair enzyme and an exonuclease that rapidly degrades cytosolic DNA. By binding to the trexl 5’ UTR, TY 1 (but not a scrambled control RNA) can stabilize Trexl mRNA levels, which in turn can increase 1110 expression in macrophages. Intravenous TY1 is cardioprotective in rat and porcine models of myocardial infarction (MI), an effect that can be abrogated by prior depletion of macrophages and mimicked by adoptive transfer of macrophages exposed either to TY1 or Trexl. Thus, provided herein are non-limiting embodiments of agents with disease-modifying bioactivity provided by pharmacologic upregulation of TREX1 in macrophages.

[0106] Provided herein is a method of treating a condition associated with aging, atrophy, inflammation and / or fibrosis in a subject by enhancing expression of Trexl in cells(e.g., macrophages) of the subject. In some embodiments, Trexl is human Trexl . In some embodiments, Trexl refers to the gene associated with the Gene ID 11277. In some embodiments, enhanced expression of Trexl (e.g., through stabilizing Trexl mRNA or Trexl overexpression) in macrophages can attenuate genotoxic stress and confer cardioprotection. Terms

[0107] As used herein the term “nucleic acid” or “oligonucleotide” refers to multiple nucleotides (e.g., molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). The term includes polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymidine, inosine, 5 -methylcytosine, 2- aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. A nucleic acid can include any other suitable modifications. Thus, the term nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and / or sugars.

[0108] Polypeptide or nucleic acid molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference polynucleotides), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules). The term “identity” as known in the ail, refers to a relationship between the sequences of two or more polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related peptides can be readily calculated by known methods. “% identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acidsequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable methods and computer programs for the alignment can be used. It is understood that identity depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation. Generally, variants of a particular polynucleotide or polypeptide have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, et al (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”. Nucleic Acids Res. 25:3389-3402). Another popular local alignment technique is based on the Smith- Waterman algorithm (Smith, T. F. & Waterman, M. S. (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147:195-197.) A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S. B. & Wunsch. C. D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol. 48:443-453.). More recently a Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed that purportedly produces global alignment of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, specifically in the definition of “identity” below.

[0109] The term “identity” refers to the overall relatedness between polymeric molecules, for example, between polynucleotide molecules (e.g. DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in thefirst sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules arc identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm. For example, the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects. Smith. D. W., ed., Academic Press. New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleic acid sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).

[0110] The term “Watson-Crick base-pairing”, or “base-pairing” refers to the formation of hydrogen bonds between specific pairs of nucleotide bases (“complementary base pairs”). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C). One method of assessing the strength of bonding between two polynucleotides is by quantifying the percentage of bondsformed between the guanine and cytosine bases of the two polynucleotides (“GC content”). In some embodiments, the GC content of bonding between two nucleic acids of a multimcric molecule (e.g., a multimeric mRNA molecule) is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of bonding between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% to about 60%, or about 30% to about 60%. The formation of a nucleic acid duplex via bonding of complementary base pairs can also be referred to as “hybridization”. Generally, two nucleic acids sharing a region of complementarity are capable, under suitable conditions, of hybridizing (e.g., via nucleic acid base pairing) to form a duplex structure. A region of complementarity can vary in size. In some embodiments, a region of complementarity ranges in length from about 2 base pairs to about 100 base pairs. In some embodiments, a region of complementarity ranges in length from about 5 base pairs to about 75 base pairs. In some embodiments, a region of complementarity ranges in length from about 10 base pairs to about 50 base pairs. In some embodiments, a region of complementarity ranges in length from about 20 base pairs to about 30 base pairs.

[0111] The term “isolated” as used herein with reference to an isolated biomolecule, e.g., a nucleic acid, has the ordinary and customary meaning to one of ordinary skill in the art in view of the present disclosure. An isolated biomolecule, e.g., an isolated nucleic acid, is generally in a non-natural environment, or in an environment that the biomolecule would otherwise not have been without human intervention of the biomolecule or its environment. In some embodiments, an isolated biomolecule is not inside a cell or an organism.

[0112] The term “micelle,” as used herein with reference to casein micelles, has its customary and ordinary meaning as understood by one of ordinary skill in the art, in view of the present disclosure. Casein micelles are colloidal particles that can include aggregates of one or more casein phosphoproteins (e.g., one or more, two or more, three or more, or all four of alpha si casein, alpha s2 casein, beta casein, and kappa casein).

[0113] The term “subject,” as used herein refers to any vertebrate animal, including mammals and non-mammals. A subject can include primates, including humans, and nonprimate mammals, such as rodents, domestic animals or game animals. Non-primate mammals can include mouse, rat, hamster, rabbit, dog, fox, wolf, cat, horse, cow, pig, sheep, goat, camel,deer, buffalo, bison, etc. Non-mammals can include bird (e.g., chicken, ostrich, emu, pigeon), reptile (e.g., snake, lizard, turtle), amphibian (e.g., frog, salamander), fish (e.g., salmon, cod, pufferfish, tuna), etc. The terms, “individual,” “patient,” and “subject” are used interchangeably herein.

[0114] “Administering” as used herein can include any suitable routes of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, without limitation, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, cutaneous, injection or topical administration. Administration can be local or systemic.

[0115] As used herein, “treat” and “treatment” includes curing, improving, ameliorating, reducing the severity of, preventing, slowing the progression of, and / or delaying the appearance of a disease, condition and / or symptoms thereof.

[0116] A treatment can be considered “effective,” or “therapeutically effective” as used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 2%, 3%, 4%, 5%, 10%, or more, following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. exercise endurance. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (e.g., progression of the disease is halted). Treatment includes any treatment of a disease or condition in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease or condition, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease or condition, e.g., causing regression of symptoms. An effective amount for the treatment of a disease or condition means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease or condition. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response, (e.g. cardiac function). One skilled in the art can monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters.

[0117] The term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of a composition or an agent needed to alleviate at least one or more symptom of the disease or condition, and relates to a sufficient amount of therapeutic composition to provide the desired effect. The term “effective amount” or “therapeutically effective amount” can refer to an amount of a composition or therapeutic agent that is sufficient to provide a particular anti-inflammatory and / or cardioprotective effect when administered to a typical subject. An effective amount as used herein, in various contexts, can include an amount sufficient to delay the development of a symptom of the disease or condition, alter the course of a symptom disease or condition (for example but not limited to, slowing the progression of a symptom of the disease or condition), or reverse a symptom of the disease or condition. In some embodiments, the therapeutically effective amount is administered in one or more doses of the therapeutic agent. In some embodiments, the therapeutically effective amount is administered in a single administration, or over a period of time in a plurality of doses.

[0118] As used herein, the phrase “physiologically compatible” and “pharmaceutically acceptable” are employed interchangeably herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0119] Definitions of common terms in cell biology and molecular biology can be found in “The Merck Manual of Diagnosis and Therapy”, 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-91 1910-19-0); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN- 10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081- 569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.

[0120] The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unlessthe context clearly indicates otherwise. The abbreviation, “e.g.” is used herein to indicate a non- limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The term “about” as used herein to, for example, define the values and ranges of molecular weights means that the indicated values and / or range limits can vary within ±20%, e.g., within ±10%, including within ±5%. The use of “about” before a number includes the number itself. For example, “about 5” provides express support for “5.” Numbers provided in ranges include overlapping ranges and integers in between; for example a range of 1-4 and 5-7 includes for example, 1-7, 1-6, 1-5, 2-5, 2-7, 4-7, 1, 2, 3, 4, 5, 6 and 7.Methods

[0121] Provided herein arc methods of treating a subject in need thereof using the agent that increases levels of the Trexl gene product (also referred to herein as “treatment methods”). As used herein, “agent” denotes any molecule, compound, or construct that is suitable for use in the present methods. In some embodiments, an agent is a protein, nucleic acid, small molecule compound, organic compound, inorganic compound, lipid, sugar, polysaccharide, etc. In some embodiments, methods of the present disclosure include enhancing expression of Trexl in the subject (e.g., in macrophages of the subject) without using an isolated RNA (e.g., an isolated RNA with at least one chemically modified nucleotide) comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID No: 3). In some embodiments, the method includes enhancing expression of Trexl in the subject without using an isolated RNA that includes a nucleotide sequence that is, is at least, or is about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, or ranges including and / or spanning the aforementioned values, identical to SEQ ID NO: 3. In some embodiments, methods of the present include enhancing expression of Trexl in the subject (e.g., in macrophages of the subject) without using TYE “TY1” as used herein refers to a nucleic acid consisting of a nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid is RNA, wherein each of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence is a locked nucleic acid (LNA). In some embodiments, a method of treating a condition associated with aging, atrophy, inflammation and / or fibrosis includes administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount ofan agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID No: 3). In some embodiments, method includes enhancing expression of Trexl in the subject without using an isolated RNA that includes a nucleotide sequence that is, is at least, or is about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, or ranges including and / or spanning the aforementioned values, identical to SEQ ID NO: 3. As used herein “Trexl” and “Trexl gene product” are used interchangeably, unless indicated otherwise.

[0122] In any method herein, in some embodiments, the agent that enhances expression of a Trexl gene product excludes NT4 (SEQ ID NO:2) or EV-YF1 (SEQ ID NO: 1). In some embodiments, the agent is not EV-YF1-U16. In some embodiments, the agent is not extracellular vesicles (e.g., exosomes) derived from cardiosphere-derived cells (CDC-EV) that contains NT4 (SEQ ID NO:2) or EV-YF1 (SEQ ID NO:1). In some embodiments, the agent is not a Y RNA and fragments thereof that are contained in CDC-EV.

[0123] The agent can enhance Trexl expression using any suitable option. In some embodiments, enhanced expression of a Trexl gene product correlates with enhanced activity of the Trexl gene product (e.g., enhanced exonuclease activity of the TREX1 protein). In some embodiments, the agent increases the rate of Trexl transcription and / or RNA processing. In some embodiments, the agent increases the rate at which the Trexl gene product is transported to the cytoplasm and translated into protein. In some embodiments, the Trexl protein folds faster. In some embodiments, degradation of the Trexl protein is blocked. In some embodiments, modification of the Trexl protein prevents its degradation. In some embodiments, the agent induces changes in gene expression and / or epigenetic changes in macrophages that increase the Trexl gene product. In some embodiments, agent increases transcription of Trexl independently by at least about 1.5 fold, 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 30 fold, 50 fold, 100 fold, 200 fold, 300 fold, 400 fold 500 fold, 1,000 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that has not been contacted with the nucleic acid.

[0124] In some embodiments, the agent is an isolated nucleic acid (e.g., isolated RNA) that does not comprise a nucleotide sequence at least 95% identical toCGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the agent comprises a nucleic acid that anneals to a first sequence in a Trcxl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID No: 3) anneals. In some embodiments, the nucleic acid does not include a nucleotide sequence that is, is at least, or is about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, or ranges including and / or spanning the aforementioned values, identical to SEQ ID NO: 3. The nucleic acid of the present disclosure can be single stranded or double stranded (e.g., RNA / DNA hybrid). In some embodiments, the nucleic acid is single stranded. An isolated nucleic acid of the present disclosure in some embodiments includes one or more chemically-modified nucleotides, e.g., nucleotides with a modified backbone. In general, the chemical modification(s) is one that substantially preserves or enhances the therapeutic potency of the nucleic acid. Any suitable number of nucleotides of the nucleic acid can be chemically modified.

[0125] The isolated nucleic acid, in some embodiments, can include any suitable chemical modification. In some embodiments, the chemical modification is a backbone modification, e.g., modification of the sugar / phosphate backbone. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified nucleotide includes a LNA. In some embodiments, the chemical modification includes the introduction of a phosphorothioate group as linker between nucleotides. Suitable backbone modifications of the chemically-modified nucleotides include, without limitation, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, the chemical modification is a base modification.

[0126] he nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, without limitation, chemical synthesis, enzymatic production and / or biological production. In some embodiments, the nucleic acids are prepare using chemical synthesis. Any suitable option for chemical synthesis of nucleic acids can be used. Suitable options include, without limitation, phosphodiester, phosphotriester, phosphoramidite, phosphite-triester, and solid phase synthesis approaches. In some embodiments, preparing the nucleic acids includes in vitro transcription. In someembodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids arc prepared by chemically modifying an unmodified nucleic acid having a nucleotide sequence of interest.

[0127] In some embodiments, the agent increases expression of Trexl mRNA in a cell. In some embodiments, the agent stabilizes the Trexl mRNA, or increases the half-life of the Trexl mRNA, e.g., in a cell, for example, in a macrophage. In some embodiments, the agent increases the amount of Trexl mRNA expressed in a cell. As used herein, “amount of mRNA expressed” denotes the net amount (e.g., amount produced - amount degraded or removed) of mRNA expressed within a defined time period. In some embodiments, the agent increases the amount of Trexl mRNA expressed in a cell without altering or substantially altering the stability of half-life of the Trexl mRNA. In some embodiments, the agent increases transcription of Trexl mRNA in the cell. In some embodiments, Trexl mRNA is increased in the cell by, by at least, or by about 1.1 , 1.2, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60 70, 80, 90, 100, 150, 200, 300, 400, 500, 750, 1,000 fold or more, compared to a suitable reference point (e.g., before administering the agent to the subject, mRNA level in a subject treated with a control, etc.), or optionally Trexl mRNA is increased by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-1,000 fold, 1.5-100 fold, 2-20 fold, 5-15 fold, 1.2-500 fold, etc.) compared to a suitable reference point.

[0128] In some embodiments, Trexl mRNA includes the following nucleotide sequence (5’ UTR underlined) (SEQ ID NO: 5):1 gteattgett tgggctgggg ccatgggaag aaaccattgt gtggcaggga aggaggtggc61 tcttggccca ggcctaaacc aggaaagcct gggaaactgg gacccacagg tgggcatgaa121 agggccgcag caggggctcc cagcagtgtg taagaccggg agctggtctg gcaccactgc181 cctggtcctt ccagctgcct gtcactggta tgatggcccc ggtgcattgt gccaccagca241 ggccacagct gtggatcttg gaaggcctct ggggtccccc gggagcaggg gagtgggtgt301 gggggggaac ggatggtggt gagagggaca gaccaggcag gccctgcccc cggggcccat361 gcagaccctc atctttttcg acatggaggc cactggcttg cccttctccc agcccaaggt421 cacggagctg tgcctgctgg ctgtccacag atgtgccctg gagagccccc ccacctctca481 ggggccacct cccacagttc ctccaccacc gcgtgtggta gacaagctct ccctgtgtgt541 ggctccgggg aaggeetgea gccctgcagc cagcgagatc acaggtctga gcacagctgt601 gctggcagcg catgggcgtc aatgttttga tgacaacctg gccaacctgc tcctagcctt661 cctgcggcgc cagccacagc cctggtgcct ggtggcacac aatggtgacc getaegaett721 ccccctgctc caagcagagc tggetatget gggcctcacc agtgctctgg atggtgeett781 ctgtgtggat agcatcactg egetgaagge cctggagcga gcaagcagcc cctcagaaca841 cggcccaagg aagagetata gcctaggcag catctacact cgcctgtatg ggcagtcccc901 tccagactcg cacacggctg agggtgatgt cctggccctg ctcagcatct gtcagtggag961 accacaggcc etgetgeggt gggtggatgc tcacgccagg cctttcggca ccatcaggcc1021 catgtatggg gtcacagcct ctgctaggac caagccaaga ccatctgctg tcacaaccac1081 tgcacacctg gccacaacca ggaacactag tcccagcctt ggagagagca ggggtaccaa1141 ggatcttcct ccagtgaagg accctggagc cctatccagg gaggggctgc tggccccact1201 gggtctgctg gccatcctga ccttggcagt agccacactg tatggactat ccctggccac1261 acctggggag taggccaaga aggaaaatct gacgaataaa gacccccgct gccccata

[0129] In some embodiments, Trexl mRNA includes the following nucleotide sequence (SEQ ID NO: 6) (5’ UTR underlined):1 acttcccgcc actgctgcca gcgagagccg cgggagagtg tgcagccgag tcactactgc61 ctgcctgcct gcctgctacg gctcagcagc aggtacgtac ccaaccatgg gctcgcaggc121 cctgcccccg gggcccatgc agaccctcat ctttttcgac atggaggcca ctggcttgcc181 cttctcccag cccaaggtca cggagctgtg cctgctggct gtccacagat gtgccctgga241 gagccccccc acctctcagg ggccacctcc cacagttcct ccaccaccgc gtgtggtaga301 caagclcLcc cLg Lg Lg Lgg cLccggggaa ggccLgcagc cc Lgcagcca gcgagaLcac361 aggtctgagc acagctgtgc tggcagcgca tgggcgtcaa tgttttgatg acaacctggc421 caacctgctc ctagccttcc tgcggcgcca gccacagccc tggtgcctgg tggcacacaa481 tggtgaccgc tacgacttcc ccctgctcca agcagagctg gctatgctgg gcctcaccag541 tgctctggat ggtgccttct gtgtggatag catcactgcg ctgaaggccc tggagcgagc601 aagcagcccc tcagaacacg gcccaaggaa gagctatagc ctaggcagca tctacactcg661 cctgtatggg cagtcccctc cagactcgca cacggctgag ggtgatgtcc tggccctgct721 cagcatctgt cagtggagac cacaggccct gctgcggtgg gtggatgctc acgccaggcc781 tttcggcacc atcaggccca tgtatggggt cacagcctct gctaggacca agccaagacc841 atctgctgtc acaaccactg cacacctggc cacaaccagg aacactagtc ccagccttgg901 agagagcagg ggtaccaagg atcttcctcc agtgaaggac cctggagccc tatccaggga961 ggggctgctg gccccactgg gtctgctggc catcctgacc ttggcagtag ccacactgta1021 tggactatcc ctggccacac ctggggagta ggccaagaag gaaaatctga cgaataaaga 1081 cccccgctgc cccata

[0130] In some embodiments, the agent comprises an isolated nucleic acid that encodes the Trexl gene product (e.g., DNA encoding Trexl mRNA, or RNA encoding TREX1 protein, or DNA encoding TREX1 protein via mRNA). In some embodiments, the nucleic acid includes a DNA sequence encoding Trexl mRNA (e.g., SEQ ID NO:5 or 6). In some embodiments, the isolated nucleic acid encodes a Tre l gene product that includes a truncated form of TREX1 protein having exonuclease activity (or a catalytically active truncation thereof). In some embodiments, the catalytically active truncation of TREX1 protein has an exonuclease activity that is, is about, or is at least 50, 60, 7075, 80, 85, 90, 95, 96, 97, 98, 99, or 100% of the exonuclease activity of the native TREX1 protein (e.g., untruncated TREX1 protein). In some embodiments, the Trexl gene product is or includes TREX1 protein, isoform a associated with the UNIPROT ID Q9NSU2-1 (SEQ ID NO: 7), or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity thereto and having exonuclease activity. In some embodiments, the Trexl gene product is or includes TREX1 protein, isoform b associated with the UNIPROT ID Q9NSU2-3 (SEQ ID NO: 8) , or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity theretoand having exonuclease activity. In some embodiments, the Trexl gene product is or includes TREX1 protein, isoform c associated with the UNIPROT ID Q9NSU2-2 (SEQ ID NO: 9) , or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity thereto and having exonuclease activity. In some embodiments, the Trexl protein gene product is includes comprises a truncated form of a TREX1 protein, where the truncated form includes the exonuclease domain of TREX1. In some embodiments, the truncated form is a C- terminal truncation of a native TREX1 protein that retains at least the catalytic domain (e.g., as set forth in any one of SEQ ID NOs:7-9). In some embodiments, the Trexl gene product is or includes the truncated form of a native TREX1 protein, isoform a as set forth in SEQ ID NO: 10, or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity thereto and having exonuclease activity. In some embodiments, the Trexl gene product is or includes the truncated form of a native TREX1 protein, isoform b as set forth in SEQ ID NO: 11, or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity thereto and having exonuclease activity. In some embodiments, the Trexl gene product is or includes the truncated form of a native TREX1 protein, isoform c as set forth in (SEQ ID NO: 12), or a variant thereof having 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more sequence identity thereto and having exonuclease activity. In some embodiments, the TREX1 protein is a homodimer (e.g., of the same isoform). In some embodiments, the TREX1 protein is a heterodimer (e.g., of different isoforms).

[0131] In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that localizes to the cytoplasm. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that localizes to the endoplasmic reticulum. In some embodiments, the Trexl protein localizes to the perinuclear region. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that localizes to the nucleus. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that localizes to the nucleus and the cytoplasm. In some embodiments, the Trexl gene product includes a Trexl catalytic domain that is fused to a nuclear localization signal. In some embodiments, the Trexl gene product includes a Trexl catalytic domain that is fused to a mitochondrial localization signal. In some embodiments,Trexl gene product includes a the Trexl catalytic domain that is fused to a endoplasmic reticulum localization signal.

[0132] In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades double- stranded DNA in the nucleus and / or the cytoplasm. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades single- stranded DNA in the nucleus and / or the cytoplasm. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades single- stranded RNA in the nucleus and / or the cytoplasm. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades single- stranded RNA, singlestranded DNA, double- stranded DNA, and DNA / RNA hybrids in the nucleus and / or the cytoplasm. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades mitochondrial DNA. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades viral single stranded RNA. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades viral single stranded DNA. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades viral double strand. In some embodiments, the Trexl gene product includes a TREX1 protein (or a catalytically active truncation thereof) that degrades viral DNA / RNA hybrids.

[0133] In some embodiments, the nucleic acid comprises a vector, e.g., a viral vector or a plasmid. Any suitable vector (e.g., viral vector or plasmid) can be used. In some embodiments, the vector is a lentiviral vector. The nucleic acid can include any suitable regulatory elements (e.g., promoter, 5’ UTR, 3’ UTR, IRES, etc.) to control expression of the sequence encoding the Trexl gene product from the nucleic acid. In some embodiments, the nucleic acid includes a promoter operably connected to the nucleotide sequence encoding the Trexl gene product (e.g., Trexl mRNA). In some embodiments, the nucleic acid is configured to express the Trexl gene product in a macrophage (e.g., a human macrophage). In some embodiments, the nucleic acid includes a CMV promoter operably connected to the nucleotide sequence encoding the Trexl gene product (e.g., Trexl mRNA). In some embodiments, the nucleic acid includes a macrophage- specific promoter operably connected to the nucleotidesequence encoding the Trexl gene product (e.g., Trexl mRNA). Any suitable macrophagespecific promoter can be used. In some embodiments, the nucleic acid includes a macrophagespecific promoter selected from a Csflr promoter, LysM promoter, CD68 promoter, or a CX3CRI promoter. In some embodiments, the nucleic acid is a Trexl activating plasmid e.g., a plasmid comprising a CMV promoter operably connected to a nucleic acid encoding a Trexl gene product.

[0134] In some embodiments, the nucleic acid is comprised in a macrophage, e.g., a human macrophage. In some embodiments, the nucleic acid is or is pail of an extrachromosomal DNA (e.g., plasmid) in the macrophage. In some embodiments, the nucleic acid is integrated into the genome of the macrophage. In some embodiments, the nucleic acid is constitutively expressed. In some embodiments, the nucleic acid is expressed from an inducible promoter.

[0135] In some embodiments, the agent is identified using a screening method for identifying agents that upregulate Trexl expression, protein levels and / or activity, as described herein. In some embodiments, the agent is a small molecule. In some embodiments, the agent is a biologic. In some embodiments, the agent is a nucleic acid (e.g., any of the nucleic acids described herein). In some embodiments, the agent directly upregulates Trexl expression, protein levels and / or activity. In some embodiments, the agent indirectly upregulates Trexl expression, protein levels and / or activity.

[0136] In some embodiments, the agent increases expression of Trexl protein in the cell by, by at least, or by about 1.1, 1.2, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 6070, 80, 90, 100, 150, 200, 300, 400, 500, 750, 1,000 fold or more, compared to a suitable reference point (e.g., before administering the agent to the subject, protein level in a subject treated with a control, etc.), or optionally Trexl protein is increased by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-1,000 fold, 1.5-100 fold, 2-20 fold, 5-15 fold, 1.2- 500 fold, etc.) compared to a suitable reference point.

[0137] In some embodiments, the agent increases activity (e.g., exonuclease activity) of a TREX1 protein in the cell by, by at least, or by about 1.1, 1.2, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 6070, 80, 90, 100, 150, 200, 300, 400, 500, 750, 1,000 fold or more,compared to a suitable reference point (e.g., before administering the agent to the subject, activity in a subject treated with a control, etc.), or optionally TREX1 protein activity (e.g., exonuclease activity) is increased by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-1,000 fold, 1.5-100 fold, 2-20 fold, 5-15 fold, 1.2-500 fold, etc.) compared to a suitable reference point.

[0138] In some embodiments, the method includes administering to the subject a population of the macrophages, wherein the effective amount of the agent that enhances expression of a Trexl gene product is comprised in the population of the macrophages. In some embodiments, the macrophages are treated ex vivo with an agent as described herein to enhance expression of a Trexl gene product in the macrophages before administering the treated macrophages to the subject. In some embodiments, the macrophages are genetically modified ex vivo to enhance expression of a Trexl gene product. In some embodiments, the macrophages administered to the subject are autologous macrophages. In some embodiments, the macrophages administered to the subject are allogeneic macrophages.

[0139] Any suitable amount of the macrophages having enhanced expression of Trexl as described herein (e.g., macrophages genetically modified with a Trexl expressing plasmid) can be administered to the subject to achieve the desired therapeutic effect. In some embodiments, the number of macrophages having enhanced expression of Trexl administered to the subject is, is about, or is at least IxlO5, 2xl05, 5xl05, IxlO6, 2xl06, 5xl06, IxlO7, 2xl07, 5xl07, IxlO8, 2xl08, 5xl08, IxlO9, 2xl09, 5xl09, IxlO10, or more cells, or optionally a number of cells in a range defined by any two of the preceding values (e.g., IxlO5- IxlO10cells, IxlO6- IxlO9cells, 1X107- 1X109cells, 2xl06-5xl09cells, 5xl08-lxl010cells, etc.).

[0140] In some embodiments, the nucleic acid comprises a stabilized Trexl mRNA (e.g., a Trexl mRNA that includes one or more chemically-modified nucleotides that stabilizes the mRNA). In some embodiments, the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2’ -methoxyethyl, 2’-O-alkyl, 2’-O-allyl, 2’-C-allyl, 2’-fluoro, 2’-deoxy, 2’-hydroxyl, and combinations thereof. In some embodiments, the modifications are lipid or cholesterol modifications.

[0141] Provided herein is a method of treating a condition associated with inflammation and / or fibrosis includes administering to a subject in need of treating a condition associated with inflammation and / or fibrosis an effective amount of an agent that attenuatesDNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0142] Also provided is a method for treating diseases related to aging, tissue senescence, or atrophy. The method can include administering to a subject in need of treating a disease related to aging, tissue senescence, or atrophy an effective amount of an agent that enhances expression of a Trexl gene product. In some embodiments, the agent for treating aging, tissue senescence, or atrophy in the present methods is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0143] In some embodiments, a method of the present disclosure includes administering the effective amount of the agent intravenously, intramuscularly, intracardially, or orally. The agent or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable option for administration include, without limitation, intravenous, intramuscular, subcutaneous, intra-arterial, intraperitoneal, or oral administration. In some embodiments, the agent or composition is administered intravenously. In some embodiments, the agent or composition is administered by infusion.

[0144] Conditions that may be treated by the treatment methods herein include, without limitation, heart conditions and inflammatory conditions. In some embodiments, the conditions include, without limitation, muscular disorders, myocardial infarction, cardiac disorders, myocardial alterations, muscular dystrophy, fibrotic disease, inflammatory disease, viral infection, sepsis or wound healing. In some embodiments, conditions treated by the treatment methods include, without limitation, conditions associated with inflammation and / or fibrosis. In some embodiments, a subject treated by administering the agent of the present disclosure, according to the treatment methods herein, are in need of treatment for conditions associated with inflammation and / or fibrosis. The conditions associated with inflammation and / or fibrosis can include, without limitation, inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the conditions associated with inflammation and / or fibrosis includes aging. In some embodiments, one or more symptoms of inflammation and / or fibrosis associated with aging are treated or reversed by administering the agent of thepresent disclosure according to the treatment methods herein. In some embodiment, a subject suffering from accelerated aging (c.g., progeria) is treated by administering the agent of the present disclosure according to the treatment methods herein. In some embodiments, the conditions treated by the present treatment methods are a symptom and / or sequelae of an infection. In some embodiments, the infection is a viral infection, e.g., a respiratory virus infection, such as COVID- 19, infections due to other coronaviruses, or other viral pathogens (e.g., flu, H1N1, Hepatitis C, HIV, West Nile Virus, Zika etc.).

[0145] In some embodiments, a treatment method includes a method of treating a muscle disorder (or muscle condition) or symptom thereof, the method including administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the agent (or the composition containing the agent) of the present disclosure. The muscle disorder can be, without limitation, a skeletal muscle disorder or a cardiac muscle disorder. In some embodiments, the muscle disorder includes muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the subject has muscular dystrophy, or is at risk of developing muscular dystrophy. In some embodiments, the subject is genetically predisposed to developing muscular dystrophy, e.g., Duchenne muscular dystrophy. In some embodiments, the subject has one or more mutations in a dystrophin gene that predisposes the subject to developing muscular dystrophy, e.g., Duchenne muscular dystrophy.

[0146] In some embodiments, a treatment method includes a method of treating a skin condition, e.g., an inflammation and / or fibrosis of the skin (such as, but not limited to, scleroderma). In some embodiments, the method includes administering to a subject in need of treating an inflammation and / or fibrosis of the skin a therapeutically effective amount of the agent (or the composition containing the agent) of the present disclosure. In some embodiments, the inflammation and / or fibrosis of the skin is scleroderma.

[0147] In some embodiments, a treatment method includes a method of treating a heart condition or symptom thereof, the method including administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of the agent (or the composition containing the agent) of the present disclosure. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject, e.g., a non-human mammal.

[0148] A variety of heart conditions may be treated by the present method. In some embodiments, the heart condition includes a symptom and / or sequelae of heart failure or myocardial infarction. In some embodiments, the heart condition includes hypertrophic cardiomyopathy. In some embodiments, the heart condition includes heart failure with preserved ejection fraction (HFpEF).

[0149] In some embodiments, the subject is at risk of developing the heart condition. In some embodiments, the subject is at risk of developing the heart condition based on one or more of the subject’s family history, genetic predisposition, life style, and medical history. In some embodiments, the subject has a mutation in cardiac troponin I that predisposes the subject to developing hypertrophic cardiomyopathy (HCM). In some embodiments, the subject has one or more comorbidities for the heart condition. In some embodiments, the one or more comorbidities includes obesity and hypertension. In some embodiments, the subject has, or is diagnosed with, the heart condition.

[0150] In some embodiments, the subject exhibits one or more of: hypertension, elevated E / e’ ratio, cardiac hypertrophy, myocardial fibrosis, obesity, wasting, reduced endurance, and elevated systemic inflammatory markers. In some embodiment, the subject has hypertension, and administering the therapeutically effective amount of the agent (or composition thereof) reduces the subject’s blood pressure. In some embodiments, a subject having hypertension has a resting blood pressure of over 130 / 90 mmHg. In some embodiments, a subject having hypertension has a resting blood pressure of over 140 / 90 mmHg. In some embodiment, administering the therapeutically effective amount of the agent (or composition thereof) reduces the subject’s systolic blood pressure or diastolic blood pressure. In some embodiment, the subject’s blood pressure (systolic or diastolic blood pressure) is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’s blood pressure (systolic or diastolic blood pressure) is reduced at least to a level that is deemed no longer to be hypertensive after administering the therapeutically effective amount of the agent (or composition thereof).

[0151] In some embodiment, the subject has an elevated E / e’ ratio, and administering the therapeutically effective amount of the agent (or composition thereof)reduces the E / e’ ratio. In some embodiment, the subject’ s E / e’ ratio is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’s E / e’ ratio is reduced at least to a level that is deemed no longer to be clinically relevant after administering the therapeutically effective amount of the agent (or composition thereof).

[0152] In some embodiment, the subject has cardiac hypertrophy, and administering the therapeutically effective amount of the agent (or composition thereof) reduces cardiac hypertrophy. Cardiac hypertrophy can be measured using any suitable option. In some embodiments, cardiac hypertrophy is measured using echocardiography. In some embodiments, a subject having cardiac hypertrophy has an increased diastolic interventricular septal wall diameter (IVSd) and / or left ventricular posterior wall diameter (LVPWd), as measured by echocardiography, and administering the therapeutically effective amount of the agent (or composition thereof) reduces the IVSd and / or LVPWd. In some embodiment, the subject’s IVSd or LVPWd is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’ s IVSd or LVPWd is reduced at least to a level that is deemed no longer to be hypertrophic after administering the therapeutically effective amount of the agent (or composition thereof)..

[0153] In some embodiment, the subject has myocardial fibrosis, and administering the therapeutically effective amount of the agent (or composition thereof) reduces cardiac fibrosis. “Fibrosis” as used herein can include any remodeling (e.g., pathological remodeling) of tissue (e.g., the myocardium), such as, but not limited to, deposition of fibrotic and / or fatty tissue, replacement of muscle tissue with fibrotic and / or fatty tissue, etc. Cardiac fibrosis is monitored using any suitable means, such as biopsy, ultrasonography or MRI. In some embodiments, administering the therapeutically effective amount of the agent (or composition thereof) eliminates or retards the development of myocardial fibrosis.

[0154] In some embodiments, the subject has inflammation and / or fibrosis associated with an autoimmune condition. In some embodiments, the subject has scleroderma or systemic sclerosis.

[0155] In some embodiment, the subject exhibits wasting or weight loss, and administering the therapeutically effective amount of the agent (or composition thereof) retards or prevents the wasting. In some embodiment, the subject exhibits body weight loss of at most about 20%, 15%, 10%, 5%, 3% or less, or a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’s body weight recovers to, or is maintained at substantially the pre-treatment level after administering the therapeutically effective amount of the agent (or composition thereof).

[0156] In some embodiment, the subject exhibits reduced endurance, e.g., exercise endurance, and administering the therapeutically effective amount of the agent (or composition thereof) retards or prevents the decline in endurance. In some embodiment, the subject exhibits a decline in endurance of at most about 20%, 15%, 10%, 5%, 3% or less, or a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’s exercise endurance recovers to, or is maintained at substantially the pre-treatment level after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject exhibits an improvement in endurance of at least about 5%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 50% or more, or a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiments, the improvement in endurance after administering the therapeutically effective amount of the agent (or composition thereof) is sustained over the duration of treatment. In some embodiments, the improvement in endurance after administering the therapeutically effective amount of the agent (or composition thereof) is sustained across multiple doses of administration.

[0157] In some embodiments, the subject exhibits elevated levels of systemic inflammatory markers, e.g., in the peripheral blood. In some embodiments, the systemic inflammatory marker includes one or more of IL-6 and brain natriuretic peptide (BNP). In some embodiments, the level of the systemic inflammatory marker is reduced by at least about5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject’s systemic inflammatory marker is reduced at least to a level that is deemed no longer to be elevated after administering the therapeutically effective amount of the agent (or composition thereof).

[0158] In some embodiments, where the subject is obese, the therapeutic effect of administering the agent is independent of the subject’s obesity. In some embodiments, administering the agent (or composition thereof) does not affect the subject’s weight.

[0159] In some embodiments, the subject exhibits reduced skeletal muscle function, e.g., the amount of force or torque exerted by a skeletal muscle group. In some embodiments, the subject exhibits reduced skeletal muscle function and administering the therapeutically effective amount of the agent (or composition thereof) retards the development of reduced skeletal muscle function, prevents deterioration of skeletal muscle function, or enhances skeletal muscle function. In some embodiment, the subject’s skeletal muscle function recovers to, or is maintained at substantially the pre-treatment level after administering the therapeutically effective amount of the agent (or composition thereof). In some embodiment, the subject exhibits an improvement in skeletal muscle function of at least about 5%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 50% or more, or a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the agent (or composition thereof).

[0160] In some embodiments, any of the therapeutic effects of administering the therapeutically effective amount of the agent (or composition thereof) herein is sustained over the duration of treatment, is sustained across multiple doses of administration is sustained across multiple doses of administration. In some embodiments, any of the therapeutic effects of administering the therapeutically effective amount of the agent (or composition thereof) herein is not transient over the duration of treatment.

[0161] In some embodiments, a treatment method of the present disclosure treats any one or more of a variety of inflammatory conditions. In some embodiments, the inflammatory condition is a chronic condition. In some embodiments, the inflammatory condition is one that is responsive to the anti-inflammatory effect of IL- 10. In someembodiments, the inflammatory condition includes an autoimmune disease, graft-versus-host disease (GVHD) or an immune response to an organ transplant. In some embodiments, the inflammatory condition includes viral infection, sepsis, arthritis (rheumatoid arthritis juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also referred to as insulin-dependent diabetes mellitus (IDDM)). In some embodiments, the inflammatory condition includes Behget's disease, polymyositis / dermatomyositis, autoimmune cytopenias, autoimmune myocarditis, primary liver cirrhosis, Goodpasture's syndrome, autoimmune meningitis, Sjogren's syndrome, systemic lupus erythematosus, Addison's disease, alopecia greata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroma, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia and ulcerative colitis. In some embodiments, the inflammation is related to a bone marrow transplantation. In some embodiments, the inflammation is related to allograft rejection following tissue transplantation. In some embodiments, the autoimmune disease is a cardiac autoimmune disease, e.g., autoimmune myocarditis. In some embodiments, the autoimmune disease is scleroderma or systemic sclerosis.

[0162] In some embodiments, a treatment method of the present disclosure treats symptoms and / or sequelae of any one or more of a variety of infectious diseases. In some embodiments, a heart condition or inflammatory condition treated by the agent of the present disclosure includes a symptom and / or sequelae of an infectious disease. In some embodiments, the infectious disease is associated with myocardial injury. In some embodiments, the heart condition includes acute myocarditis associated with the infectious disease. In some embodiment, the inflammatory condition includes a cytokine storm, or hyperinflammation, associate with the infectious disease. In some embodiments, the inflammatory condition includes acute lung injury or acute respiratory distress syndrome (ARDS).

[0163] In some embodiments, the infectious disease is an infection by, without limitation, one or more of the following pathogens: viruses (including but not limited to coronavirus, human immunodeficiency virus, herpes simplex virus, papilloma virus,parainfluenza virus, influenza virus, hepatitis virus, Coxsackie Virus, herpes zoster virus, measles virus, mumps virus, rubella, rabies vims, hemorrhagic viral fevers, H1N1, and the like), prions, parasites, fungi, mold, yeast and bacteria (both gram-positive and gram-negative). In some embodiments, pathogens include, without limitation, Candida albicans, Aspergillus niger, Escherichia coli (E. coll), Pseudomonas aeruginosa (P. aeruginosa), and Staphylococcus aureus (S. aureus), Group A streptococci, S. pneumoniae, Mycobacterium tuberculosis, Campylobacter jejuni, Salmonella, Shigella, and a variety of drug resistant bacteria.

[0164] In some embodiments, the inflammation is subsequent to or concurrent with an infection by a virus, e.g., a DNA or RNA vims. In some embodiments, the vims is an RNA vims, e.g., a single or double- stranded virus. In some embodiments, the RNA virus is a positive sense, single- stranded RNA virus. In some embodiments, the vims belongs to the Nidovirales order. In some embodiments, the virus belongs to the Coronaviridae family. In some embodiments, the vims belongs to the alphacoronavirus, betacoronavims, gammacoronavims or deltacoronavims genus. In some embodiments, the alphacoronavirus is, without limitation, human coronavirus 229E, human coronavirus NL63 or transmissible gastroenteritis virus (TGEV). In some embodiments, the betacoronavirus is, without limitation, Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), SARS-CoV-2 (COVID-19), Middle Eastern Respiratory Syndrome Coronavirus (MERS-CoV), human coronavirus HKU1, or human coronavirus OC43. In some embodiments, the gammacoronavims is infectious bronchitis virus (IBV).

[0165] In some embodiments, the agent can be administered to the subject at any suitable amount to achieve the desired therapeutic effects. In some embodiments, the therapeutically effective amount of the agent includes an amount in the range of 0.01 pg-100 mg e.g., 0.01 pg-0.1 pg, 0.1 pg-1 pg, 1 pg-10 pg, 10 pg-100 pg, 100 pg-1 mg, 1 mg-10 mg, 10 mg-lOOmg. In some embodiments, the therapeutically effective amount of the agent includes an amount in the range of 0.001 pg / g-100 pg / g of body weight, e.g., 0.001 pg / g-0.01 pg / g, 0.01 pg / g-0.1 pg / g, 0.1 pg / g-1 pg / g, 1 pg / g-10 pg / g, 10 pg / g-100 pg / g.

[0166] The agent or composition can be administered to the subject at any suitable dosing schedule. In some embodiments, the therapeutically effective amount of the agent or the composition is administered to the subject no more frequently than twice a week, once aweek, once every two weeks, once every month, once every two months, once every three months, once every four months or longer, or at a frequency in a range defined by any two of the preceding values. In some embodiments, the agent is administered to the subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times. In some embodiments, the agent is administered to the subject at regular intervals.

[0167] Also provided herein is a method of promoting anti-inflammatory activity of macrophages (also referred to herein as macrophage- modulating methods). The method generally includes contacting the agent or the composition of the present disclosure with a population of macrophages. In some embodiments, the agent induces changes in gene expression and / or epigenetic changes in macrophages that are exposed to the agent. In some embodiments, contacting the agent (or composition) increases expression of one or more of Trexl, IL-10, IRF-7, NOS-2, and ARG-1. In some embodiments, contacting the agent (or composition) increases transcription or translation of one or more of Trexl, IL-10, IRF-7, NOS-2, and ARG-1. In some embodiments, contacting the agent (e.g., nucleic acid) (or composition) increases transcription of one or more of Trexl, IL- 10, IRF-7, NOS-2, and ARG- 1 each independently by at least about 1.5 fold, 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 30 fold, 50 fold, 100 fold, 200 fold, 300 fold, 400 fold 500 fold, 1,000 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of a Trexl gene product.

[0168] In some embodiments, contacting the agent (or composition) increases secretion of interleukin 10 (IL- 10) in the macrophages. In some embodiments, contacting the agent (or composition) increases secretion of IL- 10 from the macrophages by at least about 1.2 fold, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 50 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of a Trexl gene product.

[0169] The population of macrophages can be contacted with the agent or composition for any suitable amount of time. In some embodiments, the contacting is for 24 hours or more, 36 hours or more, 48 hours or more, 60 hours or more, 72 hours or more, or an amount of time in a range between any two of the preceding values.

[0170] In some embodiments, the contacting is done in vitro. In some embodiments, the contacting is done in vivo. In some embodiments, the contacting includes administering to a subject in need of treating an inflammation an effective amount of the agent or the composition. In some embodiments, the macrophage is a human macrophage. In some embodiments, the subject is a human subject. In some embodiments, the subject is a nonhuman subject, e.g., a non-human mammal.

[0171] Any suitable amount of agent can be contacted with the population of macrophages to promote the anti-inflammatory activity of the macrophages. In some embodiments, the effective amount depends on whether the contacting is done in vivo or in vitro.

[0172] Also provided arc screening methods for identifying an agent that enhances expression of a Trexl gene product. Provided herein is an in vitro method of identifying an agent that enhances expression of a Trexl gene product in a target cell, comprising contacting a candidate agent with a target cell; and measuring an expression level of a Trexl gene product in the target cell after the contacting, wherein the candidate agent is identified as an agent that enhances expression of a Trexl gene product when the measured expression level of the Trexl gene product is elevated compared to a suitable reference value. In some embodiments, the suitable reference value is an expression level of the Trexl gene product before contacting the candidate agent with the target cell. In some embodiments, the suitable reference value is a control level of expression of the Trexl gene product (e.g., in target cells that were contacted with vehicle). In some embodiments, the target cell is genetically modified to express TREX1 protein labeled with a detectable marker (e.g., fused to a fluorescent marker such as GFP). In some embodiments, expression level of the Trexl gene product is measured by detecting the detectable marker in the target cell (e.g., GFP fluorescence). Any suitable detectable marker can be used in the screening methods. Any suitable target cell can be used in the screening methods, for example and without limitation, HEK293 or CHO cells. In some embodiments, the method includes screening a library of candidate agents (e.g., a library of small molecules, nucleic acids, biologies, etc.) with the screening method to identify one or more agents that enhances expression of a Trexl gene product in a target cell. Also provided is an in vitro method of identifying an agent that enhances expression of a Trexl gene product, comprising contacting a candidate agent with a Trexl gene product (e.g., Trexl mRNA or protein); andmeasuring a level of the Trex 1 gene product after the contacting, wherein the candidate agent is identified as an agent that enhances expression of a Trcxl gene product when the measured level and / or measured activity of the Trexl gene product is elevated compared to a suitable reference value.Compositions

[0173] Also provided is a composition for treating a condition associated with aging, atrophy, inflammation and / or fibrosis, the composition including: a nucleic acid that anneals to a first sequence in a Tre l mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3) anneals, wherein the nucleic acid enhances expression of a Trexl gene product; a nucleic acid that encodes the Trexl gene product, wherein the nucleic acid is configured to overexpress the Trexl gene product; a population of macrophages having elevated anti-inflammatory activity, wherein macrophages of the population have enhanced expression of the Trexl gene product and do not comprise an exogenous RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), or a combination thereof. In some embodiments, the composition comprises a pharmaceutically acceptable carrier.

[0174] In some embodiments, the macrophages of the population are genetically modified to overexpress the Trexl gene product. In some embodiments, genome editing is used to genetically modify the macrophages to overexpress Trexl gene product, for example, by using a CRISPR system. In some embodiments, a viral vector is used to integrate Trexl into the macrophage genome. In some embodiments, the macrophages include a plasmid configured to overexpress Trexl.

[0175] In some embodiments, the macrophages of the population are genetically modified to comprise a nucleic acid comprising a promoter operably connected to a nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Tre l gene product in the macrophages. In some embodiments, the promoter is macrophage specific, for example, the CD68 gene promoter. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector, or a plasmid.

[0176] In some embodiments, the composition is used for the treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof.

[0177] In some embodiments, the use of the composition is for the preparation of a medicament for treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof.

[0178] Also provided herein are compositions that include pharmaceutically acceptable excipient. Some non-limiting examples of materials which can serve as pharmaceutically-acceptable excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations.

[0179] In some embodiments, the composition includes a transfection reagent, e.g., to promote delivery of the agent (e.g., nucleic acid) to a target cellular target (in vitro or in vivo). Any suitable transfection reagent can be included in the composition. Suitable transfection reagents include, without limitation, a liposome, extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the transfection reagent includes a lipid (e.g., a liposome-forming lipid), or a PEGylated lipid. In some embodiments, the lipid is a cationic lipid, as provided herein. In some embodiments, the transfection reagent includes DharmaFECT® or Lipofectamine®. In some embodiments, theagent (e.g., nucleic acid) of the present disclosure is formulated with the transfection reagent in the composition so as to promote cellular uptake and / or pharmacokinetics of the agent (e.g., nucleic acid).

[0180] Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of pharmaceutical formulations. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV), which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV), which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV), which may be between 50 and 500 nm in diameter. Liposome design may include, without limitation, opsonins or ligands in order to improve the attachment of liposomes to target tissue / cells, or to activate events such as, but not limited to, endocytosis. Liposomes may contain a low or a high pH in order to improve the delivery of the cargo, e.g., a nucleic acid of the present disclosure.

[0181] In some embodiments, the composition includes, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]- dioxolane (DLin-KC2-DMA), and MC3 and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).

[0182] In some embodiments, the composition includes a cationic lipid. Any suitable cationic lipid may be used in the present compositions. Suitable cationic lipids include, without limitation, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. In some embodiments, the composition includes a cationic lipid complex, e.g., a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated, e.g., 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, PCLC is formed by exposing a mixture of PEG and the cationic lipid to one or more freeze / thaw cycles, e.g., 1, 2, 3, 4, 5 or more freeze / thaw cycles. In some embodiments, a freeze / thaw cycle includes freezing the mixture with liquid nitrogen (e.g., around -190 °C) for about 5 minutes, and thawing atabout 60 °C for about 5 minutes. A nucleic acid of the present disclosure can be mixed with the PCLC to generate a complex of the nucleic acid and the PCLC.

[0183] In some embodiments, the composition includes extracellular vesicles (EV), e.g., exosomes. The extracellular vesicles (EV) can be those from any suitable source, e.g., EV derived from cardiosphere-derived cells (CDC), or from fibroblasts. Suitable EV, such as CDC-derived EV, are provided in, e.g., U.S. Application Publication Nos. 20080267921, 20160158291 and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, M. A. et al. Stem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. 2014 May 8;2(5):606-19, Ibrahim, A. G. et al. Nanomedicine 33, 102347 (2020), each of which is incorporated by reference in its entirety. In some embodiments, the EVs are those isolated from scrum-free media conditioned by human CDCs in culture. In some embodiments, the composition includes EV and liposomes and / or PCLC as transfection reagents. In some embodiments, the composition is substantially free of CDC-derived EV.

[0184] In some embodiments, the composition includes casein, e.g., a casein micelle. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., a casein-chitosan micelle. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the agent (e.g., isolated nucleic acid) in the composition is encapsulated in a casein-chitosan complex. In some embodiments, the composition includes one or more of phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the composition includes two or more, three or more, or all four phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein. The phosphoproteins may be present in the composition at any suitable concentration (relative to each other, and relative to the total volume of the composition), and in some embodiments, is present in an amount suitable for forming casein micelles. In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5-10 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 8 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 5 % (weight by volume). The casein phosphoproteins can be those from any suitable animal, e.g., mammal such as, but not limited to, human, nonhuman primate, cow, pig, horse, camel, goat, and sheep. In some embodiments, the casein phosphoproteins arebovine alpha si casein, alpha s2 casein, beta casein, and kappa casein. Suitable casein formulations with EV arc provided in, e.g., Aminzadch ct al., J Extraccll Vesicles. 2021 Jan;10(3):el2045, the entirety of which is incorporated herein by reference. In some embodiments, a composition, e.g., pharmaceutical composition, of the present disclosure formulated with casein, as provided herein, is suitable for oral administration to the subject. Without being bound by theory, the casein phosphoproteins in the composition are thought to increase the bioavailability of orally administered EV and / or liposomes and their cargo, e.g., the agent (e.g., nucleic acid) of the present disclosure.

[0185] In several embodiments, a composition for enhancing the oral bioavailability of a therapeutic agent (e.g., nucleic acid) of the present disclosure comprises at least two phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein, where the phosphoproteins are present in an amount between about 5% to about 10% (weight by volume) of the composition, in a physiologically compatible excipient. In several embodiments, the composition includes the alpha si casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight), the alpha s2 casein in an amount between about 0% to about 20% (e.g., about 5% to about 15%, about 7% to about 12%, including about 8% to about 12%) (by weight), the beta casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight), and the kappa casein in an amount between about 0% to about 20% (e.g., about 5% to about 18%, about 8% to about 18%, including about 10% to about 15%) (by weight) of the phosphoprotein mass in the composition. The present compositions can provide for enhanced oral bioavailability of therapeutic agents (e.g., nucleic acids).

[0186] In several embodiments, the formulations provided for herein are in the form of lipid-bound vesicles, e.g., micelles or liposomes, and can therefore include any suitable number of particles. In some embodiments, the number of micelles (e.g., casein-chitosan coated micelles) is in a range of about 106to about 1010 particles, e.g., about 2 x 106to about 1010particles, about 5 xlO6to about 1010particles, about 107to about 5 x 109particles, about 2 xl07 to about 5 x 109particles, about 5 xlO7to about 5 x 109particles, including about 1 xlO8to about 2 x 109particles. In some embodiments, the amount of micelles (e.g., casein-chitin coated micelles) in the population is about 106, about 2 x 106, about 5 x 106, about 107, about 2 x 107, about 5 x 107, about 108, about 2 x 108, about 5 x 108, about 109, about 2 x 109, about 5 x 109, or about IO10particles, or an amount in between any two of the preceding values.

[0187] In several embodiments, the composition comprises casein-chitosan coated lipid micelles, where the casein phosphoproteins are present in the composition in suitable amounts (e.g., suitable total amount of phosphoprotein mass in the composition, suitable proportions of phosphoproteins relative to each other). In some embodiments, the composition includes two, three, or all four phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the amount of a phosphoprotein in the composition depends on the amount of one or more other phosphoprotein present in the composition.

[0188] In some embodiments, alpha si casein is a phosphoprotein associated with the gene name CSN1S1. The alpha si casein can be a CSN1S1 phosphoprotein from any suitable mammal. In some embodiments, the alpha si casein is bovine (Gene ID: 282208), porcine (Gene ID: 445514), equine (Gene ID: 100033982), ovine (Gene ID: 443382), caprine (Gene ID: 100750242), cameline (Gene ID: 105090954), or human (Gene ID: 1446). In some embodiments, the alpha si casein is a non-human alpha si casein. In some embodiments, the alpha si casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 17.

[0189] In some embodiments, the composition includes any suitable amount of alpha si casein. In some embodiments, the composition includes the alpha si casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the alpha si casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.

[0190] In some embodiments, the alpha s2 casein is a phosphoprotein associated with the gene name CSN1S2. The alpha s2 casein can be a CSN1S2 phosphoprotein from anysuitable mammal. In some embodiments, the alpha s2 casein is bovine (Gene ID: 282209), porcine (Gene ID: 445515), equine (Gene ID: 100327035), ovine (Gene ID: 443383), caprine (Gene ID: 100861229), or cameline (Gene ID: 105090951). In some embodiments, the alpha s2 casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 18.

[0191] The composition can include any suitable amount of alpha s2 casein. In some embodiments, the composition includes the alpha s2 casein in an amount, by weight, between about 0% to about 20%, e.g., between about 2% to about 18%, between about 3% to about 18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the alpha s2 casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.

[0192] In some embodiments, the beta casein is a phosphoprotein associated with the gene name CSN2. The beta casein can be a CSN2 phosphoprotein from any suitable mammal. In some embodiments, the beta casein is bovine (Gene ID: 281099), porcine (Gene ID: 404088), equine (Gene ID: 100033903), ovine (Gene ID: 443391), caprine (Gene ID: 100860784), cameline (Gene ID: 105080412), or human (Gene ID: 1447). In some embodiments, the beta casein is a non-human beta casein. In some embodiments, the beta casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 19 or 20.

[0193] The composition can include any suitable amount of beta casein. In some embodiments, the composition includes the beta casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the beta casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.

[0194] In some embodiments, the kappa casein is a phosphoprotein associated with the gene name CSN3. The beta casein can be a CSN3 phosphoprotcin from any suitable mammal. In some embodiments, the kappa casein is bovine (Gene ID: 281728), porcine (Gene ID: 445511), equine (Gene ID: 100033983), ovine (Gene ID: 443394), caprine (Gene ID: 100861231), cameline (Gene IDs: 105080408 or 105090949), or human (Gene ID: 1448). In some embodiments, the kappa casein is a non-human kappa casein. In some embodiments, the kappa casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 21.

[0195] The composition can include any suitable amount of kappa casein. In some embodiments, the composition includes the kappa casein in an amount, by weight, between about 0% to about 20%, e.g., between about 2% to about 18%, between about 3% to about 18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition. In some embodiments, the composition includes the kappa casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.

[0196] Combinations of caseins from different species are used, in some embodiments. For example, in several embodiments, one or more human casein is used in combination with one or more bovine casein. Ratios of caseins are used in some embodiments, for example a 3: 1:3:1 ratio of alpha SI caseimalpha s2 caseimbeta caseimkappa casein. Different ratios may be used in some embodiments, for example 4: 1:4:1, 2: 1:2:1, or 1:1: 1:1. Ratios may also be used between any two given caseins in a composition, ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 1:5, 1:4, 1:3, 1:2, etc.

[0197] Any suitable total amount of the phosphoproteins may be present in the composition. In some embodiments, the phosphoproteins are present in an amount between 5% to about 10%, e.g., about 6% to about 10%, about 6% to about 9%, including about 6% to about 8%, (weight by volume) of the composition. In some embodiments, the phosphoproteins are present in an amount of about 5%, 6%, 7%, 8%, 9%, 10%, or an amount within a range defined by any two of the preceding values, (weight by volume) of the composition.

[0198] In some embodiments, one or more of the casein phosphoproteins are nonhuman casein phosphoprotcins. In some embodiments, the exosomes and at least one of the casein phosphoproteins are from different species. In some embodiments, the exosomes are human exosomes, and one or more of the casein phosphoproteins are non-human casein phosphoproteins. In some embodiments, the exosomes are human exosomes, and one or more of the casein phosphoproteins are bovine (or ovine, porcine, caprine, cameline, or equine) casein phosphoproteins.

[0199] In some embodiments, the composition includes micellar structures formed by at least a portion of the casein phosphoproteins. In some embodiments, the casein micelles are substantially spherical. In some embodiments, a casein micelle in the composition has an average diameter (as measured per micelle) of about 40 nm, about 50 nm, about 60 nm, about 70 nm, about80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm or more, or an average diameter within a range defined by any two of the preceding values. In some embodiments, a casein micelle in the composition has an average diameter (as measured per micelle) in a range from about 40 nm to about 500 nm, e.g., from about 40 nm to about 400 nm, from about 50 nm to about 300 nm, from about 60 nm to about 250 nm, from about 70 nm to about 250 nm, from about 80 nm to about 200 nm, including from about 90 nm to about 150 nm. The casein micelles of the present composition are generally not precipitated or in gel form.

[0200] In some embodiments, the composition includes one or more colloidal minerals (e.g., minerals in suspension). In several embodiments, a complex (e.g., two or more) minerals are used as a colloidal mineral complex. The colloidal mineral complex can include any suitable mineral compounds and / or their salts. In some embodiments, the colloidal mineral complex includes, without limitation, one or more of calcium, magnesium, inorganic phosphate, citrate, sodium, potassium, and chloride, or their respective salts. In some embodiments, the colloidal mineral complex is present in an amount between about 2% and about 15%, e.g., about 2% to about 12%, about 5% to about 10%, about 5% to about 9%, including about 6% to about 9% (by weight) of the phosphoprotein mass in the composition. In some embodiments, the colloidal mineral complex is present in an amount of about 2%, 3%,4%, 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15% or an amount within a range defined by any two of the preceding percentages.

[0201] In some embodiments, the composition is in a parenteral dose form. In some embodiments, the parenteral dosage form is sterile or capable of being sterilized before administering to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of the agent include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.

[0202] Also provided herein is a macrophage that have enhanced expression of a Trexl gene product of the present disclosure. In some embodiments, the macrophage is a CD68+ macrophage. In some embodiments, the macrophage is a human macrophage. In some embodiments, a macrophage having enhanced expression of a Trexl gene product increases anti-inflammatory activity compared to a suitable control, e.g., a macrophage that does not have enhanced expression of a Trexl gene product. In some embodiments, the macrophage is a bone marrow-derived macrophage (BMDM). In some embodiments, the macrophage has increased expression of one or more of IL- 10, IRF-7, NOS-2, and ARG-1. In some embodiments, the macrophage has increased mRNA expression of one or more of IL- 10, IRF- 7, NOS-2, and ARG-1, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, the macrophage has increased mRNA expression of one or more of IL- 10, IRF-7, NOS-2, and ARG-1, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, mRNA expression of one or more of IL- 10, IRF-7, NOS- 2, and ARG-1 in the macrophage having enhanced expression of a Trexl gene product is eachindependently increased by at least 1.5 fold, 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 30 fold, 50 fold, 100 fold, 200 fold, 300 fold, 400 fold 500 fold, 1,000 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, the macrophage has increased protein expression of one or more of IL- 10, IRF-7, NOS-2, and ARG-1, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, protein expression of one or more of IL- 10, IRF-7, NOS-2, and ARG-1 in the macrophage having enhanced expression of a Trexl gene product is each independently increased by at least 1.5 fold, 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 30 fold, 50 fold, 100 fold, 200 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, the macrophage has increased secretion of IL- 10 compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, IL- 10 secretion in the macrophage having enhanced expression of a Trexl gene product is each independently increased by at least about 1.2 fold, 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 8 fold, 10 fold, 15 fold, 20 fold, 50 fold, or more, or by a fold amount in a range defined by any two of the preceding values, compared to a suitable control, e.g., a macrophage that does not have enhanced expression of the Trexl gene product. In some embodiments, the macrophage is in culture. In some embodiments, the macrophage is in a subject, e.g., in peripheral blood, bone marrow, and / or at a site of tissue injury.Table 1: SequencesAdministration of Compositions

[0203] Some embodiments of the methods and compositions provided herein include administering a composition to a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is human. In some embodiments, the subject is a non-human animal.

[0204] In some embodiments, administering a composition includes administering about 1 pg / kg to about 100 mg / kg polynucleotide to body weight per administration in a single dose. For example, in several embodiments, doses range from about 1 to about 10 pg / kg, about10 to about 20 pg / kg, about 20 to about 30 pg / kg, about 30 to about 40 pg / kg, about 40 to about 50 pg / kg, about 50 to about 60 pg / kg, about 60 to about 70 pg / kg, about 70 to about 180 pg / kg, about 80 to about 90 pg / kg, about 90 to about 100 pg / kg, about 100 to about 200 pg / kg, about 145 to about 155 pg / kg, about 100 pg / kg to about 500 pg / kg, about 500 pg / kg to about 1000 pg / kg, about 1000 pg / kg to about 10 mg / kg, about 10 mg / kg to about 50 mg / kg, about 50 mg / kg to about 100 mg / kg, or any dose between those listed.

[0205] In some embodiments, a single dose is administered multiple times to the subject (e.g., repeat administrations over a period of time). In some embodiments, administering a composition includes injecting the composition. In some embodiments, the composition is injected percutaneously, subcutaneously, intra-abdominally, retro-orbitally, intramuscularly, intracutaneously, or intraperitoneally.

[0206] In some embodiments, the quantity of polynucleotide that is administered is at a unit dose less than about 75 mg per kg of body weight, or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, or 0.0005 mg per kg of bodyweight. In some embodiments, the polynucleotide is at a unit dose less than 200 nmol of polynucleotide (e.g., about 4.4xl016copies) per kg of body weight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of polynucleotide per kg of body weight. In some embodiments, a dose of polynucleotide is in the range of 0.01 to 5.0, 0.1 to 200, 0.1 to 100, or 1.0 to 50 micrograms per kilogram body weight per day. In some embodiments, a dose of polynucleotide is in the range of 1.0 to 25 micrograms per kilogram body weight per day. In some embodiments, a dose of polynucleotide is in the range of 0.01 to 5.0, 0.1 to 200, 0.1 to 100, or 1.0 to 50 micrograms. In some embodiments, a dose of polynucleotide is in the range of 1.0 to 25 micrograms. In some embodiments, a dose of polynucleotide is in the range of 1-5 mg. In some embodiments, a dose of polynucleotide is about 10 micrograms. In some embodiments, a dose of polynucleotide is about 3 mg.

[0207] In some embodiments, single doses are compared to two, three, four, four or more sequentially-applied doses. In some embodiments, the repeated or sequentially-applied doses are provided for treatment of an acute disease or condition. In some embodiments, the repeated or sequentially-applied doses are provided for treatment of a chronic disease or condition.

[0208] In some embodiments, administration of polynucleotides to the subject occurs through any technique known in the art. In some embodiments, administration includes percutaneous delivery. In some embodiments, additional delivery sites are used, including any one or more compartments of the heart, such as arterial, venous, intracoronary or ventricular locations. In some embodiments, administration includes delivery to a tissue or organ site that is different from the site or diseased or dysfunctional tissue. In some embodiments, the delivery is via inhalation or oral administration. Systemic administration is used in several embodiments. However, in several embodiments, local delivery is employed.

[0209] In some embodiments, the composition to be administered is a pharmaceutical composition including one or more of the agent that enhances expression of a Trexl gene product described herein, and a pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. In some embodiments, such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include, but are not limited to sodium and calcium carbonate, sodium and calcium phosphate, and lactose. Suitable disintegrating agents include, but are not limited to com starch and alginic acid. Binding agents include, but are not limited to starch and gelatin. In some embodiments, a lubricating agent is present. In some embodiments, the lubricating agent is magnesium stearate, stearic acid or talc. In some embodiments, the tablets are coated with a material such as glyceryl monostearate or glyceryl distearate, e.g., to delay absorption in the gastrointestinal tract. In some embodiments, supplementary active compounds are incorporated into the compositions. In some embodiments, an agent that enhances expression of a Trexl gene product is administered with a pharmaceutically acceptable carrier.

[0210] In some embodiments, the pharmaceutical compositions include conventional pharmaceutical excipients or additives. In some embodiments, the pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents,buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (such as tromethamine hydrochloride), chclants (such as DTPA or DTPA-bisamidc) or calcium chelate complexes (such as calcium DTPA, CaNaDTPA-bisamide). Suitable additives also include additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). In some embodiments, pharmaceutical compositions are packaged for use in liquid form, or lyophilized. In some embodiments, for solid compositions, conventional non-toxic solid carriers are used: for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.

[0211] In some embodiments, the composition includes a solid pharmaceutical composition for oral administration with any of the carriers and excipients listed above and 10- 95% or 25%-75%, of one or more polynucleotide agents described herein. In some embodiments, the composition includes a therapeutically effective amount of polynucleotide.Therapeutic Effects

[0212] Some embodiments of the methods and compositions provided herein relate to conferring beneficial therapeutic effects on a subject, such as protection, cardioprotection, preventing or retarding progression of inflammation, or regenerating tissue. In some embodiments, administering the agent and / or composition regenerates tissue, or modulates apoptosis, inflammation hypertrophy, cardiac function, or fibrosis.

[0213] In some embodiments, the therapeutic benefits are derived through indirect mechanisms involving regenerated tissue arising from endogenous origin. For example, in some embodiments, the compositions allow for production and delivery of growth factors, transcription factors, cytokines and nucleic acids for new therapeutic approaches in a manner that not only ameliorates progression of the disease, but repairs and regenerates disease or dysfunctional tissue. In some embodiments, the components of the compositions recruit synergistic mechanisms to attract endogenous stem cells to sites of tissue degeneration and injury, promote cellular differentiation, and reverse chronic disease pathophysiology.

[0214] Some embodiments relate to a method for treatment including, administering a composition to the individual, wherein the administration of the composition treats the subject. In some embodiments, the subject is in need of treatment for an inflammatorydisease or condition. In some embodiments, the inflammatory related disease or condition is acute. In some embodiments, the inflammatory related disease or condition is chronic. In some embodiments, the inflammatory related disease or condition is a heart related disease or condition. In some embodiments, the heart related disease or condition is a myocardial infarction. In some embodiments, the heart related disease or condition is an ischemia reperfusion injury. In some embodiments, the heart related disease or condition is atherosclerosis or heart failure. In some embodiments, the subject is in need of treatment for a disease or condition involving tissue damage or dysfunction.

[0215] In some embodiments, treatment of the subject results in decreased fibrosis, decreased inflammation, and / or increased mitochondrial function. In some embodiments, decreased fibrosis includes a reduction in collagen accumulation. In some embodiments, collagen includes collagen I or collagen III. In some embodiments, decreased inflammation includes an increase in cytoplasmic nuclear factor (erythroid-derived 2)-like 2 (Nrf2), a reduction in fatty acid peroxidation end products, reduced numbers of inflammatory cells, and / or upregulated expression of antioxidants. In some embodiments, antioxidants include, but are not limited to, heme oxygenase- 1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), or a glutamate-cysteine ligase catalytic (GCLC) subunit. In some embodiments, inflammatory cells include CD68+ macrophages and CD3+ T-cells. In some embodiments, increased mitochondrial function includes increased mitochondrial ultrastructure or increased mitochondrial biogenesis. In some embodiments, increased mitochondrial function includes increased nuclear PPAR-y co-activator-1 (PGC-1) expression.

[0216] In some embodiments, administration of the agent or the composition alters gene expression in inflamed, damaged or dysfunctional tissue, modulates or reduces inflammation in a tissue, improves viability of the damaged tissue, or enhances regeneration or production of new tissue in the individual. In some embodiments, administration of the agent and / or composition or polynucleotides results in functional improvement in the tissue.

[0217] In some embodiments, the damaged or dysfunctional tissue is in need of repair, regeneration, or improved function due to an acute event. In some embodiments, an acute event includes trauma such as laceration, crush or impact injury, shock, loss of blood or oxygen flow, infection, chemical or heat exposure, poison or venom exposure, or drug overuse or overexposure. In some embodiments, tissue is also subject to damage due to chronic disease.In some embodiments, the administration is in repeated doses, such as two, three, four, four or more sequentially-applied doses. In some embodiments, the repeated or sequentially-applied doses are provided for treatment of an acute disease or condition. In some embodiments, the repeated or sequentially-applied doses are provided for treatment of a chronic disease or condition.

[0218] In some embodiments, the subject’s heart is hypertrophic. In some embodiments, cardiac hypertrophy is determined by increased or excessive septal or ventricular wall thickness in the heart, such as an increase in left ventricular (LV) posterior wall thickness at end-diastole (LVPWd), LV internal diastolic diameter (LVIDd), or interventricular septal thickness at end-diastole (IVSd). In some embodiments, cardiac hypertrophy is determined by increased or excessive heart mass, heart mass / body weight ratio, heart mass / tibia length ratio, LV mass, right ventricular (RV) mass, Atrial natriuretic peptide (ANP) levels, Anp gene expression, Brain natriuretic peptide (BNP) levels, Bnp gene expression, cardiomyocyte length, or cardiomyocyte width. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases cardiac hypertrophy (or a marker thereof) in the subject. In some embodiments, the decrease in cardiac hypertrophy is indicated by a decrease in an index of cardiac hypertrophy. In some embodiments, the subject’s heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional due to hypertension. In some embodiments, the subject’s heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional due to a cause other than hypertension. In some embodiments, the subject’s heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional, and the subject does not have hypertension.

[0219] In some embodiments, the subject’s heart is fibrotic. In some embodiments, the fibrosis in the heart includes interstitial myocardial fibrosis. In some embodiments, fibrosis is determined by Masson’s trichrome staining, or by increased or excessive expression of collagen genes or proteins. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases cardiac fibrosis in the subject.

[0220] In some embodiments, the subject’s heart (or other organ) is inflamed. Markers of inflammation include markers of infiltrating inflammatory cells, such as CD68, and pro-inflammatory cytokines such as 116 and Illb. In some embodiments, tissue inflammation is determined by increased or excessive expression of genes such as CD68, 116,or lllb. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases inflammation or gene expression of a marker of inflammation in the subject’s heart.

[0221] Some embodiments of the methods and compositions provided herein relate to treating a subject suffering from a cardiac injury, comprising; administering an agent that enhances expression of a Trexl gene product to a subject suffering from a cardiac injury; wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO; 3), is not EV-YF1 or a fragment thereof, is not EV-YF1-U16 or a fragment thereof, and / or is not NT4 or a fragment thereof; and wherein the agent has a therapeutic effect on the subject’s heart.

[0222] Some embodiments herein relate to a method for treating a subject suffering from a cardiac injury. In some embodiments, the cardiac injury includes a myocardial infarction or heart attack. In some embodiments, the cardiac injury is caused by ischemia or ischemia- reperfusion. In some embodiments, an agent that enhances expression of a Trexl gene product is administered to a subject suffering from a cardiac injury. In some embodiments, the agent that enhances expression of a Trexl gene product is an oligonucleotide described herein. In some embodiments, the agent that enhances expression of a Trexl gene product does not comprise EV-YF1 or a fragment thereof. In some embodiments, the agent that enhances expression of a Trexl gene product does not comprise EV-YF1-U16 or a fragment thereof. In some embodiments, the agent that enhances expression of a Trexl gene product has a therapeutic effect on the subject’s heart. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases the extent of the injury . In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases an infarct’s size in the subject’s heart.

[0223] In some embodiments, administration of the agent and / or composition decreases inflammation, or gene expression of a marker of inflammation in the injured heart of the subject.

[0224] In some embodiments, the injury decreases cardiomyocyte viability in the subject’s heart. In some embodiments, the heart (or other organ), as a result of the injury, contains excessive or increased numbers of necrotic or apoptotic cells or cardiomyocytes. In some embodiments, apoptosis is determined by the number of TUNEL-positive cells orcardiomyocytes. In some embodiments, the injury causes oxidative stress, such as increased H2O2 or superoxide production, in the subject’s heart. In some embodiments, administration of the agent that enhances expression of a Trexl gene product increases cardiomyocyte viability in the subject’s heart. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases the numbers of necrotic or apoptotic cells or cardiomyocytes in the subject. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases the number of TUNEL-positive cells or cardiomyocytes in the subject. In some embodiments, administration of the agent that enhances expression of a Trexl gene product decreases oxidative stress in the subject’s heart.

[0225] Some embodiments of the methods and compositions provided herein relate to treating a subject suffering from a metabolic disorder, comprising: administering an agent and / or a composition to a subject with a metabolic disorder; wherein the agent and / or a composition has a therapeutic effect on the subject’s metabolism.

[0226] Some embodiments herein relate to a method for treating a subject suffering from a metabolic disorder. In some embodiments, the subject is obese. In some embodiments, the subject is diabetic. In some embodiments, the subject has excessive or increased blood glucose levels. In some embodiments, the subject exhibits glucose intolerance, or excessive or increased blood glucose levels in response to a glucose challenge. In some embodiments, an agent that enhances expression of a Trexl gene product is administered to a subject with a metabolic disorder. In some embodiments, the agent that enhances expression of a Trexl gene product is an oligonucleotide described herein. In some embodiments, the agent and / or a composition has a therapeutic effect on the subject’s metabolism. In some embodiments, administration of the agent and / or a composition improves the subject’s metabolic function or decreases the extent of the subject’s diabetes. In some embodiments, administration of the agent and / or a composition decreases blood glucose levels or improves glucose tolerance in the subject.

[0227] In some embodiments, administration of the agent and / or a composition increases IL- 10 gene expression in the subject’s heart or spleen, or in at least one of the subject’s kidneys. In some embodiments, administration of the agent and / or a composition increases circulating IL- 10 in the subject. In some embodiments, administration of the agent and / or a composition increases IL- 10 in the subject’s blood, serum, or plasma.

[0228] Some embodiments herein relate to method for treating a subject by administering an agent and / or composition, to the subject. In some embodiments, the subject’s heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional. For example, the subject may suffer from heart failure or cardiomyopathy. Examples of heart failure include heart failure with reduced ejection fraction (such as reduced left or right ventricular ejection fraction), and heart failure with preserved ejection fraction. In some embodiments, the cardiomyopathy includes heart failure, cardiac hypertrophy or fibrosis.

[0229] In some embodiments, the agent and / or composition increases the amount of plasma IL- 10 protein, induces macrophage IL- 10 gene expression, attenuates one or more of cardiac CD68 and ILlb gene expression. In some embodiments, the agent and / or composition increases the amount of plasma IL- 10 protein, induction of macrophage IL- 10 gene expression, attenuation of one or more of cardiac CD68 and ILlb gene expression, induction of a therapeutic effect on the subject’s heart, thereby treating the subject’s damaged, hypertrophic, fibrotic, inflamed, or dysfunctional heart. For example, treatment with or use of the agent and / or composition leads to an improvement in heart function, fibrosis, and / or another condition of the heart in a subject with heart failure (such as heart failure with reduced or preserved ejection fraction) and / or cardiomyopathy (such as inheritable, heritable, or sporadic hypertrophic cardiomyopathy).KITS

[0230] Also provided herein are kits that include the agent or a composition of the present disclosure. The present kit in some embodiments finds use in treating a muscle disorder, a heart condition or an inflammatory condition (e.g., associated with a viral infection), as provided herein. A kit can include the agent of the present disclosure and a transfection reagent. The transfections reagent can be any suitable transfection reagent, as provided herein. In some embodiments, the transfection reagent includes one or more of a lipid (e.g., a liposome-forming lipid), a PEGylated lipid, and an extracellular vesicle. In some embodiments, the kit includes a pharmaceutically acceptable excipient, as provided herein. In some embodiments, the kit includes casein and / or chitosan. Kits can include one or more containers (e.g., vials, ampoules, test tubes, flasks or bottles) for holding one or more components of the kits. The kits may further include instructions for using the kit to treat a condition (e.g., HCM, HFpEF, muscular dystrophy, scleroderma, inflammatory conditionassociated with a viral infection). The information and instructions may be in the form of words, pictures, or both, and the like.Additional Embodiments

[0231] Some non-limiting embodiments of the present disclosure is provided by the following numbered embodiments.1. A method of treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, (SEQ ID NO: 3).2. The method of embodiment 1, wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart, skeletal muscle, or skin.3. The method of embodiment 1 or 2, wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.4. The method of any one of the preceding embodiments, wherein the condition associated with inflammation comprises a symptom or sequelae of an infectious disease or is associated with immunotherapy.5. The method of embodiment 4, wherein the infectious disease comprises a viral infection.6. The method of any one of the preceding embodiments, wherein the condition associated with inflammation comprises a cytokine storm.7. The method of embodiment 6, the condition associated with inflammation comprises an autoimmune disorder.8. The method of embodiment 7, wherein the autoimmune disorder comprises scleroderma or systemic sclerosis.9. The method of any one of the preceding embodiments, wherein the condition associated with aging, atrophy, and fibrosis comprises a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.10. A method of treating a heart condition or symptom thereof, comprising administering to a subject in need of treating a heart condition or symptom thereof an effective amount of an agent that enhances expression of a Tre l gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, (SEQ ID NO: 3).11. The method of embodiment 10, wherein the heart condition comprises a symptom and / or sequelae of heart failure.12. The method of embodiment 10 or 11, wherein the heart condition comprises hypertrophic cardiomyopathy.13. The method of any one of embodiments 10-12, wherein the heart condition comprises heart failure with preserved ejection fraction (HFpEF).14. The method of any one of embodiments 10-13, wherein the heart condition comprises a symptom or sequelae of an infectious disease.15. The method of embodiment 14, wherein the infectious disease comprises a viral infection.16. The method of any one of embodiments 10-15, wherein the subject has the heart condition.17. The method of any one of embodiments 10-15, wherein the subject is at risk of developing the heart condition.18. A method of treating a muscle disorder or symptom thereof, comprising administering to a subject in need of treating a muscle disorder or symptom thereof an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3.19. The method of embodiment 18, wherein the muscle disorder comprises muscular dystrophy or a heart condition.20. The method of embodiment 18 or 19, wherein the muscle disorder comprises Duchenne muscular dystrophy.21. The method of any one of embodiments 18-20, wherein the subject has the muscle disorder.22. The method of any one of embodiments 18-20, wherein the subject is at risk of developing the muscle disorder.23. The method of embodiment 22, wherein the subject is genetically predisposed to developing the muscle disorder.24. A method for treating diseases related to aging, tissue senescence, or atrophy, comprising administering to a subject in need of treating a disease related to aging, tissue senescence, or atrophy an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, (SEQ ID NO: 3).25. The method of any one of the preceding embodiments, wherein the agent does not comprise the isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, (SEQ ID NO: 3).26. The method of any one of the preceding embodiments, wherein the Trexl gene product comprises a Trexl mRNA.27. The method of any one of the preceding embodiments, wherein the agent comprises a nucleic acid that anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3 anneals.28. The method of embodiment 27, wherein the first sequence does not overlap with the second sequence.29. The method of any one of embodiments 26-28, wherein the agent stabilizes the Trexl mRNA, or increases the half-life of the Trexl mRNA.30. The method of any one of embodiments 1-28, wherein the agent comprises a nucleic acid that encodes the Trexl gene product.31. The method of embodiment 30, wherein the nucleic acid comprises a promoter operably connected to a nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Trexl gene product.32. The method of embodiment 30 or 31 , wherein the nucleic acid comprises a vector.33. The method of embodiment 32, wherein the vector is a viral vector, or a plasmid.34. The method of any one of embodiments 30-33, wherein the nucleic acid is comprised in a macrophage.35. The method of embodiment 34, comprising administering a population of the macrophages, wherein the effective amount of the agent that enhances expression of a Trexl gene product is comprised in the population.36. 36. The method of embodiment 30, wherein the nucleic acid comprises a stabilized Trexl mRNA.37. The method of embodiment 36, wherein the stabilized Trexl mRNA comprises an engineered poly(A) tail.38. The method of any one of the preceding embodiments, wherein the agent comprises one or more chemically-modified nucleotides.39. The method of embodiment 38, wherein the chemically-modified nucleotide comprises a backbone modification.40. The method of embodiment 39, wherein the backbone modification comprises a backbone sugar modification.41. The method of any one of embodiments 38-40, wherein the one or more chemically-modified nucleotides comprise a locked nucleic acid (LNA) and / or a methylated nucleotide.42. The method of any one of the preceding embodiments, wherein the agent attenuates DNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis.43. The method of any one of the preceding embodiments, wherein the agent enhances expression of the Trexl gene product in macrophages when the effective amount of the agent is administered to the subject.44. A method of treating a condition associated with inflammation and / or fibrosis, comprising upregulating Trexl in macrophages of a subject in need of treating a condition associated with inflammation and / or fibrosis.45. A method of treating a condition associated with inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with inflammation and / or fibrosis an effective amount of an agent that attenuates DNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3.46. The method of any one of the preceding embodiments, comprising administering the effective amount of the agent intravenously, intramuscularly, intracardially, or orally.47. A method of promoting anti-inflammatory activity of macrophages, comprising contacting a population of macrophages with an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3 to thereby promote an anti-inflammatory activity of macrophages of the population.48. The method of embodiment 47, wherein the contacting comprises administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount of the agent, to thereby promote an anti-inflammatory activity of macrophages in the subject.49. The method of embodiment 48, wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart, skeletal muscle, or skin.50. The method of embodiment 48 or 49, wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.51. The method of any one of embodiments 48-50, wherein the nucleic acid comprises a promoter operably connected to a nucleotide sequence encoding the Tre l gene product, wherein the promoter drives expression of the Trexl gene product.52. The method of embodiment 51, wherein the nucleic acid comprises a vector.53. The method of embodiment 52, wherein the vector is a viral vector, or a plasmid.54. The method of any one of embodiments 47-50, wherein the agent stabilizes a Trcxl mRNA, or increases the half-life of the Trcxl mRNA.55. The method of any one of embodiments 47-54, wherein the population of macrophages comprises human macrophages.56. A composition for treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising: a nucleic acid that anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3, anneals, wherein the nucleic acid enhances expression of a Trexl gene product; a nucleic acid that encodes the Trexl gene product, wherein the nucleic acid is configured to overexpress the Trexl gene product; a population of macrophages having elevated anti-inflammatory activity, wherein macrophages of the population have enhanced expression of the Tre l gene product and do not comprise an exogenous RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG, SEQ ID NO: 3, or a combination thereof.57. The composition of embodiment 56, further comprising a pharmaceutically acceptable carrier.58. The composition of embodiment 57, wherein the macrophages of the population are genetically modified to overexpress the Trexl gene product.59. The composition of embodiment 57 or 58, wherein the macrophages of the population are genetically modified to comprise a nucleic acid comprising a promoter operably connected to a nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Trexl gene product in the macrophages.60. The composition of embodiment 59, wherein the nucleic acid comprises a vector.61. The composition of embodiment 60, wherein the vector is a viral vector, or a plasmid.62. Use of the composition of any one of embodiments 56-61 for treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof.63. Use of the composition of embodiment 56-61 for preparation of a medicament for treatment of a heart condition, muscle disorder, inflammatory disease, or a condition associated with aging and / or atrophy, in a subject in need thereof.64. An in vitro method of identifying an agent that enhances expression of a Trexl gene product in a target cell, comprising: contacting a candidate agent with a target cell; and measuring an expression level of a Trexl gene product in the target cell after the contacting, wherein the candidate agent is identified as an agent that enhances expression of a Trexl gene product when the measured expression level and / or measured activity level of the Tre l gene product is elevated compared to a suitable reference value.

[0232] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0233] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided hereincan be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0234] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0235] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLESExample 1:

[0236] This non-limiting example shows a potential mechanism of action for the bioactivity of a synthetic non-coding RNA (ncRNA) bioinspired by naturally occurring human small Y RNAs.

[0237] Non-coding RNAs (ncRNAs) mined from extracellular vesicles (EVs) are increasingly recognized as bioactive. Here the development of TY1, a synthetic ncRNA bioinspired by a naturally occurring human small Y RNAs abundant in EVs derived from cardiac stromal / progenitor cells with immunomodulatory properties is reported. Structural optimization yielded TY1, a 24-nucleotide, chemically-modified lead compound which attenuated cell stress, inflammatory and fibrotic gene pathways, and increased IL- 10 secretion, in rodent and human macrophages. RNA-RNA pulldown assays revealed TY1 interacts with the messenger RNA (mRNA) for Trexl, a DNA damage repair enzyme and an exonuclease that rapidly degrades cytosolic DNA. By binding to the trexl 5’ UTR, TY1 (but not a scrambled control RNA) stabilized Trexl mRNA levels, which in turn increased 1110expression in macrophages. Intravenous TY1 was cardioprotective in rat and porcine models of myocardial infarction (MI), an effect abrogated by prior depletion of macrophages and mimicked by adoptive transfer of macrophages exposed either to TY1 or Trexl. In preclinical models of myocardial infarction (MI) induced by ischemia / reperfusion, TY 1 reduced scar size. Consistent with a central role for Trexl, TY1 attenuated DNA damage and aggresome accumulation in the post-MI heart. Inhibition of TREX1 in macrophages blocked TY1 cardioprotection. Consistent with a central role for TREX1, TY1 attenuated DNA damage in the post-MI heart. In conclusion, TY 1 serves as the prototype for a novel class of ncRNA drugs which target genotoxic stress, thereby exhibiting exceptional disease-modifying bioactivity. This novel mechanism — pharmacologic upregulation of TREX1 in macrophages — establishes TY1 as the prototype for a new class of ncRNA drugs with disease-modifying bioactivity.

[0238] Regenerative therapy has been notable for much hype but little success in translation1. Mechanistic studies have undermined the presumptive canonical stem cell paradigm of engraftment, proliferation, and differentiation; instead, adult regenerative cell therapies work indirectly by secreting extracellular vesicles (EVs), which transmit their diverse molecular contents into target tissue2. EVs themselves exert disease-modifying bioactivity3, but they also can be mined to identify defined factors as new therapeutic candidates. The discovery paradigm of “cell therapy to defined factors” is epitomized by extensive work in cardiosphere-derived cells (CDCs)2. These cardiac stromal / progenitor cells4, which are clinically efficacious in advanced Duchenne muscular dystrophy5, 6, work by secreting EVs laden with non-coding RNAs (ncRNAs)7. While previous investigations focused on the role of micro RNAs (miRs) as potential effectors7-9, miRs are relatively scarce in EVs10. Much more prominent in human CDC EV cargo are small Y RNAs, notably EV-YF1, a 56-nucleotide (nt) truncated product of the human Y RNA4gene10. When synthesized and packaged into lipid nanoparticles (LNPs), EV-YF1 exerts salutary effects in models of myocardial infarction (MI)10, angiotensin-induced cardiac hypertrophy11, and hypertrophic cardiomyopathy12. But clinical translation of EV-YF1 is challenging: at 56 nt, it is relatively long (all FDA-approved ncRNA drugs are 18-30 nt)13, and, being unmodified, it is predicted to be unstable and immunogenic14. To bypass these limitations, TY1, a smaller (24 nt) new chemical entity bioinspired by EV-YF1, was creatred. Here it is shown that TY1 exerts profound therapeutic efficacy in MI by suppressing genotoxic stress, in a mechanism dependent on macrophages.Examplc 2: Structure-activity relationship studies yield lead compound TY1,

[0239] This non-limiting example shows the development of TY1, which is a shorter, more stable new chemical entity that conforms to the structural conventions of FDA- approved ncRNA drugs, while retaining the bioactivity of EV-YF1.

[0240] Drug development efforts began by pinpointing small Y RNA species of unknown function, but highly enriched in CDC EVs, and testing especially plentiful species for bioactivity. One such species, EV-YF1, was extensively characterized having shown itself to be effective in various models of MI and / or hypertrophy10'12. FIG. 1A shows the aligned sequences of EV-YF1 (top; SEQ ID NO: 1) and NT4 (bottom; SEQ ID NO: 2), a truncated species (bottom) which is also plentiful in CDC EVs15. Both EV-YF1 and NT4 increase the expression of the anti-inflammatory cytokine 1110 in rat BMDM (FIG. IB), an in vitro finding which correlates well with in vivo disease-modifying bioactivity10'12. Using NT4 to define a 24 nt-long region of particular interest within EV-YF1, various modified versions were systematically made and screened in vitro for 1110 upregulation in BMDM10. First the natural sequence was mutated, then locked nucleic acids (LNAs) were included, and finally methylated nucleotides or adenines were added (FIG. 1C). The overall goal was to preserve bioactivity while optimizing structure, following what has been learned about structureactivity relations from successful ncRNA drug development studies16'18. Substituting the first residue (guanine) with cytosine (NT41G'C) yielded greater 1110 upregulation than uracil or adenine substitutions, which were largely inert (FIG. ID). LNAs that increase the stability of stem-loop structures were then added to NT41G Cstructures16. The inclusion of three alternating LNA residues on both ends of the oligonucleotide (NT41G'C3 alt.) enhanced the functionality of NT41G'C, while using all LNA nucleotides (NT41G'C3 All) or three LNA consecutive residues on each end (NT41G'C3 cons) abrogated bioactivity entirely (FIG. IE). The optimal lead compound, NT41G'C3 alt., was dubbed Therapeutic Y RNA 1, or TY1 (FIG. IE).

[0241] Further modifications designed to minimize RNA degradation were then examined. Exonucleases that target the 3' end are inhibited by adding a methyl group on the ribose sugar of the dNTP (2’-O-methylation)19, or adenine residues (1 or 2 adenine additions have been shown to provide maximal stability20). In mouse BMDM, addition of a single adenine (TYl lm) or one methylated residue (at the 3’ terminal guanine; TY11A) modestlyenhanced 1110 expression (FIG. IF), but this observation did not hold up in human macrophages (FIG. 1G). Based on these collective results, TY1 was chosen for further development.

[0242] To recap, relative to NT4, TY1 contains a point mutation (G to C) at its5 'end, as well as six LNA modifications at the residues underlined (FIG. 1H). As a control, a scrambled version (Scr) containing the same nucleotides as TY 1 but in random order (and verified to lack sequence homology to either the mouse or human genomes) was created with6 LNAs at the same positions (FIG. 1H). Finally, to quantify stability, TY1 and its precursor molecules (EV-YF1 and NT4) were exposed to exonuclease degradation (RNAse R), the primary degradation pathway of small RNAs in vivo21'23. TY1 exhibited remarkable stability with exposure to increasing concentrations of RNase R, unlike the unmodified variants which were degraded by RNase R in a concentration-dependent manner (FIG. II). Finally, to assay therapeutic effects beyond 1110 production, LPS-challenged macrophages were exposed to TY1, Scr, or vehicle. Mimicking the bioactivity of EV-YF110and NT424, TY1 reduced the expression of stress and inflammatory markers including P21 (FIG. 1J), NFkb (FIG. IK), and 116 (Fig. IL) in BMDM. Thus, TY 1 is a shorter, more stable new chemical entity that conforms to the structural conventions of FDA-approved ncRNA drugs, while retaining the bioactivity of EV-YFl.

[0243] Figure 1: TY1 is an engineered small RNA with anti-inflammatory properties. (A) Alignment of EV-YF1 and NT4, both of which are abundant in the extracellular vesicles (EVs) secreted by cardiosphere-derived cells (CDCs). (B) As has been shown for EV-YF1, NT4 upregulates 1110 expression in rat bone marrow-derived macrophages (BMDM) compared to vehicle controls (n=6 biological replicates per group). (C) Schematic of three-step screening of NT4-derived structural variants for optimization of activity. Step 1 (top panel): mutagenesis; step 2 (middle panel), the inclusion of locked nucleic acids (LNA; phase 2); step 3 (bottom panel), poly-adenylation and methylation of 3' residues. (D-G) Screening of compounds was performed in murine and human macrophage using 1110 expression assays n=3-4 biological replicates per group. (D) Step 1 screening of different nucleotide substitutions of the most 5' nucleotide (a guanine; all groups compared to NT4). (E) Step 2 screening of variants including LNAs (all groups compared to NT41G'C). (F, G) Step 3 screening evaluating the adenylation and methylation at the 3' end of TY1 in mouse andhuman macrophages, (all groups compared to TY1). (H) Comparison of naturally-occurring NT4 and its optimized, bioinspired derivative (TY1). Also depicted in (H) is the sequence of a scrambled variant (Ser) with the same nucleotide content and LNAs, which serves as a control in panels (F and G). (I) Stability of TY1, NT4, and EV-YF1 exposed to increasing concentrations of the exonuclease RNAse R (n=3 biological replicates per group). BMDM preexposed to TY1 before lipopolysaccharide (LPS) exposure showed reduced markers of senescence (P21; J), and inflammation (Nfkb and IL6; K, L) compared to vehicle or scrambled sequence (n=3 biological replicates). Bars and line dots represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***; PcO.OOl. *; denotes comparison between groups and vehicle, f; denotes comparison between groups and control.Example 3: TY1 activates genotoxic response genes and attenuates cell stress through mRNA stabilization of Trex 1.

[0244] This non-limiting example shows bioactivity of TY1 in attenuating cell stress through mRNA stabilization of TrexE

[0245] In BMDM, TY 1 induced profound transcriptomic changes (heat map, FIG. 2A). Ingenuity Pathway Analysis implicates the DNA damage response as a primary pathway activated by TY 1 (FIG. 2B). Interrogating differentially expressed DNA-damage response genes identified the Trexl-cGAS / STING pathway as especially enriched (circumscribed with dashed box; FIG. 2C, D). Downstream of the genotoxic stress pathway, anti-inflammatory mediators (FIG. 2E), the unfolded protein response sensors of the ER (UPR: FIG. 2F), and the effector E1-E3 ubiquitin system were upregulated (FIG. 21). Attenuation of genotoxic stress, coupled with enhanced ability to clear misfolded proteins, would logically suppress cell stress signaling more broadly, a prediction borne out by the finding that MAPK signaling was downregulated by TY1 (FIG. 2J). DNA damage caused by oxidative injury promotes ER stress, which in turn, leads to lower protein-folding capacity and the accumulation of stress granules containing misfolded proteins. Consistent with suppression of the unfolded protein response, TY 1 decreased ER-stress-induced misfolded protein (aggresome) accumulation in LPS-exposed BMDM, compared to Scr or vehicle (FIG. 2G, H).

[0246] To investigate the mechanism by which TY1 imparts its transcriptomic effects, the subccllular localization of TY1, at its baseline and under stress conditions, was determined. In LPS-stressed BMDM, TY1 preferentially localizes to the nuclear fraction, in contrast to its predominantly cytosolic localization in unstressed BMDM (FIG. 2K). To further examine proteins that associate with TY1, a protein pull-down was performed where biotinylated TY1 (or the native NT4) was incubated with BMDM lysate followed by mass spectrometry of the bound fraction (FIG. 2L). Both TY 1 and NT4 associated with nuclear pore proteins (nucleoporins), shuttling proteins (Ran GTPase system), and mRNA binding proteins (FIG. 2M and 2N).

[0247] Figure 2: TY1 reduces cell stress in macrophages through attenuation of genotoxicity and localizes to the nuclear membrane under stress conditions. (FIG. 2A) Heatmap of RNA sequencing data from rat bone marrow-derived macrophages (BMDM) exposed to vehicle (PBS) or TY1 (n=4 biological replicates per group). (FIG. 2B) Ingenuity Pathway Analysis (IPA) identifies DNA repair as major implicated pathway in TYl-exposed macrophages (dashed box). (FIGs. 2C, 2D) Heatmap showing all differentially expressed DNA repair genes with unique enrichment of Trexl signaling. Downregulation of (FIG. 2E) inflammatory, and (FIG. 2F) unfolded protein response (UPR) genes. LPS-stressed macrophages exposed to TY1 showed a lower burden of misfolded protein aggregates (aggresomes) compared to scramble and vehicle as measured by the amyloid aggregate dye, ProteoStat (FIGs. 2G, 2H; co-stained with DAPI; n=7-8 biological replicates per group). Scale bars: 100 pm. Bars represent group means and error bars represent s.d. Analysis of two groups was done using a two-tailed Student’s t test with a 95% CI. Analysis of three or more groups was done using One-way ANOVA; *,P<0.05; **, P<0.01; ***P<0.001. (FIG. 21) In bone marrow-derived macrophages, TY1 upregulated genes of the ubiquitination pathway and suppressed stress-induced (FIG. 2 J) MAP-ERK signaling. (FIG. 2K) Enrichment of TY I in the nuclear fraction of LPS- stimulated macrophages compared to vehicle- stimulated macrophages (n= 3 biological replicates per group). (FIG. 2L) Mass Spectrometry of protein pull down from incubating macrophage lysates with biotinylated TY1 demonstrates association with (FIG. 2M) nucleoporin proteins, RAN GTPase proteins, and mRNA binding proteins. Collectively, (FIG. 2N) these finding suggest that TY 1 associates with proteins of the inner nuclear membrane.

[0248] Given that it localizes to the nucleus, the possibility that TY 1 might interact directly with selected mRNA transcripts was explored. Thus, a mRNA pull down was performed using two complementary methods: a “bait method” in which biotinylated TY1 is incubated with BMDM lysate, or a “probe method” exposing rat BMDM to TY 1 followed by retrieval using a biotinylated anti-sense probe (FIG. 3A). Bound mRNA species retrieved by either approach were evaluated using RNA sequencing. The two methods yielded 99 mRNAs in common (FIG. 3B), which were then cross-referenced to previous sequencing data (FIG. 2A-D). Of the 99 genes identified by both the bait and probe approaches, 1 were upregulated and 8 were downregulated (FIG. 3C). The gene with the greatest TYl-induced upregulation in rat BMDM was Trexl, i.e., 3' repair exonuclease I (identified earlier in FIG. 2C, 2D), which was similarly upregulated in mouse macrophages (FIG. 3M).

[0249] In a mouse monocyte line (Raw264.7 cells), TY1 increased TREX1 protein expression (FIG. 3N, 30). Finally, Raw264.7 cells pre-incubated with TY1 were protected against DNA damage induced by serum starvation (FIG. 3P, 3Q).

[0250] Both mRNA pulldown methods identified Trexl as a potential binding partner of TY1 (FIG. 3D, 3E). Small RNAs regulate mRNA transcripts through 3’ or 5’ untranslated regions (UTR)28. A UTR-lucif erase assay demonstrated preferential binding of TY 1 to the 5’ UTR (FIG. 3F), but no binding to the 3’ UTR of human Trexl (FIG. 3G), both compared to Scr. Binding of small RNAs to the 5’ UTR can enhance mRNA stability, loading to the ribosomal complex, and resistance to mRNA degradation29'31. Therefore, the idea that TY 1 binds and stabilizes Trexl mRNA, thereby enhancing its expression was tested. Exposing BMDM to TY1 significantly upregulated Trexl expression (FIG. 3H), and TY1 partially rescued Trexl expression (FIG. 31) and 1110 expression (FIG. 3J) in BMDM transfected with Trexl -silencing RNA (siRNA). In turn, overexpression of Trexl (via knock-in plasmid; Trexl OE) dramatically increased 1110 in BMDM (FIG. 3K). In conclusion, TY1 upregulates the genotoxic stress response mediator, Trexl, by binding the 5’ UTR region of the transcript and enhancing its expression. Upregulation of Trexl enhances the expression of the antiinflammatory cytokine IL- 10, motivating us to test whether Trexl upregulation might suffice to explain the salutary effects of TY1.

[0251] Exposing Raw264.7 macrophages to the transcriptional inhibitor actinomycin D after exposure to TY1, Scr, or vehicle showed comparable mRNA lifetime curves for TREX1, excluding an mRNA stabilization effect of TY 1 (FIG. 3L).

[0252] Figure 3: TY1 attenuates cell stress through mRNA stabilization of Trexl, and TY1 upregulates Trexl in mouse macrophages. (FIG. 3A) Schematic for two orthogonal approaches to identifying RNA targets of TY1. (FIG. 3B) Venn Diagram showing genes identified using TY1 RNA targets. (FIG. 3C) TY1 RNA targets up and down regulated in the RNA sequencing of macrophages exposed to TY 1 (compared to macrophages exposed to vehicle; n=5 biological replicates per group). (FIGs. 3D, 3E) Sequencing reads of RNA- RNA pulldown showing enrichment of Trexl enrichment using the bait capture method (FIG. 3D) and the probe-capture method (FIG. 3E; n=3 biological replicated per group). Untranslated region (UTR)-luciferase assay demonstrating stabilization of luciferase signal via binding the 5’ UTR (FIG. 3F) but not the 3’ UTR (FIG. 3G) of Trexl. (FIG. 3H) QPCR validation of Trexl upregulation in bone marrow-derived macrophages (n=3 biological replicates per group). Suppression of Trexl in macrophages is partially rescued with TY1 exposure (FIG. 31) along with 1110 expression, (FIG. 3J; n=4 biological replicates per group). (FIG. 3K) Trexl upregulation leads to enhanced 1110 expression in macrophages (n=3 biological replicates per group). Bars represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA with Tukey’s post-test; *P<0.05; **, P<0.01; ***, PcO.OOl. (FIG. 3L) TY1 does not impact stability of existing TREX1 mRNA as shown by comparable decay rates (by qPCR) post treatment of Raw 264.7 macrophages incubated with the transcription inhibitor actinomycin D (10 pg / ml). (FIG. 3M) QPCR of mouse bone marrow-derived macrophages demonstrating dose-dependent upregulation of Trexl with exposure to increasing concentration of TY1 (n=3 biological replicates per group). Analysis was done using Student’s t test with 95% CI; *Pc0.05; **, PcO.Ol; ***, PcO.OOl. (FIGs. 3N, 30) In a mouse monocyte line (Raw264.7 cells), TY1 increased TREX1 protein expression (FIGs. 3P, 3Q) Comet assay showing Raw264.7 cells pre-incubated with TY 1 were protected against DNA damage induced by serum starvation.Example 4: TY 1 enhances tissue repair in MI.

[0253] This non-limiting example shows that TY1 enhances tissue repair in MI.

[0254] In vivo studies were begun by investigating the toxicity of TY 1 . Healthy mice receiving twice-weekly intravenous (IV) injections of TY1 (0.15 mg / kg, based on prior dose optimization of EV-YF1(23), and again formulated in DharmaFECT®) for four weeks (FIG. 4Z) exhibited unchanged body weight (FIG. 4AA), blood counts (FIG. 4BB), organ weights (FIG. 4CC) and blood chemistry analyses (FIG. 4DD) relative to vehicle or Scr controls (also formulated with DharmaFECT®). The precursor molecules EV-YF110and NT424exert cardioprotective effects in MI; thus, the in vivo bioactivity of TY 1 in two MI models was tested (FIG. 4A and 4W) In the first model, rats received an IV infusion of 0.15 mg / kg of TY 1 or Scr or vehicle 20 minutes post-MI. Forty-eight hours post-MI, a single dose of TY 1 administered after reperfusion sufficed to blunt circulating levels of the ischemic biomarker cardiac troponin I (Fig. 4B and 4L) and to decrease infarct size (Fig. 4C, 4D and 4K) relative to vehicle or Scr. The decrease in infarct size directly demonstrates cardioprotection, while lower troponin I levels signify decreased cardiomyocyte necrosis.

[0255] Consistent with TYl’s proposed mechanism of action, TREX1 protein levels were elevated (FIG. 4M).

[0256] To test for consistency with the in vitro findings (FIG. 3), post-MI rat LV sections were stained for the macrophage marker, CD68, and Trexl (FIG. 4E, 4EE). Tissue CD68 levels were unchanged in all groups (FIG. 4E, 4F, 4EE, 4FF) suggesting that TY 1 does not affect overall macrophage infiltration. Tissue Trexl levels were also similar in all groups (FIG. 4E, 4G, and 4EE); however, Trexl levels in macrophages (CD68+ cells) were significantly higher in hearts from MI that had received TY 1 versus Scr or vehicle (FIG. 4H, 4GG). Compared to cardio myocytes, endothelial cells, and other more plentiful cell types, macrophages are sparse in myocardium, rationalizing why a selective increase of Trexl in macrophages would be unresolvable in bulk heart tissue. Despite their sparsity, macrophages can dramatically tilt the balance between death and recovery post-MI. Indeed, evidence that enhanced Trexl in macrophages suffices to attenuate genotoxic stress in the post-MI myocardium comes from staining for the DNA damage marker phospho-histone 2AX (pH2AX; FIG. 41, 4N). Bulk heart tissue analysis revealed significantly attenuated DNA damage in animals given TY 1 compared to vehicle or Scr (FIG. 4J, 40).

[0257] Therapeutic benefits persisted at least 3 weeks post-MI (FIG. 4P), at which time rats that had received TY 1 exhibited increased left ventricular function (FIG. 4Q, 4R),attenuated chamber remodeling (FIG. 4S, 4T) and reduced myocardial scar (FIG. 4U, 4V) relative to vehicle.

[0258] To ascertain that these cardioprotective effects were not limited to rodents, whether TY 1 ’ s cardioprotective effects could be reproduced in a clinically relevant porcine model of MI was tested (FIG. 4W). As in rats, IV infusion of TY1 post-MI in pigs reduced infarct size (FIG. 4X, 4Y).

[0259] Taken together, the findings from two complementary models indicate that TY1 is highly effective in cardiac tissue repair post-MI. TY1 upregulates TREX1 (especially in infiltrating macrophages), reduces DNA damage, and augments cardiac tissue repair post- MI. Furthermore, TY1 upregulates Trexl in infiltrating macrophages, leading to reductions in post-MI DNA damage and tissue necrosis.

[0260] Figure 4: TY 1 reduces infarct size in a rat model of MI; TY 1 attenuates infarct size in a porcine model of MI and chronic intravenous exposure of TY1 is well tolerated in healthy animals. (FIG. 4A) Study design for TY 1 administration in a rat model of acute myocardial infarction (n=4-5 animals per group). Rats received ischemia reperfusion injury (45 minutes of ischemia) followed by intravenous administration of TY1 (0.15 mg / kg), TY1 scramble control (0.15 mg / kg), or vehicle. Forty-eight hours post-injury, animals receiving TY 1 had (FIG. 4B) lower circulating cardiac troponin and (FIGs. 4C, 4D) reduced infarct size. (FIG. 4E) Immunofluorescence of the left ventricles of MI animals (DAPI, CD68 and Trexl; scale bar: 100 pm). Pooled data (n=3-4 animals per group) demonstrates comparable macrophage infiltration (CD68; FIG. 4F) and Trexl (FIG. 4G). However, (FIG. 4H) macrophages in TY 1 -exposed animals had significantly higher levels of Trexl compared to vehicle or scramble groups. (FIG. 41, 4J) TYl-exposed animals had lower levels of genotoxic stress as measured by the DNA damage marker phosphor H2AX (pH2AX, scale bar: 1 mm) compared to vehicle and scramble groups. Lines represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***p<0.001. (FIG. 4K) Forty-eight hours post-injury (see, FIG. 4A), animals receiving TY1 had reduced infarct size. (FIG. 4L) Forty-eight hours post-injury (see, FIG. 4A), animals receiving TY1 had lower circulating cardiac troponin (cTNI). (FIG. 4M) Western blot showing increase of TREX1 in LV tissue of animals receiving TY1 compared to scramble or control groups. (FIG. 4N) TYl-exposed animals had lower levels of genotoxic stress asmeasured by the DNA damage marker phosphor H2AX (pH2AX, scale bar: 1 mm) compared to vehicle and scramble groups. (FIG. 40) TYl-cxposcd animals had lower levels of genotoxic stress as measured by the DNA damage marker phosphor H2AX (pH2AX; compared to vehicle and scramble groups. (FIG. 4P) Study design for long term follow-up of MI animals receiving a single dose of TY1, Scr, and vehicle. Rats receiving TY1 preserved ejection fraction (FIG. 4Q), fractional shortening (FIG. 4R), end systolic (FIG. 4S) and diastolic volumes (FIG. 4T), and reduced fibrotic burden (FIGs. 4U, 4V). Lines represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***P<0.001. (FIG. 4W) Study design for TY1 administration in a porcine model of acute myocardial infarction (n=5 animals per group). Pigs received ischemia reperfusion injury (90 minutes of ischemia) followed by intravenous infusion of TY1, TY1 scrambled control (0.15 mg / kg), or vehicle. (FIGs. 4X, 4Y) Forty-eight hours post- injury, pigs receiving TY1 had reduced smaller infarct size to both scramble and vehicle. Lines represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***P<0.001. (FIG. 4Z) Study design for chronic intravenous (retro-orbital) exposure toxicity study (n=5 animals per group). (FIG. 4AA) Animal weight profile over weeks of TY 1 exposure. (FIG. 4BB) Complete blood count, (FIG. 4CC) organ weights, and (FIG. 4DD) blood chemistry of animals at four weeks. (EE) Immunofluorescence of the left ventricles of MI animals (DAPI, CD68 and TREX1, scale bar: 100 pm). Pooled data (n=3-4 animals per group) demonstrates comparable macrophage infiltration (CD68; FIG. 4FF). (FIG. 4GG) TREX1 was also enriched in the macrophages in TY 1 -exposed animals compared to vehicle or scramble groups. Bars represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***P<0.001. Scale bars: 100 pm.Example 5 : Macrophages mediate the cardioprotective effects of TY 1

[0261] This non-limiting example shows that macrophages mediate the cardioprotective effects of TY 1..

[0262] The observation that TY1 upregulates Trexl in cardiac macrophages, but not more broadly in heart tissue, led to investigation of the role of macrophages as potential effectors of TY1 benefits. To this end, macrophages in rats were depleted prior to MI (FIG.5A-5C). When given TY1 , macrophage-depleted animals showed no reduction of infarct size relative to Scr, whereas animals with functional macrophages showed significant cardioprotective effects (FIG. 5B, C). This suggests that macrophages are required for the in vivo benefits of TY1. To determine whether macrophages suffice to confer cardioprotection, adoptively transferred rat BMDMs were transfected with vehicle, Scr, TY1, or a Trexl - overexpressing plasmid (FIG. 5D) or TY1 plus anti-TREXl siRNA (siTREXl: Fig. 5G). Animals that received macrophages exposed to TY1, or that were enriched in Trexl, had significantly smaller infarct sizes compared to Scr or vehicle groups (FIG. 5E, 5H, 5F and 51). Thus, adoptive transfer of macrophages exposed to TY1 suffices to induce cardioprotection, an effect mimicked by infusion of macrophages overexpressing Trexl. Collectively, these findings demonstrate that macrophages are necessary and sufficient mediators of TY1 therapy. The additional finding that siTREXl blocked the cardioprotective effect of TY1 (Fig. 5H and 51) directly links TREX1 upregulation in macrophages to the mechanism of TY1 action and the conclusion that macrophages are necessary and sufficient for TY 1 cardioprotection, which in turn is due to TREX1 upregulation.

[0263] Figure 5: Macrophages mediate the effects of TY1 cardioprotection.(A) Macrophages were depleted from rats through daily intravenous administration of clodronate prior to induction of myocardial infarction. Animals were given TY1, scramble, or control 20 minutes post reperfusion. (B, C) TY1 reduces scar size (compared to vehicle to scramble groups) in animals with functioning macrophages. However, TY1 therapeutic activity is attenuated by macrophage depletion in rats as shown by comparable scar size to vehicle or scramble groups (B, C; n=4 animals / group). (D) In a separate study, rats with MI received tail vein infusions of macrophages (3 x 106cells / animal) transfected with TY1, scramble, vehicle, or a Trexl activating plasmid (D; n=3-5 animals per group). (E, F) Animals with MI given macrophages overexpressing TY1 or Trexl had significant reductions in scar size compared to animals given macrophages transfected with scramble or vehicle. (G) In a separate study, rats with MI received tail vein infusions of macrophages (3 x 106cells / animal) transfected with TY1, scramble, vehicle, or a TREX1 activating plasmid (G; n=3-5 animals per group). (H, I) Animals with MI given macrophages overexpressing TY1 or TREX1 had significant reductions in scar size compared to animals given macrophages transfected withscramble or vehicle Lines represent group mean and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***P<0.001.Example 6:

[0264] This non-limiting example summarizes the results shown in Examples 2-5. A small synthetic ncRNA molecule, bioinspired by a natural cargo component of EVs, exerts remarkable bioactivity against MI, a disease marked by inflammation and loss of healthy heart tissue. The benefits of TY1 are specific: a scrambled version had no effect, and the changes are directionally opposite to those expected from the nonspecific immunogenicity that plagues many other ncRNA drugs17. Here it has been shown that this novel, biologically-based drug is effective in two different animal models of MI. TY1 is the product of a novel discovery paradigm: mining EVs for ncRNAs previously unrecognized as bioactive, then using those natural compounds as bioinspiration for new chemical entities. Unlike previous ncRNA drugs, which were designed with a specific genetic target in mind37, TY 1 was created from a natural product of unclear mechanism. Here, the bioactivity was first documented and then the mechanism was probed.

[0265] TY1 exerts its tissue-reparative effects by enhancing the cell’s ability to relieve genotoxic stress. Mechanistic dissection identified Trexl as a target of TY 1. By binding to the 5’ UTR of the Tre l mRNA, TY 1 enhances TREX1 translation and bioactivity. TREX1 degrades DNA fragments that would otherwise activate cGAS-STING innate immune signaling and promote inflammation38. Indeed, TREX1 deficiency is associated with systemic lupus erythematosus and other autoimmune disorders39, 40. While Trexl has not previously been identified as a drug target, its enhancement would logically be predicted to attenuate tissue injury associated with sterile inflammation, as seen in MI.

[0266] Additionally, it is shown that macrophages are required for the cardioprotective effects of TY 1 in vivo and that those effects are mimicked by the adoptive transfer of macrophages overexpressing Trexl. This finding is not surprising, given that macrophages are known to be critical mediators of EV cardioprotection9, 41, 42. Nevertheless, the fact that macrophages are both necessary and sufficient for TY1 bioactivity in vivo markedly simplifies mechanistic dissection. This bioinspired new chemical entity acts in amanner unprecedented among approved ncRNA drugs, none of which relies on macrophages for its actions (at least, not by design).

[0267] These findings have far-reaching implications. Though the focus here has been on MI, the same cell stress pathways figure prominently in diverse pathologies. Thus, TY 1 is worth testing in models of other diseases driven by DNA damage and / or inflammation, including (but not limited to) scleroderma43'44and Duchenne muscular dystrophy45, 46. In contrast to the existing ncRNA pharmacopeia, TY 1 does not work as a miR or small interfering RNA, nor is it an aptamer or antisense molecule, making it the prototype for a new class of RNA drugs. These findings underscore the potential of investigating otherwise obscure, EV- derived ncRNA molecules in developing next-generation therapeutic candidates.Example 7 : Experimental Procedures

[0268] This non-limiting example shows experimental materials and procedures used in Examples 2-5.Macrophage Drug Screen

[0269] Synthesis and formulation of RNA compounds TY1 and derivatives were synthesized (IDT) and mixed with 3 pl DharmaFECT® transfection reagent (Horizon Discovery) to a final volume of 100 pl in serum-free media. Following agitation and incubation (to form liposomal-RNA complexes), the preparation is added to macrophage culture media to a final concentration of 80 nM, for in vitro applications. For in vivo applications (intravenous), a similar formulation is prepared to achieve a dose of 0.15 mg / kg. The same process is repeated with each of the new chemical variants of TY 1 and with Scramble (Scr).

[0270] Rodent bone marrow cell isolation, macrophage differentiation, and activation Femurs were isolated from 7-10-week-old Wistar Kyoto rats or C57BL6 mice, as indicated. Bone marrow was isolated by flushing with phosphate-buffered saline (PBS) and then filtering through a 70 pm mesh. Red blood cells were lysed with ACK buffer (A1049201, Invitrogen); the remaining cells were resuspended in IMDM (Gibco) containing 20 ng / ml M- CSF (RP8643, Fisher Scientific) and plated. The media was exchanged every 2-3 days until day 7, in a process that yields bone marrow-derived macrophages (BMDM). BMDM were transfected with small Y RNAs (or Scr; 80 nM) after encapsulation in DharmaFECT®. For lipopolysaccharide (LPS) exposure, macrophages were pretreated with vehicle(DharmaFECT® + PBS), TY1 (80 nM, in DharmaFECT® + PBS), or TY1 Scr control (80 nM, in DharmaFECT® + PBS) for three hours followed by exposure to LPS (10 ng / ml; Cayman Chemical). Twenty-four hours after exposure to each test agent, RNA was extracted and subjected to RNA seq (detailed below) or to analysis by quantitative polymerase chain reaction (qPCR) to determine transcript levels, as indicated.

[0271] Human bone marrow-derived macrophages Human peripheral blood monocytes were purchased (STEMCELL Technologies), and cultured in RPMI 1640 Medium with 10% FBS, and human M-CSF (Invitrogen) to create macrophages. Macrophages were transfected with small Y RNAs (or Scr; 80 nM) after encapsulation in DharmaFECT®. Twenty-four hours after exposure to each test agent, RNA was extracted and subjected to analysis by quantitative polymerase chain reaction (qPCR) to determine transcript levels of the anti-inflammatory cytokine IL10, and HPRT1, a housekeeping enzyme used as an endogenous control.

[0272] Comet Assay: BMDM cultured in IMDM and 2% FBS were transfected with TY1, vehicle (transfection agent [Dharmafect] only) or control (untreated) for 4-5 hours in Optimem. Following transfection, the media was changed to fresh IMDM with 2% FBS overnight. Raw264.7 cells cultured in DMEM (ATCC) and 2% FBS were transfected with TY1, scramble, or control (untreated) for 4-5 hours in Optimem. Following transfection, the media was changed to fresh DMEM with 2% FBS overnight.

[0273] Cells were washed twice with PBS, then incubated with CTS Versene (Gibco) for 5 minutes at 37 °C and gently scraped with a cell scraper to detach cells. Cells were centrifuged at 700 x g for 2 minutes, supernatant discarded, and the cell pellet was washed once with cold PBS. Cells were centrifuged again and resuspended in 25pL of cold PBS. Cells were frozen at -80°C to permeabilize cell membrane. Positive control was made using healthy cells that were serum starved on ice for 6 hours. Following permeabilization, cells were resuspended to a concentration between 1 x 105cells / mL to 5 x 105cells / mE. Cells were combined with low-melting point Comet agarose in a ratio of 1:10 by volume and pipetted onto pre-prepared microscope slides with 1% agarose. Glass coverslips were used to set the agarose in place. Slides were transferred to the 4°C for 15 minutes in the dark before removing coverslips. Slides were allowed to fully set at 4°C for an additional 15 minutes. Slides were immersed in cold Eysis Buffer (2.5M NaCl, lOOmM EDTA, 10% DMSO, 10% 10X EysisSolution from Cell Biolabs, pH 10.0) for 60 minutes at 4°C in the dark to further permeabilize cells. Lysis Buffer was removed, and slides were immersed in cold Alkaline Solution (300mM NaOH, ImM EDTA) for 30 minutes at 4°C to denature DNA. Alkaline Solution was removed, and slides were transferred into a horizontal cold electrophoresis chamber with cold Alkaline Electrophoresis Solution (300mM NaOH, ImM EDTA). Voltage was applied for 45 minutes at 1 volt / cm with a current setting of 300 mA. Slides were removed from the electrophoresis chamber and washed 3X with pre-chilled DI H2O for 2 minutes per wash. Slides were washed with cold 70% ethanol for 5 minutes. Slides were allowed to dry at 37 °C for 30 minutes. Slides were stained with diluted Vista Green DNA Dye from Cell Biolabs (in TE Buffer, pH 7.5) for 15 minutes at room temperature, then left to dry before viewing with Cytation 5 using the GFP FITC filter. Comets were quantified using the “Cellular Analysis” program in Cytation 5 to measure the size, area, and fluorescence of the comet head and tail to generate the Olive Tail Moment calculation.

[0274] Iti A isolation and quantitative PCR Total RNA was extracted from mouse, rat, and human cells using RNeasy Plus Kit (74136, QIAGEN) and MaXtract High Density (129056, QIAGEN) and / or miRNeasy Mini Kit (217004, QIAGEN). cDNA was synthesized from RNA using High-capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems) according to the manufacturer’s protocol. Real-time PCR (QuantStudio 12K Flex Real-Time PCR system; Thermo Fisher Scientific) was performed in triplicate using the following TaqMan Gene Expression Assay probes (Cat# 4331182; with corresponding Assay IDs in Table 2); Differential gene expression analysis was done using the AACt method.Table 2: Assay IDs for TaqMan Gene Expression Assay ProbesSpecies Gene Assay IDRat 1110 Rn01483988_glRat IL6 Rn01410330_mlRat P21 Rn00589996_mlRat NF-kB Rn01399572_mlMouse 1110 Mm01288386_mlMouse P21 Mm04205640_glHuman 1110 Hs00961622_mlRat Trex! Rn03062330_slMousc Trcxl Mm01229287_ml

[0275] RNA Sequencing Cell and tissue RNA samples were sequenced at the Cedars-Sinai Genomics Core as described47. Total RNA samples were assessed for concentration using a Qubit fluorometer (ThermoFisher Scientific, Waltham, MA) and for quality using the 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Library construction was performed using the QIASeq Stranded RNA Library kit (Qiagen, Hilden, Germany) with QIAseq FastSelect - rRNA HMR Kit (Qiagen) for ribosomal RNA depletion. Library concentration was measured with a Qubit fluorometer and library size on a Bioanalyzer. Libraries were multiplexed and sequenced on a NovaSeq 6000 (Illumina, San Diego, CA) using 75 bp single-end sequencing. On average, approximately 50 million reads were generated from each sample.

[0276] Data analysis Raw sequencing data were demultiplexed and converted to FASTQ format by using bcl2fastq v2.20 (Illumina, San Diego, California). Reads were aligned to the GRCm38 reference genome (http: / / www.gencodegenes.org) using STAR (version 2.6.1)4 with default parameters. Gene expression was quantified by RSEM (version 1.2.28)5 to generate a raw count expression matrix with gene identities as rows and samples as columns. DESeq2 (version 1.26.0)6 was used to normalize the raw count expression and correct the batch effect.

[0277] Intracellular protein aggresome assay BMDM were pre-exposed to TY 1 or Scr for 4 hours, then exposed to LPS (10 ng / ml) overnight. After washing twice with PBS, cells were fixed in PFA 4% for 15 minutes, permeabilized, and incubated with PROTEOSTAT dye (1:10,000 dilution) for 30 min at RT (ENZ-51035-K100, Enzo Life Sciences). PROTEOSTAT-stained cells were imaged by epi-fluorescence microscopy for aggresomes and aggresome-like inclusion bodies.

[0278] Nuclear / cytosolic RNA isolation and qPCR analysis Nuclear and cytosolic RNA were purified using Cytoplasmic and Nuclear RNA Purification Kit (Norgen Biotek) according to the manufacturer’s protocol. Reverse transcription was performed using TaqMan® microRNA Reverse Transcription Kit (Applied Biosystems) per the manufacturer’s protocol, using specific primers for TY1. Real-time PCR was performed using TaqMan FastAdvanced Master Mix and appropriate TaqMan Gene Expression Assay (Thermo Fisher Scientific). The reaction was performed in QuantStudioTM 12K Flex Real-Time PCR System, and each reaction was performed in triplicate samples and adjusted using snu6 as housekeeping (Fife Technologies). Cycling conditions were performed according to the TaqMan protocol. Where appropriate, the 2-AACt method was used to determine gene expression fold change.

[0279] Protein Pulldown TY1 and Ser were labeled with desthiobiotinylated cytidine bisphosphate at the 3' end of the RNA strands using T4 RNA ligase (Thermo Scientific Pierce RNA 3' End Desthiobiotinylation Kit). Eabeled RNA was captured using 50 pF streptavidin magnetic beads in RNA Capture Buffer for 30 minutes at room temperature. Beads were washed twice in 20mM Tris (pH 7.5), once in Protein-RNA Binding Buffer, and 400 pg of BMDM extract was added per sample. Samples were incubated for 2 hours at 4°C, washed three times with Wash Buffer, and eluted after 15 minutes of incubation at 37°C with Biotin Elution Buffer. Samples were then analyzed by mass spectrometry (Molecular Instrumentation Center, UCEA).RNA-RNA Pulldown

[0280] Bait capture method: To identify mRNA targets of TY 1 using bait capture, lysates (400 pg of protein extract per sample) were incubated with 3’ biotinylated TY 1 and Scr sequences. After samples were washed with binding and wash buffers to remove unbound material (using a magnetic stand), RNA was extracted using column-based RNA purification (miRNAeasy; Qiagen). Following RNA purification, concentrations were measured, standardized, and submitted to the Cedars-Sinai Genomics Core for RNA quality evaluation (to ensure RNA integrity number [RIN]) followed by total RNA sequencing.

[0281] Probe-based mRNA capture: BMDM were incubated with 80 nM TY1, Scr, or vehicle for 18 hours. Cell lysates were then obtained and incubated for 18 hours with probe sequences relevant to the group (i.e., TY 1 probes for TY 1-exposed samples; Ser-specific probes for Ser-exposed samples; and both probe types for Vehicle groups, as negative controls; 100 pmol per sample). RNA was then extracted and sequenced as described in the bait-capture method above.3’ and 5’ UTR binding assays

[0282] 3’ UTR binding assay: HT1080 cells were cultured in IMDM with 10%FBS and seeded at 60-80% confluence prior to transfection. Cells were transfected with plasmids at a concentration of 120 ng / well (in FuGene HD transfection reagent [Promega] at a ratio 5:1 Fugene: vector) containing constructs containing the 3’ UTR sequence of human TREX1 (or respective controls; Gene Copoeia) upstream of a Gaussia luciferase reporter constructs for 4 hours. Cells were then transfected with 80 nM of TY1, Scr, or vehicle formulated in DharmaFECT® for 15 hours. Conditioned media from wells was then collected and measured for luminescence emission using Secrete-Pair Dual Luminescence Assay Kit (gene Copoeia) using a microplate reader.

[0283] 5’ UTR binding assay: HEK293T cells were cultured in EMEM with 10%FBS and seeded at 60-80% confluence prior to transfection. Cells were transfected with plasmids at a concentration of 120 ng / well (in DNAfectin 2100 transfection reagent [ABM]) containing constructs containing the 5’ UTR sequence of human TREX1 (or respective controls; ABM, Inc.) upstream of a firefly luciferase reporter constructs for 4 hours. Media was then replaced to complete media overnight and the cells were then transfected with 80 nM of TY1, Scr, or vehicle formulated in DharmaFECT® for 5 hours. Wells were then measured for luminescence emission using a microplate reader the day after using Luciferase assay kit (ABM).

[0284] Transcription inhibition assay: Raw 264.7 cells (ATCC) were cultured at 80% confluence in DMEM in 2% FBS and transfected with vehicle (DharmaFECT® only) or 80 nM of scramble or TY 1 for 4 hours. Media was then replaced with fresh media containing lOpg / ml of Actinomycin D (in DMSO; Sigma Aldrich). RNA was collected from cells at time 0, 1 hour, 2 hours, and three hours post-exposure with Actinomycin to measure the decay of existing TREX1 mRNA.

[0285] Experimental Animals: All studies were performed at Cedars-Sinai Medical Center in accordance with the Institutional Animal Care and Use Committee guidelines.

[0286] Rat Ischemia / Reperfusion Model Rats (7- 10- week-old female Wistar Kyoto; Charles River Labs, Wilmington, MA) were housed in a pathogen-free facility (cage bedding: Sani-Chips, PJ Murphy) with a 14 hours / 10 hours light / dark cycle with food (PicoLabRodent Diet 20 [no. 5053], Lab Diet) and water provided ad libitum. To induce MI, anesthetized rats underwent thoracotomy at the fourth intercostal space to expose the heart. A 7-0 silk suture was used to ligate the left anterior descending (LAD) coronary artery for 45 min, then removed to allow reperfusion. Twenty min later, vehicle (PBS with DharmaFECT®), TY1, or Ser (either at 0.15 mg / kg, formulated in DharmaFECT® as described above) was injected into the retro-orbital space.

[0287] Macrophage depletion using clodronate liposomes To deplete macrophages, rats were pre-infused with 1 mL clodronate liposomes (Liposoma) via tail vein infusion daily for 3 days prior to induction of MI41.

[0288] Adoptive transfer of macrophages Rat BMDM (prepared as described above) were incubated in vehicle (DharmaFECT® + PBS), 80 nM TY1 or 80 nM Ser (formulated in DharmaFECT®), or transfected a Trexl activation plasmid (Trexl (untagged ORF) - Rat three prime repair exonuclease 1 (Trexl); CAT#: RN203882, ORIGENE) formulated in FuGENE HD (Promega) transfection reagent for 24 hours. In the MI model, 20 minutes after reperfusion, each animal received a single tail vein infusion of 3xl06BMDM which had been exposed to TY1, Scr, or vehicle for 24 hours, as described.

[0289] Rat infarct size measurement Two days post-MI, 10% KC1 was injected into the LV cavity; hearts were harvested, washed in PBS, and cut into 1-mm sections from apex to base, above the infarct zone. Sections were incubated with a 1% solution of 2,3,5- triphenyl-2H-tetrazolium chloride (TTC, Sigma-Aldrich) for 30 minutes at 37°C in the dark and washed with PBS. Then, sections were imaged and weighed. The infarcted zones (white) were delineated from viable tissue (red) and analyzed (ImageJ software). Infarct mass was calculated in the tissue sections according to the following formula: (infarct area / tot areay weight (g).

[0290] Cardiac troponin I ELISA Blood was collected from animals at 24 hours (from the tail vein) or study endpoint (from the LV cavity) in EDTA tubes. After incubation at 4°C for 30 minutes, plasma was obtained by 15-minute centrifugation at 4000 rpm. Cardiac troponin I was quantified using the rat cardiac troponin-I ELISA kit (Life Diagnostics) according to the manufacturer’s protocol.

[0291] Immunohistochemistry Tissues were embedded in OCT compound and frozen in 2-methyl butane precooled in liquid nitrogen, then stored at -80°C until sectioning.Serial sections of the heart were cut at the mid-papillary level in the transverse plane to 6 pm using a cryostat (CM3050S, Leica) and adhered to superfrost microscope slides. Cryoscctions of the heart were fixed with 4% paraformaldehyde solution (Fisher Scientific, AAJ19943K2) for 10 minutes, washed with cold PBS, permeabilized with 0.25% Triton™ X-100 (Millipore Sigma, T8787), and blocked (Protein Block, Dako with 0.05% Saponin [Sigma-Aldrich, S4521]) for 30 minutes at room temperature. Following the 30-minute block, slides were incubated overnight with primary antibodies diluted in a blocking solution at 4°C. Primary antibodies are as follows; CD68 (Abeam abl25212), TREX1 (NBP1-76977, Novus Biologicals), and pH2AX (D27C4, Cell Signaling Technologies). After the overnight incubation, slides were washed with PBS (3 times 5 minutes) and incubated with the appropriate Alexa Fluor-conjugated secondary antibody (1:500, Invitrogen) for 2 hours at room temperature. Following the secondary incubation, slides were washed with PBS (3 times 10 minutes) and coverslips were mounted with Fluoroshield with DAPI (Sigma-Aldrich) mounting medium. Slides were imaged using fluorescence microscopy (Cytation 5, Biotek) and quantified using Cytation 5 or ImageJ software. Pooled data were generated by averaging data from at least 4 fields per heart section.

[0292] Porcine Ischemia / Reperfusion Model Adult female Yucatan mini-pigs were premedicated with ketamine 20 mg / kg IM, atropine 0.05 mg / kg IM, and acepromazine 0.25 mg / kg IM. Animals were subsequently induced with propofol 2-4 mg / kg IV to effect, intubated, and maintained on isoflurane 2-3%. Amiodarone 10 mg / kg IV loading dose, then 0.5 mg / kg IV as needed, and lidocaine 2 mg / kg / min were given for ventricular arrhythmias. Heparin 100 lU / kg IV was given for anticoagulation. By inflating the balloon of an angioplasty catheter placed fluoroscopically, the proximal left anterior descending artery was occluded for 90 minutes, after which the balloon was deflated to allow reperfusion. Twenty (+10) minutes post- MI, animals received an IV dose of 0.15 mg / kg TY 1 or Scr (formulated in DharmaFECT® + PBS) or vehicle (DharmaFECT® + PBS) in a total volume of 5 ml. Blood samples were acquired before balloon occlusion, after reperfusion, and at the study endpoint. Two days post- MI, pigs underwent induction of anesthesia and a lateral thoracotomy. An angioplasty balloon was placed at the level of the original occlusion during the MI procedure. With the balloon deflated, animals were infused with Thioflavin T (50 ml, 2% solution diluted with PBS) by direct injection into the left atrium over 60 seconds. The angioplasty balloon was then inflatedand animals were infused with gentian violet (50 ml, 1 .6% solution diluted with 40 ml PBS and 10 ml ethanol) by direct injection into the left atrium over 60 seconds. Finally, mini-pigs were sacrificed, and the heart was explanted and sectioned into 1 cm thick short-axis slices. Gentian violet stains the non-ischemic zone blue; the region of the heart that is not perfused by gentian violet represents the ischemic area at risk (AAR). Thioflavin T is a fluorescent dye (visualized under UV light), which stains endothelium receiving blood flow. Then, transverse ventricular slices were incubated with 2% TTC for 20 min at 37°C. TTC stains viable myocardium brick red, while the infarct appears white / yellow.

[0293] Statistical analysis: Statistical parameters including the number of samples (n), descriptive statistics (mean and standard deviation), and significance are reported in the figures and figure legends. Differences between groups were examined for statistical significance using the Student’s t-tests or analysis of variance with Tukey’s post hoc test. Differences with p values < 0.05 were regarded as significant.Example 8: Graphical Abstract:

[0294] Two naturally-occurring, therapeutically bioactive small Y RNAs, EV-YF1 and its smaller truncated version, NT4, served as bioinspiration for structure-activity optimization studies to develop the lead candidate, TY 1. TY 1 attenuates cardiac damage by translational enhancement of Trexl, a regulator of genotoxic stress. Upregulation of Trexl and suppression of genotoxic stress in macrophages favors tissue repair in the injured myocardium (FIG. 6).Example 9: Pharmacodynamics

[0295] Given that the Mo A of TY 1 is upregulation of TREX1 in monocyte derived macrophages, animals were fed TY1, isolated peripheral blood mononuclear cells (PBMC) and assessed TREX1 levels 3-, 6-, and 12-hours post-administration (FIG. 7A). TREX1 levels in PBMC increased significantly three hours after feeding (FIG, 7B). Thus, although TY 1 is not detectable in plasma, there is clear MoA-driven biomarker evidence of its action in circulating PBMC 3 hours after ingestion.

[0296] Figure 7: In vivo pharmacodynamics of TY1 (A) Schematic for pharmacodynamic study. Animals were fed TY1 at the intended dose (0.2 mg / Kg) and bloodwas collected at baseline, 3, and 12 hours post administration. (B) Peripheral blood mononuclear cells were isolated, and RNA was purified to assess TREX1 expression by qPCR. Bars represent means and error bars represent s.d. Significance was determined by one-way ANOVA; *P<0.05; **P<0.01; ***P<0.001.

[0297] An increase in TREX1 would attenuate the DNA damage response, which, in turn, would dampen the innate immunity cascade and decrease inflammation (as depicted in FIG. 8).References1. Blau, H.M. & Daley, G.Q. Stem Cells in the Treatment of Disease. N Engl J Med 380, 1748- 1760 (2019).2. Marban, E. A mechanistic roadmap for the clinical application of cardiac cell therapies. Nat Biomed Eng 2, 353-361 (2018).3. Marban, E. The Secret Life of Exosomes: What Bees Can Teach Us About Next-Generation Therapeutics. J Am Coll Cardiol 71, 193-200 (2018).4. Smith, R.R. et al. Regenerative potential of cardiosphere-derived cells expanded from percutaneous endomyocardial biopsy specimens. Circulation 115, 896-908 (2007).5. McDonald, C.M. et al. Repeated intravenous cardiosphere-derived cell therapy in late-stage Duchenne muscular dystrophy (HOPE-2): a multicentre, randomised, double-blind, placebo- controlled, phase 2 trial. Lancet 399, 1049-1058 (2022).6. Taylor, M. et al. Cardiac and skeletal muscle effects in the randomized HOPE-Duchenne trial. Neurology 92, e866-e878 (2019).7. Ibrahim, A.G., Cheng, K. & Marban, E. Exosomes as critical agents of cardiac regeneration triggered by cell therapy. Stem Cell Reports 2, 606-619 (2014).8. Walravens, A.S. et al. Mechanistic and therapeutic distinctions between cardiosphere- derived cell and mesenchymal stem cell extracellular vesicle non-coding RNA. Sci Rep 11, 8666 (2021).9. de Couto, G. et al. Exosomal MicroRNA Transfer Into Macrophages Mediates Cellular Postconditioning. Circulation 136, 200-214 (2017).10. Cambier, L. et al. Y RNA fragment in extracellular vesicles confers cardioprotection via modulation of IL- 10 expression and secretion. EMBO Mol Med 9, 337-352 (2017).11. Cambier, L. et al. Angiotensin Il-Induced End-Organ Damage in Mice Is Attenuated by Human Exosomes and by an Exosomal Y RNA Fragment. Hypertension 72, 370-380 (2018).12. Huang, F. et al. Exosomally derived Y RNA fragment alleviates hypertrophic cardiomyopathy in transgenic mice. Mol Ther Nucleic Acids 24, 951-960 (2021).13. Zogg, H., Singh, R. & Ro, S. Current Advances in RNA Therapeutics for Human Diseases. IntJMol Sci 23 (2022).14. Egli, M. & Manoharan, M. Re-Engineering RNA Molecules into Therapeutic Agents. Acc Chem Res 52, 1036-1047 (2019).15. Ciullo, A. et al. Biodistribution of unmodified cardiosphere-derived cell extracellular vesicles using single RNA tracing. J Extracell Vesicles 11, el2178 (2022).16. Schmidt, K.S. et al. Application of locked nucleic acids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 32, 5757-5765 (2004).17. Winkle, M., El-Daly, S.M., Fabbri, M. & Calin, G.A. Noncoding RNA therapeutics - challenges and potential solutions. Nat Rev Drug Discov 20, 629-651 (2021).18. Yu, A.M., Choi, Y.H. & Tu, M.J. RNA Drugs and RNA Targets for Small Molecules: Principles, Progress, and Challenges. Pharmacol Rev 72, 862-898 (2020).19. Abou Assi, H. et al. 2'-O-Methylation can increase the abundance and lifetime of alternative RNA conformational states. Nucleic Acids Res 48, 12365-12379 (2020).20. Chung, C.Z., Seidl, L.E., Mann, M.R. & Heinemann, I.U. Tipping the balance of RNA stability by 3' editing of the transcriptome. Biochim Biophys Acta Gen Subj 1861, 2971-2979 (2017).21. Houseley, J. & Tollervey, D. The Many Pathways of RNA Degradation. Cell 136, 763-776 (2009).22. Ghildiyal, M. & Zamore, P.D. Small silencing RNAs: an expanding universe. Nat Rev Genet 10, 94-108 (2009).23. Ji, L.J. & Chen, X.M. Regulation of small RNA stability: methylation and beyond. Cell Res 22, 624-636 (2012).24. Ciullo A, P.K., Jones XM, Yamaguchi S, Morris AA, Kumar AN, Li L, Lee J, dos Santos RM, Cingolani E, and Ibrahim AG TDO2-augmented fibroblasts secrete EVs enriched in immunomodulatory Y-derived small RNA. Journal of Extracellular Bm / <9gy.2023;2:e73 (2023).25. Deng, J.H., Bai, X., Tang, H.Q. & Pang, S.S. DNA damage promotes ER stress resistance through elevation of unsaturated phosphatidylcholine in Caenorhabditis elegans. J Biol Chem 296 (2021).26. Gonzalez-Quiroz, M. et al. When Endoplasmic Reticulum Proteostasis Meets the DNA Damage Response. Trends Cell Biol 30, 881-891 (2020).27. Johnston, J. A., Ward, C.L. & Kopito, R.R. Aggresomes: A cellular response to misfolded proteins. J Cell Biol 143, 1883-1898 (1998).28. Vasudevan, S., Tong, Y.C. & Steitz, J. A. Switching from repression to activation: MicroRNAs can up-regulate translation. Science 318, 1931-1934 (2007).29. Jia, L.F. et al. Decoding mRNA translatability and stability from the 5 ' UTR. Nat Struct Mol Biol 27, 814-+ (2020).30. Leppek, K., Das, R. & Barna, M. Functional 5 ' UTR mRNA structures in eukaryotic translation regulation and how to find them (vol 19, pg 158, 2018). Nat Rev Mol Cell Bio 19, 673-673 (2018).31. Mignone, F., Gissi, C., Liuni, S. & Pesole, G. Untranslated regions of mRNAs. Genome Biol 3 (2002).32. Mylonas, K.J. et al. The adult murine heart has a sparse, phagocytically active macrophage population that expands through monocyte recruitment and adopts an 'M2' phenotype in response to Th2 immunologic challenge. Immunobiology 220, 924-933 (2015).33. de Couto, G. Macrophages in cardiac repair: Environmental cues and therapeutic strategies. Exp Mol Med 51 (2019).34. Sager, H.B., Kessler, T. & Schunkert, H. Monocytes and macrophages in cardiac injury and repair. J Thorac Dis 9, S30-S35 (2017).35. Halade, G.V. & Lee, D.H. Inflammation and resolution signaling in cardiac repair and heart failure. Ebiomedicine 79 (2022).36. Sharma, A., Singh, K. & Almasan, A. Histone H2AX phosphorylation: a marker for DNA damage. Methods Mol Biol 920, 613-626 (2012).37. Shah, A.M. & Giacca, M. Small non-coding RNA therapeutics for cardiovascular disease. Eur Heart J (2022).38. Motwani, M., Pesiridis, S. & Fitzgerald, K.A. DNA sensing by the cGAS-STING pathway in health and disease. Nat Rev Genet 20, 657-674 (2019).39. Grieves, J.L. et al. Exonuclease TREX1 degrades double- stranded DNA to prevent spontaneous lupus-like inflammatory disease. Proc Natl Acad Sci U S A 112, 5117-5122 (2015).40. Peschke, K. et al. Loss of Trexl in Dendritic Cells Is Sufficient To Trigger Systemic Autoimmunity. J Immunol 197, 2157-2166 (2016).41. de Couto, G. et al. Macrophages mediate cardioprotective cellular postconditioning in acute myocardial infarction. J Clin Invest 125, 3147-3162 (2015).42. Mentkowski, K.I., Mursleen, A., Snitzer, J.D., Euscher, L.M. & Lang, J.K. CDC-derived extracellular vesicles reprogram inflammatory macrophages to an arginase 1 -dependent proangiogenic phenotype. Am J Physiol Heart Circ Physiol 318, H1447-H1460 (2020).43. Vlachogiannis, N.I. et al. Association Between DNA Damage Response, Fibrosis and Type I Interferon Signature in Systemic Sclerosis. Front Immunol 11 (2020).44. Avouac, L, Borderie, D., Ekindjian, O.G., Kahan, A. & Allanore, Y. High DNA oxidative damage in systemic sclerosis. J Rheumatol 37, 2540-2547 (2010).45. Tichy, E.D. et al. Persistent NF-kappa B activation in muscle stem cells induces proliferation-independent telomere shortening. Cell Rep 35 (2021).46. Chang, A.C.Y. et al. Telomere shortening is a hallmark of genetic cardiomyopathies. P Natl Acad Sci USA 115, 9276-9281 (2018).47. Ibrahim, A. G.E. et al. Augmenting canonical Wnt signalling in therapeutically inert cells converts them into therapeutically potent exosome factories. Nat Biomed Eng 3, 695-705 (2019).References1. M. Algoet et al., Myocardial ischemia-reperfusion injury and the influence of inflammation. Trends Cardiovasc Med 33, 357-366 (2023).2. S. Frantz, M. J. Hundertmark, J. Schulz-Menger, F. M. Bengel, J. Bauersachs, Left ventricular remodelling post-myocardial infarction: pathophysiology, imaging, and novel therapies. Eur Heart J 43, 2549-2561 (2022).3. N. Dicks, K. Gutierrez, M. Michalak, V. Bordignon, L. B. Agelion, Endoplasmic reticulum stress, genome damage, and cancer. Front Oncol 5, 11 (2015).4. S. J. Forrester, D. S. Kikuchi, M. S. Hernandes, Q. Xu, K. K. Griendling, Reactive Oxygen Species in Metabolic and Inflammatory Signaling. Circ Res 122, 877-902 (2018).5. P. Zheng el al., DNA damage triggers tubular endoplasmic reticulum extension to promote apoptosis by facilitating ER-mitochondria signaling. Cell Res 28, 833-854 (2018).6. A. Decout, J. D. Katz, S. Venkatraman, A. Ablasser, The cGAS-STING pathway as a therapeutic target in inflammatory diseases. Nat Rev Immunol 21, 548-569 (2021).7. D. J. Cao et al., Cytosolic DNA Sensing Promotes Macrophage Transformation and Governs Myocardial Ischemic Injury. Circulation 137, 2613-2634 (2018).8. K. Hamidzadeh, S. M. Christensen, E. Dalby, P. Chandrasekaran, D. M. Mosser, Macrophages and the Recovery from Acute and Chronic Inflammation. Amu Rev Physiol 79, 567-592 (2017).9. S. Pereira-Lopes et al., The exonuclease Trexl restrains macrophage proinflammatory activation. J Immunol 191, 6128-6135 (2013).10. K. Peschke et al., Loss of Trexl in Dendritic Cells Is Sufficient To Trigger Systemic Autoimmunity. J Immunol 197, 2157-2166 (2016).11. N. Yan, Immune Diseases Associated with TREX1 and STING Dysfunction. J Interferon Cytokine Res 37, 198-206 (2017).12. H. Du et al., Suppression of TREX1 deficiency-induced cellular senescence and interferonopathies by inhibition of DNA damage response. iScience 26, 107090 (2023).13. M. A. Matter et al., Inflammation in acute myocardial infarction: the good, the bad and the ugly. Eur Heart J 45, 89-103 (2024).14. E. Marban, A mechanistic roadmap for the clinical application of cardiac cell therapies. Nat Biomed Eng 2, 353-361 (2018).15. A. G. Ibrahim, K. Cheng, E. Marban, Exosomes as critical agents of cardiac regeneration triggered by cell therapy. Stem Cell Reports 2, 606-619 (2014).16. G. de Couto et al. , Exosomal MicroRNA Transfer Into Macrophages Mediates Cellular Postconditioning. Circulation 136, 200-214 (2017).17. R. Gallet et al., Exosomes secreted by cardiosphere-derived cells reduce scarring, attenuate adverse remodelling, and improve function in acute and chronic porcine myocardial infarction. Eur Heart J 38, 201-211 (2017).18. R. G. Rogers et al., Disease-modifying bioactivity of intravenous cardiosphere-derived cells and exosomes in mdx mice. J CI Insight 4, (2019).19. G. de Couto et al., Mechanism of Enhanced MerTK-Dependent Macrophage Efferocytosis by Extracellular Vesicles. Arterioscler Thromb Vase Biol 39, 2082-2096 (2019).20. I. F. Dawkins et al., Biological substrate modification suppresses ventricular arrhythmias in a porcine model of chronic ischaemic cardiomyopathy. Eur Heart J 43, 2139- 2156 (2022).21. L. Cambier et al., Y RNA fragment in extracellular vesicles confers cardioprotection via modulation of IL-10 expression and secretion. EMBO Mol Med 9, 337-352 (2017).22. L. Cambier et al., Angiotensin II- Induced End-Organ Damage in Mice Is Attenuated by Human Exosomes and by an Exosomal Y RNA Fragment. Hypertension 72, 370-380 (2018).23. F. Huang et al., Exosomally derived Y RNA fragment alleviates hypertrophic cardiomyopathy in transgenic mice. Mol Ther Nucleic Acids 24, 951-960 (2021).24. M. Winkle, S. M. ELDaly, M. Fabbri, G. A. Calin, Noncoding RNA therapeutics - challenges and potential solutions. Nat Rev Drug Discov 20, 629-651 (2021).25. A. Ciullo et al., Biodistribution of unmodified cardiosphere-derived cell extracellular vesicles using single RNA tracing. J Exiracell Vesicles 11, el2178 (2022).26. K. S. Schmidt et al., Application of locked nucleic acids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 32, 5757-5765 (2004).27. A. M. Yu, Y. H. Choi, M. I. Tu, RNA Drugs and RNA Targets for Small Molecules: Principles, Progress, and Challenges. Pharmacol Rev 72, 862-898 (2020).28. H. Abou Assi et al., 2'-O-Methylation can increase the abundance and lifetime of alternative RNA conformational states. Nucleic Acids Res 48, 12365-12379 (2020).29. C. Z. Chung, L. E. Seidl, M. R. Mann, I. U. Heinemann, Tipping the balance of RNA stability by 3' editing of the transcriptome. Biochim Biophys Acta Gen Subj 1861, 2971-2979 (2017).30. J. Houseley, D. Tollervey, The Many Pathways of RNA Degradation. Cell 136, 763- 776 (2009).31. M. Ghildiyal, P. D. Zamore, Small silencing RNAs: an expanding universe. Nat Rev Genet 10, 94-108 (2009).32. L. J. Ji, X. M. Chen, Regulation of small RNA stability: methylation and beyond. Cell Res 22, 624-636 (2012).33. P. K. Ciullo A, Jones XM, Yamaguchi S, Morris AA, Kumar AN, Li L, Lee J, dos Santos RM, Cingolani E, and Ibrahim AG, TDO2-augmented fibroblasts secrete EVs enriched in immunomodulatory Y-derived small RNA. Journal of Extracellular Bzo / ogy .2023;2:e73, (2023).34. J. H. Deng, X. Bai, H. Q. Tang, S. S. Pang, DNA damage promotes ER stress resistance through elevation of unsaturated phosphatidylcholine in Caenorhabditis elegans. J Biol Chem 296, (2021).35. M. Gonzalez-Quiroz et al. , When Endoplasmic Reticulum Proteostasis Meets the DNA Damage Response. Trends Cell Biol 30, 881-891 (2020).36. J. A. Johnston, C. L. Ward, R. R. Kopito, Aggresomes: A cellular response to misfolded proteins. J Cell Biol 143, 1883- 1898 (1998).37. S. Vasudevan, Y. C. Tong, J. A. Steitz, Switching from repression to activation: MicroRNAs can up-regulate translation. Science 318, 1931-1934 (2007).38. L. F. Jia et al., Decoding mRNA translatability and stability from the 5 ' UTR. Nat Struct Mol Biol 27, 814-+ (2020).39. K. Leppek, R. Das, M. Barna, Functional 5 ' UTR mRNA structures in eukaryotic translation regulation and how to find them (vol 19, pg 158, 2018). Nat Rev Mol Cell Bio 19, 673-673 (2018).40. F. Mignone, C. Gissi, S. Liuni, G. Pesole, Untranslated regions of mRNAs. Genome Biol 3, (2002).41. Y. Lim et al., Multiplexed functional genomic analysis of 5' untranslated region mutations across the spectrum of prostate cancer. Nat Common 12, 4217 (2021).42. S. Nikfarjam, K. K. Singh, DNA damage response signaling: A common link between cancer and cardiovascular diseases. Cancer Med 12, 4380-4404 (2023).43. B. Schumacher, J. Pothof, J. Vijg, J. H. J. Hoeijmakers, The central role of DNA damage in the ageing process. Nature 592, 695-703 (2021).44. G. Robert, J. R. Wagner, ROS-Induced DNA Damage as an Underlying Cause of Aging. Advances in Geriatric Medicine and Research 2, e200024 (2020).45. M. Motwani, S. Pesiridis, K. A. Fitzgerald, DNA sensing by the cGAS-STING pathway in health and disease. Nat Rev Genet 20, 657-674 (2019).46. Y. G. Yang, T. Lindahl, D. E. Barnes, Trexl exonuclease degrades ssDNA to prevent chronic checkpoint activation and autoimmune disease. Cell 131, 873-886 (2007).47. J. L. Grieves et al., Exonuclease TREX1 degrades double-stranded DNA to prevent spontaneous lupus-like inflammatory disease. Proc Natl Acad Sci U S A 112, 5117-5122 (2015).48. G. de Couto et al., Macrophages mediate cardioprotective cellular postconditioning in acute myocardial infarction. J Clin Invest 125, 3147-3162 (2015).49. K. I. Mentkowski, A. Mursleen, J. D. Snitzer, L. M. Euscher, J. K. Lang, CDC-derived extracellular vesicles reprogram inflammatory macrophages to an arginase 1 -dependent proangiogenic phenotype. Am J Physiol Heart Circ Physiol 318, H1447-H1460 (2020).50. N. Salari et al., The global prevalence of myocardial infarction: a systematic review and meta-analysis. BMC Carcliovasc Disord 23, 206 (2023).51. L. Gross, L. Blum, G. Silverman, Experimental Attempts to Increase the Blood Supply to the Dog's Heart by Means of Coronary Sinus Occlusion. J Exp Med 65, 91-108 (1937).52. D. J. Lefer, E. Marban, Is Cardioprotection Dead? Circulation 136, 98-109 (2017).53. K. K. Cho JH, Ibrahim A, Cingolania E, and Marban E, in Heart Rhythm. (2023), vol.20, pp. S731.54. C. A. Jones XM, Mesquita T, Fournier M, Liu W, Li L, Ibrahim AG and Marban E, in AHA, Circulation, Ed. (2023), vol. 148, pp. A14651.55. R. Phillips, Targeting the DNA damage response attenuates SLE-associated B cell characteristics. Nat Rev Rheumatol 19, 2 (2023).56. T. Manolakou et al., ATR-mediated DNA damage responses underlie aberrant B cell activity in systemic lupus erythematosus. Sci Adv 8, eabo5840 (2022).57. E. D. Tichy et al., Persistent NF-kappa B activation in muscle stem cells induces proliferation- independent telomere shortening. Cell Rep 35, (2021).58. A. C. Y. Chang et al., Telomere shortening is a hallmark of genetic cardiomyopathies. P Natl Acad Sci USA 115, 9276-9281 (2018).59. M. Hoss et al., A human DNA editing enzyme homologous to the Escherichia coli DnaQ / MutD protein. EMBO J 18, 3868-3875 (1999).60. S. R. Margolis, S. C. Wilson, R. E. Vance, Evolutionary Origins of cGAS-STING Signaling. Trends Immunol 38, 733-743 (2017).61. A. G. E. Ibrahim et al., Augmenting canonical Wnt signalling in therapeutically inert cells converts them into therapeutically potent exosome factories. Nat Biomed Eng 3, 695-705 (2019).

Claims

WHAT TS CLAIMED TS:

1. A method of treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising administering to a subject in need of treating a condition associated with aging, atrophy, inflammation and / or fibrosis an effective amount of an agent that enhances expression of a Trexl gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

2. The method of claim 1, wherein the agent comprises a nucleic acid that encodes the Trexl gene product, optionally wherein the Trexl gene product comprises a truncated form of TREX1 protein having exonuclease activity.

3. The method of claim 2, wherein the nucleic acid comprises a vector.

4. The method of claim 3, wherein the vector is a viral vector, or a plasmid.

5. The method of claim 2, wherein the nucleic acid is comprised in a macrophage.

6. The method of claim 5, comprising administering to the subject a population of the macrophages, wherein the effective amount of the agent that enhances expression of a Trexl gene product is comprised in the population of the macrophages.

7. The method of claim 2, wherein the nucleic acid comprises a promoter operably connected to a nucleotide sequence encoding the Trexl gene product, wherein the promoter drives expression of the Trexl gene product in the subject.

8. The method of claim 2, wherein the nucleic acid anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3) anneals.

9. The method of claim 1, wherein the Trexl gene product comprises a Trexl mRNA.

10. The method of claim 9, wherein the agent increases transcription of the Trexl mRNA.

11. The method of claim 9, wherein the agent stabilizes the Trexl mRNA, or increases the half-life of the Trexl mRNA.

12. The method of claim 1 , wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises inflammation and / or fibrosis of the heart, skeletal muscle, or skin.

13. The method of claim 1, wherein the condition associated with aging, atrophy, inflammation and / or fibrosis comprises a symptom and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.

14. The method of claim 1, wherein the condition associated with inflammation comprises a symptom or sequelae of an infectious disease or is associated with immunotherapy .

15. The method of claim 1, wherein the condition associated with inflammation comprises a cytokine storm.

16. The method of claim 1, wherein the condition associated with aging, atrophy, and fibrosis comprises a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.

17. The method of claim 1, wherein the agent does not comprise the isolated RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

18. The method of claim 1, wherein the agent attenuates DNA damage in an inflamed and / or fibrotic tissue or a tissue at risk of inflammation and / or fibrosis.

19. The method of claim 1, wherein the agent enhances expression of the Tre l gene product in macrophages when the effective amount of the agent is administered to the subject.

20. A composition for treating a condition associated with aging, atrophy, inflammation and / or fibrosis, comprising: a nucleic acid that anneals to a first sequence in a Trexl mRNA 5’ UTR that is different from a second sequence in the Trexl mRNA 5’ UTR to which a nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), anneals, wherein the nucleic acid enhances expression of a Trexl gene product; a nucleic acid that encodes the Trexl gene product, wherein the nucleic acid is configured to overexpress the Trexl gene product;a population of macrophages having elevated anti-inflammatory activity, wherein macrophages of the population have enhanced expression of the Trc l gene product and do not comprise an exogenous RNA comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), or a combination thereof.

21. An in vitro method of identifying an agent that enhances expression f a Trexl gene product in a target cell, comprising: contacting a candidate agent with a target cell; and measuring an expression level of a Trexl gene product in the target cell after the contacting, wherein the candidate agent is identified as an agent that enhances expression of a Tre l gene product when the measured expression level of the Trexl gene product is elevated compared to a suitable reference value.

Images