Preparation method for immune cell

Abstract

Provided is a preparation method for an immune cell, comprising: introducing into a peripheral blood mononuclear cell a first expression cassette sequence containing an induced differentiation gene, and then introducing a second expression cassette sequence containing a CAR to obtain a CAR-NK cell; or synchronously introducing into the peripheral blood mononuclear cell the first expression cassette sequence containing the induced differentiation gene and the second expression cassette sequence containing the CAR to obtain the CAR-NK cell.

Description

A method for preparing immune cells Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to a method for preparing immune cells. Background Art

[0002] Natural killer cells (NK cells) are a unique type of innate immune cell with broad-spectrum cytotoxicity. They can efficiently identify and lyse malignant cells without prior sensitization or recognition of antigenic peptides. Furthermore, genetically modified NK cells can be used for efficient targeted killing and are used in adoptive cell therapy for cancer patients. Current preclinical and clinical research data on CAR-NK cells show that they can effectively eliminate target cells without toxic side effects such as cytokine release syndrome or neurotoxins, and therefore have broad application prospects. However, the biological technologies associated with genetically modified NK cells have greatly limited the progress of NK cell therapy, including in vitro expansion technology of NK cells, chimeric antigen receptors (CARs), and viral transfection efficiency.

[0003] There are many current technical solutions for CAR-NK cell preparation, including technical solutions for CAR structure design, but they all have a common problem, namely, the final conversion rate of peripheral blood mononuclear cells (PBMC cells) to final CAR-NK cells is relatively low. In the final cell product, NK cells account for the majority, while CAR-NK cells account for a smaller proportion, which makes the adoptive cell therapy effect unsatisfactory.

[0004] At the same time, in terms of the final product application, different CAR-NK cell concentrations correspond to different treatment methods and therapeutic effects. Under ideal conditions and within a certain culture period, the higher the proportion of CAR-NK cells per unit concentration in the final product, the better the effect. Therefore, how to improve the conversion rate and proportion of CAR-NK cells in the final product obtained by the CAR-NK cell preparation method is a technical problem that urgently needs to be solved.

[0005] Summary of the Invention

[0006] In view of the above problems, the present disclosure proposes a method for preparing immune cells, which is beneficial to improving the conversion rate and concentration ratio of CAR-NK cells in the final product obtained by the CAR-NK cell preparation method.

[0007] As shown in FIG1 , in some embodiments of the present disclosure, the preparation method includes:

[0008] Introducing a first expression framework sequence containing a differentiation-inducing gene into peripheral blood mononuclear cells to induce the peripheral blood mononuclear cells to differentiate into NK cells, and then introducing a second expression framework sequence containing CAR to obtain CAR-NK cells; or,

[0009] The first expression framework sequence containing the differentiation-inducing gene and the second expression framework sequence containing CAR are synchronously introduced into peripheral blood mononuclear cells to obtain CAR-NK cells.

[0010] Optionally, the second expression framework sequence lacks the promoter of the CAR; and,

[0011] The first expression framework sequence includes the terminator of the differentiation-inducing gene and the promoter of the CAR, and the expression sequence of the terminator of the differentiation-inducing gene is located upstream of the expression sequence of the promoter of the CAR.

[0012] Optionally, the differentiation-inducing gene comprises one or more of the following genes:

[0013] CD122, CD38, CD7, CD127.

[0014] Optionally, the introduction method includes gene transfection, and the gene transfection includes the steps of:

[0015] mixing the expression vector group and the plasmid expressing the recombinase to obtain a mixed plasmid;

[0016] Transfecting the mixed plasmid and necessary gene elements into peripheral blood mononuclear cells to achieve gene recombination of peripheral blood mononuclear cells to obtain transfected cells; or,

[0017] mixing the expression vector group and the mRNA fragment expressing the recombinase to obtain a mixture;

[0018] transfecting the mixture and necessary gene elements into peripheral blood mononuclear cells to achieve gene recombination of the peripheral blood mononuclear cells and obtain transfected cells;

[0019] The expression vector group comprises at least one of a first expression vector and a second expression vector, wherein the first expression vector comprises the first expression framework sequence, and the second expression vector comprises the second expression framework sequence.

[0020] Optionally, the recombinase is Cre recombinase, FLP recombinase, Bxb1 integrase and At least one of the integrases.

[0021] Optionally, the recombinase is Cre recombinase, the amino acid sequence of the Cre recombinase is shown in SEQ ID NO: 1, and the sequence of the mRNA fragment expressing Cre recombinase is shown in SEQ ID NO: 2.

[0022] Optionally, the molar ratio of the plasmid expressing Cre recombinase to the expression vector group is 1:2 to 1:5; and / or,

[0023] The molar ratio of the mRNA fragment expressing Cre recombinase to the expression vector group is 1:3 to 1:5.

[0024] Optionally, the essential gene elements include a cas9 protein expression gene, an sgRNA fragment, and a homology arm fragment.

[0025] Optionally, the nucleotide sequence of the sgRNA fragment includes the Sg1 fragment shown in SEQ ID NO: 3; and / or,

[0026] The nucleotide sequence of the sgRNA fragment includes the Sg2 fragment shown in SEQ ID NO: 4; and / or,

[0027] The nucleotide sequence of the sgRNA fragment includes the Sg3 fragment shown in SEQ ID NO: 5; and / or,

[0028] The nucleotide sequence of the sgRNA fragment includes the Sg4 fragment shown in SEQ ID NO:6.

[0029] In the second aspect, based on the same inventive concept, the present disclosure provides the following technical solutions through an embodiment:

[0030] A combined expression framework comprises the first expression framework sequence and the second expression framework sequence in the preparation method of the first aspect.

[0031] Optionally, the first expression framework sequence includes at least a first recognition site sequence, an inducing differentiation gene expression sequence, a CAR promoter, and a third recognition site sequence in the order of 5'-3';

[0032] The differentiation-inducing gene expression sequence includes a promoter, a differentiation-inducing gene and a terminator; and

[0033] The CAR promoter is a combination of an enhanced promoter and ATG; and,

[0034] The first recognition site sequence is used for recognition and pairing of the first expression framework sequence with the recipient cell genome;

[0035] The third recognition site sequence is used for recognition of the recombinase.

[0036] Optionally, the first recognition site sequence is the Sg5 fragment shown in SEQ ID NO: 8, or the Sg7 fragment shown in SEQ ID NO: 10.

[0037] Optionally, the first expression framework sequence further includes a first SOI sequence;

[0038] The first SOI sequence is a regulatory sequence required for expressing differentiation-inducing genes.

[0039] Optionally, the third recognition site sequence includes one or more of the following sequences:

[0040] LoxFaS sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, NKG2A.

[0041] Optionally, the second expression framework sequence includes a third recognition site sequence, a CAR gene, and a second recognition site sequence in the order of 5'-3';

[0042] The third recognition site sequence lacks the CAR gene promoter; and

[0043] The second recognition site sequence is the Sg6 fragment shown in SEQ ID NO: 9, or the Sg8 fragment shown in SEQ ID NO: 11.

[0044] Optionally, the CAR gene includes: a polyadenosine signal peptide gene fragment, a signal peptide gene fragment, a single-chain fragment variant, a linker, a hinge region, a transmembrane domain fragment and a costimulatory domain fragment;

[0045] The linker is used to link the poly(A) signal peptide and the signal peptide, or the signal peptide and the single-chain fragment variant; or the single-chain fragment variant and the hinge region.

[0046] Optionally, the transmembrane domain fragment is a CD28 fragment.

[0047] Optionally, the amino acid sequence of the single-chain fragment variant is the Sg10 fragment shown in SEQ ID NO:13.

[0048] Optionally, the hinge region amino acid sequence is the Sg11 fragment shown in SEQ ID NO:14.

[0049] In a third aspect, based on the same inventive concept, the present disclosure provides the following technical solutions through an embodiment:

[0050] A CAR-NNK cell product, obtained by the preparation method described in the first aspect, or by expressing the combined expression framework described in the second aspect in immune cells.

[0051] The above technical solution provided by the present disclosure has the following advantages compared with the prior art:

[0052] The present disclosure provides a method for preparing immune cells, which introduces a first expression framework sequence and a second expression framework sequence during the preparation of peripheral blood mononuclear cells. Since the second expression framework sequence cannot be normally expressed during the normal expression process, the promoter of the CAR formed can promote the normal expression of the second expression framework sequence only after the first expression framework sequence is expressed, and the differentiation-inducing substance formed after the expression of the first expression framework sequence can promote the differentiation of PBMC cells into NK cells. Therefore, by setting the first expression framework sequence and the second expression framework sequence, CAR can be expressed after cell differentiation, and preliminary screening of CAR-NK cells and NK cells can be achieved, so that a large number of CAR-NK cells can be obtained, thereby improving the conversion rate of CAR-NK cells and at the same time increasing the proportion concentration of CAR-NK cells in NK cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present disclosure and, together with the description, serve to explain the principles of the present disclosure.

[0054] In order to more clearly illustrate the embodiments of the present disclosure or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0055] FIG1 is a schematic diagram showing a process of preparing immune cells according to some embodiments of the present disclosure;

[0056] FIG2 is a schematic diagram showing a process of another method for preparing immune cells according to some embodiments of the present disclosure;

[0057] FIG3 shows a schematic structural diagram of a combined expression framework according to some embodiments of the present disclosure;

[0058] FIG4 shows a schematic diagram of the principle of forming a combined expression framework using CRISPER gene editing technology in some embodiments of the present disclosure, wherein FIG4A is a schematic diagram of the principle of forming a first expression framework sequence using CRISPER gene editing technology, and FIG4B is a schematic diagram of the principle of forming a second expression framework sequence using CRISPER gene editing technology;

[0059] Figure 5 shows a schematic diagram of the proportion of CAR-NK cells in the final cell product to NK cells in some embodiments of the present disclosure, wherein Figure 5a is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 1, Figure 5b is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 6, Figure 5c is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 11, Figure 5d is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 16, Figure 5e is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 21, and Figure 5f is a schematic diagram of the proportion of CAR-NK cells in the final cell product provided by Experimental Group 26;

[0060] Figure 6 shows schematic diagrams of cell culture conditions according to some embodiments of the present disclosure, wherein Figure 6a is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 1, Figure 6b is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 6, Figure 6c is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 11, Figure 6d is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 16, Figure 6e is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 21, and Figure 6f is a schematic diagram of the culture conditions of the final cell product CAR-NK cells provided by Experimental Group 26;

[0061] FIG7 is a schematic diagram showing the fluorescence intensity of the transfected GFP-tagged cells in experimental group 1 after 48 hours of culture according to some embodiments of the present disclosure. DETAILED DESCRIPTION

[0062] To make the objectives, technical solutions, and advantages of the embodiments of the present disclosure more clear, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present disclosure, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present disclosure without making any creative efforts shall fall within the scope of protection of the present disclosure.

[0063] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present disclosure can be purchased from the market or prepared by existing methods.

[0064] As shown in FIG1 and FIG2 , in some embodiments of the present disclosure, a method for preparing immune cells is provided, the method comprising:

[0065] S1. Introducing a first expression framework sequence containing a differentiation-inducing gene into peripheral blood mononuclear cells to induce the peripheral blood mononuclear cells to differentiate into NK cells, and then introducing a second expression framework sequence containing CAR to obtain CAR-NK cells; or,

[0066] S1. Synchronously introduce a first expression framework sequence containing a differentiation-inducing gene and a second expression framework sequence containing CAR into peripheral blood mononuclear cells to obtain CAR-NK cells.

[0067] In some optional embodiments, the second expression framework sequence lacks the promoter-related sequence of the CAR (at least lacks the start codon sequence -ATG);

[0068] The first expression framework sequence includes the terminator of the differentiation-inducing gene and the promoter of the CAR, and the expression sequence of the terminator of the differentiation-inducing gene is located upstream of the expression sequence of the promoter of the CAR.

[0069] The terminator can be any conventional terminator, such as human gastrin terminator (hGT).

[0070] The promoter of the CAR may be a combination of an enhanced promoter + ATG, and the enhanced promoter may be a CMV promoter.

[0071] In the embodiment of the present disclosure, the specific workflow of the first expression framework sequence and the second framework used in the preparation method is: since the first expression framework sequence has the promoter of the CAR in the second expression framework sequence, the CAR in the second expression framework sequence can be correctly expressed only after the first expression framework sequence is successfully expressed. Since the first expression framework sequence contains an inducing differentiation gene, after its expression, the immune cells will gradually differentiate from PBMC cells into NK cells. At this time, the CAR expressed by the second expression framework sequence combines with it to form CAR-NK cells. Through this workflow, it can be ensured that CAR-NK cells are formed after the NK cells are differentiated, thereby improving the conversion rate of CAR-NK cells and further increasing the proportion concentration of CAR-NK cells in immune cells.

[0072] Since the CAR in the second expression framework sequence can only be correctly expressed after the first expression framework sequence is successfully expressed, the introduction of the first expression framework sequence and the second expression framework sequence can be introduced in steps according to the different growth cycles of the immune cells, or can be introduced simultaneously before the immune cells differentiate.

[0073] It should be noted that the first expression framework sequence and the second expression framework sequence are a nucleotide sequence, including multiple recognition sites, functional units and other gene elements necessary for the gene expression process.

[0074] It should be noted that the peripheral blood mononuclear cells (PBMCs) are cells with a single nucleus in the peripheral blood, including lymphocytes and monocytes.

[0075] It should be noted that the CAR is a chimeric antigen receptor (CAR), which is a chimeric antigen receptor T cell that couples the antigen binding portion of an antibody that recognizes a certain tumor antigen with the intracellular portion recognized by the CD3-recognition chain or Fc3-in vitro to form a chimeric protein. The chimeric protein is transfected into the patient's T cells through gene transduction to express the chimeric antigen receptor, so that the patient's T cells are "recoded" and can generate a large number of tumor-specific CAR-T cells.

[0076] In some optional embodiments, the differentiation-inducing gene comprises one or more of the following genes:

[0077] CD122, CD38, CD7, CD127.

[0078] In the disclosed embodiments, by refining the specific types of differentiation-inducing genes, the key gene types for the conversion of peripheral blood mononuclear cells into NK cells can be identified. Therefore, by introducing these differentiation-inducing genes, peripheral blood mononuclear cells can be converted into NK cells.

[0079] Cytokines are important inflammatory mediators that control multiple aspects of NK cell biology. NK cells express cytokine receptors early in their development and require signaling through the common gamma (γc) chain to promote their development, homeostasis, and function. The γc chain (CD132) is a 40 kDa type I transmembrane glycoprotein that serves as a signaling subunit for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 (65). Proteins containing γ chain receptors play a key role in NK cell development. IL-7, in addition to playing a key role in early cell development, can also regulate the stock and expansion of mature CD56+ NK cells. CD127 is responsible for expressing IL-7's protein ligand IL-2Rα. The optimized gene sequences are shown in Table 1.

[0080] It should be noted that the differentiation process of peripheral blood mononuclear cells includes immune cell stem cells - common lymphoid progenitors (CLPs) - T cells / natural killer precursor cells (PreTs / NKPs) - immature NK (iNK) - mature NK (mNK). CD122 is responsible for expressing the IL-2 protein ligand IL-2Rβ. The expression of this protein marks the irreversible transformation of CLPs into the NK lineage. The optimized gene sequence is shown in Table 1.

[0081] CD38 is responsible for expressing cyclic ADP-ribose hydrolase. The successful expression of this protein contributes to the activation of hematopoietic stem cells. The optimized gene sequence is shown in Table 1.

[0082] CD7 is responsible for expressing a co-stimulatory ligand belonging to the Ig protein family, which stimulates the secretion of IFN-γ and leads to the proliferation of NK cells. The optimized sequence is shown in Table 1.

[0083] Table 1 Sequence list of genes that induce differentiation

[0084] It should be noted that the differentiation-inducing gene needs to be optimized before artificial synthesis for better intracellular expression. The selection of the differentiation-inducing gene is based on experimental results, and the related mechanism is not elaborated in this disclosure.

[0085] As shown in FIG1 and FIG2 , in some optional embodiments, the introduction method includes gene transfection, and the gene transfection includes the steps of:

[0086] S1. Mixing the expression vector group and the plasmid expressing the recombinase to obtain a mixed plasmid;

[0087] S2. transfecting the mixed plasmid and necessary gene elements into peripheral blood mononuclear cells to achieve genetic recombination of peripheral blood mononuclear cells to obtain transfected cells; or,

[0088] S1. Mixing the expression vector group and the mRNA fragment expressing the recombinase to obtain a mixture;

[0089] S2. transfecting the mixture and necessary gene elements into peripheral blood mononuclear cells to achieve genetic recombination of peripheral blood mononuclear cells to obtain transfected cells;

[0090] The expression vector group comprises at least a first expression vector and a second expression vector, wherein the first expression vector comprises the first expression framework sequence, and the second expression vector comprises the second expression framework sequence.

[0091] In the embodiment of the present disclosure, the method of gene introduction is gene transfection, and a first expression vector containing a first expression framework sequence, a second expression vector containing a second expression framework sequence, and a plasmid expressing a recombinase or a plasmid containing a recombinase mRNA are co-transfected. The recombinase can be used to promote independent gene recombination of different recognition site sequences and binding site sequences in the first expression framework sequence and the second expression framework sequence, so that the recombined target gene can be expressed in a manner of first expressing the differentiation-inducing gene and then expressing CAR, so that the PMBC cells first differentiate into NK cells and then combine with the expressed CAR, thereby increasing the proportion concentration of CAR-NK cells in the obtained NK cells and the conversion rate of CAR-NK cells.

[0092] It should be noted that the first expression vector and the second expression vector can independently select plasmids with matching functions, such as pUC19 plasmid.

[0093] In some optional embodiments, the recombinase is Cre recombinase, FLP recombinase, Bxb1 integrase and At least one of the integrases.

[0094] In the disclosed embodiments, by refining the specific composition of the recombinase, it is possible to cover most of the enzymes required for recombination at different sites, and utilize recombination to promote genetic recombination of different recognition site sequences and binding site sequences in the first expression framework sequence and the second expression framework sequence, thereby more accurately achieving the process of first expressing the target gene, inducing the differentiation gene, and then expressing the CAR.

[0095] In some optional embodiments, the recombinase is Cre recombinase, the amino acid sequence of the Cre recombinase is shown in SEQ ID NO: 1, and the sequence of the mRNA fragment expressing Cre recombinase is shown in SEQ ID NO: 2.

[0096] In the disclosed embodiments, Cre recombinase refers to a tyrosine recombinase that catalyzes site-specific recombinase using a topoisomerase I-like mechanism between LoxP sites. The Cre recombinase has a molecular weight of approximately 38 kDa and is mainly composed of 343 amino acid residues. The specific amino acid sequence is shown in SEQ ID NO: 1, and the corresponding mRNA nucleotide sequence is shown in SEQ ID NO: 2.

[0097] It should be noted that the Cre recombinase can combine specific recognition sites and binding sites through gene recombination, thereby inducing the smooth expression of differentiation genes and promoting the differentiation of PBMC immune stem cells into NK cells.

[0098] In some optional embodiments, the molar ratio of the Cre recombinase-expressing plasmid to the expression vector group is 1:2 to 1:5; and / or,

[0099] The molar ratio of the mRNA fragment expressing Cre recombinase to the expression vector group is 1:3 to 1:5.

[0100] In the disclosed embodiments, by separately refining the relationship between the plasmid expressing Cre recombinase, the plasmid expressing Cre recombinase mRNA, and the expression vector group, the resulting mixed plasmid can express a sufficient amount of Cre recombinase, and the first expression framework sequence and the second expression framework sequence in the expression vector group can be smoothly expressed after genetic recombination. The differentiation-inducing gene can promote the differentiation of PBMC cells into NK cells. Through the coordination mechanism of the first expression framework sequence and the second expression framework sequence, the CAR sequence can only be expressed in NK cells. This has at least three advantages: first, it increases the conversion rate of PBMC cells to NK cells; second, it increases the proportion of CAR-NK cells in the final cell product; and third, it prevents the CAR sequence from being transplanted into non-NK cells, causing inappropriate adaptation of the immune response. The so-called inappropriate adaptation of the immune response refers to the fact that the non-NK cells in the PBMC cells bind to the target cells due to the directionality of the CAR sequence, resulting in a series of uncontrollable reactions.

[0101] In some optional embodiments, the essential gene elements include a Cas9 protein expression gene, an sgRNA fragment, and a homology arm fragment.

[0102] In the embodiments of the present disclosure, essential gene elements refer to the essential elements for realizing CRISPR / Cas9 gene editing technology when the dual vectors formed by the first expression vector and the second expression vector in the expression vector group are transfected into immune cells. For example, the cas9 protein expression gene can express the Cas9 protease that can cut the double-stranded DNA; sgRNA, that is, single-stranded guide RNA, is used to identify the implantation site in the chromosomal DNA and form an sgRNA-Cas9 complex with the Cas9 protein to guide the Cas9 protein to cut the target DNA; the homology arm fragment can provide specific recognition and binding sites for the binding of the recombinase, thereby enabling the CRISPR / Cas9 gene editing technology to proceed smoothly.

[0103] In the disclosed embodiments, essential gene elements include a nuclear localization sequence. The term "nuclear localization sequence" can be interpreted as a nuclear localization sequence-expressed gene, indicating that the translated short peptide contains multiple copies of the positively charged amino acid residues arginine and / or lysine. It can also be interpreted as a short peptide that is used to be identified by cells and imported into the cell nucleus. For example, the nucleotide sequence of the nuclear localization sequence is: CCGAAGAAAAAGCGGAAAGTA; those skilled in the art may choose other nuclear localization sequences.

[0104] Such as PKKKRKV, PAATKKAGQA]KKKK, MSRRRKANPTKLSENAKKLAKEVEN, KLKIKRPVK, etc.

[0105] In some alternative embodiments, the sgRNA includes a nuclear localization sequence.

[0106] In some alternative embodiments, the Cas9 protein includes a nuclear localization sequence.

[0107] In some alternative embodiments, the recombinase comprises a nuclear localization sequence.

[0108] In some optional embodiments, the nucleotide sequence of the sgRNA fragment includes the Sg1 fragment shown in SEQ ID NO: 3; and / or,

[0109] The nucleotide sequence of the sgRNA fragment includes the Sg2 fragment shown in SEQ ID NO: 4; and / or,

[0110] The nucleotide sequence of the sgRNA fragment includes the Sg3 fragment shown in SEQ ID NO: 5; and / or,

[0111] The nucleotide sequence of the sgRNA fragment includes the Sg4 fragment shown in SEQ ID NO:6.

[0112] In the embodiments of the present disclosure, by refining the specific nucleotide sequence of the sgRNA fragment, on the one hand, the CRISPR / Cas9 gene editing technology can be used to simultaneously edit the first expression framework sequence and the second expression framework sequence. On the other hand, the specificity of the sgRNA fragment can be used to screen out the expected recombinant target gene fragment, so that the transfected cells can first differentiate into NK cells and then combine with the expressed CAR to proliferate, thereby increasing the proportion concentration and conversion rate of CAR-NK cells in the final immune cells.

[0113] As shown in FIG3 , in some embodiments of the present disclosure, the following technical solutions are provided:

[0114] A combined expression framework comprises the first expression framework sequence and the second expression framework sequence in the preparation method.

[0115] This combined expression framework is implemented based on the above-mentioned immune cell preparation method. The specific steps of the immune cell preparation method can refer to the above-mentioned embodiments. Since this combined expression framework adopts part or all of the technical solutions of the above-mentioned embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above-mentioned embodiments, which will not be repeated here.

[0116] In some optional embodiments, the first expression framework sequence includes at least a first recognition site sequence, an inducing differentiation gene, a special promoter, and a third site recognition sequence in the order of 5' to 3'.

[0117] In some optional embodiments, the first recognition site sequence is Sg1; the differentiation-inducing gene expression sequence includes a promoter, a differentiation-inducing gene, and a termination codon required for the transcription of the differentiation-inducing gene in the cell; the exemplary promoter can be one of CMV, SV40, CAG, and UAS, and other types of promoters can also be selected; the special promoter is a nucleic acid sequence combination of CMV+ATG, and the third site recognition sequence is Sg3.

[0118] In some optional embodiments, the first recognition site sequence is Sg1; the differentiation-inducing gene expression sequence includes a promoter, a differentiation-inducing gene, and a termination codon required for the transcription of the differentiation-inducing gene in the cell; the exemplary promoter can be one of CMV, SV40, CAG, and UAS, and other types of promoters can also be selected; the special promoter is a nucleic acid sequence combination of CMV+ATG, and the third site recognition sequence is Sg2.

[0119] It should be noted that, in the embodiments of the present disclosure, the nucleotide sequences of the first recognition site, the second recognition site, and the third recognition site may be the same or different, and they may be designed according to specific needs in actual operations.

[0120] In other embodiments, the differentiation-inducing gene comprises one or more of the following genes:

[0121] CD122, CD38, CD7, CD127.

[0122] The recognition site sequence is used for recognition pairing between the first expression framework sequence and the recipient cell genome and recognition pairing between the first expression framework and the second expression framework;

[0123] In some optional embodiments, the second expression framework sequence includes at least a third recognition site sequence, a CAR gene (-ATG), and a second site recognition sequence in the order of 5'-3'.

[0124] The CAR gene (-ATG) is a CAR nucleic acid sequence lacking a start codon.

[0125] In the embodiment of the present disclosure, by refining the distribution of different recognition site sequences, induced differentiation gene expression sequences and CAR promoters in the first expression framework sequence, and the distribution of different recognition site sequences and CAR genes in the second expression framework sequence, the first recognition site sequence in the different recognition site sequences can be used as the recognition pairing site sequence between the first expression framework sequence and the recipient cell genome, and the third recognition site sequence can be used as the binding site sequence of the recombinase. Since the terminator in the induced differentiation gene expression sequence is set between the first recognition site sequence and the third recognition site sequence, on the one hand, the induced differentiation gene can be normally expressed after the subsequent gene recombination of the first expression framework sequence, thereby promoting the transfected cells to successfully differentiate into NK cells. On the other hand, the CAR promoter can be smoothly expressed, and the CAR in the second expression framework sequence can be smoothly expressed, thereby allowing the transfected cells to proliferate by first differentiating into NK cells and then binding to the expressed CAR.

[0126] It should be noted that the third recognition site sequence is a nucleotide sequence recognized by the recombinase, and the nucleotide sequence is necessary for the recombination event mediated by the recombinase and is sufficient to trigger such a recombination event.

[0127] It should be noted that the enhanced promoter enhances the transcription efficiency of the differentiation-inducing gene and increases its expression level, thereby enabling PBMC immune stem cells to proliferate by first differentiating into NK cells and then combining with the expressed CAR, thereby increasing the proportion concentration of CAR-NK cells in the immune cell product; the first enhanced promoter sequence can be CMV promoter, EF1a, SV40, PGK1, etc.

[0128] It should be noted that the above embodiment is only an example of using CRISPER for gene editing. Those skilled in the art can use other gene recombination methods to perform the same transformation on the target cells to achieve the bundled expression of the differentiation-inducing gene and the CAR gene.

[0129] In some optional embodiments, the first recognition site sequence is the Sg5 fragment shown in SEQ ID NO:8, or the Sg7 fragment shown in SEQ ID NO:10.

[0130] It should be noted that the first, second, and third recognition site sequences are present in the target cells / recipient cells. If they are not present in the target cells / recipient cells, the target cells must first be genomic modified to obtain cells with the corresponding recognition sequences. The modification methods are conventional and will not be described here.

[0131] In the disclosed embodiment, by refining the specific composition of the first recognition site sequence, the first expression framework sequence can be specifically recognized and paired with the recipient cell genome through different implantation site sequences, thereby promoting the smooth expression of the first expression framework sequence.

[0132] It should be noted that the implantation site sequence can be selected as needed, and the selection principle is: if a single implantation site is integrated at a site with low transcriptional activity in the cell genome, only a small amount of encoded polypeptide is expressed; if multiple implantation site sequences are integrated at a site with high transcriptional activity in the cell genome, a large amount of encoded polypeptide is expressed.

[0133] It should be noted that the first recognition site sequence may also include a nuclear localization sequence, which represents an amino acid sequence containing multiple copies of positively charged amino acid residues arginine and / or lysine. Only polypeptides containing these amino acid sequences can be recognized by cells and enter the cell nucleus. Therefore, the nuclear localization sequence is specifically determined according to the genes of the PBMC immune stem cells entering.

[0134] In some optional embodiments, the first expression framework sequence further includes a first SOI sequence;

[0135] The first SOI sequence is a regulatory sequence required for expressing differentiation-inducing genes.

[0136] In the disclosed embodiments, since the activity of PBMC cells varies depending on the source of the receptor and the transfection steps are fixed, when the culture cycle of low-activity cells is long and the differentiation-inducing gene needs to be overexpressed later, it is necessary to introduce a dynamic regulatory module into the first expression framework sequence so that the differentiation-inducing gene can be overexpressed later by simply changing the components of the culture medium fed. The dynamic regulatory module can use a control gene, such as LacI+LacO or other cistrons.

[0137] It should be noted that the use of regulatory sequences can greatly improve the convenience of manipulating differentiation-inducing genes. In the actual production process of immune cell products, the timing of overexpression of differentiation-inducing genes can be manipulated by improving the culture medium components, thereby increasing the final CAR-NK cell product yield.

[0138] In some optional embodiments, the third recognition site sequence includes one or more of the following sequences:

[0139] LoxFaS sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, NKG2A.

[0140] In some optional embodiments, the first expression framework sequence includes at least a first recognition site sequence, a special promoter, and a third site recognition sequence in the order of 5' to 3'.

[0141] In this embodiment, the special promoter is a CMV promoter, and the first recognition site sequence and the third recognition site sequence are located upstream of the endogenous differentiation-inducing gene of the target cell / recipient cell, and the differentiation-inducing gene includes one or more of the following genes:

[0142] CD122, CD38, CD7, CD127.

[0143] By solely transfecting the first expression framework of this embodiment, the in situ expression intensity of the differentiation-inducing gene can be enhanced, so that PBMC cells can be transformed into NK cells more quickly.

[0144] In the embodiment of the present disclosure, when different sequences are selected for the third recognition site sequence, the recombinase and integrase required for performing gene recombination are also different. For example, when the LoxFaS sequence is used as the third recognition site sequence, the corresponding recombinase is Cre recombinase; when the FRT sequence is used as the third recognition site sequence, the corresponding recombinase is FLP recombinase; when the Bxb1 attP sequence or the Bxb1 attB sequence is used, the corresponding recombinase is Bxb1 integrase; when the attP sequence or attB sequence, the corresponding recombinase is Since changes in the recombinase will lead to corresponding changes in the implantation site, the corresponding first recognition site sequence will also change.

[0145] It should be noted that when the LoxFaS sequence shown in SEQ ID NO: 7 is used as the third recognition site sequence, the recombinase needs to be Cre recombinase, so the corresponding first recognition site sequence needs to be the Sg5 fragment shown in SEQ ID NO: 8. At this time, the second recognition site sequence can be the Sg6 fragment shown in SEQ ID NO: 9. The above two sites can realize the recognition and pairing of the first expression framework sequence and the recipient cell genome and the binding of the recombinase and the second expression framework sequence.

[0146] It should be noted that since NKG2A is mainly expressed in NK cells or NK precursor cells and can bind to CD94 protein to form a heterodimer, the ligand activates NKG2A after binding, activates the inhibitory signaling pathway in the cell, inhibits the activation signal from the activating receptor, and ultimately inhibits the activity of NK cells. Therefore, designing the recognition site sequence upstream of the NKG2A gene can disrupt the normal expression of the NKG2A gene in immune cells, thereby improving the effect of the target product cell CAR-NK in the tumor microenvironment.

[0147] In some optional embodiments, the first expression framework sequence includes at least a first recognition site sequence, an inducing differentiation gene, a special promoter, and a third site recognition sequence in the order of 5' to 3'.

[0148] The differentiation-inducing genes include one or more of the following genes:

[0149] CD122, CD38, CD7, CD127.

[0150] The first recognition site sequence adopts the Sg7 fragment shown in SEQ ID NO:10, and the inducing differentiation gene expression sequence includes the promoter, inducing differentiation gene and termination codon required for the transcription of the inducing differentiation gene in the cell; the exemplary promoter can be one of CMV, SV40, CAG, UAS, and other types of promoters can also be selected; the special promoter is a nucleic acid sequence combination of CMV+ATG, and the third site recognition sequence is Sg3.

[0151] The recognition site sequence is used for recognition pairing between the first expression framework sequence and the recipient cell genome and recognition pairing between the first expression framework and the second expression framework;

[0152] The second expression framework sequence includes at least a third recognition site sequence, a CAR gene (-ATG), and a second site recognition sequence in the order of 5'-3'.

[0153] Wherein the CAR gene (-ATG) is a CAR nucleic acid sequence lacking a start codon, the third recognition site sequence is used for homologous recombination with the third site recognition sequence in the first expression frame, and the second site recognition sequence is used for homologous recombination with a sequence in a cell nuclear chromosome;

[0154] The second expression framework sequence includes the third recognition site sequence, the first CAR gene and the second recognition site sequence in the order of 5'-3' expression; at this time, the second recognition site sequence can adopt the Sg8 fragment shown in SEQ ID NO:11.

[0155] In the disclosed embodiment, by selecting sites S3 and S4 located 400 bp upstream of the NKG2A chromosomal position Chromosome12:10,442,264-10,454,685, the differentiation-inducing gene is implanted upstream of the NKG2A gene to downregulate the expression of the NKG2A gene, thereby enhancing the killing effect of the target CAR-NK cell product in a microtumor environment.

[0156] It should be noted that the embodiments of the present disclosure provide an inventive concept of downregulating key genes to make NK cell products more efficient.

[0157] It should be noted that the structure of CAR includes at least: an extracellular region, a transmembrane region and an intracellular region. The extracellular region includes one or more of an antigen recognition domain, a hinge region and a linker, wherein the antigen recognition domain includes one or more of a polyadenylation signal peptide, a signal peptide, and a single-chain fragment variant (ScFV); the transmembrane region includes a transmembrane domain; the intracellular region includes one or more of a costimulatory domain and a signal transduction domain, collectively referred to herein as an intracellular signal transduction domain;

[0158] In some optional embodiments, the CAR gene comprises: a polyadenosine signal peptide gene fragment, a signal peptide gene fragment, a single-chain fragment variant, a linker, a hinge region, a transmembrane domain fragment, and a costimulatory domain fragment;

[0159] The linker is used to link the poly(A) signal peptide and the signal peptide, or the signal peptide and the single-chain fragment variant; or the single-chain fragment variant and the hinge region.

[0160] Exemplarily, in an optional embodiment of the present disclosure, the hinge region amino acid sequence is the Sg11 fragment shown in SEQ ID NO: 14, which is essentially an IgG1 hinge sequence that serves as a spacer connecting the antigen recognition domain and the transmembrane domain;

[0161] The single-chain fragment variant (ScFV) is an antigen-binding fragment that specifically binds to a tumor antigen. Here, the ScFV is an anti-PSMA ScFV, whose amino acid sequence is the Sg10 fragment shown in SEQ ID NO: 13. As a single-domain antibody (VHH), it has the ability to target and recognize prostate cancer cells.

[0162] The transmembrane domain fragment may be CD28, CD16, or NKp46.

[0163] The signal transduction domain uses CD28, and the costimulatory domain fragment can use CD3ξ. It should be noted that those skilled in the art can obtain the sequences of CD28, CD17, NKp46, and CD3ξ from public channels, and no special description is made in this disclosure.

[0164] It should be noted that since CAR binding affinity and its expression level determine the antigen binding properties of CAR and the effectiveness of target cell recognition, the affinity of CAR must be high enough to recognize the target antigen, but too high will induce off-target tumor toxicity. Based on this characteristic, it is crucial to construct CARS with appropriate affinity to distinguish between malignant and normal cells without causing any toxicity.

[0165] The CAR structural sequence provided in the embodiments of the present disclosure can effectively inhibit the development of prostate cancer in animal experiments and has strong clinical application prospects.

[0166] It should be noted that for different indications, the single-chain fragment variant (ScFV) in CAR will have different designs. By designing ScFV, it can be adapted to different target cells. At the same time, the corresponding antigen recognition domain design is carried out in conjunction with ScFV to make the CAR sequence have better affinity and low toxicity.

[0167] In some embodiments of the present disclosure, the following technical solutions are provided:

[0168] A CAR-NNK cell product is obtained by the preparation method, or by expressing the combined expression framework in immune cells.

[0169] The CAR-NNK cell product is realized based on the above-mentioned immune cell preparation method. The specific steps of the immune cell preparation method can be referred to the above-mentioned embodiments. Since the CAR-NNK cell product adopts part or all of the technical solutions of the above-mentioned embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above-mentioned embodiments, which will not be described in detail here.

[0170] It should be noted that due to the high concentration of CAR-NK cells in the cell product obtained by this preparation method, it needs to be diluted to the normal usage concentration when used, and the effective period of the cell product is 1 to 2 weeks. Therefore, it can be injected at least once every two weeks to be used in conjunction with other therapies without toxic side effects to the human body.

[0171] The present disclosure will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present disclosure only and are not intended to limit the scope of the present disclosure. Experimental methods in the following examples where specific conditions are not specified are generally measured in accordance with national standards. If no corresponding national standards are available, the methods were performed in accordance with commonly used international standards, conventional conditions, or conditions recommended by the manufacturer.

[0172] Example

[0173] 1. Design modular expression framework components:

[0174] 1. A composition of the first expression framework sequence:

[0175] As shown in Figure 3, the first expression framework sequence consists of a promoter element A, an inducing differentiation gene B, a termination sequence C, and a homologous recombination sequence D1. The order from 5' to 3' is: a promoter element, an inducing differentiation gene, a termination sequence, an enhanced promoter P (+ATG), and a homologous recombination sequence.

[0176] The specific composition is as follows:

[0177] (1) The promoter element A includes the nuclear localization sequence A1: the amino acid sequence is PKKKRKV, and the corresponding nucleotide sequence K1 is CCGAAGAAAAAGCGGAAAGTA (it can also be other optimized base sequences).

[0178] The nuclear localization sequence can also be other amino acid sequences, such as MSRRRKANPTKLSENAKKLAKEVEN, PAAKRVKLD, KLKIKRPVK, etc. The specific amino acid sequence is determined by the optimized gene sequence.

[0179] The function of the nuclear localization sequence is to guide the polypeptide containing the nuclear localization sequence into the cell nucleus.

[0180] The promoter element A also includes an implantation site homologous recombination sequence A2, which functions to pair with the cell nuclear chromosomes for homologous recombination; the A2 sequence is SEQ ID NO: 8, as shown in Table 2.

[0181] Table 2 Distribution of homologous recombination sequences and third recognition site sequences at the implantation site

[0182] (2) Gene B is converted into the differentiation-inducing gene CD122 gene, including a first enhanced promoter, specifically a CMV promoter.

[0183] (3) The termination sequence C is the human gastrin terminator (hGT) as shown in SEQ ID NO: 12.

[0184] (4) Enhanced promoter P (+ATG) is a combination of CMV promoter and ATG nucleotide sequence, and the order of 5'-3' is CMV+ATG.

[0185] (5) The homologous recombination sequence includes a third recognition site sequence, and the third recognition site sequence is LoxFaS as shown in SEQ ID NO: 7 in Table 2.

[0186] When the implantation site homologous recombination sequence and the third recognition site sequence in Table 1 are used, the enhanced promoter is a human CMV promoter with intron A, and recombination is performed by Cre recombinase.

[0187] It should be noted that the implantation site homologous recombination sequence, namely the first recognition site sequence, and the stop codon are well known to those skilled in the art and are not specifically described here.

[0188] 2. The second composition of the first expression framework sequence:

[0189] When the third recognition site sequence is NKG2A, the implantation site sequences are site S3 (Sg7) and site S4 (Sg8) located 400 bp upstream of chromosomal position Chromosome 12:10,442,264-10,454,685, and the specific distribution is shown in Table 3.

[0190] Table 3 Distribution of implantation site sequences

[0191] It should be noted that since NKG2A is mainly expressed in NK cells or NK precursor cells and can bind to CD94 protein to form a heterodimer, the ligand activates NKG2A after binding, activates the inhibitory signaling pathway in the cell, inhibits the activation signal from the activating receptor, and ultimately inhibits the activity of NK cells. Therefore, designing the recognition site sequence upstream of the NKG2A gene can disrupt the normal expression of the NKG2A gene in immune cells, thereby improving the effect of the target product cell CAR-NK in the tumor microenvironment.

[0192] 3. Design of the second expression framework sequence:

[0193] As shown in Figure 3, the second expression framework sequence consists of the homologous recombination sequence D2, the CAR segment E and the CAR termination sequence F, and the specific composition is as follows:

[0194] (1) The homologous recombination sequence D2 includes a third recognition site sequence and a second enhanced promoter, and the second enhanced promoter is a CMV promoter.

[0195] (2) Fragment E of CAR is a CAR lacking ATG (CAR promoter). In the order of extracellular region-transmembrane region-intracellular region, the CAR structure consists of antigen recognition domain, hinge region, transmembrane domain, signal transduction domain, and co-stimulatory domain. When prostate cancer is used as the target cell, the antigen recognition domain is the recognition domain V1 (Sg10), and the hinge region domain is V2 (Sg11). The amino acid sequences are shown in Table 4.

[0196] Table 4 Distribution of CAR recognition domain V1 and hinge domain V2 in prostate cancer cells

[0197] In Table 4, the recognition domain V1 is anti-PSMA ScFV, which functions to specifically recognize prostate cancer cells, and V2 is based on the (IgG1-CH2CH3) sequence of immunoglobulin G (IgG), contains 217 amino acids, and functions as a spacer connecting the antigen recognition domain and the transmembrane domain.

[0198] The transmembrane domain adopts any one of CD28, CD3z, CD16, and NKp46, the signal transduction domain adopts CD28, and the costimulatory domain fragment adopts CD3ξ.

[0199] It should be noted that the genes in the above structures are derived from sequences with optimized codons and are artificially synthesized based on the original sequences.

[0200] 2. Immune cell preparation process:

[0201] General techniques:

[0202] 1) Recombinant DNA technology:

[0203] Standard methods were used to manipulate DNA, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, (1989). Molecular biology reagents were used according to the manufacturer's instructions.

[0204] 2) DNA sequence determination:

[0205] DNA sequencing was performed at SequiServe GmbH (Vaterstetten, Germany).

[0206] 3) DNA and protein sequence analysis and sequence data management:

[0207] The EMBOSS (European Molecular Biology Open Software Suite) software package and Invitrogen's Vector NTI version 11.5 or Geneious prime were used for sequence creation, mapping, analysis, annotation, and illustration.

[0208] 4) Gene and oligonucleotide synthesis:

[0209] The desired gene fragments were prepared by chemical synthesis at Geneart GmbH (Regensburg, Germany). The synthesized gene fragments were cloned into E. coli plasmids for propagation / amplification. The DNA sequences of the subcloned gene fragments were verified by DNA sequencing. Alternatively, short synthetic DNA fragments were assembled by annealing chemically synthesized oligonucleotides or by PCR. Individual oligonucleotides were prepared by metabion GmbH (Planegg-Martinsried, Germany).

[0210] 5) Main reagents:

[0211] 1. DNA purification kit: PureLink Fast (Thermo Fisher).

[0212] 2. Reagent 1: Retronectin (Takara, GT-T551H3) stock solution concentration is 1 μg / μL. Dilute with PBS to a working concentration of 25 μg / mL. Prepare and use immediately.

[0213] 3. Reagent 2: Dilute polybrene with culture medium to a concentration of 0-20 μg / mL and use immediately.

[0214] 4. Reagent 3: Dilute BX795 (Cayman Chemical Company, 14932) with culture medium to a concentration of 0-20 mM. Prepare and use immediately.

[0215] In all of the foregoing aspects and some embodiments:

[0216] Further operations are performed based on the aforementioned first expression framework sequence and the second expression framework sequence:

[0217] The first expression framework sequence and the second expression framework sequence are introduced into expression vectors respectively to form a first expression vector and a second expression vector, and then transfection is performed.

[0218] Plasmid composition: For expression of antibody chains, a transcription unit containing the following functional elements was used:

[0219] The immediate early enhancer and promoter from human cytomegalovirus, comprising intron A; human heavy chain immunoglobulin 5'-untranslated region (5'UTR); murine immunoglobulin heavy chain signal sequence; nucleic acid encoding the corresponding antibody chain; bovine growth hormone polyadenylation sequence (BGH pA); and optionally, human gastrin terminator (hGT).

[0220] In addition to the expression unit / cassette comprising the desired gene to be expressed, the basic / standard mammalian expression plasmid contains an origin of replication from the vector pUC18, which allows replication of the plasmid in E. coli, and a β-lactamase gene, which confers ampicillin resistance in E. coli.

[0221] The specific process is as follows: cDNA encoding the corresponding antibody chain is generated by gene synthesis (Geneart, Life Technologies Co., Ltd.). The gene synthesis vector and backbone vector are digested with HindIII-HF and EcoRI-HF (NEB) at 37°C for 1 hour and separated by agarose gel electrophoresis. The DNA fragments of the insert and backbone are cut out from the agarose gel and extracted by a QIAquick gel extraction kit (Qiagen). The purified insert fragment and backbone fragment are connected with an insert / backbone ratio of 3:1 via a quick ligation kit (Roche) according to the manufacturer's protocol. The ligation method is then transformed into competent Escherichia coli DH5α via heat shock at 42°C for 30 seconds and incubated at 37°C for 1 hour. Afterwards, they are plated on agar plates containing ampicillin for selection. The plates are incubated overnight at 37°C.

[0222] The next day, clones were picked and incubated overnight at 37°C with shaking for minimal or maximal prep using 5075 (Eppendorf) or QIAprep Spin Mini-Prep Kit (Qiagen) / NucleoBond Xtra Maxi EF Kit (Macherey & Nagel), respectively. All constructs were sequenced to ensure the absence of any unwanted mutations (SequiServe GmbH).

[0223] In the second cloning step, the previously cloned vector was digested with KpnI-HF / SalI-HF and SalI-HF / MfeI-HF under the same conditions as the first cloning. The backbone vector was digested with KpnI-HF and MfeI-HF, isolated and extracted as described above.

[0224] Purified insert and backbone were ligated using T4 DNA ligase (NEB) at a 1:1:1 insert / insert / backbone ratio at 4°C overnight and inactivated at 65°C for 10 min according to the manufacturer's protocol, and cloning steps were performed as described above.

[0225] The cloned plasmids were used for transfection and stored.

[0226] It should be noted that the above experimental operations are commonly used technical means in this field, and those skilled in the art can use other means to complete the construction of the expression vector.

[0227] Host cells were propagated in a proprietary DMEM / F12-based medium in a 125 mL disposable split shake flask under standard humidified conditions (95% rH, 37°C, and 5% CO2) at a constant agitation rate of 150 rpm. Cells were plated every 3-4 days at a concentration of 3 x 10 5 Cells were plated at an effective concentration of 10 cells / mL in chemically defined medium. The density and viability of the cultures were measured using a Cedex HiRes cell counter (F. Hoffmann-La Roche GmbH, Basel, Switzerland).

[0228] 1 to 2 days before transfection, the host cells were cultured at a rate of 4 × 10 5 Cells were seeded at a density of 100 cells / mL in fresh culture medium and transfected using the Nucleofector kit V (Lonza, Switzerland) via the Nucleofector device;

[0229] A mixture of 5 μg of a Cre recombinase-expressing plasmid and 25 μg of the first expression vector and the second expression vector is used as 30 μg of nucleic acid; or a mixture of 5 μg of a Cre recombinase mRNA-expressing plasmid and 25 μg of the first expression vector and the second expression vector is used as 30 μg of nucleic acid;

[0230] 30 μg of the nucleic acid was added to the host cells, and the cells were inoculated into 30 mL of culture medium without a selection agent for subsequent culture.

[0231] The principle of the above process is shown in Figure 4. The genetic elements necessary for this process include:

[0232] (1) Cas9 protein expression gene, whose vector is pUC18 / P0261 / psPAX2 lentiviral packaging plasmid, and GFP is used as the transfection tag;

[0233] (2) sgRNA fragments, the specific distribution is shown in Table 5.

[0234] Table 5. Distribution of sgRNA fragments

[0235] (3) Cre recombinase and Cre recombinase mRNA, wherein the amino acid sequence of Cre recombinase is shown in SEQ ID NO: 1, and an artificially synthesized cDNA fragment is used, and the cDNA fragment sequence of Cre recombinase is shown in SEQ ID NO: 2.

[0236] (4) Homology arm fragments, including implantation sites S1 (Sg5), S2 (Sg6) and LoxFaS sequences, or sites S3 (Sg7) and S4 (Sg8).

[0237] The above-mentioned sgRNA fragment can use the pGRB-sgRNA plasmid editing system, which contains an sgRNA expression system and ampicillin resistance, etc., and can normally express sgRNA targeting a specific site for identifying the target gene to achieve gene editing; the pGRB-sgRNA plasmid editing system uses the replication origin of the expression vector pUC18, so it can allow replication and amplification in Escherichia coli, which makes commercial Escherichia coli trans5α a tool for plasmid preparation and amplification.

[0238] In all of the foregoing aspects and some embodiments:

[0239] As shown in FIG1 , based on the raw materials and principles disclosed in the above examples, an asynchronous method was used to prepare immune cells;

[0240] S1. Obtain peripheral blood-derived cells;

[0241] S2. Primary expansion of peripheral blood-derived cells using an initial culture medium during a first culture cycle to obtain peripheral blood mononuclear cells (PBMCs); wherein the first culture cycle is 1 to 2 days and the initial culture medium includes recombinant human interleukins IL-2, IL-15, IL-3, and IL-7, tyrosine kinase 3 ligand (Flt3L), plasma replacement fluid, and IMDM medium;

[0242] S3. Perform the first CRISPER transfection on peripheral blood mononuclear cells to introduce the Cre recombinase mRNA fragment, the cDNA fragment of the first expression vector, and the cDNA fragment of the second expression vector into the cells. The specific steps are as follows:

[0243] Cre recombinase mRNA fragment, pSpCas9(BB)-2A-GFP plasmid and pUC19-sg1-GEU1 plasmid were co-transfected with a nucleic acid molar ratio of 3:1:1;

[0244] S4. performing secondary amplification on the first transfected cells using the primary culture medium during a second culture period to obtain secondary amplified cells; wherein the second culture period is 2 to 3 days;

[0245] S5. Perform a second CRISPER transfection on the secondary amplified cells to obtain secondary transfected cells, which contain Cre recombinase mRNA fragment, pSpCas9(BB)-2A-GFP plasmid, and pUC19-sg1-GEU2 plasmid at a nucleic acid molar ratio of 3:1:1;

[0246] S6. Use NK expansion medium to iteratively amplify the second transfected cells during the third culture cycle to obtain an immune cell product, wherein the third culture cycle is 10 to 14 days, and the NK expansion medium includes at least recombinant human interleukin IL-2, IL-15, plasma replacement fluid and IMDM medium.

[0247] In all of the foregoing aspects and some embodiments:

[0248] As shown in Figure 2, based on the above-disclosed raw materials and principles, the actual immune cell preparation method is a synchronous method:

[0249] S1. Obtain peripheral blood-derived cells;

[0250] S2. Primary expansion of peripheral blood-derived cells using an initial culture medium during a first culture cycle to obtain peripheral blood mononuclear cells; wherein the first culture cycle is 3 days, and the initial culture medium includes recombinant human interleukins IL-2, IL-15, IL-3, and IL-7, tyrosine kinase 3 ligand (Flt3L), plasma replacement fluid, and IMDM medium;

[0251] S3. Perform a CRISPER transfection on the peripheral blood mononuclear cells to introduce the Cre recombinase mRNA fragment, the cDNA fragment of the first expression vector, and the cDNA fragment of the second expression vector into the cells, specifically in the following steps:

[0252] pSpCas9(BB)-2A-GFP plasmid, pUC19-sg1-sg2-GEU1-GEU2 plasmid, and Cre recombinase mRNA fragment were co-transfected with a nucleic acid molar ratio of 1:1:3;

[0253] S4. Culturing and screening the infected cells using the primary culture medium during a second culture cycle to obtain normally propagating screened cells; wherein the second culture cycle is 1 day;

[0254] S5. Use NK expansion medium to iteratively amplify the screened cells during the third culture cycle to obtain an immune cell product, wherein the third culture cycle is 10 to 14 days, and the NK expansion medium includes at least recombinant human interleukin IL-2, IL-15, plasma replacement fluid, and IMDM medium.

[0255] In all of the foregoing aspects and some embodiments:

[0256] As shown in FIG1 , based on the raw materials and principles disclosed in the above examples, an asynchronous method was used to prepare immune cells;

[0257] S1. Obtain peripheral blood-derived cells;

[0258] S2. Primary expansion of peripheral blood-derived cells using an initial culture medium during a first culture cycle to obtain peripheral blood mononuclear cells (PBMCs); wherein the first culture cycle is 1 to 2 days and the initial culture medium includes recombinant human interleukins IL-2, IL-15, IL-3, and IL-7, tyrosine kinase 3 ligand (Flt3L), plasma replacement fluid, and IMDM medium;

[0259] S3. Perform the first CRISPER transfection of peripheral blood mononuclear cells to introduce the Cre recombinase mRNA fragment, the cDNA fragment of the first expression vector, and the cDNA fragment of the second expression vector into the cells. Specifically, the Cre recombinase mRNA fragment, the pSpCas9(BB)-2A-GFP plasmid, and the pUC19-sg3-GEU1 plasmid are co-transfected at a nucleic acid molar ratio of 3:1:1.

[0260] S4. performing secondary amplification on the first transfected cells using the primary culture medium during a second culture period to obtain secondary amplified cells; wherein the second culture period is 2 to 3 days;

[0261] S5. Perform a second CRISPER transfection on the secondary amplified cells to obtain secondary transfected cells, containing the Cre recombinase mRNA fragment, the pSpCas9(BB)-2A-GFP plasmid, and the pUC19-sg4-GEU2 plasmid at a nucleic acid molar ratio of 3:1:1;

[0262] S6. Use NK expansion medium to iteratively amplify the second transfected cells during the third culture cycle to obtain an immune cell product, wherein the third culture cycle is 10 to 14 days, and the NK expansion medium includes at least recombinant human interleukin IL-2, IL-15, plasma replacement fluid and IMDM medium.

[0263] In all of the foregoing aspects and some embodiments:

[0264] As shown in Figure 2, based on the disclosed raw materials and principles, the actual immune cell preparation method is a synchronous method:

[0265] S1. Obtain peripheral blood-derived cells;

[0266] S2. Primary expansion of peripheral blood-derived cells using an initial culture medium during a first culture cycle to obtain peripheral blood mononuclear cells; wherein the first culture cycle is 3 days, and the initial culture medium includes recombinant human interleukins IL-2, IL-15, IL-3, and IL-7, tyrosine kinase 3 ligand (Flt3L), plasma replacement fluid, and IMDM medium;

[0267] S3. Perform a CRISPER transfection on the peripheral blood mononuclear cells to introduce the Cre recombinase mRNA fragment, the cDNA fragment of the first expression vector, and the cDNA fragment of the second expression vector into the cells, specifically in the following steps:

[0268] The pSpCas9(BB)-2A-GFP plasmid, pUC19-sg3-sg4-GEU1-GEU2 plasmid, and Cre recombinase mRNA fragment were co-transfected with a nucleic acid molar ratio of 1:1:3;

[0269] S4. Culturing and screening the infected cells using the primary culture medium during a second culture cycle to obtain normally propagating screened cells; wherein the second culture cycle is 1 day;

[0270] S5. Use NK expansion medium to iteratively amplify the screened cells during the third culture cycle to obtain an immune cell product, wherein the third culture cycle is 10 to 14 days, and the NK expansion medium includes at least recombinant human interleukin IL-2, IL-15, plasma replacement fluid, and IMDM medium.

[0271] It should be noted that, in the above transfection process, short double-stranded DNA fragments such as homologous sequence fragments sg1, S1, LoxFaS fragments, sg2, S2, sg3, S3, sg4, S4 can be mixed with relevant plasmids for transfection to improve the transfection success rate. The transfection method can be electroporation. Cre recombinase can also be constructed in the plasmid for transfection. When constructed in the plasmid, pOG231 (Wong, ET, et al., Nuc. Acids Res. 33 (2005) e147; O'Gorman, S., et al., Proc. Natl. Acad. Sci. USA 94 (1997) 14602-14607) can be selected. The above cre recombinase can also be replaced by FLP recombinase, Bxb1 integrase and Integrase.

[0272] When the homologous recombination sequence is an FRT site, the cell requires FLP recombinase to perform recombination. In certain embodiments, when the homologous recombination sequence is a Bxb1 attP or Bxb1 attB site, the cell requires Bxb1 integrase to perform recombination. In certain embodiments, when the homologous recombination sequence is a φC31 attP or φC31 attB site, the cell requires φC31 integrase to perform recombination. The recombinase can be introduced into the cell using an expression vector containing the coding sequence for the enzyme. The above homologous recombination sequences are common knowledge in the art and are not specifically described here.

[0273] In all the aforementioned aspects and some embodiments, the transfection method can also use lentiviral transfection. Accordingly, the virus-related plasmid can be constructed according to the same idea, or a commercial kit can be used, such as Lipofectamine Stem (Thermo Fisher), which is not specifically described here.

[0274] It should be noted that the detection methods involved in the present disclosure, such as FACS screening, flow cytometry, PCR, gel electrophoresis, etc., are all conventional technical means in the field and are not specifically described here.

[0275] Monoclonal identification was performed on immune cell products obtained with different implantation sites, selected third recognition site sequences, different forms of Cre recombinase, different transfection methods and induced differentiation genes. The results are shown in Table 6.

[0276] Table 6 Monoclonal identification results of immune cell products

[0277] The flow cytometer test results of the immune cell products in the experimental group 1 shown in Table 6 in the above process are shown in Figure 5; in Figure 5, Figure 5a corresponds to the experimental group 1, Figure 5b corresponds to the experimental group 6, Figure 5c corresponds to the experimental group 11, Figure 5d corresponds to the experimental group 16, Figure 5e corresponds to the experimental group 21, and Figure 5f corresponds to the experimental group 26.

[0278] The corresponding cell culture conditions are shown in FIG6 , where letters af correspond to experimental groups 1, 6, 11, 16, 21, and 26, respectively.

[0279] At the same time, during the immune cell preparation process of the above-mentioned experimental group 1, after the screening cells were cultured for 48 hours, the cell distribution under a fluorescence microscope was shown in Figure 7, and the transfection label GFP was highlighted, indicating that the expression vector containing the first expression framework sequence and the second expression framework sequence was successfully transduced into the PB-NK cells.

[0280] In summary, the first expression framework sequence and the second expression framework sequence constructed by the CRISPR / CSA9 gene editing technology disclosed in the present invention can enhance the expression of CAR binding while transforming PBMC immune stem cells into NK cells, prompting PBMC immune stem cells to bind to the expressed CAR while transforming into NK cells, thereby increasing the proportion concentration and conversion rate of CAR-NK cells in the final immune cell product.

[0281] At the same time, the combined expression framework of the first expression framework sequence and the second expression framework sequence can be used in the differentiation and enrichment preparation process of various immune cells, such as invariant natural killer T cells (iNKT), natural or non-natural T cells, natural or non-natural NK cells, cytotoxic T cells, NK cell lines and induced pluripotent stem cells (iPS cells), and has a wide range of application scenarios.

[0282] Various embodiments of the present disclosure may be presented in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a hard limitation on the scope of the present disclosure; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numbers within the range. For example, the description of a range from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0283] In the present disclosure, unless otherwise specified, the directional words used, such as "upper" and "lower", specifically refer to the directions of the drawings in the accompanying drawings. In addition, in the description of the present disclosure, the terms "including", "comprising", etc. mean "including but not limited to". In this article, relational terms such as "first" and "second" are merely used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply that there is any such actual relationship or order between these entities or operations. In this article, "and / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. Wherein A and B can be singular or plural. In this article, "at least one" refers to one or more, and "plurality" refers to two or more. "At least one", "at least one of the following" or similar expressions refer to any combination of these items, including any combination of single or plural items. For example, "at least one of a, b, or c", or "at least one of a, b and c", can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple.

[0284] The foregoing description is intended only to provide specific embodiments of the present disclosure, intended to enable those skilled in the art to understand and implement the present disclosure. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present disclosure. Therefore, the present disclosure is not to be limited to the embodiments shown herein, but is to be construed in the broadest manner consistent with the principles and novel features claimed herein.

Claims

1. A method for preparing immune cells, comprising: Introducing a first expression framework sequence containing a differentiation-inducing gene into peripheral blood mononuclear cells to induce the peripheral blood mononuclear cells to differentiate into NK cells, and then introducing a second expression framework sequence containing CAR to obtain CAR-NK cells; or, The first expression framework sequence containing the differentiation-inducing gene and the second expression framework sequence containing CAR are synchronously introduced into peripheral blood mononuclear cells to obtain CAR-NK cells.

2. The preparation method according to claim 1, wherein The second expression framework sequence lacks the promoter of the CAR; and, The first expression framework sequence includes the terminator of the differentiation-inducing gene and the promoter of the CAR, and the expression sequence of the terminator of the differentiation-inducing gene is located upstream of the expression sequence of the promoter of the CAR.

3. The preparation method according to claim 1 or 2, wherein The differentiation-inducing genes include one or more of the following genes: CD122, CD38, CD7, CD127.

4. The preparation method according to claim 1, wherein The introduction method is gene transfection, and the gene transfection comprises the following steps: Mixing the expression vector group and the plasmid expressing the recombinase to obtain a mixed plasmid; Transfecting the mixed plasmid and necessary gene elements into peripheral blood mononuclear cells to achieve gene recombination of peripheral blood mononuclear cells to obtain transfected cells; or, mixing the expression vector group and the mRNA fragment expressing the recombinase to obtain a mixture; Transfecting the mixture and necessary gene elements into peripheral blood mononuclear cells to achieve gene recombination of peripheral blood mononuclear cells and obtain transfected cells; The expression vector group comprises at least one of a first expression vector and a second expression vector, wherein the first expression vector comprises the first expression framework sequence, and the second expression vector comprises the second expression framework sequence.

5. The preparation method according to claim 4, wherein The recombinase is Cre recombinase, FLP recombinase, Bxb1 integrase and At least one of the integrase enzymes.

6. The preparation method according to claim 5, characterized in that: The recombinase is Cre recombinase, the amino acid sequence of the Cre recombinase is shown in SEQ ID NO:1, and the mRNA sequence of the Cre recombinase is shown in SEQ ID NO:

2.

7. The preparation method according to claim 4, wherein The molar ratio of the plasmid expressing Cre recombinase to the expression vector group is 1:2 to 1:5; and / or, The molar ratio of the mRNA fragment expressing Cre recombinase to the expression vector group is 1:3 to 1:

5.

8. The preparation method according to claim 4, wherein The essential gene elements include cas9 protein expression gene, sgRNA fragment and homology arm fragment.

9. The preparation method according to claim 8, wherein: The nucleotide sequence of the sgRNA fragment includes the Sg1 fragment as shown in SEQ ID NO: 3; and / or, The nucleotide sequence of the sgRNA fragment includes the Sg2 fragment as shown in SEQ ID NO:4; and / or, The nucleotide sequence of the sgRNA fragment includes the Sg3 fragment as shown in SEQ ID NO: 5; and / or, The nucleotide sequence of the sgRNA fragment includes the Sg4 fragment shown in SEQ ID NO:

6.

10. A gene combination expression framework, comprising the first expression framework sequence and the second expression framework sequence in the preparation method according to any one of claims 1 to 9.

11. The combined expression framework according to claim 10, wherein: The first expression framework sequence includes at least a first recognition site sequence, an inducing differentiation gene expression sequence, a CAR promoter and a third recognition site sequence in the order of 5'-3'; The differentiation-inducing gene expression sequence includes a promoter, a differentiation-inducing gene and a termination codon; and, The promoter of CAR is a combination of an enhanced promoter and ATG; and, The first recognition site sequence is used for recognition pairing of the first expression framework sequence and the recipient cell genome; and, The third recognition site sequence is used for recognition of the recombinase.

12. The combined expression framework according to claim 11, wherein: The first recognition site sequence is the Sg5 fragment as shown in SEQ ID NO:8, or the Sg7 fragment as shown in SEQ ID NO:

10.

13. The combined expression framework according to claim 11, wherein: The first expression framework sequence also includes a first SOI sequence; The first SOI sequence is a regulatory sequence required for expressing differentiation-inducing genes.

14. The combined expression framework according to claim 11, wherein: The third recognition site sequence includes one or more of the following sequences: LoxFaS sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, sequence, NKG2A.

15. The combined expression framework according to claim 10, wherein: The second expression framework sequence includes the third recognition site sequence, the CAR gene and the second recognition site sequence in the order of 5'-3'; The third recognition site sequence lacks the CAR gene promoter; and, The second recognition site sequence is the Sg6 fragment shown in SEQ ID NO:9, or the Sg8 fragment shown in SEQ ID NO:

11.

16. The combined expression framework according to claim 15, wherein: The CAR gene includes: a polyadenosine signal peptide gene fragment, a signal peptide gene fragment, a single-chain fragment variant, a linker, a hinge region, a transmembrane domain fragment and a co-stimulatory domain fragment; The linker is used to link the polyadenosine signal peptide and the signal peptide, or the signal peptide and the single-chain fragment variant; or the single-chain fragment variant and the hinge region.

17. The combined expression framework according to claim 16, wherein: The transmembrane domain fragment is a CD28 fragment.

18. The combinatorial expression framework according to claim 16, wherein: The amino acid sequence of the single-chain fragment variant is the Sg10 fragment shown in SEQ ID NO:

13.

19. The combinatorial expression framework according to claim 16, wherein: The hinge region amino acid sequence is the Sg11 fragment shown in SEQ ID NO:

14.

20. A CAR-NNK cell product obtained by the preparation method according to any one of claims 1 to 9, or by expressing the combined expression framework according to any one of claims 10 to 19 in immune cells.

Images