Use of bcor and zc3h12a in prevention and treatment of chronic infections

Abstract

Disclosed in the present invention is a use of Bcor and Zc3h12a in the prevention and treatment of chronic infections. The present invention provides any one of the following uses of a reagent targeting a Bcor gene or an expression product thereof, or a combination of the reagent targeting the Bcor gene or the expression product thereof and a reagent targeting a Zc3h12a gene or an expression product thereof: (i) a use in the preparation of a drug for preventing and / or treating chronic infections; (ii) a use in the preparation of a reagent for enhancing the capability of T cells against chronic infections; and (iii) a use in the preparation of a reagent for preventing and / or reversing T cell exhaustion.

Description

Use of Bcor and Zc3h12a in preventing and treating chronic infections

[0001] Priority and related applications

[0002] The present invention claims priority to Chinese patent application No. 202311232399.1 filed on September 22, 2023, entitled “Use of Bcor and Zc3h12a in the prevention and treatment of chronic infections”, the entire contents of which including the appendix are incorporated herein by reference. Technical Field

[0003] The present invention belongs to the technical field of immune cells, and particularly relates to uses of Bcor and Zc3h12a in preventing and treating chronic infections. Background Art

[0004] During chronic viral infection, T cells that recognize viral antigens enter a low-function state known as exhaustion, i.e., T cell exhaustion. Exhausted T cells have reduced proliferation capacity, weakened killing capacity, reduced cytokine secretion, and high expression of various immunosuppressive receptors (such as PD-1, etc.), which ultimately leads to reduced T cell antiviral ability and the inability of the body to completely eliminate the virus. Preventing, reducing and / or reversing T cell exhaustion is an important way to enhance antiviral ability. Currently, the main way to prevent, reduce and / or reverse T cell exhaustion is to block inhibitory receptors on the surface of T cells through antibodies, but this method has not yet achieved significant results in chronic viral infection.

[0005] Therefore, further research is needed to prevent, reduce and / or reverse T cell exhaustion / damage and restore T cell effector function after or during chronic infection, thereby effectively preventing or treating chronic infection.

[0006] Summary of the Invention

[0007] Problems to be solved by the invention

[0008] The present invention modifies the fate of antigen-specific T cells targeting pathogens (such as viruses) through gene editing, effectively preventing and / or reversing the state of T cell exhaustion, enhancing T cell survival, stemness and function, and improving the ability of T cells to resist chronic infections (such as chronic viral infections), which can significantly reduce the titer of chronic viruses.

[0009] Solutions for solving problems

[0010] The first aspect of the present invention provides any of the following uses of an agent targeting the Bcor gene or its expression product, or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product:

[0011] (i) use in the preparation of a medicament for preventing and / or treating chronic infection;

[0012] (ii) use in the preparation of a reagent for enhancing the ability of T cells to resist chronic infection;

[0013] (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

[0014] In some embodiments, the T cells comprise naive T cells, CD4 + T cells, CD8 + at least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells, and antigen-specific T cells;

[0015] Optionally, the T cells comprise activated T cells;

[0016] Optionally, the T cells comprise antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against pathogens that cause chronic infection;

[0017] Optionally, the T cells comprise CD8 + T cells;

[0018] Optionally, said T cells comprise exhausted T cells.

[0019] In some embodiments, the chronic infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection;

[0020] Preferably, the chronic infection comprises a viral infection.

[0021] In some embodiments, the T cells are T cells from a subject; and / or, the chronic infection is a chronic infection in a subject;

[0022] Optionally, the subject is a human or non-human animal.

[0023] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex, and a small molecule inhibitor;

[0024] Optionally, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule;

[0025] Optionally, the polypeptide comprises at least one of an antibody or antigen-binding fragment thereof, an artificial zinc finger nuclease, and a TALEN system;

[0026] Optionally, the ribonucleoprotein complex comprises a CRISPR / cas system.

[0027] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product includes an agent used in any one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology.

[0028] A second aspect of the present invention provides a modified T cell, wherein the modified T cell is a T cell treated with an agent targeting the Bcor gene or its expression product, or the modified T cell is a T cell treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product;

[0029] Optionally, the T cells comprise activated T cells;

[0030] Optionally, the T cells comprise antigen-specific T cells;

[0031] Optionally, the T cells comprise CD8 + T cells;

[0032] Optionally, said T cells comprise exhausted T cells.

[0033] In some embodiments, the antigen-specific T cells are antigen-specific T cells directed against pathogens that cause chronic infection;

[0034] Optionally, the chronic infection comprises at least one of bacterial infection, viral infection, fungal infection, protozoan infection and parasitic infection;

[0035] Preferably, the chronic infection comprises a viral infection;

[0036] Optionally, the chronic infection is a chronic infection in a subject.

[0037] The third aspect of the present invention provides use of the modified T cells according to the second aspect of the present invention in the preparation of a medicament for preventing and / or treating chronic infection.

[0038] The fourth aspect of the present invention provides a composition comprising at least one selected from the following (a) to (c):

[0039] (a) an agent targeting the Bcor gene or its expression product;

[0040] (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and,

[0041] (c) The modified T cell according to the second aspect of the present invention.

[0042] Optionally, the composition is a pharmaceutical composition, further comprising a pharmaceutically acceptable carrier.

[0043] Effects of the Invention

[0044] The present invention achieves the purpose of enhancing the ability of T cells to resist chronic infection (such as chronic viral infection) by gene editing of antigen-specific T cells of chronically infected pathogens (such as viruses). By knocking out the Bcor gene or knocking out the Bcor and Zc3h12a genes at the same time, the proliferation capacity, stemness and function of T cells are greatly improved during chronic infection, especially during chronic viral infection, thereby enhancing the ability to resist pathogens (viruses), such as reducing viral titers. The present invention solves the problems of weak proliferation, low stemness and functional defects of T cells in chronic infection, such as chronic viral infection, and will effectively improve the ability of T cells to resist chronic infection, such as anti-viral infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1. Simultaneous knockout of Bcor and Zc3h12a affects CD8 in acute infection with LCMV Armstrong virus. + T cell expansion and persistence were not significantly affected

[0046] Figure 1A is a schematic diagram of the experimental design. + P14 cells were activated and transduced with retrovirus expressing non-targeting sgRNA with GFP marker (sgControl) or indicated sgRNA with Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a 1:1 ratio and co-transferred to Cas9 cells infected with LCMV Armstrong one day before cell adoptive transfer. + 1.1-positive P14 cells in the blood and spleen during LCMV Armstrong infection (n=5 mice per group). +Representative images of Thy1.1-positive P14 cells (Figure 1C) and statistical analysis (Figure 1D) (n = 5 mice per group). Figure 1B and D, data represent mean ± standard error (mean ± SEM); Figure 1B and F are two-way ANOVA multiple-comparisons tests, and Figure 1D is a two-tailed paired Student's t test.

[0047] Figure 2. Simultaneous knockout of Bcor and Zc3h12a enhances CD8 expression during chronic LCMV clone 13 infection. + T cell expansion capacity, persistence and stemness

[0048] Figure 2A is a schematic diagram of the experimental design. + P14 cells were activated and transduced with retrovirus expressing non-targeting sgRNA with a GFP marker (sgControl) or the indicated sgRNA with a Thy1.1 marker. GFP-positive and Thy1.1-positive P14 cells were mixed at a 1:1 ratio and co-transferred to Cas9 cells infected with LCMV clone 13 one day before cell adoptive transfer. + GFP and Thy1.1 double positive P14 cells in blood and spleen were detected by flow cytometry. Figure 2B shows the dynamics of Thy1.1 positive P14 cells in blood during LCMV clone 13 infection (n=5 mice per group). GFP in spleen 36 days after infection is shown. + Representative images (C in FIG2 ) and statistical analysis (D in FIG2 ) of P14 cells and Thy1.1-positive P14 cells (n=5 mice per group). FIG2 E shows a schematic diagram of the experimental design of the secondary transfer of P14 cells. FIG2 F shows the expression of Thy1.1 in blood after LCMV clone 13 infection. + Kinetics of P14 cells (n = 4 mice per group). Data in Figure 2, B, D, and F, represent mean ± SEM; Figure 2, B and F, are two-way ANOVA multiple-comparisons tests, and Figure 2, D, is a two-tailed paired Student's t test.

[0049] Figure 3. Simultaneous knockout of Bcor and Zc3h12a enhances CD8 expression during chronic viral infection. + T cell survival and function

[0050] Figure 3 A is the experimental design diagram. Activated Cas9 was infected with a retrovirus expressing the indicated sgRNA. + P14 cells, LCMV clone 13 infected with Cas9 + One day after infection, P14 cells were adoptively transferred into B6 mice. Two weeks after infection, P14 cells in the spleen were analyzed by flow cytometry. Figures B and C show the expression of Annexin V in P14 cells. + Representative graphs (B in FIG. 3 ) and statistical analysis (C in FIG. 3 ) of the proportion of P14 cells (n = 3-6 mice per group). FIG. 3 D and E show that P14 cells were stimulated with 50 ng / ml phorbol 12-myristate 13-acetate (PMA) and 1 μM ionomycin for 4 hours and examined by intracellular staining. FIG. 3 D is a representative graph and FIG. 3 E is a statistical analysis (n = 3-4 mice per group). Data represent mean ± SEM, and P values ​​are shown, using a two-tailed unpaired Student's t-test.

[0051] Figure 4. Simultaneous knockout of Bcor and Zc3h12a reverses CD8 T cell exhaustion during chronic viral infection and enables T cells to become TCFs. + TIM3 - Stem phenotype

[0052] Infect activated Cas9 with retrovirus expressing the indicated sgRNA + P14 cells were infected with LCMV clone 13 Cas9 the day before adoptive transfer. + In B6 mice, the analysis was performed two weeks after infection. Figure 4 A and B are TCF1 + TIM3 - and TCF1 - TIM3 + Representative flow cytometry analysis of P14 cell proportions (Figure 4A) and statistical analysis (Figure 4B, n = 3-5 mice per group). Data represent mean ± SEM, P values ​​are shown, and one-way ANOVA multiple-comparisons test is used. Figures 4C and 4D show single-cell sequencing analysis of P14 cells in four groups. Figure 4C shows the UMAP projection of single-cell sequencing of P14 cells in four groups. Eight cell clusters were defined and represented by different grayscales; Figure 4D shows the proportions of the eight clusters in the four groups of P14 cells.

[0053] Figure 5. Simultaneous knockout of Bcor and Zc3h12a enhances T cell resistance to chronic viral infection and reduces viral titers

[0054] Figure 5A shows the experimental design. LCMV clone 13 infected CD8- / - 30 days later, mice were adoptively transferred with the indicated Cas9 + P14 cells. After 40 days, P14 cells in the spleen were analyzed by flow cytometry, and viral titers in peripheral blood, liver, and lung were detected. Figure 5 B and C show the expression of Thy1.1 in the spleen. + Representative flow cytometric analysis of P14 cell ratios (Figure 5B) and statistical analysis (Figure 5C) (n = 3 mice per group). Figure 5D shows viral titers in various organs, with 6-8 mice per group. Data in Figures 5C and 5D represent mean ± SEM, using a two-tailed unpaired Student's t-test.

[0055] Figure 6. Inducible knockout of Bcor and Zc3h12a expression in exhausted T cells partially reverses T cell exhaustion during chronic LCMV clone 13 infection.

[0056] Figure 6, A, is a diagram of the experimental design: initial P14 cells from CD45.2 B6 mice with the indicated genotype were transferred into CD45.1 / 2B6 mice, which were infected with LCMV clone 13 one day later. 21 days later, the recipient mice were induced to knock out the indicated genes with tamoxifen, and tamoxifen was injected into the tail for 5 consecutive days. P14 cells in the peripheral blood of the recipient mice were monitored by flow cytometry, and P14 cells in the spleen were analyzed 40 days after the initial injection of tamoxifen. Figure 6, B, is the kinetics of P14 cells in the blood of recipient mice. Figures 6, C and D show representative images (Figure 6, C) and statistical analysis (Figure 6, D) of P14 cells in the spleen of recipient mice (n = 9 to 11 mice per group). Figures 6, E and F show Ly108 in P14 cells of recipient mice in the spleen + CD62L + Representative images (E in FIG6 ) and statistical analysis (F in FIG6 ) of P14 cells (n=9 to 11 mice per group). FIG6 G and H show the expression of TCF1 in P14 cells of recipient mice in the spleen. + TIM3 - Representative images of P14 cells ( FIG. 6 G ) and statistical analysis ( FIG. 6 H ) (n = 9-11 mice per group). In FIG. 6 B , D , F , and H , data are represented by mean ± SEM, and P values ​​are shown. FIG. 6 B is a two-way ANOVA multiple-comparisons test, and FIG. 6 D , F , and H are two-tailed unpaired Student's t-tests. DETAILED DESCRIPTION

[0057] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or preferred over other embodiments.

[0058] In addition, numerous specific details are provided in the following detailed description to better illustrate the present invention. Those skilled in the art will appreciate that the present invention can be practiced without certain specific details. In other instances, methods, means, equipment, and steps well known to those skilled in the art are not described in detail in order to highlight the main points of the present invention.

[0059] Unless otherwise stated, the units used in this specification are international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0060] In this specification, the use of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

[0061] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "embodiments," etc., mean that the specific elements (e.g., features, structures, properties, and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not be present in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0062] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints A and B.

[0063] In this specification, when the term "and / or" is used to connect two or more options, it should be understood to mean any one of the options or any two or more of the options.

[0064] As used herein, the term "immune cell" refers to any cell that plays a role in an immune response. Immune cells are of hematopoietic origin and include lymphocytes, such as B cells and T cells; natural killer cells; and myeloid cells, such as monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils, and granulocytes.

[0065] In this specification, the term "lymphocyte" refers to all immature, mature, undifferentiated and differentiated white lymphocyte populations, including tissue-specific and specialized types. By way of non-limiting example, the lymphocytes encompass B cells, T cells, NKT cells and NK cells.

[0066] As used herein, "administer," "give," and "treat" as applied to an animal, human, experimental subject, cell, tissue, organ, or biological fluid, refers to the contact of an exogenous drug, therapeutic agent, diagnostic agent, or composition with an animal, human, subject, cell, tissue, organ, or biological fluid. "Administer," "give," and "treat" can refer to, for example, treatment, pharmacokinetics, diagnosis, research, and experimental procedures. Treatment of cells includes contact of an agent with a cell, and contact of an agent with a fluid, wherein the fluid is in contact with the cell. "Administer," "give," and "treat" also mean the in vitro and ex vivo treatment of, for example, a cell, by a reagent, a diagnostic agent, a binding composition, or by another cell. "Treat" as applied to a human, veterinary, or research subject refers to treatment, prophylaxis, or preventative measures, research, and diagnostic applications.

[0067] As used herein, "treatment" means administering an internal or external therapeutic agent, such as a recombinant immune cell comprising the present invention, to a patient having one or more symptoms of a disease for which the therapeutic agent is known to have a therapeutic effect. Typically, the therapeutic agent is administered in an amount effective to alleviate one or more symptoms of a disease in the patient or population being treated, either by inducing regression of such symptoms or inhibiting the development of such symptoms to any clinically measurable degree. The amount of a therapeutic agent effective to alleviate any specific disease symptom (also referred to as a "therapeutically effective amount") can vary according to a variety of factors, such as the patient's disease state, age, and weight, and the ability of the drug to produce the desired therapeutic effect in the patient. Whether the symptoms of the disease have been alleviated can be evaluated by any clinical test method commonly used by a physician or other health care professional to evaluate the severity or progression of the symptoms.

[0068] In this specification, the term "prevention" refers to preventive treatment of a subject who does not currently have a disease or has not had a disease in the past but is at risk of developing a disease or who has had a disease in the past and does not currently have a disease but is at risk of recurrence of the disease.

[0069] As used herein, an "effective amount" encompasses an amount sufficient to ameliorate or prevent the symptoms or conditions of a medical condition. An effective amount also refers to an amount sufficient to permit or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective amount can be the maximum dose or dosage regimen that avoids significant side effects or toxic effects.

[0070] As used herein, a "therapeutically effective amount" is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or sufficient to delay or minimize one or more symptoms associated with the condition. A therapeutically effective amount refers to an amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a condition. The term "therapeutically effective amount" can include an amount that improves overall therapy; reduces or avoids symptoms, signs, or causes of a condition; and / or enhances the therapeutic efficacy of another therapeutic agent.

[0071] As used herein, a "prophylactically effective amount" is an amount sufficient to prevent a condition or one or more symptoms associated with a condition or to prevent its recurrence. A prophylactically effective amount refers to an amount of a therapeutic agent, alone or in combination with other agents, that provides a prophylactic benefit in preventing a condition. The term "prophylactically effective amount" may include an amount that improves overall prevention or enhances the prophylactic efficacy of another prophylactic agent.

[0072] In this specification, the term "pharmaceutically acceptable" (or "pharmacologically acceptable", "pharmaceutically usable") refers to molecular entities and compositions that do not produce adverse reactions, allergic reactions or other untoward reactions when administered to animals or humans, as appropriate. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, etc. that can be used as media for pharmaceutically acceptable substances.

[0073] In this specification, "BCOR gene" and "Bcor gene" can be used interchangeably unless otherwise specified. The "BCOR gene" is the BCOR gene of any target subject.

[0074] In this specification, "ZC3H12A gene" and "Zc3h12a gene" can be used interchangeably unless otherwise specified. The "ZC3H12A gene" is the "ZC3H12A gene" of any target subject.

[0075] In this specification, "stemness" is also called "stem cell characteristics", which refers to the ability of cells to self-renew and differentiate into different cell types.

[0076] As used herein, "subject" or "host" refers to a human or non-human animal, including mammals. Examples include primates (e.g., humans and monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, and mice. "Subjects" or "hosts" include both therapeutic and non-therapeutic subjects. "Subjects" or "hosts" also include experimental animal models or animals used to produce biomolecules expressing therapeutic diseases, i.e., "non-therapeutic hosts" or "non-therapeutic subjects."

[0077] <Use for preventing and / or treating chronic infections, enhancing T cell resistance to chronic infections, and preventing and / or reversing T cell exhaustion>

[0078] In some aspects of the present invention, any of the following uses of an agent targeting the Bcor gene or its expression product, or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product is provided:

[0079] (i) use in the preparation of a medicament for preventing and / or treating chronic infection;

[0080] (ii) use in the preparation of a reagent for enhancing the ability of T cells to resist chronic infection;

[0081] (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

[0082] (gene, gene expression product)

[0083] In some embodiments, the expression product of the Bcor gene or Zc3h12a gene refers to various forms of molecules of the Bcor gene or Zc3h12a gene at various stages, such as but not limited to molecules produced during the amplification, replication, transcription, splicing, processing, translation, and modification of the Bcor gene or Zc3h12a gene, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.

[0084] In some embodiments, exemplary information of the Bcor gene and the Zc3h12a gene can be found in Table 1 below.

[0085] Table 1 Bcor gene and Zc3h12a gene information

[0086] In the present invention, specifically, the human Bcor gene (Gene ID: 54880, updated on May 29, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 54880) and the mouse Bcor gene (Gene ID: 71458, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 71458) encode the transcriptional repressor BCOR in cells. The human Zc3h12a gene (Gene ID: 80149, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 80149) and the mouse Zc3h12a gene (Gene ID: 230738, updated on May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 230738) encode the protein ZC3H12A involved in mRNA degradation in cells. The above genes are all incorporated into the present invention by reference.

[0087] (Agents targeting genes or their expression products)

[0088] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can recognize and bind to the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can regulate the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can reduce the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can silence the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0089] In other embodiments, an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product reduces or eliminates the expression and / or function of the Bcor gene or Zc3h12a gene (e.g., in immune cells, specifically T cells). For example, the T cells do not contain the Bcor gene or the Zc3h12 gene, or the biological function of the expression product of the Bcor gene or the expression product of the Zc3h12 gene of the T cells is inhibited. In some specific embodiments, the expression or function of the Bcor gene or Zc3h12a gene in immune cells (e.g., T cells) treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is reduced by at least 10%, at least 30%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%, compared to immune cells (e.g., T cells) that are not treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product.

[0090] In the present invention, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product can be an agent used in at least one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology, or can be a small molecule inhibitor.

[0091] In some embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product is selected from, but not limited to, at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex (RNP), or a small molecule inhibitor.

[0092] Nucleic Acids

[0093] In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA.

[0094] In some embodiments, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule.

[0095] "Antisense RNA molecule" refers to an RNA molecule that is complementary to an mRNA transcript, regardless of length. An antisense RNA molecule refers to a single-stranded RNA molecule that can be introduced into a cell, tissue, or subject and that causes reduced expression of an endogenous target gene product by a mechanism that is independent of the endogenous gene silencing pathway but relies on the degradation of the target mRNA transcript mediated by RNase H. In some embodiments, the antisense nucleic acid comprises a modified backbone, such as a phosphorothioate, a phosphorodithioate, or other backbones known in the art, or may comprise non-natural internucleoside linkages. In some embodiments, the antisense nucleic acid may comprise a locked nucleic acid (LNA).

[0096] "RNA interference molecules" refer to RNA polynucleotides that mediate the reduced expression of endogenous target gene products by degrading target mRNA through endogenous gene silencing pathways (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference molecules include microRNAs (also referred to herein as "miRNAs"), short hairpin RNAs (shRNAs), small interfering RNAs (siRNAs), RNA aptamers, and morpholinos.

[0097] In some specific embodiments, the siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary and together form an RNA dimer; and the antisense strand is capable of hybridizing or complementing a target sequence in the Bcor gene or its expression product or the Zc3h12a gene or its expression product. In some specific embodiments, the siRNA can specifically bind to a target sequence in the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0098] In some specific embodiments, the shRNA is expressed from a vector, for example, by cloning a DNA fragment capable of transcribing the shRNA into a viral expression vector for expression. The shRNA comprises a sense strand segment and an antisense strand segment, as well as a stem-loop structure connecting the sense strand segment and the antisense strand segment. The sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the antisense strand is complementary to or hybridizes with the sequence of the transcription product of the target sequence in the Bcor gene or the Zc3h12a gene. The shRNA can be converted into siRNA after enzyme cleavage, thereby specifically regulating the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0099] Those skilled in the art will appreciate that when targeting the Bcor gene or its expression product or the Zc3h12a gene or its expression product, effective siRNA or shRNA can be designed and prepared according to interfering RNA design principles known in the art.

[0100] peptides

[0101] In some embodiments, the polypeptide is selected from at least one of: an antibody or an antigen-binding fragment thereof, a protein containing one or more zinc finger binding domains and an enzyme domain (zinc finger system, or artificial zinc finger nucleases (Zinc Finger Nucleases, ZFN)), and a protein containing a transcription activator-like effector (TALE) nuclease domain and an enzyme domain (TALEN system).

[0102] Ribonucleoprotein complex (RNP)

[0103] In some embodiments, the RNP is selected from the group consisting of: CRISPR / cas system.

[0104] In some specific embodiments, the CRISPR / cas system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog.

[0105] In some optional embodiments, the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e or Cas13f protein or its direct homologs.

[0106] In some embodiments, the CRISPR / cas system includes at least one of the following:

[0107] (i) a targeting domain sequence in a guide RNA (gRNA) targeting the Bcor gene complexes with a first Cas endonuclease protein to form a first ribonucleoprotein (RNP) complex; and,

[0108] (ii) The targeting domain sequence in the guide RNA (gRNA) targeting the Zc3h12a gene is complexed with the second Cas endonuclease protein to form a second ribonucleoprotein (RNP) complex.

[0109] In some embodiments, in the CRISPR / cas system of the present invention, the nucleic acid binding segment in the guide RNA (gRNA) targeting the Bcor gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Bcor gene derived from a subject (e.g., NCBI Gene ID: 54880 or NCBI Gene ID: 71458); the nucleic acid binding segment in the guide RNA (gRNA) targeting the Zc3h12a gene binds to a target DNA sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a DNA sequence encoded by a Zc3h12a gene derived from a subject (e.g., NCBI Gene ID: 80149 or NCBI Gene ID: 230738).

[0110] In some specific embodiments, in the CRISPR / cas system of the present invention, the targeting domain in the guide RNA (gRNA) targeting the Bcor gene comprises the sequence ACTGGGCAATACCGCAACAG (SEQ ID NO: 3) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: 3; the targeting domain in the guide RNA (gRNA) targeting the Bcor gene comprises the sequence GCTGCCACAAGCACTCTAGG (SEQ ID NO: 6) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: 6; the targeting domain of the guide RNA (gRNA) targeting the Zc3h12a gene comprises the sequence CTAGGGGAATTGGTGAAGCA (SEQ ID NO: 4) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: 4; the targeting domain of the guide RNA (gRNA) targeting the Zc3h12a gene comprises the sequence CAGGACGCTGTGGATCTCCG (SEQ ID NO: 7) or a sequence having at least 85%, 90%, or 95% identity to SEQ ID NO: NO:7 has a sequence with at least 85%, 90%, or 95% identity.

[0111] Small molecule inhibitors

[0112] In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises a small molecule inhibitor that can reduce or silence the level or activity of the Bcor gene or its expression product or the Zc3h12a gene or its expression product.

[0113] In the present invention, the term "small molecule" refers to a low molecular weight compound, which can be produced synthetically or obtained from natural sources and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da or less than 500 Da.

[0114] In some embodiments, the small molecule inhibitor can be an organic compound, an inorganic compound, or a combination of organic and / or inorganic compounds. In some specific embodiments, the small molecule inhibitor is a chemically prepared active substance or compound. Typically, these compounds are synthesized in a classical manner by chemical reactions between different organic and / or inorganic compounds.

[0115] In some embodiments, the small molecule inhibitor can exert its activity in the form in which it is administered, or the small molecule inhibitor can be a prodrug. Thus, "small molecule inhibitor" encompasses both the active form and the prodrug.

[0116] The term "prodrug" refers to a compound or substance that is converted into a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that is metabolized into a pharmaceutically active form in a subject after administration (e.g., by enzymatic activity in the subject).

[0117] The term "small molecule inhibitor" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule inhibitor that is safe and effective for administration to a subject and that possesses the desired biological, pharmacological, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts may include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, sucrose salt, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). Suitable base salts may include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0118] (T cells, T cell depletion)

[0119] In the present invention, the term "T cells" includes naive T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells and antigen-specific T cells.

[0120] In some specific embodiments, the T cells comprise activated T cells.

[0121] In some specific embodiments, the T cells comprise CD8 + T cells.

[0122] In some specific embodiments, the T cells comprise antigen-specific T cells.

[0123] In some specific embodiments, the antigen-specific T cells are antigen-specific T cells directed against pathogens that cause chronic infections.

[0124] In some embodiments, the T cells comprise exhausted T cells.

[0125] In the present invention, the term "exhausted T cells" or "T cell exhaustion" refers to dysfunctional T cells, which gradually lose their effector functions during chronic infection.

[0126] In some embodiments, the T cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0127] In some embodiments, the subject has a chronic infection.

[0128] In some specific embodiments, the T cells comprise T cells specific for an antigen against a pathogen causing the chronic infection in a subject with a chronic infection.

[0129] (Chronic Infection)

[0130] In some embodiments, chronic infection refers to the persistence of a pathogen in the body after an acute infection or latent infection. In some embodiments, chronic infection is a chronic infection in a subject. In some embodiments, the subject is a human or non-human animal.

[0131] In some embodiments, the chronic infection refers to a chronic microbial infection, which includes bacterial infection, viral infection, fungal infection, protozoan infection or parasitic infection. In some embodiments, the chronic microbial infection is a chronic or latent form of viral infection, i.e., a chronic viral infection.

[0132] In some embodiments, the chronic microbial infection is caused by a pathogen selected from the group consisting of: Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium bovis, Helicobacter pylori, Staphylococcus aureus, Salmonella typhi, Treponema pallidum, Escherichia coli, Haemophilus influenzae, Pseudomonas aeruginosa, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, human immunodeficiency virus (HIV), herpes virus, herpes simplex virus (HSV), hepatitis B virus (HBV), hepatitis C virus (HCV), measles virus, papovavirus, varicella-zoster virus, T-cell leukemia virus, adenovirus, parvovirus, Epstein-Barr virus, enterovirus, mouse hepatitis virus (MHV), cytomegalovirus (CMV), papillomavirus, and lymphocytic choriomeningitis virus (LCMV). In some embodiments, the chronic microbial infection is an antibiotic-resistant or antiviral-resistant infection (e.g., antibiotic-resistant tuberculosis (TB), methicillin-resistant Staphylococcus aureus (MRSA), enterovirus 68, Nipah virus, Middle East Respiratory Syndrome (MERS)).

[0133] <Modified T cells and their use in treating chronic infections>

[0134] In some aspects of the present invention, a modified T cell is provided, which is a T cell treated with the reagent targeting the Bcor gene or its expression product as described above, or the modified T cell is a T cell treated with the reagent targeting the Bcor gene or its expression product and the reagent targeting the Zc3h12a gene or its expression product as described above.

[0135] In some embodiments, the T cells comprise activated T cells.

[0136] In some embodiments, the T cells comprise CD8 + T cells.

[0137] In some embodiments, the T cells comprise antigen-specific T cells.

[0138] In some embodiments, the antigen-specific T cells are antigen-specific T cells directed against pathogens that cause chronic infections, wherein the chronic infections are as described above.

[0139] In some embodiments, the T cells comprise exhausted T cells.

[0140] In some embodiments, the T cells are from a subject. In some specific embodiments, the subject is a human or non-human animal.

[0141] In some embodiments, the subject has a chronic infection. In some embodiments, the T cells comprise antigen-specific T cells against a pathogen causing the chronic infection in a subject with a chronic infection.

[0142] In some aspects of the present invention, provided is the use of modified T cells in the preparation of a medicament for preventing and / or treating chronic infection, wherein the modified T cells are T cells treated with the reagent targeting the Bcor gene or its expression product as described above, or the modified T cells are T cells treated with the reagent targeting the Bcor gene or its expression product and the reagent targeting the Zc3h12a gene or its expression product as described above.

[0143] In some specific embodiments, the agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product reduces or eliminates the expression and / or function of the Bcor gene or Zc3h12a gene in the modified T cells. Exemplarily, the modified T cells do not contain the Bcor gene or the Zc3h12 gene, or the biological function of the expression product of the Bcor gene or the expression product of the Zc3h12 gene of the T cells is inhibited. In some specific embodiments, compared to T cells that are not treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product (unmodified T cells), the expression or function of the Bcor gene or Zc3h12a gene in the modified T cells treated with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is reduced by at least 10%, at least 30%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100%.

[0144] In some embodiments, the modified T cells do not contain other genetic modifications, such as modifications of structures for adoptive cell therapy and modifications of biomolecules for treating diseases. Wherein, the structures for adoptive cell therapy include chimeric antigen receptor (CAR) structures, T cell antigen receptor (TCR) structures, receptor structures based on ligand receptor binding, or synthetic T cell receptors or antigen receptors (synthetic T cell receptor and antigen receptor, STAR). The biomolecules used to treat diseases are selected from: cytokines, hormones, growth factors, coagulation factors, chemokines, co-stimulatory molecules, activation peptides, antibodies or their antigen binding fragments, or mutants of the above.

[0145] (Handling method)

[0146] In the present invention, the method for treating T cells with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is not particularly limited. For example, the agent targeting the Bcor gene or its expression product and / or the agent targeting the Zc3h12a gene or its expression product can be introduced into T cells. In some exemplary embodiments, treating T cells with an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product can be by introducing nucleotides carrying one or more components capable of expressing an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product into T cells using techniques known to those skilled in the art.

[0147] In some embodiments, the vector used is a viral vector, a virus-like vector or a non-viral vector. In some embodiments, the recombinant vector comprising a polynucleotide encoding one or more components of an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product (e.g., components for reducing or eliminating the expression and / or function of the Bcor gene and Zc3h12a gene in T cells, such as sgRNA, Cas protein, etc.) is a viral vector. Suitable viral vectors include, but are not limited to, viral vectors based on the following: vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc. Suitable non-viral vectors are selected from transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria, or virus-like particles.

[0148] In some embodiments, the polynucleotide sequence encoding an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is operably linked to a control element, for example, a transcriptional control element, such as a promoter. The transcriptional control element can be functional in eukaryotic cells (e.g., mammalian cells) or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the polynucleotide sequence encoding an agent targeting the Bcor gene or its expression product or an agent targeting the Zc3h12a gene or its expression product is operably linked to a plurality of control elements that allow the polynucleotide to be expressed in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulatory system used, any of a number of suitable transcriptional and translational control elements (including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, etc.) can be used in the expression vector.

[0149] In some embodiments, non-limiting examples of suitable eukaryotic promoters (promoters that function in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTR) from retroviruses, and mouse metallothionein 1. The selection of suitable vectors and promoters is entirely within the capabilities of those of ordinary skill in the art. The expression vector may also include a ribosome binding site and a transcription terminator for translation initiation. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include a nucleotide sequence encoding a protein tag (e.g., 6×His tag, hemagglutinin tag, green fluorescent protein, etc.) fused to the site-directed modified polypeptide to produce a chimeric polypeptide.

[0150] (Methods for obtaining and culturing T cells).

[0151] In the present invention, there is no particular limitation on the method for obtaining T cells. For example, peripheral blood mononuclear cells can be isolated from the peripheral blood of a subject, and immune cells of a specific phenotype can be isolated by, for example, magnetic bead sorting or flow cytometry sorting.

[0152] In some embodiments, in the present disclosure, there are no particular limitations on the method for culturing T cells. In some embodiments, T cells can be implanted into a subject for expansion, and recombinant immune cells after in vivo expansion can be obtained. Modified T cells obtained after expansion from a first-generation subject can be used for autologous treatment of the subject or for allogeneic treatment of other subjects. In some embodiments, the T cells are autologous T cells or allogeneic T cells for the subject. In some embodiments, T cells can also be expanded in vitro.

[0153] <Composition>

[0154] In other aspects, the present disclosure provides a composition. In some embodiments, the "composition" is a preparation comprising at least one of (a) an agent targeting the Bcor gene or its expression product as described above; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and (c) the modified T cells described above, which can be administered or delivered to a subject or cell. The composition can (i) prevent and / or treat chronic infection; (ii) enhance the ability of T cells to resist chronic infection; (iii) prevent and / or reverse T cell exhaustion.

[0155] A "therapeutic composition" or "pharmaceutical composition" (used interchangeably herein) is a composition comprising at least one of (a) an agent targeting the Bcor gene or its expression product as described above; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and (c) the modified T cell species described above, which can be administered to a subject to treat a chronic infection. In some optional embodiments, the composition for treating a disease further comprises a pharmaceutically acceptable carrier.

[0156] <Method>

[0157] In some embodiments, the present disclosure provides a method for treating a chronic infection in a subject in need thereof, comprising administering to the subject an agent targeting the Bcor gene or its expression product as described above, or administering to the subject an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product as described above, or administering to the subject the modified T cells as described above, or administering to the subject a composition or pharmaceutical composition as described above.

[0158] In some embodiments, the present disclosure provides a method for enhancing the ability of T cells to resist chronic infection, comprising the step of treating T cells with the agent targeting the Bcor gene or its expression product as described above, or the agent targeting the Bcor gene or its expression product as described above and the agent targeting the Zc3h12a gene or its expression product.

[0159] In some embodiments, the present disclosure provides a method for preventing and / or reversing T cell exhaustion, comprising the step of treating T cells with an agent targeting the Bcor gene or its expression product as described above, or an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product as described above.

[0160] Example

[0161] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0162] Example 1. Preparation of recombinant T cells with Bcor and / or Zc3h12a knockout

[0163] 1. Construction of gene knockout vector

[0164] In this example, retrovirus-based sgRNA expression vectors, namely pMSCV-sgBcor-Thy1.1, pMSCV-sgZc3h12a-Thy1.1, pMSCV-sgBcor / Zc3h12a-Thy1.1, pMSCV-sgControl-Thy1.1, and pMSCV-sgControl-GFP, were constructed.

[0165] Among them, the vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1), in which positions 1686-1705 are a random sequence SEQ ID NO: 2 that does not target any gene, is used as a control without knocking out any gene and is called sgNon-targeting or sgControl;

[0166] Vector pMSCV-sgBcor-Thy1.1, which is obtained by replacing positions 1686-1705 of SEQ ID NO: 1 with SEQ ID NO: 3 while keeping the rest of the sequence unchanged. SEQ ID NO: 3 is the target sequence recognition region of sgBcor for knocking out Bcor;

[0167] Vector pMSCV-sgZc3h12a-Thy1.1, wherein the sequence of this vector is obtained by replacing positions 1686-1705 of SEQ ID NO:1 with SEQ ID NO:4, while keeping the rest of the sequence unchanged. SEQ ID NO:4 is the target sequence recognition region of sgZc3h12a for knocking out Zc3h12a;

[0168] Vector pMSCV-sgBcor / Zc3h12a-Thy1.1, which is a vector sequence in which positions 1686-1705 of SEQ ID NO:1 are the target sequence recognition region of mouse sgBcor for knocking out Bcor (SEQ ID NO:3), and positions 2131-2150 are the target sequence recognition region of sgZc3h12a for knocking out mouse Zc3h12a (SEQ ID NO:4), for simultaneous knockout of mouse Bcor and mouse Zc3h12;

[0169] The vector pMSCV-sgControl-GFP is obtained by replacing the Th1.1 expression sequence at positions 2079-2616 of SEQ ID NO: 1 with the EGFP expression sequence (SEQ ID NO: 5).

[0170] All vectors were obtained by complete gene synthesis.

[0171] The sgRNAs used above are shown in Table 2 below:

[0172] Table 2 Target sequence recognition region of sgRNA

[0173] 2. Isolation and Activation of Initial P14 Cells

[0174] Cas9 was isolated by magnetic bead sorting +The initial CD8 + T cells were resuspended in 2 ml of RPMI1640 medium (containing 5% fetal bovine serum and interleukin-2) and activated in vitro by the addition of the peptide gp33-41 (Qiangyao Biotechnology, Cat#04010023714; a polypeptide consisting of 9 amino acid residues, which is the optimal sequence in the lymphocytic choriomeningitis virus GP1 antigenic determinant, sequence KAVYNFATC; SEQ ID NO: 8). The cells were cultured in a 5% carbon dioxide incubator at 37°C and infected with the virus after 24 hours of culture.

[0175] 3. Construction of P14 cells with Bcor and Zc3h12a gene knockout

[0176] 1) Retrovirus preparation

[0177] 1×10 6 After Phoenix-Eco cells (ATCC #CRL-3214) were cultured adherently for 24 hours, 20 μg of the sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1 prepared in 1 above and 60 mg of the packaging plasmid pCL-Eco (purchased from Addgene #12371) were co-transfected by the calcium phosphate precipitation method. The supernatant containing the packaged virus was harvested 48 hours after transfection, and the viral supernatant was filtered with a 0.45 μm filter membrane to remove dead cell impurities to obtain the retroviral supernatant, i.e., the retrovirus with Bcor and Zc3h12a knocked out.

[0178] 2) Retroviral infection

[0179] 1×10 6 CD8 + T cells were added with 1 ml of the retroviral supernatant obtained in step 1) and mixed, and then centrifuged at room temperature at 2000 × g for 2 hours. Then, the cells were cultured in a CO2 incubator for 4 hours, replaced with 2 ml of fresh RPMI1640 medium (containing 5% fetal bovine serum and 2 ng / ml interleukin-2) and continued to be cultured (this time was recorded as the post-infection time). Thy1.1-positive cells (Thy1.1-biotin, BioLegend #202510) were sorted by flow cytometry to obtain P14 cells with simultaneous knockout of Bcor and Zc3h12a (denoted as Thy1.1-sgBcor / Zc3h12a-P14).

[0180] 4. Construction of Bcor-knockout P14 cells

[0181] The only difference from "3. Construction of P14 cells with Bcor and Zc3h12a knockout" is that "sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1" is replaced with "sgRNA expression vector pMSCV-Zc3h12a-Thy1.1", and the other steps remain unchanged to obtain P14 cells with Bcor knockout (expressed as Thy1.1-sgZc3h12a-P14).

[0182] 5. Construction of Zc3h12a-knockout P14 cells

[0183] The only difference from "3. Construction of P14 cells with Bcor and Zc3h12a knockout" is that "sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1" is replaced with "sgRNA expression vector pMSCV-sgBcor-Thy1.1", and the other steps remain unchanged to obtain P14 cells with Bcor knockout (expressed as Thy1.1-sgBcor-P14).

[0184] 6. Construction of sgControl-P14 cells without gene knockout

[0185] The only difference from "3. Construction of P14 cells with Bcor and Zc3h12a knockout" is that the "sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgControl-Thy1.1". The other steps remain unchanged, and P14 cells with no gene knockout (expressed as Thy1.1-sgControl-P14) are obtained.

[0186] The only difference from "3. Construction of P14 cells with Bcor and Zc3h12a knockout" is that the "sgRNA expression vector pMSCV-sgBcor / Zc3h12a-Thy1.1" is replaced with the "sgRNA expression vector pMSCV-sgControl-GFP". The other steps remain unchanged, and P14 cells with no gene knockout (expressed as GFP-sgControl-P14) are obtained.

[0187] 7. ERT2 Cre P14 and ERT2CreBcor fl / fl Zc3h12a fl / fl Construction of P14 mice

[0188] By ERT2 CreB6 mice (Strain#:008463, Jackson Laboratory) were crossbred with P14 transgenic mice to obtain ERT2 Cre P14 mice; ERT2 Cre P14 mice and Bcor fl / fl Zc3h12a fl / fl Transgenic mice (commissioned by Saiye Biotechnology) were cross-bred to obtain ERT2CreBcor fl / fl Zc3h12a fl / fl P14 mice. ERT2Cre was induced by tamoxifen to express Cre, thereby knocking out Bcor and Zc3h12a.

[0189] Example 2. Virus infection and titration

[0190] Lymphocytic choriomeningitis virus (LCMV) strains Armstrong and LCMV clone 13 each induced acute and chronic infection. LCMV was expressed in BHK21[C13] cells. The cells were propagated and titrated by plaque assay on VERO cells. LCMV clone 13 (2 × 10 6 Mice were intravenously infected with LCMV Armstrong (2×10 6 Mice were infected by intraperitoneal injection of 100 PFU (1000 PFU). LCMV-infected mice were maintained according to the institutional biosafety regulations of Tsinghua University. LCMV viral loads in serum, organ, and tissue samples were quantified by qPCR.

[0191] Example 3: Knockout of Bcor and Zc3h12a does not affect CD8 expression during acute LCMV Armstrong virus infection + T cell expansion capacity and persistence

[0192] The cell reinfusion process is shown in Figure 1A: + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were respectively infected with activated CD8+ The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14, Thy1.1-sgBcor / Zc3h12a-P14 and GFP-sgControl-P14 cells (the method was the same as that in 3 of Example 1). The above cells obtained after infection for 24 hours were respectively infused into C57bl / B6 mice (hereinafter referred to as B6 mice) through the tail vein. The specific infusion method is as follows:

[0193] 6-8 week old B6 mice weighing 20-25 g were divided into 4 groups, namely, control (sgControl) group (5 mice), sgBcor group (5 mice), sgZc3h12a group (5 mice) and sgBcor / Zc3h12a group (5 mice).

[0194] Mice were infected with LCMV Armstrong (the method was the same as in Example 2).

[0195] Control (sgControl) group: Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS. Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via tail injection.

[0196] sgBcor group: Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were separately prepared into a cell suspension with PBS, and Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgBcor group via tail transfusion;

[0197] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgZc3h12l-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgZc3h12 group via tail transfusion;

[0198] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS. Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via tail transfusion.

[0199] On the 7th, 14th, 21st and 28th day after transfusion, Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry were used to analyze the percentage of non-knockout gene Thy1.1-sgControl-P14 cells, Bcor knockout Thy1.1-sgBcor-P14 cells, Zc3h12a knockout Thy1.1-sgZc3h12-P14 cells and Bcor and Zc3h12a knockout Thy1.1-sgBcor / Zc3h12a-P14 cells transfused into the peripheral blood of each mouse in terms of their proportion of total CD8 + The proportion of T cells, i.e., proliferation, contraction, and persistence of infused P14 cells were monitored in the blood and spleen.

[0200] The results are shown in Figure 1B. During acute LCMV Armstrong infection, Zc3h12a deficiency and Bcor / Zc3h12a deficiency, but not Bcor deficiency, enhanced the expansion of P14 cells in the blood on day 7 after infection (Figure 1B). Bcor deficiency enhanced the expansion of P14 cells in the blood on day 14 after infection. However, Bcor deficiency, Zc3h12a deficiency, and Bcor / Zc3h12a deficiency had no effect on the persistence of P14 cells (Figure 1B).

[0201] The results are shown in Figure 1C and Figure 1D. 36 days after infection, Thy1.1 in the spleen of LCMV Armstrong-infected mice was significantly higher than that in the control group. + Compared with the control P14 cells, the number of Bcor-deficient, Zc3h12a-deficient and Bcor / Zc3h12a-deficient P14 cells was slightly lower or had no significant difference.

[0202] These data indicate that knockout of Bcor and Zc3h12a, either individually or simultaneously, inhibits the expression of Bcor in CD8 + T cells cannot increase CD8 + T cell expansion capacity and persistence.

[0203] Example 4: Knockout of Bcor and Zc3h12a significantly enhanced CD8 + T cell expansion, persistence, and stemness

[0204] The cell reinfusion process is shown in Figure 2A: + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgControl-GFP were respectively infected with activated CD8 + The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14, Thy1.1-sgBcor / Zc3h12a-P14 and GFP-sgControl-P14 cells (the method was the same as that in 3 of Example 1). The above cells obtained after infection for 24 hours were infused into the tail vein of B6 mice respectively. The specific infusion method was as follows:

[0205] Six- to eight-week-old B6 mice weighing 20-25 g were divided into four groups: a control (sgControl) group (5 mice), a sgBcor group (5 mice), a sgZc3h12a group (5 mice), and a sgBcor / Zc3h12a group (5 mice). The mice were infected with LCMV clone 13 (using the same method as in Example 2).

[0206] Control (sgControl) group: Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS. Thy1.1-sgControl-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via tail injection.

[0207] sgBcor group: Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were separately prepared into a cell suspension with PBS, and Thy1.1-sgBcor-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgBcor group via tail transfusion;

[0208] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS, and Thy1.1-sgZc3h12l-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgZc3h12 group via tail transfusion;

[0209] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells prepared according to the method of Example 1 were respectively prepared into a cell suspension with PBS. Thy1.1-sgBcor / Zc3h12a-P14 cells and GFP-sgControl-P14 cells were mixed at a ratio of 1:1 and then transfused into each mouse in the sgControl group via tail transfusion.

[0210] On the 7th, 14th, 21st and 28th day after transfusion, Thy1.1 antibody (the knockout vector carries a Thy1.1 screening tag) and GFP fluorescence flow cytometry were used to analyze the percentage of non-knockout gene Thy1.1-sgControl-P14 cells, Bcor knockout Thy1.1-sgBcor-P14 cells, Zc3h12a knockout Thy1.1-sgZc3h12-P14 cells and Bcor and Zc3h12a knockout Thy1.1-sgBcor / Zc3h12a-P14 cells transfused into the peripheral blood of each mouse in terms of their proportion of total CD8 + The proportion of T cells, i.e., proliferation, contraction, and persistence of infused P14 cells were monitored in the blood and spleen.

[0211] The results are shown in Figure 2B. During chronic infection with LCMV clone 13, Bcor deficiency, and to a greater extent Bcor / Zc3h12a deficiency, strongly enhanced the expansion and persistence of P14 cells in the blood (Figure 2B). Zc3h12a deficiency alone did not affect the expansion and persistence of P14 cells in chronic infection with LCMV clone 13, but it significantly enhanced the effect of Bcor deficiency on P14 cell persistence (Figure 2B).

[0212] The results are shown in Figure 2C and Figure 2D. 36 days after infection, in the spleens of mice infected with LCMV clone 13, the number of Bcor-deficient P14 cells increased by about 43 times, and the number of Bcor / Zc3h12a-deficient P14 cells increased by 234 times (compared with Thy1.1 in the control group). + These data indicate that Bcor potently suppresses CD8 + T cell expansion and persistence, and the effects of Bcor deficiency can be further enhanced by loss of Zc3h12a.

[0213] Because Bcor-deficient and Bcor / Zc3h12a-deficient P14 cells are abundant in mice infected with LCMV clone 13, we tested their stemness. The experimental procedure is shown in Figure 2, E. P14 cells from primary recipients were flow cytometry sorted and transferred into secondary recipient mice, with primary P14 cells serving as a reference. After LCMV clone 13 infection, Bcor / Zc3h12a-deficient P14 cells expanded and persisted in secondary recipients. While Bcor-deficient P14 cells expanded slightly more strongly than primary P14 cells, their secondary expansion / persistence was much weaker than that of Bcor / Zc3h12a-deficient P14 cells (Figure 2, F), indicating that Bcor / Zc3h12a-deficient P14 cells have a higher stemness than Bcor-deficient P14 cells, which is consistent with the higher number of Bcor / Zc3h12a-deficient P14 cells in the primary host (Figure 2, B to D).

[0214] Example 5: Knockout of Bcor and Zc3h12a enhances CD8 expression during chronic LCMV clone 13 infection + T cell survival, function, and stemness

[0215] The cell reinfusion process is shown in Figure 3A: + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Th1.1, the retrovirus obtained by transfection with pMSCV-sgBcor-Thy1.1, the retrovirus obtained by transfection with pMSCV-Zc3h12a-Thy1.1, and the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1 were respectively infected with activated CD8 +The obtained recombinant cells were named Thy1.1-sgControl-P14, Thy1.1-sgBcor-P14, Thy1.1-sgZc3h12a-P14 and Thy1.1-sgBcor / Zc3h12a-P14 cells (the method was the same as that in 3 of Example 1). The above cells obtained after infection for 24 hours were infused into the tail vein of B6 mice respectively. The specific infusion method was as follows:

[0216] B6 mice aged 6-8 weeks and weighing 20-25 g were divided into four groups: control (sgControl), sgBcor, sgZc3h12a, and sgBcor / Zc3h12a. Mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0217] Control (sgControl) group: Thy1.1-sgControl-P14 cells prepared according to the method of Example 1 were transfused into each mouse in the sgControl group via tailbone injection;

[0218] sgBcor group: Thy1.1-sgBcor-P14 cells prepared according to the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgBcor group via tail injection;

[0219] sgZc3h12 group: Thy1.1-sgZc3h12-P14 cells prepared according to the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgZc3h12 group via tail transfusion;

[0220] sgBcor / Zc3h12a group: Thy1.1-sgBcor / Zc3h12a-P14 cells prepared according to the method of Example 1 were prepared into a cell suspension with PBS and then transfused into each mouse in the sgControl group via tail injection.

[0221] 24 hours after cell reinfusion, mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0222] We analyzed the apoptosis of P14 cells. As shown in Figure 3B and Figure 3C, the apoptosis of P14 cells in the sgZc3h12 group was increased compared with that in the control group (sgControl), while the apoptosis of P14 cells in the sgBcor group and the sgBcor / Zc3h12a group was decreased compared with that in the control group (sgControl).

[0223] As shown in Figures 3 and 4, we investigated the effects of Bcor and Zc3h12a on CD8 +Regulatory mechanisms of T cells. To distinguish effector T cells from effector / terminal T cells, we performed flow cytometry analysis of TCF1 and TIM3 expression, a marker of T cells. (Figure 4, A) Apoptosis was significantly reduced in Bcor-deficient and Bcor / Zc3h12a-deficient P14 cells, whereas apoptosis was slightly increased in Zc3h12a-deficient P14 cells (Figure 3, B and C). The enhanced stemness and persistence of Bcor-deficient and Bcor / Zc3h12a-deficient P14 cells did not affect the expression of the effector molecule IFNg (Figure 3, D and E).

[0224] Zc3h12a deficiency increases TCF1 + TIM3 - The percentage of effector T cells (Figure 4A and B) was significantly higher in the spleen of Zc3h12a-deficient TCF1 cells compared with control P14 cells. + TIM3 - The proportion of T cells increased, but the absolute number decreased significantly due to increased apoptosis. + TIM3 - The proportion of T cells increased, their apoptosis was significantly reduced, and their absolute number was significantly increased. + TIM3 - The proportion of T cells further increased, and their number also increased significantly ( Figure 4 , A and B ).

[0225] To further understand the status of Bcor / Zc3h12a-deficient P14 cells, we performed single-cell RNA sequencing (scRNA-seq). The results are shown in Figure 4C and D. P14 cells can be divided into 8 major clusters, C0 to C7. Control, Bcor-deficient, Zc3h12a-deficient and Bcor / Zc3h12a-deficient P14 cells are each mainly concentrated in one or two related clusters with limited overlap. Control P14 cells are mainly present in C2 and C5, with a small part in C6. Zc3h12a-deficient P14 cells are mainly in C3. C0 generated by Bcor deficiency is almost absent in control P14 cells. Bcor / Zc3h12a-deficient P14 cells are mainly present in C1, and this cluster is absent in control P14 cells, indicating that Bcor / Zc3h12a deficiency induces CD8 + A new state of T cells.

[0226] Example 6: Reinfusion of CD8 Bcor and Zc3h12a knockout cells + T cells reduce LCMV clone 13 virus titers in mice

[0227] The cell reinfusion process is shown in Figure 5A: LCMV clone 13 infected Cd8 - / - Mice, from Jaxson Laboratory, JAX#:002665 (method is the same as Example 2). + CD8 cells were isolated from spleen and lymph nodes of P14 transgenic mice + T cells were activated with peptide gp33-41 for 24 hours to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the retrovirus obtained by transfection with pMSCV-sgControl-Th1.1 and the retrovirus obtained by transfection with pMSCV-sgBcor / Zc3h12a-Thy1.1 were respectively infected with activated CD8 + The recombinant cells were named Thy1.1-sgControl-P14 and Thy1.1-sgBcor / Zc3h12a-P14 (the method was the same as that in Example 1, step 3). The cells obtained after infection for 24 hours were injected into the tail vein of Cd8 mice infected for 30 days. - / - Mice were infected and the cell population and P14 cell ratio were analyzed by flow cytometry 40 days after infection, and the virus titer in serum, liver and lung was analyzed.

[0228] As shown in Figure 5B and C, the striking expansion and persistence of Bcor / Zc3h12a-deficient P14 cells in mice chronically infected with LCMV clone 13 prompted us to investigate whether these cells could suppress viral replication. + To influence T cell responses, we used Cd8 - / - Mice were used as recipients. CD8 cells were infected with LCMV clone 13. - / - Mice were cultured for 30 days to establish chronic infection, and then control or Bcor / Zc3h12a-deficient P14 cells were transfected into these mice. - / - Expansion of P14 cells in mice improved viral control, indicating that Bcor / Zc3h12a-deficient P14 cells have antiviral efficacy in mice chronically infected with LCMV clone 13.

[0229] Example 7: Induction of BCOR in Exhausted T Cells and ZC3H12A Deletion Partially Reverses T Cell Exhaustion During Chronic LCMV Clone 13 Infection

[0230] To examine whether BCOR and ZC3H12A deletion could reprogram exhausted T cells and reverse T cell exhaustion, we isolated ERT2 from mice. Cre P14 or ERT2 Cre Bcor fl / flZc3h12a fl / fl P14 cells were transferred into B6 mice infected with LCMV clone 13. To distinguish the transferred cells from the host endogenous cells, we used B6 mice with CD45.1 / 2 genetic background. The cell transfusion process is shown in Figure 6A: Cre P14 (CD45.2 genetic background) and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl CD8 T cells were isolated from spleen and lymph nodes of P14 (CD45.2 genetic background) transgenic mice (obtained in Example 1). + T cells activated by peptide gp33-41 to obtain activated CD8 + T cells (the method is the same as that of Example 1, step 2); the above cells were infused into B6 (CD45.1 / 2 genetic background) mice via the tail vein, and the infusion method was as follows:

[0231] B6 mice aged 6-8 weeks with a body weight of 20-25 g were divided into 4 groups, namely ERT2 Cre P14 (control) group (9 rats) and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Group P14 (11 mice): Mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0232] ERT2 Cre P14 (control) group: ERT2 prepared by the method of Example 1 Cre P14 cells were transfused into ERT2 cells by tail injection Cre Each mouse in the P14 group;

[0233] ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Group P14: ERT2 prepared by the method of Example 1 Cre Bcor fl / fl Zc3h12a fl / fl P14 cells were prepared into cell suspension with PBS and transfused into ERT2 Cre Bcor fl / fl Zc3h12a fl / fl Each mouse in the P14 group;

[0234] 24 hours after cell reinfusion, mice were infected with LCMV clone 13 (the method was the same as in Example 2).

[0235] Twenty-one days after infection, mice were tail-injected with tamoxifen (Sigma) for five consecutive days. P14 cells in peripheral blood were analyzed by flow cytometry weekly, and P14 cells in spleen were analyzed 40 days after tamoxifen injection.

[0236] The persistence of exhausted T cells in chronic viral infection depends on a cell subset called precursor-exhausted T (TPEX) cells (TCF1 + TIM3 - or Ly108 + CD62L + ), which has stem cell-like properties and can self-renew and replenish exhausted T cells. As shown in Figure 6, 21 days after the establishment of chronic viral infection, before the injection of tamoxifen, ERT2 Cre ERT2 transferred in peripheral blood of P14 (control) group Cre P14 and ERT2 Cre Bcor fl / fl Zc3h12a fl / fl ERT2 transferred in peripheral blood of P14 group Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage of T cells is close to that of ERT2 after tamoxifen injection. Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage of T cells exceeded that of control P14 cells, which accounted for CD8 + The percentage of T cells (Figure 6B); 40 days after tamoxifen injection, ERT2 Cre Bcor fl / fl Zc3h12a fl / fl P14 cells account for CD8 + The percentage and number of T cells were greater than those of control P14 cells (Figure 6C and D); more importantly, 40 days after tamoxifen injection, the ERT2 Cre Bcor fl / fl Zc3h12a fl / fl In P14 cells, TCF1 + TIM3 - or Ly108 + CD62L + The proportion of T cells was significantly higher than that of ERT2 Cre P14 cells (Figure 6E, F, G, and H). These data indicate that T cell exhaustion can be partially reversed by inhibition of BCOR and ZC3H12A.

[0237] It should be noted that, although the technical solutions of the present invention are described with specific examples, those skilled in the art will appreciate that the present invention should not be limited thereto.

[0238] While various embodiments of the present invention have been described above, the above descriptions are intended to be illustrative, non-exhaustive, and not limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is selected to best explain the principles of the embodiments, their practical applications, or technological improvements in the marketplace, or to enable others skilled in the art to understand the embodiments disclosed herein.

[0239] Nucleotide sequence of vector pMSCV-sgControl-Thy1.1 (SEQ ID NO: 1):

[0240] Among them, the single underline part is sgControl; the double underline part is Thy1.1.

[0241] Nucleotide sequence encoding EGFP (SEQ ID NO: 5)

Claims

1. Any of the following uses of an agent targeting the Bcor gene or its expression product or a combination of an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product: (i) Use in the preparation of a medicament for preventing and / or treating chronic infections; (ii) use in the preparation of an agent for enhancing the ability of T cells to resist chronic infection; (iii) Use in the preparation of an agent for preventing and / or reversing T cell exhaustion.

2. The use according to claim 1, wherein The T cells include naive T cells, CD4 + T cells, CD8 + at least one of T cells, memory T cells, activated T cells, exhausted T cells, tolerant T cells, chimeric T cells, and antigen-specific T cells; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells, preferably, the antigen-specific T cells are antigen-specific T cells against pathogens causing chronic infection; Optionally, the T cells comprise CD8 + T cells; Optionally, said T cells comprise exhausted T cells.

3. The use according to claim 1 or 2, wherein The chronic infection comprises at least one of bacterial infection, viral infection, fungal infection, protozoan infection and parasitic infection; Preferably, the chronic infection comprises a viral infection.

4. The use according to any one of claims 1 to 3, wherein The T cells are T cells from a subject; and / or, the chronic infection is a chronic infection in a subject; Optionally, the subject is a human or a non-human animal.

5. The use according to any one of claims 1 to 4, wherein The agent targeting the Bcor gene or its expression product or the agent targeting the Zc3h12a gene or its expression product comprises at least one of a nucleic acid, a polypeptide, a ribonucleoprotein complex and a small molecule inhibitor; Optionally, the nucleic acid comprises at least one of an antisense RNA molecule and an RNA interference molecule; Optionally, the polypeptide comprises at least one of an antibody or an antigen-binding fragment thereof, an artificial zinc finger nuclease, and a TALEN system; Optionally, the ribonucleoprotein complex comprises a CRISPR / cas system.

6. The use according to any one of claims 1 to 5, wherein The reagent targeting the Bcor gene or its expression product or the reagent targeting the Zc3h12a gene or its expression product includes a reagent used in any one of gene knockout technology, gene silencing technology, inactivation mutation technology, and PROTAC technology.

7. A modified T cell, wherein: The modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product, or the modified T cells are T cells treated with an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; Optionally, the T cells comprise activated T cells; Optionally, the T cells comprise antigen-specific T cells; Optionally, the T cells comprise CD8 + T cells; Optionally, said T cells comprise exhausted T cells.

8. The modified T cell according to claim 7, wherein The antigen-specific T cells are antigen-specific T cells targeting pathogens that cause chronic infections; Optionally, the chronic infection comprises at least one of a bacterial infection, a viral infection, a fungal infection, a protozoan infection, and a parasitic infection; Preferably, the chronic infection comprises a viral infection; Optionally, the chronic infection is a chronic infection in a subject.

9. Use of the modified T cell according to claim 7 or 8 in the preparation of a medicament for preventing and / or treating chronic infection.

10. A composition comprising at least one selected from the following (a) to (c): (a) an agent targeting the Bcor gene or its expression product; (b) an agent targeting the Bcor gene or its expression product and an agent targeting the Zc3h12a gene or its expression product; and, (c) the modified T cell according to claim 7 or 8; Optionally, the composition is a pharmaceutical composition, which further comprises a pharmaceutically acceptable carrier.

Images