Sirnas for simultaneously inhibiting expression of two target genes, drug and use thereof

Abstract

A dual-targeting siRNA agent, comprising two different siRNAs targeting two different genes or pharmaceutically acceptable salts thereof, the two different siRNAs or salts thereof being linked to each other by means of a pharmaceutically acceptable ligand, the siRNAs being dsRNAs consisting of sense strands and antisense strands, and the two different genes being two selected from angiotensinogen (AGT), proprotein convertase subtilisin / kexin type 9 (PCSK9) and human angiopoietin-like protein 3 (ANGPTL3). Also provided is the use of the dual-targeting siRNA agent in preparing a drug for preventing or treating diseases related to hypertension or / and lipid imbalance. The dual-targeting siRNA agent can simultaneously and effectively inhibit the expressions of the two target genes in vivo, and has the advantages of no mutual antagonism, high activity and high safety. Further provided are siRNAs of genes corresponding to the dual-targeting siRNA agent and the use thereof for preventing or treating diseases related to hypertension or / and lipid imbalance.

Description

siRNA, drug and application thereof for simultaneously inhibiting the expression of two target genes

[0001] The present invention claims priority to Chinese patent application filed on September 18, 2023, with application number 202311209042.1. The present invention also claims priority to Chinese patent application filed on February 7, 2024, with application number 202410174987.2. The present invention also claims priority to Chinese patent application filed on June 13, 2024, with application number 202410762953.5. The entire contents of the above patent applications are incorporated herein by reference. Technical Field

[0002] The present invention belongs to the field of biomedicine, and in particular relates to siRNA, a drug and applications thereof for simultaneously inhibiting the expression of two target genes. Background Art

[0003] Chronic diseases such as hypertension, hyperlipidemia, and hypercholesterolemia are the main inducements of cardiovascular and cerebrovascular complications. With the improvement of human living standards, these chronic diseases have become an important factor that troubles people's health and reduces the quality of life. In most hypertension guidelines, when antihypertensive drugs are not used, systolic blood pressure (SBP) or diastolic blood pressure (DBP) ≥ 140 / 90 mmHg is defined as hypertension (Whelton, Paul K et al. Hypertension vol.71, 6 (2018): 1269-1324.). According to statistics, in the past 30 years, the incidence of hypertension in China has increased significantly, affecting the health of about a quarter of adults (Wang, Ji-Guang et al. Nature reviews. Cardiology vol.20, 8 (2023): 531-545.). Hypertension usually occurs together with other chronic diseases such as hyperlipidemia, high cholesterol, diabetes, etc. In a 2009 study involving 4,942 outpatients with hypertension, 24.3% of them also had diabetes. Dyslipidemia is also prominent in Chinese hypertensive patients. In the above survey, the prevalence of hypertriglyceridemia was 18.9%, and the prevalence of hypercholesterolemia and low HDL cholesterol was 13.5% and 16.6%, respectively. The simultaneous occurrence of these diseases not only increases the risk of cardiovascular and cerebrovascular complications, but also complicates the management of such diseases (Miao, Chao-Ying et al. Journal of clinical hypertension vol. 23, 7 (2021): 1399-1404). It has been reported that antihypertensive treatment is beneficial to improve various indicators of patients. For example, the risk of cardiovascular disease is reduced by 20% for every 10 mmHg reduction in systolic blood pressure; in addition, the risks of coronary heart disease, stroke, and heart failure are reduced by 17%, 27%, and 28%, respectively. Due to the common risk factors and pathogenesis, the combination of antihypertensive and lipid-lowering drugs will have a synergistic effect in the treatment of the above chronic diseases, and the improvement of cardiovascular and cerebrovascular diseases can also be used as an endpoint indicator for hypertension treatment (Ranasinghe, Priyanga et al. Journal of the American Heart Association vol. 11, 20(2022): e027694.).

[0004] The renin-angiotensin-aldosterone system (RAAS) is an endocrine system that maintains blood pressure, blood volume, and water-salt balance in the human body. The angiotensin (ANG I / II) secreted by this system has the effect of constricting blood vessels. Overactivation of the RAAS system is one of the important causes of hypertension (Arendse, Lauren B et al.Pharmacological reviews vol.71, 4 (2019): 539-570). Currently, the main antihypertensive drugs used in clinical practice are RAAS inhibitors, including angiotensin-converting enzyme inhibitors ACEI (such as pril drugs), angiotensin II antagonists ARB (such as sartan drugs), etc. Even though the mechanism of action of these RAAS inhibitors is not exactly the same, they have certain body compensatory properties and all require patients to take the medicine continuously every day, so some patients have poor compliance. It is worth noting that angiotensinogen (AGT) produced by liver cells is the only precursor of angiotensin (Ang II). Studies have shown that the polymorphism of the AGT gene is closely related to the body's blood pressure regulation, so AGT is an important target for gene silencing treatment of hypertension and related diseases. Inhibiting AGT can effectively prevent the overactivation of the RAAS system, thereby lowering blood pressure and making up for the common shortcomings of RAAS inhibitors (Ren, Liwei et al. Current opinion in nephrology and hypertension vol. 29, 2 (2020): 180-189). Recent studies have shown that siRNA-mediated AGT gene silencing using a GalNAc system coupled to a specific hepatocyte-targeting system can inhibit the RAAS system for weeks to months, requiring only a single dose. This can improve compliance and improve cardiovascular and cerebrovascular disease conditions better than current RAAS inhibitors (Desai, Akshay S et al. The New England Journal of Medicine vol. 389, 3 (2023): 228-238.).

[0005] As mentioned above, hypertension is closely related to hyperlipidemia. Hyperlipidemia is usually caused by elevated serum cholesterol and / or triglyceride levels, which is a major predisposing factor for cardiovascular diseases such as atherosclerosis. Loss-of-function variants in the angiopoietin-like protein 3 (ANGPTL3) gene are associated with decreased plasma levels of triglycerides, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol. Human genetic studies have shown that people carrying heterozygous ANGPTL3 loss-of-function variants have significantly lower serum levels of triglycerides, high-density lipoprotein cholesterol, and low-density lipoprotein (LDL-C) cholesterol than those without these variants (Dewey, Frederick E et al. The New England Journal of Medicine vol. 377, 3 (2017): 211-221.). In terms of function, ANGPTL3 produced by hepatocytes will be secreted into the blood and formed into active molecules after cleavage by PCSK3 or PCSK6, which can inhibit lipoprotein lipase (which catalyzes the hydrolysis of triglycerides) and endothelial lipase (which hydrolyzes lipoprotein phospholipids), thereby leading to increased plasma levels of triglycerides, high-density lipoprotein (HDL) and phospholipids. Therefore, inhibiting the expression of ANGPTL3 can be an important target for the treatment of hyperlipidemia (Kersten, Sander. Nature reviews. Endocrinology vol. 13, 12 (2017): 731-739.).

[0006] In addition, a high proportion of patients with hypertension suffer from hypercholesterolemia, which is generally defined based on LDL-C and non-HDL-C levels. Similarly, human genetic studies have shown that prealbumin convertase subtilisin / kexin type 9 (PCSK9) may be associated with familial hypercholesterolemia, with two common loss-of-function PCSK9 mutations (PCSK9-679X and PCSK9-142X) positively correlated with low LDL-C levels in the blood (Cohen, Jonathan C et al. The New England Journal of Medicine vol. 354, 12 (2006): 1264-72.). PCSK9 is synthesized in the liver and secreted into the circulatory system. Cellular PCSK9 can bind to and guide newly generated LDL receptors from the Golgi apparatus to the lysosome for degradation. Circulatory PCSK9 can specifically bind to LDL receptors on the surface of liver cells, mediating their entry into the lysosomes of liver cells for degradation. This ultimately leads to a decrease in the liver's ability to bind and clear LDL-C, and an increase in LDL-C levels in the blood (Horton, Jay D et al. Journal of lipid research vol. 50 Suppl, Suppl (2009): S172-7). Therefore, inhibiting PCSK9 expression is an important target for treating hypercholesterolemia and preventing cardiovascular and cerebrovascular diseases associated with LDL-C. Currently, lipid-lowering treatment methods include monoclonal antibodies, antisense oligonucleotides (ASOs), and siRNAs targeting ANGPTL3 and PCSK9, respectively, and have achieved good therapeutic effects using LDL-C or triglycerides as indicators (Chen, Ruoyu et al. Journal of clinical laboratory analysis vol. 36, 7 (2022): e24552.).

[0007] The discovery of the RNAi phenomenon has brought RNA therapy to a new level. RNAi technology refers to the use of exogenous siRNAs to degrade the targeted target gene using the cell's endogenous system. In terms of mechanism, exogenously introduced double-stranded siRNAs can be recognized by the cellular endoribonuclease Dicer and split into a single-stranded guide strand and its complementary strand by the RNA-induced silencing complex (RISC). The guide stranded siRNA then binds to the Argonate 2 protein (AGO2) and guides it to the target RNA, where AGO2 mediates the degradation of the target RNA. In addition to degrading RNAs in the cytoplasm, siRNAs can also promote chromosome remodeling and histone modification in the cell nucleus, leading to transcriptional silencing (Matzke et al. Nature reviews. Genetics vol. 6, 1 (2005): 24-35.). Currently, a variety of siRNA drugs have been approved by the FDA, and many candidate siRNAs are undergoing Phase III clinical trials (Zhu, Yiran et al. Cell death & disease vol. 13, 7644. 23 Jul. 2022). siRNA is unstable in blood and tissue, and is easily digested and degraded by nucleases in vivo. In order to improve the stability of siRNA antisense strand and sense strand, chemical modifications such as 2'-O-methylation and 2'-fluoro modification are generally introduced when synthesizing siRNA drugs. The delivery of siRNA drugs is also an important guarantee for RNAi treatment. The most mature delivery system at present is N-oligosaccharide acetylgalactosamine (GalNAc), and GalNAc can be combined with asialoglycoprotein receptor (ASGPR) specifically expressed by hepatocytes. After being coupled with siRNA, it can achieve active delivery of hepatocytes, which is an important breakthrough in the field of RNA therapy. The three genes AGT, ANGPTL3 and PCSK9 that the present invention is concerned about are all hepatocyte-specific or highly expressed proteins, so the liver delivery of single-target or dual-target siRNA drugs can be achieved using the GalNAc system (Debacker, Alexandre J et al.Molecular therapy vol.28, 8 (2020): 1759-1771).

[0008] Currently, RNAi drugs targeting the PSCK9 gene have been approved for marketing, while those targeting the AGT and ANGPTL3 genes are still in the development stage and have demonstrated promising therapeutic effects. However, further development of highly effective and long-lasting RNAi drugs remains crucial. Dual-target RNAi drugs, combining siRNAs targeting each of the three genes, hold great promise for the combined treatment of chronic cardiovascular and cerebrovascular diseases, such as hypertension, hyperlipidemia, and hypercholesterolemia. For example, dual-target drugs combining siRNAs targeting AGT and ANGPTL3, or AGT and PSCK9, may have synergistic therapeutic effects in lowering both blood pressure and blood lipids. Combining siRNAs targeting ANGPTL3 and PSCK9 may achieve unexpectedly long-lasting efficacy and enhance therapeutic efficacy in treating hypercholesterolemia or hyperlipidemia. However, few single-target siRNAs are truly suitable for clinical application, and combining different siRNAs targeting two target genes simultaneously is even more challenging. In addition to effectively controlling the target gene, there are also high requirements for the two siRNAs to not antagonize each other in vivo and to ensure that the duration of the two targets is roughly the same. Despite this, due to the huge potential for medical applications, multi-target research remains welcomed and anticipated.

[0009] Summary of the Invention

[0010] Based on this, the purpose of the present invention is to provide a dual-targeted siRNA agent for simultaneously inhibiting the expression of any two target genes in cells, namely angiotensinogen (AGT), proprotein convertase subtilisin / kexin type 9 (PCSK9), and angiopoietin-like protein 3 (ANGPTL3), and its application. The dual-targeted siRNA agent has the advantages of being able to effectively inhibit the expression of two target genes in vivo at the same time, without mutual antagonism, high activity and high safety.

[0011] In a first aspect, the present invention provides a dual-targeting siRNA agent, wherein the dual-targeting siRNA agent comprises two different siRNAs or pharmaceutically acceptable salts thereof that target two different genes, wherein the two different siRNAs or their salts are connected to a ligand for nucleic acid delivery to form a whole, wherein the siRNAs are dsRNAs consisting of a sense strand and an antisense strand, and the two different genes are selected from two of AGT, PCSK9, and ANGPTL3;

[0012] The base composition of the siRNA targeting AGT is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0013] A) The dsRNA duplex is 1167f, wherein the sense strand comprises UGACCAGCUUGUUUGUGAA (SEQ ID NO: 59), and the antisense strand comprises UUCACAAACAAGCUGGUCGGG (SEQ ID NO: 60);

[0014] B) the dsRNA duplex is 1167b, wherein the sense strand comprises GCCGACCAGCUUGUUUGUGAA (SEQ ID NO: 51), and the antisense strand comprises UUCACAAACAAGCUGGUCGGC (SEQ ID NO: 52);

[0015] C) the dsRNA duplex is 1165d, wherein the sense strand comprises GAGAACCAGUGUUUAGCGA (SEQ ID NO: 39), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 40);

[0016] D) the dsRNA duplex is 1165f, wherein the sense strand comprises CCAAGAACCAGUGUUUAGCGA (SEQ ID NO: 43), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 44);

[0017] The base composition of the siRNA targeting PCSK9 is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0018] E) the dsRNA duplex is 11040a, wherein the sense strand comprises CUUAUUCUGGGUUUUGUAGCA (SEQ ID NO: 375), and the antisense strand comprises UGCUACAAAACCCAGAAUAAG (SEQ ID NO: 376);

[0019] F) the dsRNA duplex is 11002d, wherein the sense strand comprises GCAGCCAACUUUUCUAGAA (SEQ ID NO: 259), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUGG (SEQ ID NO: 260);

[0020] G) the dsRNA duplex is 11002a, wherein the sense strand comprises CUACAGCCAACUUUUCUAGAA (SEQ ID NO: 253), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUAG (SEQ ID NO: 254);

[0021] The base composition of the siRNA targeting ANGPTL3 is selected from one of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than one nucleotide:

[0022] H) the dsRNA duplex is 7061f, wherein the sense strand comprises UACUUGAACUCAACUCAAA (SEQ ID NO:579), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGG (SEQ ID NO:580); I) the dsRNA duplex is 7061b, wherein the sense strand comprises GCCACUUGAACUCAACUCAAA (SEQ ID NO:571), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGC (SEQ ID NO:572).

[0023] In some embodiments, the dual-targeted siRNA agent targets genes AGT and PCSK9, AGT and ANGPTL3, and PCSK9 and ANGPTL3.

[0024] In some embodiments, the targeted genes are AGT and any one selected from PCSK9 and ANGPTL3, preferably AGT and PCSK9.

[0025] The present invention also provides a method for modifying nucleotides used in the above-mentioned siRNA to improve the stability and activity of the siRNA in vivo and in vitro and to reduce non-target activity. The modified nucleotides include at least one or more of 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'3'-seco nucleotide mimics, LNA, open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic residues, inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides and 3'-OMe nucleotides, nucleotides containing 5'-phosphorothioate groups, or terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides.

[0026] In some embodiments, the sense strand comprises no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the sense strand comprise 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2'-fluoro modified nucleotides, inverted abasic residues, and the sense strand contains 0, 1, 2, or 3 phosphorothioate bonds at the 5'-end and 3'-end; and wherein the antisense strand comprises no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the antisense strand comprise 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2'-fluoro modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate) or other VPU derivatives, and the antisense strand contains 1-3 phosphorothioate bonds at the 5'-end and 3'-end.

[0027] In some embodiments, the dsRNA duplex targeting the AGT gene is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0028] a) The dsRNA duplex is 1167.25-19, wherein the 5'-3' sense strand comprises

[0029] Invab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG;

[0030] b) The dsRNA duplex is 1167.27-21, wherein the 5'-3' sense strand comprises

[0031] Invab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC;

[0032] c) The dsRNA duplex is 1165.5-14, wherein the 5'-3' sense strand comprises

[0033] Invab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0034] d) The dsRNA duplex is 1165.5-16, wherein the 5'-3' sense strand comprises

[0035] Invab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG.

[0036] In some embodiments, the siRNA targeting PCSK9 is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0037] e) The dsRNA duplex is 11040.10-23, wherein the 5'-3' sense strand comprises

[0038] Invab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAInvab, and the 5'-3' antisense strand comprises VPU-S*fG*mCmUmAmCmAmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG;

[0039] f) The dsRNA duplex is 11002.17-21, wherein the 5'-3' sense strand comprises

[0040] Invab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG;

[0041] g) The dsRNA duplex is 11002.10-23, wherein the 5'-3' sense strand comprises

[0042] Invab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG.

[0043] In some embodiments, the dsRNA targeting the ANGPTL3 gene is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:

[0044] h) The dsRNA is 7061.18-14, wherein the 5'-3' sense strand comprises

[0045] Invab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG;

[0046] i) The dsRNA duplex is 7061.4-16, wherein the 5'-3' sense strand comprises

[0047] Invab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC.

[0048] Among them, the above VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2' -fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

[0049] In some embodiments, the ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0050] In some embodiments, the N-acetylgalactosamine or its derivative is linked to the 3' ends of the sense strands of the two siRNAs respectively via chemical bonds, preferably, via phosphate bonds or phosphorothioate bonds.

[0051] In some embodiments, the structure of the ligand is as follows:

[0052] In some embodiments, the ligand is linked to the 3' end of the sense strand of the siRNA.

[0053] In some embodiments, the ligand is linked to the 3' end of the sense strand of the siRNA as follows:

[0054] Represents siRNAs targeting modified sequences of AGT, PCSK9, or ANGPTL3.

[0055] In some embodiments, when targeting AGT and PCSK9 genes, each siRNA of the dual-targeted siRNA agent is selected from the sequence shown in any one of DT03081, DT03086, DT03103, DT03099, DT03085, DT03101, DT03082, DT03097, DT03100 or DT03102 in Table 45.

[0056] In some embodiments, when targeting AGT and ANGPTL3 genes, each siRNA of the dual-targeting siRNA agent is selected from the sequence shown in any one of DT02043 or DT02047 in Table 45.

[0057] In some embodiments, when targeting ANGPTL3 and PCSK9 genes, each siRNA of the dual-targeting siRNA agent is selected from the sequence shown in any one of DT09001, DT09003 and DT09005 in Table 45.

[0058] The second aspect of the present invention provides the use of any of the above dual-targeting siRNA agents in the preparation of a double-stranded siRNA product that simultaneously inhibits the expression of two targets (target genes) of any combination of AGT, PCSK9, and ANGPTL3.

[0059] In some embodiments, the product is a biological preparation or a pharmaceutical preparation.

[0060] The third aspect of the present invention is to provide the use of any of the above-mentioned dual-targeting siRNA agents in the preparation of a drug for preventing and / or treating hypertension and / or lipid disorder-related diseases.

[0061] The fourth aspect of the present invention is to provide a biological preparation or pharmaceutical preparation for simultaneously inhibiting the expression of two target genes in any combination of AGT, PCSK9 and ANGPTL3, wherein the active ingredient includes any of the above-mentioned dual-targeting siRNA agents.

[0062] A fifth aspect of the present invention is to provide a method for simultaneously inhibiting the expression of any combination of two target genes selected from AGT, PCSK9, and ANGPTL3, the method comprising:

[0063] (a) contacting cells in vivo or in vitro with any of the corresponding dual-targeting siRNA agents or the biological agents or pharmaceutical agents described above; and

[0064] (b) maintaining the cells produced in step (a) for a period of time sufficient to achieve degradation of mRNA transcripts expressed by two targets of any combination of AGT, PCSK9, and ANGPTL3, thereby simultaneously inhibiting the expression of two targets of any combination of AGT, PCSK9, and ANGPTL3 in the cells.

[0065] A method for treating a disease associated with the AGT gene and / or the PCSK9 gene and / or the ANGPTL3 gene, comprising administering a therapeutically effective amount of the aforementioned dual-targeting siRNA agent or the aforementioned biological agent or pharmaceutical agent to the subject, thereby treating the subject.

[0066] In some embodiments, the cell is in a subject in vivo or in vitro. Preferably, the subject is a mammal.

[0067] In some embodiments, the subject is a human.

[0068] In some embodiments, the expression of AGT, PCSK9, and ANGPTL3 is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0069] Among them, the hypertension diseases are mediated by the AGT gene, including but not limited to critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and unstable hypertension or other diseases mediated by the AGT gene.

[0070] Among them, the lipid disorder diseases are mediated by the PCSK9 gene, including but not limited to hyperlipidemia, atherosclerosis, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease or other diseases mediated by the PCSK9 gene.

[0071] The lipid disorder diseases are mediated by the ANGPTL3 gene, including but not limited to hyperlipidemia, hypertriglyceridemia, lipid and / or cholesterol metabolism disorders, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, cardiometabolic diseases, obesity, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis caused by hypertriglyceridemia, or other diseases mediated by the ANGPTL3 gene.

[0072] The sixth aspect of the present invention is to provide an siRNA targeting the AGT gene, PCSK9 gene or ANGPTL3 gene, which can be used as a single-target drug or a dual-target drug.

[0073] An siRNA targeting the AGT gene or a pharmaceutically acceptable salt thereof, wherein the sequence is selected from one of the following, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0074] A) the dsRNA is 1167f, wherein the sense strand comprises UGACCAGCUUGUUUGUGAA (SEQ ID NO: 59), and the antisense strand comprises UUCACAAACAAGCUGGUCGGG (SEQ ID NO: 60);

[0075] B) the dsRNA is 1167b, wherein the sense strand comprises GCCGACCAGCUUGUUUGUGAA (SEQ ID NO: 51), and the antisense strand comprises UUCACAAACAAGCUGGUCGGC (SEQ ID NO: 52);

[0076] C) the dsRNA is 1165d, wherein the sense strand comprises GAGAACCAGUGUUUAGCGA (SEQ ID NO: 39), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 40);

[0077] D) the dsRNA is 1165f, wherein the sense strand comprises CCAAGAACCAGUGUUUAGCGA (SEQ ID NO: 43), and the antisense strand comprises UCGCUAAACACUGGUUCUUGG (SEQ ID NO: 44);

[0078] In some embodiments, the siRNA is modified and selected from one of the following sequences, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0079] a) The dsRNA is 1167.25-19, wherein the 5'-3' sense strand comprises

[0080] Invab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG;

[0081] b) The dsRNA is 1167.27-21, wherein the 5'-3' sense strand comprises

[0082] Invab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC;

[0083] c) The dsRNA is 1165.5-14, wherein the 5'-3' sense strand comprises

[0084] Invab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0085] d) dsRNA is 1165.5-16, wherein the 5'-3' sense strand comprises

[0086] Invab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, and the 5'-3' antisense strand comprises VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG;

[0087] An siRNA targeting the PCSK9 gene or a pharmaceutically acceptable salt thereof, wherein the sequence is selected from one of the following, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0088] E) the dsRNA is 11040a, wherein the sense strand comprises CUUAUUCUGGGUUUUGUAGCA (SEQ ID NO: 375), and the antisense strand comprises UGCUACAAAACCCAGAAUAAG (SEQ ID NO: 376);

[0089] F) the dsRNA is 11002d, wherein the sense strand comprises GCAGCCAACUUUUCUAGAA (SEQ ID NO: 259), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUGG (SEQ ID NO: 260);

[0090] G) the dsRNA is 11002a, wherein the sense strand comprises CUACAGCCAACUUUUCUAGAA (SEQ ID NO: 253), and the antisense strand comprises UUCUAGAAAAGUUGGCUGUAG (SEQ ID NO: 254);

[0091] In some embodiments, the siRNA targeting the proprotein convertase subtilisin / kexin type 9 gene (PCSK9 gene) is modified and selected from one of the following sequences, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0092] e) The dsRNA is 11040.10-23, wherein the 5'-3' sense strand comprises

[0093] Invab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAInvab, and the 5'-3' antisense strand comprises VPU-S*fG*mCmUmAmCmAmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG;

[0094] f) The dsRNA is 11002.17-21, wherein the 5'-3' sense strand comprises

[0095] Invab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG;

[0096] g) The dsRNA is 11002.10-23, wherein the 5'-3' sense strand comprises

[0097] Invab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, and the 5'-3' antisense strand comprises VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG;

[0098] An siRNA targeting the ANGPTL3 gene or a pharmaceutically acceptable salt thereof, wherein the sequence is selected from one of the following, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0099] H) the dsRNA is 7061f, wherein the sense strand comprises UACUUGAACUCAACUCAAA (SEQ ID NO: 579), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGG (SEQ ID NO: 580);

[0100] I) the dsRNA is 7061b, wherein the sense strand comprises GCCACUUGAACUCAACUCAAA (SEQ ID NO: 571), and the antisense strand comprises UUUGAGUUGAGUUCAAGUGGC (SEQ ID NO: 572);

[0101] In some embodiments, the siRNA is modified and selected from one of the following sequences, or a sense strand or antisense strand sequence thereof that differs by no more than 1 nucleotide:

[0102] h) The dsRNA is 7061.18-14, wherein the 5'-3' sense strand comprises

[0103] Invab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, and the antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG;

[0104] i) The dsRNA is 7061.4-16, wherein the 5'-3' sense strand comprises

[0105] Invab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, and the antisense strand comprises VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC;

[0106] The seventh aspect of the present invention is to provide an siRNA agent targeting the AGT gene, PCSK9 gene or ANGPTL3 gene, wherein the active ingredient comprises any one of the above-mentioned siRNAs or a pharmaceutically acceptable salt thereof connected to a ligand.

[0107] In some embodiments, the ligand is an N-acetylgalactosamine derivative, and preferably, the structural formula of the ligand is as follows:

[0108] In some embodiments, the ligand is connected to the 3' end of the sense strand via a chemical bond, preferably a phosphate bond or a phosphorothioate bond, and the connection is as follows:

[0109] Through extensive research on siRNA sequences and extensive experimentation, we have screened multiple dual-targeted siRNA agents capable of simultaneously inhibiting the expression of two targets, including any combination of AGT, PCSK9, and ANGPTL3. Furthermore, appropriate modifications have been made to enhance target silencing and reduce off-target activity, enabling their use against both single and dual targets. Furthermore, the siRNA agents described herein can be delivered simultaneously to the liver using a suitable, preferably combined, delivery system, achieving enhanced activity. These agents are expected to be clinically applicable to treat hypertension and / or lipid disorders associated with any combination of targets, including AGT, PCSK9, and ANGPTL3. BRIEF DESCRIPTION OF THE DRAWINGS

[0110] Figure 16 shows the inhibitory effect of AGT / PCSK9 dual-targeting siRNA DT03081 on AGT targets in AAV8-hAGT / hPCSK9 mice at a dose of 0 nmol / kg over time.

[0111] Figure 2 shows the inhibitory effect of AGT / PCSK9 dual-targeting siRNA DT03081 on PCSK9 targets in AAV8-hAGT / hPCSK9 mice at a dose of 60 nmol / kg over time. DETAILED DESCRIPTION

[0112] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0113] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0114] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0115] The present invention provides a dual-targeting siRNA agent, comprising two different siRNAs or pharmaceutically acceptable salts thereof targeting two different genes, wherein the siRNA is a dsRNA consisting of a sense strand and an antisense strand, wherein the agent comprises a first dsRNA targeting a first gene and a second dsRNA targeting a second gene, wherein the first dsRNA and the second dsRNA are linked by a pharmaceutically acceptable ligand, and the first targeted gene and the second targeted gene are respectively selected from angiotensinogen (AGT), angiopoietin-like protein 3 (ANGPTL3), and proprotein convertase subtilisin / kexin type 9 (PCSK9);

[0116] The expression of any combination of two targets, such as AGT, ANGPTL3, and PCSK9, can be assessed based on the level of any variable associated with AGT, ANGPTL3, and PCSK9 gene expression, such as AGT, ANGPTL3, and PCSK9 mRNA levels in tissue or serum, AGT, ANGPTL3, and PCSK9 protein levels, and related blood lipid levels. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as a pre-dose baseline level, or a level measured from a similar subject, cell, or sample that has not been treated or has received a control treatment, as well as a known population level.

[0117] In some embodiments, the disease associated with the expression of any combination of two targets such as AGT, ANGPTL3 and PCSK9 is hypertension and / or lipid disorders.

[0118] The application of the invention in a drug for treating and / or preventing hypertension, wherein the hypertension is mediated by the AGT gene, including but not limited to critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and unstable hypertension or other diseases mediated by the AGT gene.

[0119] The use of the drug in a drug for treating and / or preventing diseases related to lipid disorders, wherein the diseases related to lipid disorders are mediated by the PCSK9 gene, including but not limited to hyperlipidemia, atherosclerosis, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease or other diseases related to PCSK9 gene mediation.

[0120] The use of the drug in a drug for treating and / or preventing lipid disorders, wherein the lipid disorders are mediated by the ANGPTL3 gene, including but not limited to hyperlipidemia, hypertriglyceridemia, lipid and / or cholesterol metabolism disorders, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, cardiometabolic diseases, obesity, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, pancreatitis caused by hypertriglyceridemia, or other diseases mediated by the ANGPTL3 gene.

[0121] Delivery of the siRNA agents of the present invention to cells, such as cells within a subject (e.g., a human subject, such as a subject suffering from a disorder related to AGT, ANGPTL3, and PCSK9, such as hemochromatosis), can be achieved through a variety of different pathways. For example, delivery can be achieved by contacting cells with the siRNA of the present invention either in vitro or in vivo. In vivo delivery can also be achieved by administering a composition comprising the siRNA or a salt thereof to a subject.

[0122] Generally, any method of delivering nucleic acid molecules (in vitro or in vivo) can refer to existing delivery technologies. For in vivo delivery, factors to be considered for the delivery of siRNA molecules include, for example, the biological stability of the delivered molecule, the prevention of non-specific effects, and the accumulation of the delivered molecule in the target tissue. The formulation can be administered locally (for example, by direct injection or implantation into the tissue or by topical administration). Local administration to the treatment site maximizes the local concentration of the drug formulation, limits the exposure of the agent to systemic tissues that can be damaged or degraded by the agent, and allows a lower total dose of the siRNA molecules to be administered.

[0123] For systemic administration of siRNA to treat disease, the RNA can be modified or delivered using a drug delivery system; both methods work to prevent rapid degradation of dsRNA by endonucleases and exonucleases in vivo. Modifications to the RNA or pharmaceutical carriers can also allow the siRNA composition to be targeted to the target tissue and avoid off-target effects. siRNA molecules can be modified by chemically conjugating them to lipophilic groups such as cholesterol, for example, in lipid particles, to enhance cellular uptake and prevent degradation.

[0124] The present invention also includes pharmaceutical compositions and formulations comprising any of the siRNAs or salts thereof described herein. In some embodiments, the pharmaceutical formulations comprise a pharmaceutical composition comprising the siRNA or salt thereof described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing the siRNAs are useful for treating diseases or conditions associated with AGT, ANGPTL3, and PCSK9, such as hemochromatosis. These pharmaceutical compositions are formulated based on the mode of delivery.

[0125] In some embodiments, the composition is formulated for systemic administration via parenteral delivery, such as intravenous (IV) delivery or subcutaneous (SC) delivery. In the methods of the present invention, the pharmaceutical preparation of the siRNA or its salt can be administered in a solution, preferably in a sterile solution, for example, by injection.

[0126] As used herein, a "therapeutically effective amount" includes an amount of siRNA or a salt thereof sufficient to treat an AGT, ANGPTL3, or PCSK9-related disease (e.g., by attenuating, alleviating, or maintaining an existing disease, or one or more symptoms of a disease) when administered to a patient. The "therapeutically effective amount" may vary depending on the pharmaceutical formulation of the siRNA or salt thereof, how the formulation is administered, the disease and its severity, and the patient's medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by AGT, ANGPTL3, or PCSK9, type of previous treatment or co-treatment (if any), and other independent characteristics.

[0127] For purposes of the present invention, a "prophylactically effective amount" includes an amount of a pharmaceutical agent comprising an siRNA or a salt thereof that, when administered to a subject who has not yet experienced or developed symptoms of a disease associated with AGT, ANGPTL3, and PCSK9 but may be susceptible to the disease, is sufficient to prevent or alleviate the disease or one or more symptoms of the disease. Alleviating the disease includes slowing the progression of the disease or reducing the severity of the disease if it subsequently develops. The "prophylactically effective amount" may vary depending on how the siRNA or a salt thereof is administered, the risk of the disease, and the patient's medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by AGT, ANGPTL3, and PCSK9 expression, type of previous treatment or combination therapy (if any), and other independent characteristics.

[0128] "Therapeutically effective amount" or "prophylactically effective amount" also includes an amount of siRNA at any reasonable benefit-risk ratio acceptable for treatment.

[0129] The targeted delivery ligand or other types of delivery carriers of the present invention, wherein the ligand is preferably an N-acetylgalactosamine derivative (GalNAc carrier), other types of delivery carriers such as liposomes that are specifically delivered to liver cells can be used in the present invention as long as they can achieve the delivery of siRNA.

[0130] In recent years, GalNAc carriers have been studied in depth. GalNAc-nucleic acid is a monoconjugate formed by a carbohydrate compound and a nucleic acid. N-acetylated galactosamine is covalently conjugated to the 3′ and / or 5′ end of the sense chain of RNA of different sequences in a trivalent manner to form GalNAc-siRNA drugs, thereby achieving specific delivery to hepatocytes, and allowing the drug to enter the cells and exert its function through endocytosis.

[0131] All siRNAs in the present invention target human AGT, PCSK9, or ANGPTL3. In some embodiments, hAGT, hPCSK9, or hANGPTL3 are used to express the target in order to emphasize that the gene or protein detected in AAV8-transfected mice or humanized mice is human AGT, human PCSK9, or human ANGPTL3.

[0132] In some of the following examples, the dual-target GalNAc ligand structure is as follows:

[0133] Single-target GalNAc ligands are as follows:

[0134] In some of the following examples, the structure of the dual-target GalNAc ligand after linking to siRNA is as follows:

[0135] The structure of the single-target GalNAc ligand after connecting to siRNA is as follows:

[0136] In the nucleic acid sequence table of the present invention, the abbreviations and structures of the nucleotide monomers used are as follows:

[0137] According to existing technologies, those skilled in the art know that the pharmaceutically acceptable salt of the siRNA may be a sodium salt or a potassium salt, for example, a sodium salt produced during purification.

[0138] Human angiotensinogen (AGT) mRNA [NCBI Reference Sequence: NM_001384479.1].

[0139] Human proprotein convertase subtilisin / kexin type 9 gene (PCSK9) mRNA [NCBI Reference Sequence. NM_174936.4]:

[0140] Human angiopoietin-like protein 3 (ANGPTL3) mRNA [NCBI Reference Sequence: NM_014495.4].

[0141] The present invention is further described in detail below with reference to specific embodiments.

[0142] Example 1 siRNA targeting human AGT (hAGT)

[0143] A solid-phase oligonucleotide synthesis protocol was used on a 12-channel nucleic acid synthesizer at Beijing Qingke Biotechnology Co., Ltd. to synthesize 0.2-1 μmol of oligonucleotides. siRNA sequences were synthesized on a prepacked CPG column, using either GalNAc-coupled CPG or universal CPG as needed. Aminolysis reagent was added to the synthesized oligonucleotide and incubated at 45-80°C to separate the oligonucleotide from the solid support and free the oligonucleotide. The crude oligonucleotide was then precipitated with ethanol, and the supernatant discarded. This process was repeated twice to obtain the crude oligonucleotide, which was then resuspended in DEPC-free water. The crude oligonucleotide was purified by ion-pairing HPLC, and the collected product was dried to a powder in a vacuum centrifuge. The purified product was dissolved in DEPC-free water and analyzed by time-of-flight LC-MS. The oligonucleotide concentration was determined, and the required volumes of equimolar amounts of the sense and antisense strands were calculated. The equimolar amounts of the sense and antisense strands were mixed and annealed to form a duplex by heating at 95°C for 5 minutes and then cooling to room temperature.

[0144] Table 1: Sense and antisense strand sequences of unmodified siRNA targeting the AGT gene

[0145] Next, we modified the siRNA to improve its stability in vitro and in vivo, enhance its activity against the target, and reduce its activity against non-target sites. Unless otherwise noted, L96 delivery was used for in vivo and in vitro screening of single-target sequences to more realistically reflect the efficacy of liver-targeted siRNA. The siRNA was linked to L96 at the 3' end of the sense strand.

[0146] Duplex 1000PM (AD-85481) is the fastest-progressing AGT-targeted drug, Zilebesiran, currently in Phase II clinical trials with patent number US11015201B2, and is used as a positive comparison sequence.

[0147] Table 2: Modified siRNA sequences targeting the AGT gene

[0148] Example 2 In vitro screening of siRNA targeting AGT

[0149] Experimental Method 1: In vitro siRNA screening using liposome transfection in Hep3B cells

[0150] Cell culture and 96-well plate transfection: In vitro experiments were performed in Hep3B cells using MEM + 10% FBS + 1X penicillin-streptomycin + 1X non-essential amino acids. When the cell confluence area reached 80%, the cells were trypsinized and the cell density was determined using a Scepter automated cell counter (Millipore, #PHCC00000). siRNA, Opti-MEM, and INTERFERin (Polyplus) were mixed in a 96-well plate and incubated at room temperature for 10 minutes. Then, complete medium containing Hep3B cells was added to each well, and the 96-well plate was incubated in a 37°C, 5% CO2 incubator for 24 hours.

[0151] 96-well plate RNA extraction and reverse transcription: Oligo d(T)25 Magnetic Beads reagent (NEB) was used to extract mRNA from cells in a 96-well plate. The medium in the 96-well plate was aspirated, and the plate was washed once with DPBS. 100 μl of cell lysis buffer was added to each well, followed by 20 μl of beads. The plate was shaken on a shaker. The 96-well plate was placed on a magnetic separation rack, and the lysate was aspirated. 100 μl of wash buffer A was added to each well, and the plate was placed on a magnetic separation rack. Wash buffer A was aspirated, and the beads were then aspirated with 100 μl of wash buffer B. The beads were then transferred to a new 96-well plate, placed on a magnetic separation rack, and wash buffer B was aspirated. The beads were then aspirated with 100 μl of low-salt buffer and transferred to a 96-well PCR plate. The 96-well PCR plate was placed on a magnetic separation rack, and the low-salt buffer was aspirated. 10 μL of elution buffer was added to each well, and the beads were aspirated. The plate was incubated at 50°C for 2 minutes to elute the mRNA from the beads. Prepare the reverse transcription system using StarScript Pro Genstar Reverse Transcription Master Mix (1 tube). Aliquot 5 μL per well of a 96-well PCR plate. Add 5 μL of the mRNA solution obtained in the previous step and mix thoroughly. Centrifuge briefly and seal the plate with a film sealer. 9) Incubate the plate in a PCR instrument at 37°C for 3 minutes, 50°C for 50 minutes, and then at 85°C for 2 minutes. Cool to 4°C to complete the reverse transcription.

[0152] Real-time fluorescence quantitative PCR: After reverse transcription, place the 96-well plate on a magnetic separation rack until the beads are adsorbed to the bottom. Aspirate the reverse transcription reagent, add the prepared QPCR system to the 96-well PCR plate, seal the plate with a film, and perform PCR on a StepOnePlus Real-Time PCR System (Applied Biosystems). Data are analyzed using the ΔΔCt method and normalized using cells transfected with a negative control sequence at the same concentration.

[0153] The sequence of the negative control AD-1955 is as follows:

[0154] Sense strand: CUUACGCUGAGUACUUCGAdTdT (SEQ ID NO: 703)

[0155] Antisense strand: UCGAAGUACUCAGCGUAAGdTdT (SEQ ID NO: 704).

[0156] The primers for detecting AGT are as follows:

[0157] Forward primer: ATTCTGCACACCGAGCTGAA (SEQ ID NO: 705)

[0158] Reverse primer: TCAAGCTCAAAAAAAATGCTGTTC (SEQ ID NO: 706)

[0159] Probe: CTGCAAAAATTGAGCAATGACCGCATC (SEQ ID NO: 707) (reporter gene 5' FAM, quencher group 3' MGB)

[0160] Experimental method 2: In vitro screening was performed in primary hepatocytes of humanized AGT mice (purchased from Jicui Yaokang) or mice infected with AAV8 virus expressing both human AGT (hAGT) and ANGPTL3 (hANGPTL3).

[0161] Construction of AAV8-infected mice stably expressing both hAGT and hANGPTL3 (AAV8-hAGT / hANGPTL3 mice): 1x10 11 Titer ultrapurified recombinant AAV8-hAGT and 1x10 11 Mice were infected with titrated ultra-purified recombinant AAV8-hANGPTL3 viral particles to obtain transgenic mice that stably expressed both hAGT and hANGPTL3.

[0162] Mouse primary hepatocyte extraction: Mouse hepatocytes were extracted by collagenase digestion via inferior vena cava perfusion. Viable primary hepatocytes were filtered through a tissue cell strainer (BIOLOGIX, 15-1070) and resuspended in DMEM medium supplemented with 10% FBS and 1X penicillin-streptomycin. Cell density was determined using a Scepter automated cell counter.

[0163] The methods of siRNA transfection, RNA extraction, reverse transcription, and real-time fluorescence quantitative PCR were the same as those in method 1. siRNA was delivered by free uptake without the addition of INTERFERin.

[0164] Table 3: Experimental results of 0.1 nM modified siRNA transfection in Hep3B cells by liposome

[0165] We screened the activity of some sequences targeting AGT using Hep3B cells. Table 3 shows that at a concentration of 0.1 nM, the activities of multiple sequences such as 1131.21-11, 1165.1-1, 1167.1-1, and 1172.1-1 were similar to or better than the positive reference.

[0166] Table 4: Experimental results of 1 nM modified siRNA delivered via L96 in primary hepatocytes of humanized AGT mice

[0167] We further evaluated the in vitro activity of the modified siRNAs using primary humanized AGT mouse hepatocytes. As shown in Table 4, when delivered via L96, several siRNAs, such as 1131.21-11 and 1167.1-1, showed superior activity compared to the positive reference sequence.

[0168] Table 5: Experimental results of 0.1 nM modified siRNA delivery via L96 in AAV8-hAGT / hANGPTL3 mouse primary hepatocytes

[0169] From the experimental data in Table 5, we can see that several siRNAs, such as 1165.4-13 and 1167.3-14, exhibited superior activity to the positive control (1000 pM) at a concentration of 0.1 nM when delivered using L96 in primary AAV8-hAGT / hANGPTL3 mouse hepatocytes. Furthermore, we found that even with identical seed regions, 1165.4-13 exhibited superior activity to 1165.2-3, while the 19 / 21 paired 1167.3-14 sequence exhibited superior activity to the 21 / 21 paired 1167.2-4 sequence, indicating that changes in the final siRNA bases can significantly affect sequence activity. We next evaluated the sequences that demonstrated superior activity in the aforementioned in vitro assays in mice.

[0170] Example 3 Evaluation of the Effect of Preferred Sequences on AGT Protein Expression in AAV8-hAGT Mice

[0171] Experimental methods:

[0172] 1. Adenovirus integration of hAGT

[0173] By 1x10 11 Mice were infected with titrated ultra-purified recombinant AAV8 virus particles to obtain transgenic mice stably expressing hAGT.

[0174] 2. Experimental Grouping and Medication

[0175] Fourteen days after virus injection, mice were bled from the submandibular vein, allowed to rest at room temperature for 30 minutes, and centrifuged at 1000×g for 10 minutes. The supernatant serum was collected and aliquoted and stored frozen at -80°C. Serum samples were diluted 1000-fold, and hAGT expression in mouse serum was assayed using the Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Lianke Bio, Cat. No. EK1202–96). Mice were divided into groups of four based on hAGT expression. siRNA was dissolved in PBS at a concentration of 0.2 mg / kg, and mice were subcutaneously injected with 1 mg / kg of the siRNA solution.

[0176] 3.ELISA test

[0177] After siRNA injection, blood was collected from the submandibular vein at regular intervals, allowed to stand at room temperature for 30 minutes, and centrifuged at 1000 × g for 10 minutes. The supernatant serum was diluted 1000-fold and assayed for hAGT expression by ELISA. AGT residual (%) = hAGT protein concentration on day N / hAGT protein concentration on day 0 * 100%.

[0178] Table 6: Experimental results of changes in hAGT protein expression levels over time after hAGT-targeted siRNA at a dose of 1 mg / kg was delivered into AAV8-hAGT mice via L96

[0179] NA means not detected

[0180] As shown in Table 6, some sequences with good in vitro activity did not perform as well as the positive reference in vivo. Several siRNAs, such as 1161.3-7, 1165.3-11, 1167.4-14, 1172.2-17, and 1172.9-28, showed comparable or better activity than the positive reference 1000 PM. In particular, on day 56, hAGT protein expression levels in the 1000 PM group of the positive reference sequence showed a significant rebound, while hAGT protein expression levels in the 1165.3-11, 1167.4-14, 1172.2-17, and 1172.9-28 groups remained below 50%. In addition, the AGT expression of 1161.3-7 remained at only 24% on the 30th day, while that of 1161.3-11 remained at 45.1% on the 30th day. This indicates that the activity of the same naked sequence is significantly different after different modifications, further proving that the effect of modification on siRNA activity is extremely important.

[0181] Example 4 siRNA Safety Test

[0182] 7-8 week old mice (Vitamin B) were subcutaneously injected with 400 mg / kg of siRNA every two weeks for 4 weeks, for a total of three injections. A control group of mice received a subcutaneous injection of normal saline every two weeks for 4 weeks, for a total of three injections, with 4-6 mice per group. Serum was collected 24 hours after the last injection for measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels.

[0183] Table 7: Safety test results of siRNA targeting AGT

[0184] From Table 7, we can see that different siRNA sequences have different effects on the liver function of mice. 1167.3-14 has no effect on liver function in mice, while 1172.2-17 and 1191.1-1 have significant effects.

[0185] Example 5 Effects of different modifications on the activity and stability of the preferred sequence targeting AGT

[0186] The sequence activity method is described in Example 2.

[0187] The experimental method for siRNA stability study is as follows:

[0188] The test compound sequence was accurately diluted with DEPC water to a working concentration of 10 μM.

[0189] Preparation of liver homogenate: Weigh 200 mg of mouse liver, add 1 mL of potassium phosphate buffer solution and 5 magnetic beads, and homogenize three times in a grinder at 60 Hz, 30 s / time to obtain 200 mg / mL liver homogenate.

[0190] Preparation of 72h samples: Take 17μL of 10μM test compound / positive compound working solution, add 153μL of liver homogenate and mix, vortex for 30s, take 75μL of the mixed solution of compound and liver homogenate into EP tube, the number of parallel samples is 2, place in a 37℃ incubator and incubate for 72h, and take out 50μL after incubation.

[0191] Preparation of 0h samples: Take 75μL liver homogenate in EP tube, the number of parallel samples is 2, and incubate in a 37℃ incubator for 72h. After incubation, take out 45μL liver homogenate, add 5μL 10μM test compound / positive compound, and mix well.

[0192] After incubation, 5 μL of 50 μg / ml internal standard was added to each tube of the sample, mixed, and then 100 μL of lysis buffer was added to each tube, vortexed for 30 s, and allowed to stand for 20 min.

[0193] After all samples were treated with appropriate pretreatment methods, the supernatant was taken for instrumental analysis. The relative residual rate (%) was then calculated as (72h compound content / 0h compound content)×100%.

[0194] We next investigated whether all sequences near 1167 exhibited high activity. We selected sequences with 1-2 nucleotide differences from 1167 and evaluated their activity in primary hepatocytes from humanized AGT mice. The results are shown in Table 8.

[0195] Table 8: Experimental results of 1 nM modified siRNA delivery via L96 in primary mouse hepatocytes

[0196] We found that sequences such as 1198.1-1, 1222.1-1, 1223.1-1, and 1224.1-1 were significantly less active than sequences such as 1167.3-5. We also found that even within the same seed region, sequences such as 1167.3-5, which used a 19 / 21 pairing, were significantly more active than sequences such as 1167.2-4 and 1167.11-15, which used a 21 / 21 pairing.

[0197] We then explored the effects of different modifications on the activity of 1167. The results are shown in Table 9.

[0198] Table 9: Experimental results of different transfection methods using different concentrations of modified siRNA in different cells

[0199] NA means not detected

[0200] For the preferred sequence 1167, different modified siRNAs were designed, and the activities of these sequences were compared in vitro by liposome transfection and free uptake in Hep3B cells, AAV8-hAGT / hPCSK9 mouse primary hepatocytes, and humanized AGT mouse primary hepatocytes. The experimental method refers to Example 2. As can be seen from Table 9, different modifications have a great influence on the activity of the sequence. The most active 1167.17-19 is much higher than the positive reference, while the least active 1167.12-14 is much worse than the positive reference, which further illustrates the importance of modification for siRNA activity. We next conducted a liver homogenate stability test on the sequences with good activity to evaluate the stability of the sequence in vivo.

[0201] Table 10: Liver homogenate stability test results of different modified siRNAs

[0202] As can be seen from Table 10, the stability of the sequences in liver homogenate varies with the modification. The most active 1167.17-19 is also more stable in liver homogenate than other modified 1167 sequences.

[0203] Table 11: Experimental results of 0.1 nM modified siRNA delivered by liposomes in primary hepatocytes of humanized AGT mice

[0204] Table 12: Liver homogenate stability test results of different modified siRNAs

[0205] From Tables 11 and 12, we found that different endings have a great influence on the activity and stability of the 1167 sequence. When 1167 ends with mGmG, both the activity and stability are much higher than those of mCmC, dTdT or mAmA.

[0206] Table 13: Experimental results of 0.3 nM modified siRNA delivered via L96 in AGT / PCSK9 dual humanized mouse primary hepatocytes

[0207] As can be seen from Table 13, the activity of VPU-S modified 1167.25-19 is comparable to that of VPU modified 1167.17-19.

[0208] We further optimized the two sequences 1165 and 1161 with good activity and high safety, and tested the changes in in vitro activity when different modifications and bases were changed.

[0209] Table 14: Experimental results of 0.3 nM modified siRNA duplex delivered via L96 in AGT / PCSK9 dual humanized mouse primary hepatocytes

[0210] Sequences 1161 and 1165 were further optimized by base modification and modification. The VPU-S modification was found to significantly impact the activity of these two sequences. For sequence 1161, modifications 1161.4-13, 1161.5-14, and 1161.7-15 showed the best activity. For sequence 1165, modifications 1165.8-17, 1165.5-14, and 1165.5-16 all showed excellent activity. Furthermore, the activity of these preferred sequences was significantly higher than the positive reference of 1000 pM.

[0211] Table 15: Experimental results of different concentrations of modified siRNA delivered by SL01 in AAV8-AGT / ANGPTL3 mouse primary hepatocytes

[0212] In vitro activity evaluation of siRNA duplexes delivered using SL01 was performed at 1 nM and 0.1 nM concentrations for the preferred sequences 1161.7-15, 1161.7-17, 1165.5-14, 1165.5-16, 1167.25-19, and 1167.27-21. As shown in Table 15, the preferred sequences exhibited higher activity than the Alnylam positive reference at both 1 nM and 0.1 nM concentrations, with 1167.25-19, 1165.5-14, and 1165.5-16 showing the highest activity.

[0213] Next, we evaluated several preferred sequences in vivo.

[0214] Table 16: Experimental results of hAGT protein expression levels after AGT-targeted siRNA was delivered into AAV8-hAGT mice via L96 at a dose of 1 mg / kg

[0215] As can be seen from Table 16, the in vivo activity of 1167.25-19, 1167.27-21, and 1165.5-16 is much better than that of the positive reference, especially in terms of long-term efficacy. On day 74, the inhibition rate of the positive reference 1000PM on AGT expression was only 20%, while the inhibition rate of the preferred sequences 1167.25-19, 1167.27-21, and 1165.5-16 on AGT expression was still around 50%. We next tested the in vivo activity of the preferred sequences delivered by SL01.

[0216] Table 17: Experimental results of hAGT protein expression levels after hAGT-targeted siRNA was delivered into AAV8-hAGT / hPCSK9 mice via SL01 at a dose of 1 mg / kg

[0217] The two most active sequences were further validated in vivo. The positive reference was delivered using L96, while 1167.25-19 and 1165.5-16 were delivered using SL01. As can be seen, the activity of the two preferred sequences was far superior to that of the positive reference.

[0218] Example 6 Synthesis of siRNA Targeting PCSK9

[0219] The synthesis method is as described in Example 1. Duplex 11000PM is the approved drug inclisiran, patent number CN108220295B, and is used as a positive control sequence.

[0220] Table 18: Sense and antisense strand sequences of unmodified siRNA targeting PCSK9

[0221] Next, we modified the siRNA to improve its stability in vitro and in vivo, enhance its activity against the target, and reduce its activity against non-target sites. Unless otherwise noted, L96 delivery was used for in vivo and in vitro screening of single-target sequences to more realistically reflect the efficacy of liver-targeted siRNA. The siRNA was linked to L96 at the 3' end of the sense strand.

[0222] Table 19: Modified siRNA sequences targeting PCSK9

[0223] Example 7 Experimental results of in vitro activity and stability of siRNA targeting PCSK9

[0224] Humanized PCSK9 mice were purchased from Shanghai Model Organisms Science Co., Ltd. The primary hepatocyte extraction experimental method and cell target gene qPCR detection method were referred to Example 2.

[0225] The primers for detecting PCSK9 are as follows:

[0226] Forward primer: ACGTGGCTGGCATTGCA (SEQ ID NO: 708)

[0227] Reverse primer: AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO: 709)

[0228] Probe: CATGATGCTGTCTGCCGAGCCG (SEQ ID NO: 710) (reporter gene 5' NED, quencher group 3' BHQ1)

[0229] Table 20: Experimental results of lipofectamine transfection of modified siRNA at different concentrations in Hep3B cells

[0230] NA means not detected

[0231] Table 21: Experimental results of different concentrations of modified siRNA in humanized PCSK9 mouse primary hepatocytes by liposome transfection or L96 delivery

[0232] Table 22: Experimental results of 10 nM modified siRNA delivered by L96 in humanized PCSK9 mouse primary hepatocytes

[0233] In vitro activity data in Hep3B and humanized PCSK9 mouse primary liver cells showed that multiple sequences, including 11002.1-1, 11040.1-1, and 11042.1-1, showed superior activity compared to the positive reference. Next, we tested the activity of these sequences in humanized PCSK9 mice.

[0234] Example 8 Evaluation of the effect of a single subcutaneous injection of 1 mg / kg siRNA on PCSK9 protein expression in humanized PCSK9 mice

[0235] Experimental methods:

[0236] 1. Experimental Grouping and Medication

[0237] Before the experiment, whole blood was collected from the mice via the submandibular vein. The blood samples were allowed to stand at room temperature for 30 minutes and then centrifuged at 1000×g for 10 minutes. The supernatant serum was collected and stored frozen at -80°C. Serum samples were diluted 1000-fold, and PCSK9 expression in mouse serum was measured using the Human PCSK9 ELISA Kit (Proteintech, Cat No: KE00278). Mice were divided into groups of four based on PCSK9 expression. siRNA was dissolved in saline at a concentration of 0.1 mg / ml, and mice received a single subcutaneous injection of 1 mg / kg of siRNA solution.

[0238] 2.ELISA test

[0239] After siRNA injection, a small amount of blood was collected from the submandibular vein at regular intervals, allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was collected. After dilution 1000-fold, the PCSK9 expression level was detected by ELISA.

[0240] The experimental results are shown in Table 23.

[0241] Table 23: Experimental results of PCSK9-targeted siRNA inhibition of PCSK9 protein expression in humanized PCSK9 mice at a dose of 1 mg / kg

[0242] Data showed that the inhibition rate of serum PCSK9 protein reached its maximum on day 30 after administration and then rebounded. On day 40, the positive reference group had approximately 89.7% PCSK9 protein remaining, with an inhibition rate of approximately 10.3%. The inhibition rates of the remaining experimental groups were higher than the positive reference, especially 11040.1-6 and 11042.1-15, both of which had inhibition rates exceeding 50%. The inhibition rate of 11002.1-8 was also 46.8%, and on day 55, the inhibition rate of the 11042.1-15 group was still 50%. The activity of 11040.1-6 was higher than that of 11040.1-8, indicating that even with the same sequence, different modifications can have different activities in vivo.

[0243] Example 9 Safety Test of siRNA Targeting PCSK9

[0244] The siRNA safety test method is shown in Example 4, and the experimental results are shown in Table 24.

[0245] Table 24: Safety Experiment Results of siRNA Targeting PCSK9 Note: Data for 11042.1-15 is from the test 10 days after the second injection.

[0246] From Table 24, we can see that 11002.7-14 and 11040.3-10 are very safe in mice, while 11042.1-15 has a great impact on liver function in mice.

[0247] Effects of Different Modifications and Base Changes in Examples 1011002 and 11040 on Sequence Activity and Stability

[0248] Table 25: Experimental results of 1 nM modified siRNA delivered by L96 in humanized PCSK9 mouse primary hepatocytes

[0249] From Table 25, we can conclude that different positive chain modifications of the same sequence have a significant impact on activity, with modification 11040.1-23 having the best activity.

[0250] Table 26: Experimental results of 3nM modified siRNA delivery via L96 in humanized PCSK9 mouse primary hepatocytes

[0251] It can be concluded from Table 26 that the activity changes are different when the bases and modifications are changed in different sequences.

[0252] Table 27: Metabolic stability data of different modified siRNAs in liver homogenate

[0253] It can be concluded from Table 27 that different sequence modifications and base changes have different effects on stability. Among them, 11002.7-14 and 11040.1-1 are very stable in liver homogenate, while the stability of 11002.5-14 and 11040.5-10 is significantly reduced.

[0254] Table 28: Experimental results of different concentrations of modified siRNA delivered by L96 or liposome transfection in humanized PCSK9 mouse primary hepatocytes

[0255] Table 29: Experimental results of different concentrations of modified siRNA delivered by L96 or liposome transfection in humanized PCSK9 mouse primary hepatocytes

[0256] Table 31: Experimental results of 0.1 nM modified siRNA transfection in primary hepatocytes of AVV8-hPCSK9 mice by liposome transfection

[0257] Table 32: Experimental results of different concentrations of modified siRNA delivered via L96 in primary hepatocytes of AVV8-hPCSK9 mice

[0258] The experimental data in Tables 28-32 demonstrate that we optimized sequences 11002 and 11040 from multiple perspectives, including both the sense and antisense strands. The results indicate that the preferred sequences 11002.17-21, 11002.10-23, and 11040.10-23 all exhibited superior activity to the positive reference 11000 PM. We next validated the activity of the selected sequences in vivo.

[0259] Table 33: Experimental results of PCSK9-targeted siRNA inhibition of PCSK9 protein expression in humanized PCSK9 mice at a dose of 1 mg / kg

[0260] It can be concluded from Table 33 that the in vivo activities of 11002.17-21 and 11040.10-23 are much better than the positive reference 1000PM.

[0261] Example 11 Synthesis of siRNA Targeting ANGPTL3

[0262] The specific synthesis method is shown in Example 1.

[0263] Table 34: Sense and antisense strand sequences of unmodified siRNA targeting ANGPTL3

[0264] Next, we modified the siRNA to improve its stability in vitro and in vivo, enhance its activity against the target, and reduce its activity against non-target sites. Unless otherwise noted, L96 delivery was used for in vivo and in vitro screening of single-target sequences to more realistically reflect the efficacy of liver-targeted siRNA. The siRNA was linked to L96 at the 3' end of the sense strand.

[0265] 7000PM (AD-1331212) is the optimal sequence in US11613751B2. ARO-ANG3 is the optimal sequence in US10995335B2 and was used as a positive comparison sequence. Sequence information is shown in Table 34. To assess sequence activity, the same GalNAc was used for delivery.

[0266] Table 35: Modified siRNA sequences targeting ANGPTL3

[0267] Example 12 In vitro activity evaluation of siRNA targeting ANGPTL3

[0268] The in vitro activity evaluation method of Hep3B cells is as described in Example 2. When primary hepatocytes are used for in vitro activity evaluation, the method for obtaining transgenic mice stably expressing hANGPTL3 and extracting primary hepatocytes is as described in Example 2.

[0269] The primers for detecting ANGPTL3 are as follows:

[0270] Forward primer: ACATGTGGCTGAGATTGCTGG (SEQ ID NO: 711)

[0271] Reverse primer: CCTTTGCTCTGTGATTCCATGTAG (SEQ ID NO: 712)

[0272] Probe: CCTCCCAGAGCACACAGACCTGATGTTT (SEQ ID NO: 713) (reporter gene 5' NED, quencher group 3' MGB)

[0273] Table 36: Experimental results of different concentrations of modified siRNA in Hep3B and humanized ANGPTL3 mouse primary hepatocytes via liposome transfection or L96 delivery

[0274] NA means not detected

[0275] The modified siRNAs were evaluated for activity in Hep3B cells and primary humanized ANGPTL3 mouse hepatocytes using lipofectamine transfection and free uptake, respectively. As shown in the table, many sequences exhibited activity superior to the positive reference. Next, we evaluated their in vivo activity. The results are shown in Table 37 below.

[0276] Example 13 Evaluation of the Effect of In Vitro Preferred Sequences on hANGPTL3 Expression in the Liver in AAV8-hANGPTL3 Mice The effect of in vitro preferred sequences on hANGPTL3 expression in the liver was evaluated in hANGPTL3-expressing mice.

[0277] Experimental methods:

[0278] 1. Adenoviral integration of hANGPTL3

[0279] Pass 1-10x10 11 Recombinant AAV8 virus particles were titered and purified to infect mice, and transgenic mice stably expressing hANGPTL3 were obtained.

[0280] 2. Medication

[0281] Fourteen days after virus injection, mice were divided into groups of 4. siRNA was dissolved in saline and injected subcutaneously at a dose of 1 mg / kg or 3 mg / kg.

[0282] 3. Liver sampling and testing

[0283] Liver samples were harvested at different time points after siRNA injection. RNA was extracted from the liver tissue using the TRI REAGENT (MRC, Catalog No. TR118) and reverse transcribed into cDNA using the PrimeScript RT-PCR Kit (Takara, Catalog No. RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a film, and QPCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) to measure hANGPTL3 expression.

[0284] Table 37: Experimental results of ANGPTL3-targeted siRNA inhibiting hANGPTL3 gene expression in the liver of AAV8-hANGPTL3 mice at a dose of 1 mg / kg

[0285] NA means not detected

[0286] siRNAs with relatively good in vitro activity were screened for in vivo activity at a dose of 1 mg / kg. The experimental results are shown in Table 37. 7061.1-11 had the best activity, which was much better than the positive reference ARO-ANG3.

[0287] Table 38: Experimental results of 0.3 nM modified siRNA delivery via L96 in AAV8-hAGT / hANGPTL3 mouse primary hepatocytes

[0288] From Table 38, it can be seen that the activities of 7061.9-13 and 7061.1-11 are much higher than the positive reference ARO-ANG3.

[0289] Table 39: Experimental results of 0.3 nM modified siRNA transfection in Hep3B cells by liposome

[0290] As shown in Table 39, several sequences exhibited in vitro activity superior to or comparable to the positive reference. Sequence 7061.9-13 showed the highest activity. We selected sequences with the highest activity from this table and evaluated their activity in AAV8-hANGPTL3 mice.

[0291] Table 40: AAV8-hANGPTL3 mouse in vivo experimental data

[0292] In vivo activity screening was conducted at a dose of 1 mg / kg, and the results are shown in Table 40. On day 28, sequences 7061.9-13 and 7083.1-1 demonstrated superior activity to the positive reference, ARO-ANG3. Sequence 7061 was further optimized, and the activity of adjacent sequences was also tested.

[0293] Table 41: Experimental results of 1 nM modified siRNA delivered via L96 in humanized ANGPTL3 mouse primary hepatocytes

[0294] Sequence 7061 was further optimized based on its modified siRNA 7061.9-13, and its in vitro activity was evaluated in primary humanized ANGPTL3 mouse hepatocytes. Table 41 shows that the activity of 7061 varies significantly depending on the modification. 7061.4-16 showed the highest activity. We also compared the activity of adjacent sequences 7094.1-1, 7095.1-1, and 7096.1-1, adjacent to sequence 7061. It can be seen that, with the same modification, 7061 exhibits significantly superior activity to its neighboring sequences.

[0295] We further evaluated the activity of 7061.18-14 and 7061.4-16 in primary hepatocytes from humanized ANGPTL3 mice. The results are shown in Table 42.

[0296] Table 42: Experimental results of 1 nM modified siRNA delivery via L96 in humanized ANGPTL3 mouse primary hepatocytes

[0297] From Table 42, it can be seen that the activities of 7061.18-14 and 7061.4-16 are much higher than the positive reference ARO-ANG3.

[0298] Next, we tested the safety of sequences 7061 and 7083. The experimental results are shown in Table 43.

[0299] Table 43: Safety Experiment Results of siRNA Targeting ANGPTL3

[0300] From Table 43 we can see that 7061.1-11 is very safe in mice, while 7083.9-2 has a great impact on the liver function of mice.

[0301] Next, we will conduct further activity evaluation in vivo.

[0302] Example 14 Activity Evaluation of Optimized siRNA of Sequence 7061 in AAV8-hANGPTL3 Mice

[0303] Table 44: Results of in vivo activity evaluation of preferred sequences

[0304] The activity of sequence 7061.4-16 was evaluated in vivo in AAV8-hANGPTL3 mice at a dose of 1 mg / kg via SL01 delivery. As shown in Table 44, 7061.4-16 was more active than the positive reference.

[0305] Through the above single-target screening, we have found sequences with relatively good activity for each target. Next, we use the following structure to connect the single-target sequences with relatively good activity into a whole, so that it can inhibit the expression of two genes at the same time.

[0306] Example 15 Preparation of SL01-CPG

[0307] Preparation of compound 1a-1: A mixture of (3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (10 g, 23.84 mmol, 1.0 eq), 12-methoxy-12-oxodecanoic acid (5.8 g, 23.84 mmol, 1.0 eq), and N,N-diisopropylethylamine (12.3 g, 95.36 mmol, 4.0 eq) in dichloromethane (100 mL) was stirred at room temperature for 2.0 hours. The mixture was washed with sodium carbonate solution, and the aqueous phase was extracted with dichloromethane (50 mL x 3). The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 20 / 1) to give the yellow oily product 1a-1 (16.7 g, yield: 79.3%).

[0308] Preparation of compound 1a-2: To a mixture of compound 1a-1 (16.7 g, 25.89 mmol, 1.0 eq) in tetrahydrofuran / methanol / water (80 ml / 16 ml / 16 ml) was added lithium hydroxide monohydrate (3.1 g, 64.73 mmol, 2.5 eq). The mixture was reacted at 40°C for 4 hours. The solvent was removed from the reaction solution under reduced pressure. The aqueous residue was lyophilized. The residue was dissolved in dichloromethane and filtered. The filtrate was concentrated under reduced pressure to give the white solid product 1a-2 (14.3 g, yield: 85.3%). LCMS (ESI): m / z = 630 [M-1] - .

[0309] Preparation of compound 1a-3: To a mixture of tert-butyl (azadiylbis(ethane-2,1-diyl))carbamate (3.0 g, 9.9 mmol, 1.0 eq) and sodium carbonate (1.57 g, 14.85 mmol, 1.5 eq) in tetrahydrofuran (20 ml) and water (10 ml) was added benzyl chloroformate (2.03 g, 11.88 mmol, 1.2 eq). The mixture was stirred at room temperature overnight. The mixture was diluted with water (50 ml) and then extracted with ethyl acetate (20 ml x 3). The combined organic layers were washed with saturated brine (20 ml x 1), dried over anhydrous sodium sulfate and concentrated. The residue was separated by column chromatography on silica gel (petroleum ether: ethyl acetate = 3: 1) to give the white solid product 1a-3 (3.80 g, yield: 88%). LCMS (ESI): m / z = 438 [M+1] +.

[0310] Preparation of compound 1a-4: To a mixture of compound 1a-3 (3.74 g, 8.55 mmol, 1.0 eq) in methanol (10 mL) was added a solution of hydrogen chloride-dioxane (4 mol / L, 15 mL). The mixture was stirred at room temperature for 1.5 hours. The solvent was removed under reduced pressure. The residue was dried under vacuum to give the product 1a-4 (2.92 g, crude) as a white solid. LCMS (ESI): m / z = 238 [M+1] + .

[0311] Preparation of Compound 1a-5: To a mixture of (S)-4-(tert-butoxy)-3-((tert-butoxycarbonyl)amino)-4-oxobutanoic acid (45 g, 155.54 mmol, 1.0 eq) and N-methylmorpholine (15.7 g, 155.54 mmol, 1.0 eq) in tetrahydrofuran (220 mL) was added dropwise isobutyl chloroformate (20.17 mL, 155.54 mmol, 1.0 eq) at -20°C. The mixture was stirred for 10 minutes and then filtered. To the filtrate was slowly added a solution of sodium borohydride (11.8 g, 311.08 mmol, 2.0 eq) in water (70 mL) at -30°C. The mixture was warmed to 0°C and stirred for 0.5 hours. The mixture was diluted with water (200 mL) and then extracted with ethyl acetate (100 mL x 3). The combined organic layers were washed with saturated brine (100 mL x 1), dried over anhydrous sodium sulfate and concentrated to give a colorless oil 1a-5 (43.67 g, crude product). LCMS (ESI): m / z = 276 [M+1] + .

[0312] Preparation of compound 1a-6: To a mixture of compound 1a-5 (42.8 g, 155.54 mmol, 1.0 eq) and sodium bicarbonate (39.2 g, 466.62 mmol, 3.0 eq) in dichloromethane (300 ml) was added Dess-Martin reagent (79.2 g, 186.65 mmol, 1.2 eq) at 0°C. The mixture was warmed to room temperature and stirred for 2 hours. The mixture was filtered. The filtrate was concentrated under reduced pressure. The residue was diluted with ethyl acetate (200 ml) and washed sequentially with saturated sodium thiosulfate solution (100 ml x 1), saturated sodium bicarbonate solution (100 ml x 1) and saturated brine (100 ml x 1), dried over anhydrous sodium sulfate and concentrated to give 1a-6 (40 g, crude) as a pale yellow oil. LCMS (ESI): m / z = 274 [M+1] + .

[0313] Preparation of compound 1a-7: A mixture of benzylamine (6.1 g, 57.01 mmol, 1.0 eq), compound 1a-6 (38 g, 139.2 mmol, 2.44 eq) and acetic acid (3.26 ml, 57.01 mmol, 1.0 eq) in methanol (200 ml) was stirred at room temperature for 10 minutes. The mixture was cooled to 0°C, and then sodium cyanoborohydride (12.53 g, 199.54 mmol, 3.5 eq) was slowly added. The mixture was warmed to room temperature and stirred overnight. The solvent was removed under reduced pressure, and the residue was diluted with water (150 ml). Solid sodium bicarbonate was added to adjust the pH to 9, and the aqueous layer was extracted with ethyl acetate (60 ml x 3). The combined organic layers were washed with saturated brine (50 ml x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was subjected to column chromatography on silica gel (petroleum ether:ethyl acetate = 50:1 to 5:1) to give a colorless oil 1a-7 (24.1 g, yield: 68%). LCMS (ESI): m / z 622 [M+1] + .

[0314] Preparation of compound 1a-8: To a mixture of compound 1a-7 (27.5 g, 44.23 mmol, 1.0 eq) and N,N-diisopropylethylamine (1.54 ml, 8.85 mmol, 0.2 eq) in acetonitrile (125 ml) was added dropwise 1-chloroethyl chloroformate (7.16 ml, 66.34 mmol, 1 eq) at 0°C. The mixture was warmed to room temperature and stirred for 2 hours. The solvent was removed under reduced pressure. The residue was diluted with methanol (20 ml). The mixture was heated to 63°C and stirred for 1.5 hours. The solvent was removed under reduced pressure, and the residue was diluted with dichloromethane (150 ml). The organic layer was washed with saturated sodium bicarbonate solution (30 ml x 1) and saturated brine (50 ml x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was subjected to column chromatography on silica gel (dichloromethane:methanol=200:1 to 20:1) to give a pale yellow oil 1a-8 (11.5 g, yield: 49%). LCMS (ESI): m / z=532 [M+1] + .

[0315] Preparation of compound 1a-9: To a mixture of compound 1a-8 (4.3 g, 22.7 mmol, 1.05 eq), 3-(tert-butyloxycarbonyl)amino)propionic acid (4.3 g, 22.7 mmol, 1.05 eq), and N,N-diisopropylethylamine (5.58 g, 43.24 mmol, 2.0 eq) in dichloromethane (70 ml) was added 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (9.84 g, 23.78 mmol, 1.1 eq). The mixture was stirred at room temperature for 2.5 hours. The solvent was removed under reduced pressure. The residue was separated by column chromatography on silica gel (petroleum ether:ethyl acetate = 4:1 to 2:1) to give the product 1a-9 (14.98 g, yield: 99%) as a light yellow solid. LCMS (ESI): m / z = 703 [M+1] + .

[0316] Preparation of compound 1a-10: A mixture of hydrogen chloride-dioxane (4 mol per liter, 90 ml) of compound 1a-9 (14.9 g, 21.19 mmol, 1.0 equivalent) was stirred at room temperature overnight. The solvent was removed under reduced pressure. The residue was dissolved in tetrahydrofuran (100 ml) and water (100 ml). Sodium carbonate (13.48 g, 127.14 mmol, 6.0 equivalent) and di-tert-butyl carbonate (24.36 ml, 105.95 mmol, 5.0 equivalent) were added. The mixture was stirred at room temperature for 48 hours. Tetrahydrofuran was removed under reduced pressure. The residue was diluted with water (200 ml) and then washed with dichloromethane (60 ml × 4). A 2 mol per liter dilute hydrochloric acid solution was added to the aqueous layer to adjust the pH to 3, and then extracted with ethyl acetate (60 ml × 4). The combined organic layers were washed with saturated brine (50 mL x 1), dried over anhydrous sodium sulfate, and concentrated to give a light yellow solid product 1a-10 (10.5 g, yield: 84%). LCMS (ESI): m / z = 592 [M+1] + .

[0317] Preparation of Compound 1a-11: To a mixture of 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (6.58 g, 15.9 mmol, 2.5 eq) in dichloromethane (570 mL) was added dropwise over 30 minutes at 0°C: Compound 1a-10 (3.76 g, 6.36 mmol, 1.0 eq), Compound 1a-4 (1.97 g, 6.36 mmol, 1.0 eq), and N,N-diisopropylethylamine (4.92 g, 38.16 mmol, 6.0 eq) in dichloromethane (60 mL). The mixture was allowed to warm to room temperature and stirred for 20 minutes. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium bicarbonate solution (50 mL) and then extracted with ethyl acetate (30 mL x 3). The combined organic layers were washed with saturated brine (50 mL x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was separated by column chromatography on silica gel (ethyl acetate:methanol = 50:1 to 30:1) to afford the product 1a-11 as a white solid (1.97 g, yield: 39%). LCMS (ESI): m / z = 792 [M+1] + .

[0318] Preparation of compound 1a-13: A mixture of 1a-11 (1.97 g, 2.49 mmol, 1.0 eq) in hydrogen chloride-dioxane (4 mol / L, 13 ml) was stirred at room temperature for 1.5 hours. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (60 ml). Compound 1a-12 (3.34 g, 7.47 mmol, 3.0 eq), N,N-diisopropylethylamine (2.57 g, 19.92 mmol, 8.0 eq) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3.03 g, 7.97 mmol, 3.2 eq) were added. The mixture was stirred at room temperature for 1.5 hours. The mixture was washed with saturated sodium bicarbonate solution (30 ml x 2) and saturated brine (30 ml x 1), dried over anhydrous sodium sulfate and concentrated. The residue was separated by column chromatography on silica gel (dichloromethane:methanol=30:1, supplemented with 1% triethylamine) to give a pale yellow solid product 1a-13 (3.43 g, yield: 77%). LCMS (ESI): m / z=1780 [M+1] + .

[0319] Preparation of compound 1a-14: To a mixture of compound 1a-13 (3.47 g, 1.95 mmol, 1.0 eq) and trifluoroacetic acid (0.15 ml, 1.95 mmol, 1.0 eq) in isopropanol (50 ml) and ethanol (25 ml) was added palladium hydroxide on carbon (10%, 0.69 g). The mixture was stirred at room temperature under hydrogen balloon pressure for 20 hours. The mixture was filtered. The filtrate was concentrated under reduced pressure to give the product 1a-14 (3.45 g, crude) as a white solid. LCMS (ESI): m / z = 1646 [M+1] + .

[0320] Preparation of Compound 1a-15 (Compound 31): To a mixture of Compound 1a-14 (1.0 g, 0.57 mmol, 1.0 eq), Compound 1a-2 (0.396 g, 0.63 mmol, 1.1 eq), and N,N-diisopropylethylamine (0.441 g, 3.42 mmol, 6.0 eq) in dichloromethane (15 ml) was added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.26 g, 0.68 mmol, 1.2 eq). The mixture was stirred at room temperature for 2.5 hours. The solvent was removed under reduced pressure. The residue was purified by preparative HPLC (A: pH 7 phosphate buffer, B: acetonitrile, acetonitrile concentration 50%-70% over 30 minutes) to give the product 1a-15 (Compound 31) as a white solid (0.45 g, yield: 35%). LCMS (ESI): m / z = 980 [(M-302+2) / 2] + .

[0321] Preparation of compound 1a-16: To a mixture of compound 1a-15 (130 mg, 0.058 mmol, 1.0 eq), triethylamine (70 mg, 0.696 mmol, 12.0 eq), and 4-dimethylaminopyridine (3.5 mg, 0.029 mmol, 0.5 eq) in dichloromethane (1 ml) was added succinic anhydride (34.5 mg, 0.348 mmol, 6.0 eq). The mixture was stirred at room temperature for 2 days. The mixture was diluted with dichloromethane (10 ml), then washed with saturated sodium bicarbonate solution (5 ml x 2) and saturated brine (5 ml x 1), dried over anhydrous sodium sulfate, and concentrated to give the product 1a-16 as a white solid (111 mg, yield: 81%). LCMS (ESI): m / z = 1030.5 [(M-302) / 2+H] + . 1H NMR(500MHz,DMSO)δ8.42–8.25(m,2H),8.06(t,J=25.8Hz,2H),7.89–7.70(m ,4H),7.30(dd,J=14.4,6.9Hz,4H),7.20(dd,J=10.1,6.9Hz,5H),6.93–6.84 (m,4H),6.58(d,J=5.9Hz,1H),5.76(s,1H),5.21(s,3H),4.97(d,J=13.1Hz, 3H),4.50(d,J=8.2Hz,3H),4.20(s,3H),4.02(s,9H),3.87(dd,J=18.8,9.5H z,3H),3.80–3.63(m,11H),3.41(d,J=8.7Hz,10H),3.24(s,2H),3.20–3.12( m,3H),3.03(dd,J=26.7,13.8Hz,3H),2.47(d,J=9.6Hz,3H),2.44–2.36(m,4 H),2.31–2.18(m,5H),2.11(d,J=10.6Hz,13H),2.07(s,2H),2.03(d,J=7.3H z,3H),1.99(s,9H),1.89(s,9H),1.77(s,12H),1.47(s,16H),1.25(s,11H).

[0322] Preparation of compound SL01-CPG: To a mixture of compound 1a-16 (111 mg, 0.047 mmol, 1.0 equiv) and N,N-diisopropylethylamine (36 mg, 0.282 mmol, 6.0 equiv) in N,N-dimethylformamide (5.5 ml) were added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (21 mg, 0.056 mmol, 1.2 equiv) and 1-hydroxybenzotriazole (9 mg, 0.066 mmol, 1.4 equiv). The mixture was shaken at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 550 mg, 0.092 mmol, 1.95 equiv) was added, and the mixture was shaken at room temperature for 22 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour. The residue was added with pyridine / acetic anhydride (3 ml / 1 ml) and shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane, and dried under vacuum for 1 hour to give the white solid product SL01-CPG (578 mg, loading: 35 μmol / g).

[0323] Example 16 Preparation of Intermediate M

[0324] To a mixture of 11-aminoundecanoic acid (5 g, 24.8 mmol, 1.0 eq) and triethylamine (2.5 g, 24.8 mmol, 1.0 eq) in methanol (50 mL) was added ethyl 2,2,2-trifluoroacetate (4.4 g, 31.0 mmol, 1.25 eq). The mixture was stirred at room temperature overnight. The methanol was removed under vacuum, the residue was dissolved in water, and the pH was adjusted to 1 to 2 with 1 M hydrochloric acid solution. The product was extracted with ethyl acetate, the organic phase was washed with saturated brine, and concentrated under vacuum to give the product 11-(2,2,2-trifluoroacetamido)undecanoic acid (Intermediate M-1, 6.16 g, yield: 83.4%) as a yellow oil. LCMS (ESI): m / z = 298 [M+H] + .

[0325] To a mixture of 11-(2,2,2-trifluoroacetamido)undecanoic acid (6.06 g, 20.4 mmol, 1.0 eq), (3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (8.55 g, 20.4 mmol, 1.0 eq) and N,N-diisopropylethylamine (7.8 g, 61.2 mmol, 3.0 eq) in N,N-dimethylformamide (60 ml) was added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.1 g, 21.4 mmol, 1.05 eq). The mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1 to 3 / 1, with 0.5% triethylamine added) to give the product N-(11-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-11-oxoundecyl)-2,2,2-trifluoroacetamide as a white solid (Intermediate M-2, 11.6 g, yield: 80.7%). LCMS (ESI): m / z = 699 [M+H] + .

[0326] A mixture of N-(11-((2S,4R)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxypyrrolidin-1-yl)-11-oxoundecyl)-2,2,2-trifluoroacetamide (11.6 g, 16.5 mmol, 1.0 eq) and potassium hydroxide (9.3 g, 165 mmol, 10.0 eq) in methanol (110 ml) was stirred at room temperature overnight. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 50 / 1, supplemented with 0.5% triethylamine) to give the intermediate M (9.24 g, yield: 92.4%) as a yellow oil. LCMS (ESI): m / z = 603 [M+H] + .

[0327] Example 17 Preparation of DL07-CPG

[0328] Preparation of compound 2b-2: A mixture of compound 2b-1 (22.02 g, 50.00 mmol, 1.0 eq), benzyl (2-aminoethyl)carbamate (9.71 g, 50.00 mmol, 1.0 eq), N,N-diisopropylethylamine (12.90 g, 10.00 mmol, 2.0 eq) and 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (21.72 g, 52.50 mmol, 1.05 eq) in N,N-dimethylformamide (250 ml) was stirred at room temperature for 30 minutes. The mixture was diluted with water and then filtered. The filter cake was washed with water. The filter cake was dried to give the crude product 2b-2 as a white solid. LCMS (ESI): m / z=617 [M+H] + . 1 H NMR (500MHz, DMSO) δ7.87(t,J=8.1Hz,3H),7.67(d,J=6.9Hz,2H),7.42(d,J=7.4Hz,2H),7.37–7.26(m,7H),7.19(d,J=4.7Hz,2H),6.84(d,J=7.2H z,1H),5.00(s,2H),4.34–4.15(m,3H),3.90(d,J=5.0Hz,1H),3.19–2.94 (m,6H),1.78(d,J=6.6Hz,1H),1.62(dd,J=13.1,6.6Hz,1H),1.37(s,9H).

[0329] Preparation of Compound 2b-3: A mixture of compound 2b-2 (crude) in piperidine / acetonitrile (50 mL / 200 mL) was stirred at room temperature for 1 hour. The mixture was filtered, the filtrate was concentrated, and the residue was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 20 / 1) to afford the product 2b-3 (15.0 g, yield: 76.14%) as a yellow solid. LCMS (ESI): m / z = 395 [M+H] + .

[0330] Preparation of compound 2b-4: A mixture of compound 2b-3 (7.80 g, 19.80 mmol, 1.5 eq), tert-butyl (2-bromoethyl)carbamate (2.96 g, 13.20 mmol, 1.0 eq) and potassium carbonate (3.64 g, 26.40 mmol, 2.0 eq) in N,N-dimethylformamide (80 ml) was stirred at room temperature overnight. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 50 / 1) to give the product 2b-4 (4.0 g, yield: 56.43%) as a colorless oil. LCMS (ESI): m / z = 538 [M+H] + . 1 H NMR (500MHz, DMSO) δ7.92(s,1H),7.42–7.28(m,5H),7.19(s,1H),6.93(d,J=7.3Hz,1H),6.75(s,1H),5.01(s,2H),3.95(d,J=5.4Hz ,1H),3.14(ddd,J=18.3,12.5,6.1Hz,2H),3.05(d,J=5.5Hz,4H),2.68–2.56(m,4H),1.79(s,1H),1.72–1.60(m,1H),1.37(s,18H).

[0331] Preparation of compound 2b-6: A mixture of compound 2b-4 (4.0 g, 7.45 mmol, 1.0 eq), compound 2b-5 (2.39 g, 7.08 mmol, 0.95 eq), N,N-diisopropylethylamine (1.92 g, 14.90 mmol, 2.0 eq), and 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (3.08 g, 7.45 mmol, 1.0 eq) in N,N-dimethylformamide (50 ml) was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 60 / 1) to give the white solid product 2b-6 (4.4 g, yield: 72.52%). LCMS (ESI): m / z=858[M+H] + . 1 H NMR(500MHz,DMSO)δ7.88(d,J=12.6Hz,1H),7.32(d,J=22.7Hz,10H),7.26– 7.13(m,2H),7.01–6.65(m,2H),5.25–5.03(m,2H),5.00(s,2H),4.10–3.96( m,1H),3.82(s,1H),3.17(d,J=43.7Hz,6H),3.03(d,J=22.8Hz,4H),2.43–2. 21(m,2H),2.03–1.86(m,1H),1.79(s,2H),1.63(s,1H),1.44–1.29(m,27H).

[0332] Preparation of compound 2b-7: A solution of compound 2b-6 (4.4 g, 5.13 mmol, 1.0 eq) in hydrogen chloride-dioxane (40 mL) was stirred at room temperature for 1 hour. The solvent was removed under vacuum. The residue was used directly in the next step without purification (crude product). LCMS (ESI): m / z = 557 [M+H] + .

[0333] Preparation of compound 2b-8: A mixture of 2b-7 (crude), N,N-diisopropylethylamine (6.60 g, 51.16 mmol, 10.0 eq), compound 1a-12 (7.10 g, 15.87 mmol, 3.1 eq), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (6.20 g, 16.31 mmol, 3.2 eq) in acetonitrile (70 ml) was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 50 / 1 to 25 / 1) to give the product 2b-8 (6.0 g, yield: 63.39%) as a yellow solid. LCMS (ESI): m / z=923 [M / 2+H] + .

[0334] Preparation of compound 2b-9: Under a hydrogen atmosphere, a mixture of compound 2b-8 (6.0 g, 3.25 mmol, 1.0 eq), palladium hydroxide / carbon (1.5 g, 25% mass fraction) and trifluoroacetic acid (371 mg, 3.25 mmol, 1.0 eq) in ethanol (100 ml) was stirred at room temperature overnight. The mixture was filtered through celite. The filter cake was washed with ethanol and the filtrate was concentrated. The residue was used directly in the next step without purification (5.0 g, yield: 94.93%). LCMS (ESI): m / z=811 [M / 2+H] + .

[0335] Preparation of compound 2b-10: To a mixture of 6-azidohexanoic acid (30 g, 190.8 mmol, 1.0 eq) and 1-hydroxypyrrolidine-2,5-dione (24 g, 210 mmol, 1.1 eq) in dichloromethane / N,N-dimethylformamide (270 / 30 ml) was added 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (40.2 g, 210 mmol, 1.1 eq) under nitrogen protection. The mixture was stirred at room temperature overnight. The dichloromethane was removed under vacuum, and 1 mol / L hydrochloric acid solution and methyl tert-butyl ether were added. The layers were separated, and the organic layer was washed with sodium bicarbonate solution and saturated brine. The organic phase was dried and concentrated under vacuum to give the product 2b-10 (46.8 g, yield: 96.8%) as a yellow oil. LCMS (ESI): m / z = 255 [M+1] + .

[0336] Preparation of Compound 2b-11: A mixture of Compound 2b-9 (5.0 g, 3.09 mmol, 1.0 eq), Compound 2b-10 (824 mg, 3.24 mmol, 1.05 eq), and N,N-diisopropylethylamine (1.19 g, 9.22 mmol, 3.0 eq) in acetonitrile (60 mL) was stirred at room temperature for 1 hour. The reaction was carried on to the next step without post-treatment. LCMS (ESI): m / z = 881 [M / 2+H] + .

[0337] Preparation of Compound 2b-12 (Compound 54): A mixture of Compound 2b-11 (crude), Intermediate M (2.04 g, 3.39 mmol, 1.1 eq), N,N-diisopropylethylamine (796 mg, 6.17 mmol, 2.0 eq), and 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (1.4 g, 3.39 mmol, 1.1 eq) in acetonitrile (60 mL) was stirred for 1 hour. The mixture was directly purified by HPLC (UniSil 10-120C18 column, 30×250 mm) to give the product 2b-12 (Compound 54) as a white solid (3.1 g, yield: 42.79%). LCMS (ESI): m / z = 1022 [(M-302) / 2+H] + . 1 H NMR (500MHz, DMSO) δ8.04–7.72(m,9H),7.30(dd,J=17.9,8.1Hz,4H),7.23–7.10(m,5H),6.93–6.81(m,4H),5.76(s,1H),5.21(d,J=2.3Hz,3H) ,5.02–4.83(m,4H),4.49(d,J=8.2Hz,3H),4.15(s,3H),4.02(s,9H),3. 87(q,J=9.5Hz,3H),3.72(d,J=12.9Hz,9H),3.41(s,3H),3.29(d,J=6.8 Hz,2H),3.07(ddd,J=23.5,22.3,17.2Hz,14H),2.22(dd,J=22.2,15.1Hz,4H),2.11(d,J=13.0Hz,13H),2.04(dd,J=14.3,6.9Hz,5H),1.99(s,1 0H),1.89(s,9H),1.84(d,J=13.3Hz,3H),1.77(s,9H),1.68(d,J=35.4H z,2H),1.50(dd,J=14.8,7.4Hz,19H),1.35(s,3H),1.30–1.18(m,13H).

[0338] Preparation of compound 2b-13: A mixture of compound 2b-12 (3.1 g, 1.32 mmol, 1.0 eq), succinic anhydride (793 mg, 7.93 mmol, 6.0 eq), triethylamine (1.60 g, 15.84 mmol, 12.0 eq) and 4-dimethylaminopyridine (16 mg, 0.13 mmol, 0.1 eq) in dichloromethane (25 ml) was stirred at room temperature for 6 hours. The mixture was washed with 10% sodium bicarbonate solution and acetonitrile. The organic phase was concentrated to give the product 2b-13 (3.4 g, crude) as a light purple solid. LCMS (ESI): m / z=1072[(M-302) / 2+H] + .

[0339] Preparation of compound DL07-CPG: To a solution of compound 2b-13 (300 mg, 0.12 mmol, 1.0 equiv) in N,N-dimethylformamide were added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (56 mg, 0.15 mmol, 1.2 equiv), 1-hydroxybenzotriazole (23 mg, 0.17 mmol, 1.4 equiv), and N,N-diisopropylethylamine (63 mg, 0.49 mmol, 4.0 equiv). The mixture was shaken at room temperature for 5 minutes. 1.5 g of CPG-NH2 was added to the mixture, and the mixture was shaken at room temperature overnight. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour. The residue was added with pyridine / acetic anhydride (12 ml / 4 ml) and shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane, and dried under vacuum for 1 hour to obtain the light yellow solid product DL07-CPG (1.61 g, loading: 41.1 μmol / g).

[0340] Example 18 Preparation of DL09-CPG

[0341] Preparation of compound 4a-2: Under nitrogen protection, a mixture of compound 4a-1 (10 g, 62 mmol, 1.0 eq), compound 2b-10 (17 g, 68 mmol, 1.1 eq) and N,N-diisopropylethylamine (18 g, 136 mmol, 2.2 eq) in acetonitrile (100 ml) was stirred at room temperature overnight. The acetonitrile was removed under vacuum, and 1 mol / L hydrochloric acid solution and methyl tert-butyl ether were added. The layers were separated, and the organic layer was washed with water and saturated brine. The organic phase was dried and concentrated under vacuum to give the product 4a-2 (18.5 g, yield: 99.4%) as a yellow oil. LCMS (ESI): m / z = 301 [M+1] + .

[0342] Preparation of compound 4a-3: To a mixture of compound 4a-2 (18.5 g, 61.5 mmol, 1.0 eq), tert-butyl 3-(2-aminoethoxy)propionate (11.6 g, 61.5 mmol, 1.0 eq) and N,N-diisopropylethylamine (17.4 g, 135.2 mmol, 2.0 eq) in N,N-dimethylformamide (180 ml) was added 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (28 g, 67.6 mmol, 1.1 eq). The mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: petroleum ether / ethyl acetate = 2 / 1 to dichloromethane / methanol = 20 / 1) to give the product 4a-3 as a white solid (14.8 g, yield: 51.4%). LCMS (ESI): m / z = 472 [M+1] + .

[0343] Preparation of compound 4a-4: A mixture of compound 4a-3 (8.86 g, 20.7 mmol, 1.0 eq) in trifluoroacetic acid / dichloromethane (10 / 50 ml) was stirred at room temperature for 5.0 hours. The mixture was concentrated under vacuum to give the product 4a-4 (8 g, crude) as a yellow oil. LCMS (ESI): m / z = 416 [M+1] + .

[0344] Preparation of compound 4a-5: To a mixture of compound 4a-4 (8.86 g, 18.7 mmol, 1.0 eq), (3R,5S)-5-(bis(4-methoxyphenyl)(phenyl)methoxy)methyl)pyrrolidin-3-ol (7.8 g, 18.7 mmol, 1.0 eq) and N,N-diisopropylethylamine (9.6 g, 75 mmol, 4.0 eq) in N,N-dimethylformamide (90 ml) was added 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (8.1 g, 19.7 mmol, 1.1 eq). The mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine and concentrated under vacuum. The residue was purified by silica gel column chromatography (eluent: petroleum ether / dichloromethane / methanol = 50 / 50 / 1 to 30 / 30 / 1) to give product 4a-5 as a white solid (7.5 g, yield: 49%). LCMS (ESI): m / z = 817 [M+1] + .

[0345] Preparation of compound 4a-6: A mixture of compound 4a-5 (7.5 g, 9.19 mmol, 1.0 eq) and lithium hydroxide monohydrate (1.1 g, 27.5 mmol, 3.0 eq) in tetrahydrofuran / methanol / water (60 / 30 / 30 ml) was stirred at room temperature overnight. The mixture was diluted with water and washed with methyl tert-butyl ether. The aqueous phase was extracted with dichloromethane. The organic phase was concentrated under vacuum to give the product 4a-6 as a pale white solid (4.68 g, yield: 63.4%). LCMS (ESI): m / z = 801 [M-1] - .

[0346] Preparation of compound 4a-7 (compound 53): To a mixture of compound 1a-14 (570 mg, 0.32 mmol, 1.0 eq), compound 4a-6 (260 mg, 0.32 mmol, 1.0 eq), and N,N-diisopropylethylamine (146 mg, 1.13 mmol, 3.5 eq) in N,N-dimethylformamide (2.5 ml) was added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (148 mg, 0.39 mmol, 1.2 eq). The mixture was stirred at room temperature overnight. The mixture was purified by preparative HPLC (A: pH 7 phosphate buffer, B: acetonitrile, acetonitrile concentration 30%-90% over 30 minutes) to give the product 4a-7 (compound 53) as a white solid (245 mg, yield: 31%). LCMS(ESI): m / z=1065[(M-302+2) / 2] + .

[0347] Preparation of compound 4a-8: To a mixture of compound 4a-7 (245 mg, 0.10 mmol, 1.0 eq), triethylamine (121 mg, 1.2 mmol, 12.0 eq) and 4-dimethylaminopyridine (12 mg, 0.10 mmol, 1.0 eq) in dichloromethane (2 ml) was added succinic anhydride (60.5 mg, 0.60 mmol, 6.0 eq). The mixture was stirred at room temperature for 20 hours. The mixture was diluted with dichloromethane (10 ml), then washed with saturated sodium bicarbonate solution (10 ml x 2) and saturated brine (10 ml x 1), dried over anhydrous sodium sulfate and concentrated to give the product 4a-8 as a white solid (275 mg, crude product). LCMS (ESI): m / z = 1115 [(M-302+2) / 2] + .

[0348] Preparation of compound DL09-CPG: To a mixture of compound 4a-8 (253 mg, 0.10 mmol, 1.0 eq) and N,N-diisopropylethylamine (77 mg, 0.60 mmol, 6.0 eq) in N,N-dimethylformamide (10 ml) were added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (57 mg, 0.15 mmol, 1.5 eq) and 1-hydroxybenzotriazole (20 mg, 0.15 mmol, 1.5 eq). The mixture was shaken at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 1.27 g, 0.21 mmol, 2.1 eq) was added, and the mixture was shaken at room temperature for 22 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour. The residue was added with pyridine / acetic anhydride (12 ml / 4 ml) and shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour to give DL09-CPG (1.36 g, loading: 30 μmol / g) as a white solid.

[0349] Example 19 Preparation of DL15-CPG

[0350] Preparation of compound 15a-1: To a mixture of compound 10a-5 (6.0 g, 14.7 mol, 1.5 eq) and tert-butyl (2-bromoethyl)carbamate (2.2 g, 9.8 mmol, 1.0 eq) in 30 ml of dimethylformamide was added potassium carbonate (5.07 g, 36.75 mmol, 2.5 eq) at room temperature and stirred overnight. The mixture was diluted with ethyl acetate and washed with water and saturated brine. The organic phase was concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 30 / 1 to 10 / 1, with aqueous ammonia) to give compound 15a-1 (3.29 g, yield: 60.8%) as a white solid. LCMS (ESI): m / z = 552 (M+H) + .

[0351] Preparation of compound 15a-2: Compound 15a-1 (1.7 g, 3.08 mmol, 1.0 eq), compound 10a-2 (3.2 g, 9.97 mmol, 3.2 eq), acetic acid (185 mg, 3.08 mmol, 1.0 eq) and sodium cyanoborohydride (626 mg, 9.97 mmol, 3.2 eq) were added to 24 ml of methanol. The mixture was stirred at room temperature for 96 hours, concentrated under reduced pressure, and sodium carbonate solution was added, and extracted with ethyl acetate. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 40 / 1 to 10 / 1, with addition of aqueous ammonia) to give compound 15a-2 (1.72 g, yield: 54.0%) as a white solid. LCMS (ESI): m / z = 857.5 (M+H) + .

[0352] Preparation of compound 15a-3: Compound 15a-2 (1.72 g, 2.01 mmol, 1.0 eq) was added to 20 mL of a 4 M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to give compound 15a-3 (1.57 g, crude product). LCMS (ESI): m / z = 557 (M+H) + .

[0353] Preparation of compound 15a-4: Crude compound 15a-3 (1.57 g, 2.01 mmol, 1.0 eq), compound 1a-12 (2.87 g, 6.41 mol, 3.2 eq), diisopropylethylamine (2.58 g, 20.1 mmol, 10.0 eq), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2.87 g, 6.41 mmol, 3.2 eq) were added to 35 ml of acetonitrile, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 40 / 1 to 15 / 1, with triethylamine added) to obtain compound 15a-4 (2.01 g, yield: 54.1%) as a white solid. LCMS (ESI): m / z=1845 (M+H) + .

[0354] Preparation of compound 15a-5: Compound 15a-4 (2.0 g, 1.08 mmol, 1.0 eq) was dissolved in 45 mL of ethanol, and trifluoroacetic acid (160 mg, 1.41 mmol, 1.3 eq) and 300 mg of 10% palladium hydroxide on carbon were added. The mixture was stirred at room temperature overnight under a hydrogen atmosphere. The mixture was filtered through celite, and the filtrate was concentrated under reduced pressure to afford compound 15a-5 (2.0 g, crude) as a white solid. LCMS (ESI): m / z = 1621 (M+H) + .

[0355] Preparation of compound 15a-6: Compound 15a-5 (2.0 g, 1.08 mmol, 1.0 eq), diisopropylethylamine (418 mg, 3.24 mmol, 3.0 eq), and compound 2b-10 (307 mg, 1.21 mmol, 1.12 eq) were added to 15 mL of acetonitrile, and the mixture was stirred at room temperature for 1.5 hours. Diisopropylethylamine (209 mg, 1.62 mmol, 1.5 eq), 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (538 mg, 1.30 mmol, 1.2 eq), and intermediate M (783 mg, 1.30 mmol, 1.2 eq) were added, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: pH 7.0 potassium dihydrogen phosphate-potassium hydroxide buffer solution / acetonitrile) to give compound 15a-6 as a white solid (1.81 g, yield: 37.1%). LCMS (ESI): m / z = 1022 ((M-302) / 2+H) + .

[0356] Preparation of compound 15a-7: Under nitrogen, compound 15a-6 (300 mg, 0.128 mmol, 1.0 eq), triethylamine (155 mg, 1.54 mmol, 12.0 eq), succinic anhydride (77 mg, 0.768 mmol, 6.0 eq) and p-dimethylaminopyridine (1.6 mg, 0.013 mmol, 0.1 eq) were added to 1.5 ml of dichloromethane, and the mixture was stirred at room temperature overnight. The mixture was diluted with dichloromethane / acetonitrile and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give compound 15a-7 (375 mg, crude) as a white solid. LCMS (ESI): m / z = 1072 ((M-302) / 2+H) + .

[0357] Preparation of Compound DL15-CPG: Compound 15a-7 (375 mg, 0.128 mmol, 1.0 equiv), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (68 mg, 0.179 mmol, 1.4 equiv), 1-hydroxybenzotriazole (28 mg, 0.205 mmol, 1.6 equiv), and diisopropylethylamine (76 mg, 0.59 mmol, 4.6 equiv) were added to 13 mL of dimethylformamide, and the mixture was stirred at room temperature for 5 minutes. 1.735 g of CPG-NH2 was added, and the mixture was shaken at room temperature overnight. The mixture was filtered, and the solid phase was washed with dichloromethane and acetonitrile and dried under reduced pressure. 10 mL of pyridine and 3.4 mL of acetic anhydride were added, and the mixture was shaken for 3 hours. The solid phase was filtered, washed with dichloromethane and acetonitrile, and dried under reduced pressure to obtain a yellow solid compound DL15-CPG (1.39 g, 37.5 μmol / g).

[0358] Example 20 Preparation of DL16-CPG

[0359] Preparation of compound 16a-1: To a mixture of compound 2b-3 (3.2 g, 8.1 mmol, 1.0 eq) and N,N-diisopropylethylamine (2.0 g, 16.2 mmol, 2.0 eq) in tetrahydrofuran (40 ml) was added dropwise a solution of 2,4-dinitrobenzenesulfonyl chloride (2.6 g, 9.7 mmol, 1.2 eq) in tetrahydrofuran (10 ml) under nitrogen protection and ice-bath conditions. The mixture was stirred on ice for 1 hour. Ethyl acetate was added to the mixture, and the mixture was washed with water, dilute hydrochloric acid, aqueous sodium bicarbonate solution, brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give 16a-1 (6.0 g, crude) as a brown solid. LCMS (ESI): m / z = 582 [M+H] + .

[0360] Preparation of compound 16a-2: Compound 16a-1 (1 g, 1.6 mmol, 1.0 eq), (tert-butyloxycarbonyl)-L-homoserine benzyl ester (1.24 g, 4.0 mmol, 2.5 eq), and triphenylphosphine (1.26 g, 4.8 mmol, 3.0 eq) were added to 30 ml of toluene and stirred at room temperature for 5 minutes. Diethyl azodicarboxylate (0.835 g, 4.8 mmol, 3.0 eq) was added dropwise under an ice bath, and the mixture was stirred at room temperature for 2 hours. The mixture was filtered. The residue was dissolved in 30 ml of dichloromethane, and 30 ml of petroleum ether was added. The mixture was stirred at room temperature for 1 hour. The mixture was filtered. The residue was washed with dichloromethane / petroleum ether (1 / 1). Drying gave compound 16a-2 (1.42 g, yield: 96.59%) as a yellow solid. LCMS (ESI): m / z=916 (M+H) + .

[0361] Preparation of compound 16a-3: Compound 16a-2 (1.6 g, 1.75 mmol, 1.0 eq) and triethylamine (530 mg, 5.25 mmol, 3.0 eq) were added to 10 ml of dichloromethane. 2-Mercaptoacetic acid (322 mg, 3.5 mmol, 2.0 eq) was added, and the mixture was stirred at room temperature for 10 minutes. Ethyl acetate was added for extraction. The organic phase was washed with aqueous sodium carbonate solution and saturated brine. Concentration under reduced pressure was performed to obtain compound 16a-3 (1.2 g, crude) as a yellow oil. LCMS (ESI): m / z = 686 (M+H) + .

[0362] Preparation of compound 16a-4: Compound 16a-3 (1.2 g, 1.75 mmol, 1.0 eq), 3-(tert-butyloxycarbonyl)amino)propionic acid (331 mg, 1.75 mmol, 1.0 eq), diisopropylethylamine (451 mg, 3.5 mmol, 2.0 eq), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (798 mg, 2.1 mmol, 1.2 eq) were added to 30 ml of dichloromethane, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 25 / 1 to 10 / 1, with the addition of triethylamine) to obtain compound 16a-4 (740 mg, yield: 49.33%) as a white solid. LCMS (ESI): m / z=858 (M+H) + .

[0363] Preparation of compound 16a-5: Compound 16a-4 (740 mg, 0.86 mmol, 1.0 eq) was added to 5 mL of a 4 M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to give compound 16a-5 (482 mg, crude) as a yellow solid. LCMS (ESI): m / z = 557 (M+H) + .

[0364] Preparation of compound 16a-6: Compound 16a-5 (482 mg, 0.86 mmol, 1.0 eq), compound 1a-12 (1.2 g, 2.68 mmol, 3.1 eq), diisopropylethylamine (1.12 g, 8.64 mmol, 10.0 eq), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.05 g, 2.76 mmol, 3.2 eq) were added to 10 ml of acetonitrile, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 25 / 1 to 10 / 1, with triethylamine added) to obtain compound 16a-6 (879 mg, yield: 55.28%) as a white solid. LCMS (ESI): m / z=1844 (M+H) + .

[0365] Preparation of compound 16a-7: Compound 16a-6 (879 mg, 0.476 mmol, 1.0 eq) was dissolved in 5 mL of ethanol, and trifluoroacetic acid (54 mg, 0.476 mmol, 1.0 eq) and 88 mg of 10% palladium hydroxide on carbon were added. The mixture was stirred at room temperature overnight under a hydrogen atmosphere. The mixture was filtered through celite, and the filtrate was concentrated under reduced pressure to obtain compound 16a-7 (800 mg, crude) as a white solid. LCMS (ESI): m / z = 1621 (M+H) + .

[0366] Preparation of compound 16a-8 (compound 65): Compound 16a-7 (800 mg, 0.476 mmol, 1.0 eq), diisopropylethylamine (184 mg, 1.428 mmol, 3 eq), and compound 2b-10 (133 mg, 0.523 mmol, 1.1 eq) were added to 10 mL of acetonitrile, and the mixture was stirred at room temperature for 1.5 hours. Diisopropylethylamine (184 mg, 1.428 mmol, 3 eq), 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (236 mg, 0.57 mmol, 1.2 eq), and intermediate M (343 mg, 0.57 mmol, 1.2 eq) were added, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate was added for extraction. The organic phase was washed with water and saturated brine and concentrated to dryness under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: pH 7.0 potassium dihydrogen phosphate-potassium hydroxide buffer solution / acetonitrile) to give a yellow solid compound 16a-8 (343 mg, yield: 30.90%). LCMS (ESI): m / z = 1022 ((M-302) / 2+H) + .

[0367] Preparation of compound 16a-9: Compound 16a-8 (343 mg, 0.146 mmol, 1.0 eq), triethylamine (177 mg, 1.752 mmol, 12.0 eq), succinic anhydride (88 mg, 0.878 mmol, 6.0 eq) and p-dimethylaminopyridine (2 mg, 0.014 mmol, 0.1 eq) were added to 5 ml of dichloromethane, and the mixture was stirred at room temperature overnight. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give compound 16a-9 (396 mg, crude) as a yellow solid. LCMS (ESI): m / z = 1072 ((M-302) / 2+H) + .

[0368] Preparation of Compound DL16-CPG: Compound 16a-9 (396 mg, 0.162 mmol, 1.0 equiv), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (74 mg, 0.194 mmol, 1.2 equiv), 1-hydroxybenzotriazole (30 mg, 0.226 mmol, 1.4 equiv), and diisopropylethylamine (84 mg, 0.648 mmol, 4.0 equiv) were added to 10 mL of dimethylformamide, and the mixture was stirred at room temperature for 5 minutes. 1.58 g of CPG-NH2 was added, and the mixture was shaken at room temperature overnight. The mixture was filtered, and the solid phase was washed with dichloromethane and acetonitrile and dried under reduced pressure. 9 mL of pyridine and 3 mL of acetic anhydride were added, and the mixture was shaken for 3 hours. The solid phase was filtered, washed with dichloromethane and acetonitrile, and dried under reduced pressure to obtain a yellow solid compound DL16-CPG (1.68 g, loading: 45.7 μmol / g).

[0369] Example 21 Preparation of DL18-CPG

[0370] Preparation of compound 18a-2: To a mixture of compound 18a-1 (4.0 g, 43.96 mmol, 1.0 eq) and potassium carbonate (18.2 g, 131.88 mmol, 3.0 eq) in ethanol (40 ml) was added benzyl bromide (13.1 ml, 109.89 mmol, 2.5 eq). The mixture was heated to reflux for 3 hours. The solvent was removed under reduced pressure. The residue was diluted with water (60 ml) and then extracted with dichloromethane (50 ml x 2). The combined organic layers were washed with saturated brine (50 ml x 1), dried over anhydrous sodium sulfate and concentrated. The residue was subjected to column chromatography on silica gel (dichloromethane: methanol 80: 1) to obtain compound 18a-2 (9.89 g, yield: 83%) as a white solid. LCMS (ESI): m / z 272 [M+1] +; TLC: Rf 0.5 (dichloromethane:methanol ester=50:1).

[0371] Preparation of compound 18a-3: Sodium hydroxide (15 g, 375 mmol, 15 eq) was added to a mixture of compound 18a-2 (6.7 g, 24.72 mmol, 1.0 eq), tert-butyl bromoacetate (28.78 g, 147.55 mmol, 6.0 eq) and tetrabutylammonium hydrogensulfate (1.26 g, 3.71 mmol, 0.15 eq) in water (50 ml) and toluene (65 ml). The mixture was heated to 50°C and reacted for 40 hours. The mixture was diluted with water (50 ml) and then extracted with dichloromethane (50 ml x 2). The combined organic layers were washed with saturated brine (50 ml x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was subjected to column chromatography on silica gel (petroleum ether: ethyl acetate 50:1) to obtain compound 18a-3 (3.61 g, yield: 29%) as a colorless oil. LCMS (ESI): m / z 500[M+1] + ; TLC: Rf 0.5 (petroleum ether:ethyl acetate=30:1).

[0372] Preparation of compound 18a-4: A mixture of compound 18a-3 (3.73 g, 7.46 mmol, 1.0 eq) in hydrogen chloride-dioxane (4M, 20 ml) was stirred at room temperature overnight. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (40 ml). Ammonium chloride (2.39 g, 44.76 mmol, 6.0 eq), N, N-diisopropylethylamine (7.7 g, 59.68 mmol, 8.0 eq) and 2-(7-azabenzotriazole)-N, N, N', N'-tetramethyluronium hexafluorophosphate (8.51 g, 22.38 mmol, 3.0 eq) were added. The mixture was stirred at room temperature for 7 hours. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium carbonate solution (50 ml) and then extracted with ethyl acetate (20 ml × 3). The combined organic layers were washed with saturated brine (30 mL x 1), dried over anhydrous sodium sulfate and concentrated to give compound 18a-4 (3.5 g, crude) as a pale yellow oil. LCMS (ESI): m / z 386 [M+1] + ; TLC: Rf 0.5 (dichloromethane:methanol=20:1).

[0373] Preparation of compound 18a-5: Borane dimethyl sulfide complex (10M, 5.97 mL, 59.7 mmol, 8.0 eq) was added to a mixture of compound 18a-4 (2.87 g, 7.46 mmol, 1.0 eq) in tetrahydrofuran (40 mL). The mixture was heated to 65°C for 5 hours. The mixture was quenched with water (25 mL). Sodium carbonate (2.37 g, 22.38 mmol, 3.0 eq) and di-tert-butyl dicarbonate (4.88 g, 22.38 mmol, 3.0 eq) were added. The mixture was stirred at room temperature for 3 hours. The mixture was diluted with water (50 mL) and then extracted with ethyl acetate (30 mL, × 2). The combined organic layers were washed with saturated brine (30 mL × 1), dried over anhydrous sodium sulfate and concentrated. The residue was separated by column chromatography on silica gel (petroleum ether:ethyl acetate 8:1 to 3:1) to give compound 18a-5 (741 mg, yield: 18%) as a pale yellow oil. LCMS (ESI): m / z 558 [M+1] + ; TLC: Rf 0.5 (petroleum ether:ethyl acetate=5:1).

[0374] Preparation of compound 18a-6: To a mixture of compound 18a-5 (741 mg, 1.33 mmol, 1.0 eq) in methanol (2 mL) was added a 4 M hydrogen chloride-dioxane solution (5 mL). The mixture was stirred at room temperature for 1 hour. The solvent was removed under reduced pressure. The residue was dried under vacuum to obtain crude compound 18a-6 as a white solid. LCMS (ESI): m / z 358 [M+1] + ; TLC: Rf 0.2 (dichloromethane:methanol=10:1).

[0375] Preparation of compound 18a-7: To a mixture of 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (1.38 g, 3.33 mmol, 2.5 eq) in dichloromethane (85 mL) was added dropwise over 30 minutes of a solution of compound 1a-10 (786 mg, 1.33 mmol, 1.0 eq), compound 18a-6 (616 mg, 1.33 mmol, 1.0 eq) and N,N-diisopropylethylamine (1.03 g, 7.98 mmol, 6.0 eq) in dichloromethane (15 mL) at 0°C. The mixture was allowed to warm to room temperature and stirred for 20 minutes. The solvent was removed under reduced pressure. The residue was diluted with saturated sodium carbonate solution (30 mL) and then extracted with ethyl acetate (20 mL x 3). The combined organic layers were washed with saturated brine (20 mL x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was subjected to column chromatography on silica gel (ethyl acetate:methanol 50:1 to 30:1) to give compound 18a-7 as a white solid (0.42 g, yield: 35%). LCMS (ESI): m / z 911 [M+1]+ ; TLC: Rf 0.3 (ethyl acetate:dichloromethane=1:1).

[0376] Preparation of compound 18a-8: A mixture of compound 18a-7 (0.42 g, 0.46 mmol, 1.0 eq) in hydrogen chloride-dioxane (4 M, 4 mL) was stirred at room temperature for 1 hour. The solvent was removed under reduced pressure. The residue was diluted with dichloromethane (10 mL). Compound 1a-12 (618 mg, 1.38 mmol, 3.0 eq), N,N-diisopropylethylamine (475 mg, 3.68 mmol, 8.0 eq) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (525 mg, 1.38 mmol, 3.0 eq) were added. The mixture was stirred at room temperature for 1 hour. The mixture was diluted with dichloromethane (20 mL), washed with saturated sodium bicarbonate solution (20 mL x 2) and saturated brine (20 mL x 1), dried over anhydrous sodium sulfate, and concentrated. The residue was separated by column chromatography on silica gel (dichloromethane:methanol:triethylamine 30:1:0.3) to give compound 18a-8 as a white solid (778 mg, yield: 89%). LCMS (ESI): m / z 1900 [M+1] + ; TLC: Rf 0.5 (dichloromethane:methanol=10:1).

[0377] Preparation of compound 18a-9: To a mixture of compound 18a-8 (778 mg, 0.409 mmol, 1.0 eq) and trifluoroacetic acid (47 mg, 0.409 mmol, 1.0 eq) in methanol (10 ml) and ethanol (5 ml) was added palladium hydroxide on carbon (10%, 0.5 g). The mixture was stirred at room temperature overnight under hydrogen balloon pressure. The mixture was filtered. The filtrate was concentrated under reduced pressure to give compound 18a-9 (600 mg, crude) as a pale yellow solid. LCMS (ESI): m / z 1720 [M+1] + ; TLC: Rf 0.3 (dichloromethane:methanol=10:1).

[0378] Preparation of compound 18a-10: To a mixture of compound 18a-9 (600 mg, 0.33 mmol, 1.0 eq), compound 4a-6 (265 mg, 0.33 mmol, 1.0 eq), and N,N-diisopropylethylamine (255 mg, 1.98 mmol, 6.0 eq) in N,N-dimethylformamide (2 ml) was added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (188 mg, 0.495 mmol, 1.5 eq). The mixture was stirred at room temperature for 0.5 h. The mixture was purified by preparative liquid chromatography (A: pH 7 phosphate buffer, B: acetonitrile, acetonitrile concentration 30%-90% over 30 min) to afford compound 18a-10 (180 mg, yield: 22%) as a white solid. LCMS(ESI): m / z 1102[(M-302+2) / 2] + ; TLC: Rf 0.5 (dichloromethane:methanol=10:1).

[0379] Preparation of compound 18a-11: To a mixture of compound 18a-10 (180 mg, 0.072 mmol, 1.0 eq), triethylamine (87 mg, 0.862 mmol, 12.0 eq) and 4-dimethylaminopyridine (4.4 mg, 0.036 mmol, 0.5 eq) in dichloromethane (2 ml) was added succinic anhydride (43 mg, 0.43 mmol, 6.0 eq). The mixture was stirred at room temperature for 20 hours. The mixture was diluted with dichloromethane (10 ml), then washed with saturated sodium bicarbonate solution (10 ml x 2) and saturated brine (10 ml x 1), dried over anhydrous sodium sulfate, and concentrated to give compound 18a-11 (155 mg, yield: 83%) as a white solid. LCMS (ESI): m / z 1152 [(M-302+2) / 2] + ; TLC: Rf 0.3 (dichloromethane:methanol=10:1).

[0380] Preparation of compound DL18-CPG: To a mixture of compound 18a-11 (155 mg, 0.06 mmol, 1.0 eq) and N,N-diisopropylethylamine (46 mg, 0.36 mmol, 6.0 eq) in N,N-dimethylformamide (8 ml) were added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (34 mg, 0.09 mmol, 1.5 eq) and 1-hydroxybenzotriazole (12 mg, 0.09 mmol, 1.5 eq). The mixture was stirred at room temperature for 5 minutes. CPG-NH2 (0.167 mmol / g, 775 mg, 0.13 mmol, 2.2 eq) was added. The mixture was stirred at room temperature overnight. The mixture was filtered. The solid was washed with dichloromethane (8 ml x 5). Pyridine (6 ml) and acetic anhydride (2 ml) were added. The mixture was stirred at room temperature for 3 hours. The mixture was filtered. The solid was washed with dichloromethane (8 mL x 5) and dried under vacuum to give a white solid compound DL18-CPG (785 mg, 21.5 μmol / g, yield: 29%).

[0381] Example 22 Preparation of DL20-CPG

[0382] Preparation of compound 20a-1: Di-tert-butyl dicarbamate (5.0 g, 16.48 mmol, 1.00 eq), ethyl 2-bromoacetate (3.1 g, 18.13 mmol, 1.1 eq), and potassium carbonate (4.5 g, 32.96 mmol, 2.0 eq) were reacted in N,N-dimethylformamide (40 ml) at room temperature overnight. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to give the product 20a-1 (6.4 g, crude) as a yellow oil. LCMS (ESI): m / z = 390 [M+H] + .

[0383] Preparation of compound 20a-2: Compound 20a-1 (6.2 g, 15.94 mmol, 1.0 eq) and lithium hydroxide monohydrate (1.6 g, 39.85 mmol, 2.5 eq) in tetrahydrofuran + methanol + aqueous solution (40 ml + 10 ml + 10 ml) were stirred at 40°C for 2.5 hours. Water was added to the mixture, and the pH was adjusted to 5 by adding 2 M dilute hydrochloric acid. The aqueous phase was extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to give compound 20a-2 (5.1 g, crude product). LCMS (ESI): m / z = 362 [M+H] + .

[0384] Preparation of compound 20a-3: Compound 2b-2 (13.6 g, 22.05 mmol, 1.00 equiv) was reacted in a trifluoroacetic acid / dichloromethane solution (50 ml / 100 ml) at room temperature for 1 hour. The mixture was spin-dried. The residue was adjusted to pH 8 by adding water. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to afford product 20a-3 as a white solid (6.1 g, yield: 53.6%). LCMS (ESI): m / z = 517 [M+H] + .

[0385] Preparation of compound 20a-4: Compound 20a-2 (4.3 g, 11.82 mmol, 1.0 equiv), compound 20a-3 (6.1 g, 11.82 mmol, 1.0 equiv), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (5.4 g, 14.18 mmol, 1.2 equiv), and diisopropylethylamine (3.1 g, 23.04 mmol, 2.0 equiv) were stirred in N,N-dimethylformamide (50 mL) at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The residue was stirred with dichloromethane / petroleum ether = 1:1. The mixture was filtered to give compound 20a-4 (10 g, crude) as a yellow solid. LCMS (ESI): m / z = 861 [M+H] + .

[0386] Preparation of compound 20a-5: A solution of compound 20a-4 (9.5 g, 11.05 mmol, 1.0 eq) in diethylamine / acetonitrile (20 / 80 ml) was stirred at room temperature for 1 hour. The mixture was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 10 / 1) to give the product 20a-5 (5.1 g, yield: 72.5%) as a yellow solid. LCMS (ESI): m / z = 638 [M+H] + .

[0387] Preparation of compound 20a-6: To a solution of (tert-butyloxycarbonyl)-L-homoserine benzyl ester (2.3 g, 7.44 mmol, 1.0 eq) in tetrahydrofuran (30 mL) was added Dess-Martin reagent (4.7 g, 11.17 mmol, 1.5 eq) at 0°C. The mixture was stirred at room temperature for 2 hours. The mixture was quenched with saturated sodium thiosulfate solution and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to give the product 20a-6 (3.5 g, crude) as a yellow oil. LCMS (ESI): m / z = 308 [M+H] + .

[0388] Preparation of compound 20a-7: A methanol solution (50 ml) of compound 20a-5 (3.65 g, 5.72 mmol, 1.0 eq), compound 20a-6 (1.8 g, 6.01 mmol, 1.05 eq), and acetic acid (343 mg, 5.72 mmol, 1.0 eq) was stirred at room temperature for 30 minutes. Sodium cyanoborohydride was added at 0°C. The mixture was stirred at room temperature for 1.5 hours. The mixture was quenched with water and extracted with ethyl acetate. The organic phase was washed with saturated sodium carbonate solution and brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane to dichloromethane / methanol = 100 / 1 to 30 / 1) to give the white solid product 20a-7 (2.65 g, yield: 49.9%). LCMS (ESI): m / z = 930 [M+H] + .

[0389] Preparation of compound 20a-8: Compound 20a-7 (3 g, 3.23 mmol, 1.0 eq), 3-(tert-butyloxycarbonyl)amino)propionic acid (611 mg, 3.23 mmol, 1.0 eq), diisopropylethylamine (835 mg, 6.46 mmol, 2.0 eq) and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 mg, 3.88 mmol, 1.2 eq) were added to dichloromethane (36 ml), and the mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 20 / 1, with 1% triethylamine added) to give compound 20a-8 as a white solid (1.5 g, yield: 42.1%). LCMS (ESI): m / z = 1101 [M+H] + .

[0390] Preparation of compound 20a-9: Compound 20a-8 (1.5 g, 1.36 mmol, 1.0 eq) was added to 20 mL of a 4 M hydrogen chloride-dioxane solution. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to give the product 20a-9 (1.1 g, crude) as a yellow solid. LCMS (ESI): m / z = 700 [M+H] + .

[0391] Preparation of Compound 20a-10: Compound 20a-9 (1.1 g, 1.27 mmol, 1.0 eq), Compound 1a-12 (2.3 g, 5.21 mmol, 4.1 eq), diisopropylethylamine (2 g, 15.24 mmol, 12.0 eq), and 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (2 g, 5.33 mmol, 4.2 eq) were added to 15 ml of acetonitrile, and the mixture was stirred at room temperature for 1 hour. The mixture was diluted with water and extracted with ethyl acetate. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol = 100 / 1 to 10 / 1, with triethylamine added) to obtain Compound DL20-8 (1.8 g, yield: 58.6%) as a white solid. LCMS (ESI): m / z=1209 [M / 2+H] + .

[0392] Preparation of compound 20a-11: Compound 20a-10 (800 mg, 0.331 mmol, 1.0 eq) was dissolved in 8 mL of ethanol, and trifluoroacetic acid (38 mg, 0.331 mmol, 1.0 eq) and 80 mg of 10% palladium hydroxide on carbon were added. The mixture was stirred at room temperature under a hydrogen atmosphere for two days. The mixture was filtered, and the filtrate was concentrated under reduced pressure to give compound 20a-11 (890 mg, crude) as a white solid. LCMS (ESI): m / z = 1097 [M / 2+H] + .

[0393] Preparation of compound 20a-12: Compound 20a-11 (760 mg, 0.346 mmol, 1.0 eq), diisopropylethylamine (134 mg, 1.038 mmol, 3.0 eq) and compound 2b-10 (97 mg, 0.381 mmol, 1.1 eq) were added to 10 ml of acetonitrile, and the mixture was stirred at room temperature for 1.5 hours. Diisopropylethylamine (134 mg, 1.038 mmol, 3.0 eq), 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (171 mg, 0.415 mmol, 1.2 eq) and intermediate M (249 mg, 0.415 mmol, 1.2 eq) were added, and the mixture was stirred at room temperature for 1 hour. The solvent was removed from the mixture under reduced pressure. The residue was purified by preparative liquid chromatography (eluent: pH 7.0 potassium dihydrogen phosphate-potassium hydroxide buffer solution / acetonitrile) to give a yellow solid compound DL20-10 (272 mg, yield: 27.2%). LCMS (ESI): m / z = 1308 [(M-302) / 2+H] + .

[0394] Preparation of Compound 20a-13: Compound 20a-12 (172 mg, 0.0589 mmol, 1.0 eq), triethylamine (71 mg, 0.707 mmol, 12.0 eq), succinic anhydride (35 mg, 0.354 mmol, 6.0 eq), and p-dimethylaminopyridine (1 mg, 0.00589 mmol, 0.1 eq) were added to 1 mL of dichloromethane, and the mixture was stirred at room temperature overnight. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to yield Compound 20a-13 (167 mg, crude) as a yellow solid. LCMS (ESI): m / z = 1358 [(M-302) / 2+H]+.

[0395] Preparation of Compound DL20-CPG: Compound 20a-13 (167 mg, 0.0554 mmol, 1.0 equiv), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (29 mg, 0.0775 mmol, 1.2 equiv), 1-hydroxybenzotriazole (12 mg, 0.0886 mmol, 1.6 equiv), and diisopropylethylamine (29 mg, 0.222 mmol, 4.0 equiv) were added to 2 mL of dimethylformamide, and the mixture was stirred at room temperature for 5 minutes. 501 mg of CPG-NH2 was added, and the mixture was shaken at room temperature overnight. The mixture was filtered, and the solid phase was washed with dichloromethane and acetonitrile and dried under reduced pressure. 6 mL of pyridine and 2 mL of acetic anhydride were added, and the mixture was shaken for 3 hours. The solid phase was filtered, washed with dichloromethane and acetonitrile, and dried under reduced pressure to obtain a yellow solid compound DL20-CPG (532 mg, loading: 28.6 μmol / g).

[0396] Example 23 Preparation of Q20-CPG

[0397] Preparation of compound 8a-2: A mixture of compound 8a-1 (2.72 g, 18.99 mmol, 1.0 eq), 4-piperidinyl carboxylate (2.72 g, 18.99 mmol, 1.0 eq), N,N-diisopropylethylamine (4.90 g, 37.98 mmol, 2.0 eq) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.47 g, 22.28 mmol, 1.2 eq) in dichloromethane (50 ml) was stirred at room temperature for 30 minutes. The mixture was concentrated under reduced pressure, the residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate and concentrated to give the product 8a-2 (12.7 g, crude) as a yellow oil. LCMS (ESI): m / z=389[M+H] + .

[0398] Preparation of compound 8a-3: A solution of compound 8a-2 (crude) in hydrogen chloride-dioxane (40 mL) was stirred at room temperature for 1 hour. The solvent was removed under vacuum. The residue was used directly in the next step without purification (crude). LCMS (ESI): m / z = 289 [M+H] + .

[0399] Preparation of compound 8a-4: A mixture of compound 8a-3 (crude), hept-6-ynoic acid (2.35 g, 18.69 mmol, 1.0 eq), N,N-diisopropylethylamine (7.23 g, 56.06 mmol, 3.0 eq) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.52 g, 22.42 mmol, 1.2 eq) in dichloromethane (50 ml) was stirred at room temperature for 30 minutes. The mixture was concentrated under reduced pressure, and the residue was diluted with water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated. The residue was purified by silica gel column chromatography (eluent: ethyl acetate to dichloromethane / methanol = 20 / 1) to give the product 8a-4 (8.19 g, crude) as a yellow oil. LCMS (ESI): m / z=397 [M+H] + .

[0400] Preparation of compound 8a-5: A mixture of compound 8a-4 (8.19 g, 18.69 mmol, 1.0 eq) and sodium hydroxide (1.24 g, 30.94 mmol, 1.5 eq) in tetrahydrofuran / methanol / water (20 ml / 10 ml / 10 ml) was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure, diluted with water, adjusted to pH 3 with dilute hydrochloric acid, and extracted with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated to give the product 8a-5 (6.0 g, crude) as a yellow oil. LCMS (ESI): m / z=383 [M+H] + .

[0401] Preparation of compound 8a-6: A mixture of compound 8a-5 (1.1 g, 2.87 mmol, 1.0 eq), compound 2a-6 (1.22 g, 2.15 mmol, 0.75 eq), N,N-diisopropylethylamine (1.11 g, 8.62 mmol, 3.0 eq) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.31 g, 3.45 mmol, 1.2 eq) in N,N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. The mixture was purified by preparative HPLC (A: pH 7 phosphate buffer, B: acetonitrile, acetonitrile concentration 30%-90% over 30 minutes) to give the product 8a-6 as a white solid (320 mg, yield: 16%). LCMS(ESI): m / z=627[(M-302)+H] + .

[0402] Preparation of compound 8a-7: A mixture of compound 8a-6 (320 mg, 0.34 mmol, 1.0 eq), succinic anhydride (207 mg, 2.07 mmol, 6.0 eq), triethylamine (418 mg, 4.14 mmol, 12.0 eq) and 4-dimethylaminopyridine (5 mg, 0.034 mmol, 0.1 eq) in dichloromethane (5 ml) was stirred at room temperature overnight. The mixture was diluted with dichloromethane and washed with 10% sodium bicarbonate solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated in vacuo to give the product 8a-7 (380 mg, crude) as a yellow solid. LCMS (ESI): m / z=727 [(M-302)+H] + . 1 H NMR(500MHz,MeOD)δ7.42–7.12(m,9H),6.93–6.71(m,4H),5.55–5.28(m,1H),4.40(dd,J=44.2,7.2 Hz,2H),4.32–4.16(m,3H),3.91–3.82(m,2H),3.77(s,6H),3.72–3.60(m,8H),3.54(td,J=13.4,6.2 Hz,6H),3.35(dd,J=14.8,9.4Hz,4H),3.18–3.05(m,6H),3.02–2.82(m,1H),2.64–2.41(m,6H),2.39 –2.24(m,1H),2.17(dtd,J=17.2,12.8,5.6Hz,5H),1.81–1.60(m,5H),1.51(dt,J=14.4,7.0Hz,3H).

[0403] Preparation of Compound Q20-CPG: To a solution of compound 8a-7 (380 mg, 0.37 mmol, 1.0 eq) in N,N-dimethylformamide (10 mL) were added 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (169 mg, 0.44 mmol, 1.2 eq), 1-hydroxybenzotriazole (70 mg, 0.52 mmol, 1.4 eq), and N,N-diisopropylethylamine (191 mg, 1.48 mmol, 4.0 eq), and the mixture was shaken at room temperature for 5 minutes. CPG-NH2 (1.9 g) was then added to the reaction mixture, which was shaken at room temperature overnight. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane and dried under vacuum for 1 hour. The residue was added with pyridine / acetic anhydride (7.5 mL / 2.5 mL) and shaken at room temperature for 3 hours. The mixture was filtered, and the filter cake was washed with dichloromethane, acetonitrile, and dichloromethane, and dried under vacuum for 1 hour to obtain the product Q20-CPG (2.08 g, loading: 101 μmol / g) as a light yellow solid.

[0404] Example 24 Synthesis of dual-targeting siRNA

[0405] 1. Synthesis of two siRNA sense strands for dual-targeting siRNA conjugation

[0406] First, the solid phase oligonucleotide synthesis method in Example 1 was used to replace the solid phase carrier with DL07-CPG and Q20-CPG to synthesize DL07-siRNA-1-SS containing an azide group and Q20-siRNA-2-SS containing an alkyne group, respectively; at the same time, universal CPG was used to synthesize the corresponding antisense strands.

[0407] 2. Synthesis of Dual-targeting siRNA-SS Chains

[0408] A certain amount of DL07-siRNA-1-SS and Q20-siRNA-2-SS were taken and dissolved in DEPC water respectively, mixed at an equivalent ratio of 1:1.5, and CuSO4·5H2O (45 equiv.), THPTA (225 equiv.), NaVc (205 equiv.), MgCl2 aqueous solution (100 mM, 50 equiv.), TEAA buffer (2 M, 1000 equiv.) and DMSO (1 / 2 the volume of DEPC water) were added, and the reaction was allowed to react at room temperature overnight. After the reaction was complete as monitored by LC-MS, three times the volume of anhydrous ethanol and 1 / 3 the volume of 3M NaCl solution were added to the reaction solution. The mixture was thoroughly shaken and placed at -20°C for approximately 30 minutes. The mixture was centrifuged at 15,000 rpm at 4°C for 3 minutes. The solution was removed by aspiration and dissolved in DEPC water. After the concentration was detected, the mixture was purified by HPLC to obtain a dual-targeting siRNA-SS chain (siRNA-1-SS-DL07-Q20-siRNA-2-SS).

[0409] 3. Synthesis of Dual-targeting siRNA

[0410] A certain amount of dual-targeting siRNA-SS (siRNA-1-SS-DL07-Q20-siRNA-2-SS) chain was dissolved in DEPC water, and equivalent amounts of two antisense chains siRNA-1-AS and siRNA-2-AS were added thereto; the mixture was heated at 95°C for 5 minutes and then naturally cooled to room temperature to obtain dual-targeting siRNA (siRNA-1-DL07-Q20-siRNA-2).

[0411] When using other linkers and delivery systems, the synthesis of dual-targeting siRNA can refer to this example.

[0412] Table 45: Dual-target sequence and delivery system structure information

[0413] The structures of the dual-targeting siRNA-linked ligands listed in the table above are shown below:

[0414] Example 25 Evaluation of the Effects of Dual-Targeting siRNAs Delivered with Different Structures on AGT and PCSK9 Expression in Primary Hepatocytes of AAV8-hAGT / hPCSK9 Mice

[0415] Table 46: Experimental results of different delivery methods of dual-targeting siRNA at different concentrations in AAV8-hAGT / hPCSK9 mouse primary hepatocytes

[0416] Experimental results indicate that all dual-targeting siRNAs exhibited significantly higher activity than two independent positive references delivered via a mixed approach. Furthermore, we found that different delivery systems had varying effects on the activity of the two targets. siRNAs delivered using DL07-Q20, DL09-Q20, and DL20-Q20 demonstrated the highest activity, significantly exceeding the 1000 PM mixed siRNAs of the positive reference (11,000 PM). We next tested the IC50 value of the highly active dual-target construct, DT03081, for knockdown of both targets in primary AAV8-hAGT / hPCSK9 mouse hepatocytes.

[0417] Table 47: IC50 experimental results of DT03081 in AAV8-hAGT / hPCSK9 mouse primary hepatocytes

[0418] As shown in Table 47, DT03081 exhibited highly potent inhibitory IC50s of approximately 44 pM for both AGT and PCSK9, demonstrating comparable inhibitory activity against both targets. This suggests that DT03081 can simultaneously and persistently inhibit the expression of both targets in vivo.

[0419] Some other combinations of AGT and PCSK9 target preferred sequences were evaluated for activity in vitro using the same delivery system, and the results are as follows.

[0420] Table 48: Experimental results of different delivery methods of dual-targeting siRNA at different concentrations in AAV8-hAGT / hPCSK9 mouse primary hepatocytes

[0421] It can be seen from the data that the dual-targeting siRNA activity of multiple preferred sequence combinations is better than the positive reference 1000PM mixed 11000PM

[0422] Example 26 Evaluation of the Effects of Different Dual-Target Sequences on hAGT and hPCSK9 Protein Expression Levels in Mice Simultaneously Expressing hAGT and hPCSK9

[0423] Experimental methods:

[0424] 1. Adenovirus integration of hAGT / hPCSK9

[0425] By 1.5x10 11Titer ultra-purified recombinant AAV8-hAGT and 1.5x10 11 Mice were co-infected with titered ultra-purified recombinant AAV8-hPCSK9 viral particles to obtain transgenic mice stably expressing hAGT / hPCSK9.

[0426] 2. Experimental Grouping and Medication

[0427] Fourteen days after virus injection, mice were bled from the submandibular vein, allowed to rest at room temperature for 30 minutes, and centrifuged at 1000×g for 10 minutes. The supernatant serum was aliquoted and stored frozen at -80°C. Serum samples were diluted 1000-fold and assayed for hAGT and hPCSK9 expression using the Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Lianke Bio, Cat. No. EK1202–96) and the Human PCSK9 ELISA Kit (Proteintech, Cat. No. KE00278), respectively. Mice were divided into groups of four based on hAGT and hPCSK9 expression levels. siRNA was dissolved in saline at a concentration of 10 μM and injected subcutaneously into mice at a dose of 60 nmol / kg or 180 nmol / kg.

[0428] 3.ELISA test

[0429] After siRNA injection, a small amount of blood was collected from the submandibular vein every other week, allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was collected. After dilution 1000-fold, the expression level of hPCSK9 was detected by ELISA.

[0430] The experimental results are shown in Table 1 and Figure 1

[0431] Table 49: Inhibitory effect of AGT / PCSK9 dual-targeting siRNA DT03081 on two targets in AAV8-hAGT / hPCSK9 mice at a dose of 60 nmol / kg

[0432] As shown in Table 49 and Figures 1 and 2, at a dose of 60 nmol / kg, DT03081 demonstrated excellent in vivo knockdown effects on both AGT and PCSK9 targets, significantly outperforming the efficacy of a combination of Zilebesiran and Inclisiran. Furthermore, the duration of combined administration of the two active drugs reveals that 1000PM still maintained an inhibition rate of approximately 50% on day 56, while 11000PM had already recovered to approximately 50% inhibition of PCSK9 by day 27. The duration of inhibition on the targets by the two sequences differed. However, the inhibitory levels of DT03081, obtained through sequence optimization and delivery structure optimization, showed consistent trends over time for both targets, making the timing and frequency of dosing more manageable in clinical practice.

[0433] Table 50: Inhibitory effects of AGT / PCSK9 dual-targeting siRNA on two targets in AAV8-hAGT / hPCSK9 mice at different doses

[0434] We further compared the activities of our preferred sequences after forming dual targets. From the data, we can see that DT03081, DT03082, DT03085 and DT03086 have comparable activities.

[0435] The activities of other preferred sequences combined into dual targets were also compared at a dose of 60 nmol / kg.

[0436] Experimental methods:

[0437] 1. Adenovirus integration of hAGT / hPCSK9

[0438] By 1.5x10 11 Humanized PCSK9 mice were infected with titered ultrapurified recombinant AAV8-hAGT viral particles to obtain transgenic mice stably expressing hAGT / hPCSK9.

[0439] 2. Experimental Grouping and Medication

[0440] Fourteen days after virus injection, mice were bled from the submandibular vein, allowed to rest at room temperature for 30 minutes, and centrifuged at 1000×g for 10 minutes. The supernatant serum was aliquoted and stored frozen at -80°C. Serum samples were diluted 1000-fold and assayed for hAGT and hPCSK9 expression using the Human Angiotensinogen / AGT / SerpinA8 ELISA Kit (Lianke Bio, Cat. No. EK1202–96) and Human PCSK9 ELISA Kit (Proteintech, Cat. No. KE00278), respectively. Mice were divided into groups of four based on hAGT and hPCSK9 expression levels. siRNA was dissolved in saline at a concentration of 10 μM and injected subcutaneously into mice at a dose of 60 nmol / kg.

[0441] 3.ELISA test

[0442] After siRNA injection, a small amount of blood was collected from the submandibular vein every other week, allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was collected. After dilution 1000-fold, the expression level of hPCSK9 was detected by ELISA.

[0443] The experimental results are shown in the table.

[0444] Table 51: Inhibitory effects of AGT / PCSK9 dual-targeting siRNA on two targets in humanized PCSK9 mice infected with AAV8 hAGT virus at a dose of 60 nmol / kg

[0445] The data show that the activities of multiple dual-targeting siRNAs are comparable to or slightly better than those of DT03081. Example 27: Evaluation of the effects of different dual-targeting sequences on the expression of hAGT and hANGPTL3 in the liver in mice expressing both hAGT and hANGPTL3

[0446] Experimental methods:

[0447] 1. Adenovirus Integration of hAGT and hANGPTL3

[0448] By 1x10 11 Titer ultrapurified recombinant AAV8 hAGT and 1x10 11 Mice were infected with ultra-purified recombinant AAV8 hANGPTL3 viral particles to generate transgenic mice stably expressing both hAGT and hANGPTL3. 100 μl of virus was added to 5.9 mL of PBS, and 200 μl of the diluted virus solution was injected intravenously into each mouse.

[0449] 2. Medication

[0450] Fourteen days after virus injection, mice were divided into groups of 4. siRNA was dissolved in saline and injected subcutaneously at a dose of 60 nmol / kg.

[0451] 3. Liver sampling and testing

[0452] Liver samples were harvested at different time points after siRNA injection. RNA was extracted from the liver tissue using the TRI REAGENT (MRC, Catalog No. TR118) and reverse transcribed into cDNA using the PrimeScript RT-PCR Kit (Takara, Catalog No. RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a film, and QPCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) to measure hAGT and hANGPTL3 expression.

[0453] Table 52: Inhibitory effects of AGT / ANGPTL3 dual-targeting siRNA on two targets in AAV8-hAGT / hANGPTL3 mice at a dose of 60 nmol / kg

[0454] The preferred AGT target sequences 1167.25-19, 1167.27-21, 1165.5-16, and 1161.7-17 were combined with the preferred ANGPTL3 target sequences 7061.18-14 and 7061.4-16 to generate AGT / ANGPTL3 dual-targeting siRNAs DT02042, DT02043, DT02047, DT02058, and DT02059. These were then evaluated for in vivo activity alongside a positive reference sequence. As shown in Table 52, the activity of the different sequence combinations varied significantly. DT02043 was the most active sequence, with activity against both targets far exceeding that of the positive reference, the 1000 pM mixed ARO-ANG3. However, the least active dual-targeting siRNA, DT02042, exhibited activity worse than the positive reference. Further comparison of DT02043 and DT02047 showed that although the ANGPTL3-targeting portion of the two dual-target siRNAs both used the 7061.4-16 sequence, the different sequences of the linked AGT-targeting siRNAs resulted in significant differences in the activities of targeting ANGPTL3.

[0455] Example 28: Evaluation of the Effects of Different Dual-Targeting Sequences on hANGPTL3 and hPCSK9 Expression Levels in Mice Co-Expressing hANGPTL3 and hPCSK9

[0456] Experimental methods:

[0457] 1. Adenovirus Integration of hANGPTL3 / hPCSK9

[0458] By 1.5x10 11 Titer ultra-purified recombinant AAV8-hANGPTL3 and 1.5x10 11 Mice were co-infected with titered ultra-purified recombinant AAV8-hPCSK9 viral particles to obtain transgenic mice stably expressing hANGPTL3 / hPCSK9.

[0459] 2. Experimental Grouping and Medication

[0460] Fourteen days after virus injection, mice were bled from the submandibular vein, allowed to stand at room temperature for 30 minutes, and centrifuged at 1000×g for 10 minutes. The supernatant serum was collected and aliquoted for storage at -80°C. Serum samples were diluted 1000-fold, and hPCSK9 expression in mouse serum was assessed using the Human PCSK9 ELISA Kit (Proteintech, Cat No. KE00278). Based on hPCSK9 expression, mice were divided into groups of four. siRNA was dissolved in saline at a concentration of 10 μM and injected subcutaneously into mice at a dose of 60 nmol / kg.

[0461] 3.ELISA test

[0462] After siRNA injection, a small amount of blood was collected from the submandibular vein every other week, allowed to stand at room temperature for 30 minutes, centrifuged at 1000×g for 10 minutes, and the supernatant serum was collected. After dilution 1000-fold, the expression level of hPCSK9 was detected by ELISA.

[0463] 4. Liver sampling and testing

[0464] Liver samples were harvested at different time points after siRNA injection. RNA was extracted from the liver tissue using the TRI REAGENT (MRC, Catalog No. TR118) and reverse transcribed into cDNA using the PrimeScript RT-PCR Kit (Takara, Catalog No. RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a film, and QPCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) to measure the expression levels of hPCSK9 and hANGPTL3.

[0465] Table 53: Inhibitory effects of PCSK9 / ANGPTL3 dual-targeting siRNA on two targets in AAV8-hPCSK9 / hANGPTL3 mice at a dose of 60 nmol / kg

[0466] The preferred siRNAs 7061.4-16 and 7061.18-14 targeting the ANGPTL3 sequence 7061 were combined with the PCSK9 targeting sequences 11040.10-23 and 11002.17-21 to generate the ANGPTL3 / PCSK9 dual-targeting siRNAs DT09001, DT09003, and DT09005. Their activity was evaluated in AAV8-hANGPTL3 / hPCSK9 mice. Blood and liver samples were collected at different time points, and PCSK9 and ANGPTL3 expression levels were assessed by ELISA and QPCR, respectively. The data demonstrate that DT09001 and DT09005 exhibit the best knockdown activity against both targets. Similarly, in this experiment, we observed that even though the dual-targeting siRNAs DT09003 and DT09005 both utilize the 11002.17-21 sequence to target PCSK9, their PCSK9 targeting activity differed significantly due to the different ANGPTL3-targeting sequences attached to them.

[0467] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A dual-targeting siRNA agent, characterized in that: The dual-targeting siRNA agent comprises two different siRNAs or pharmaceutically acceptable salts thereof targeting two different genes, wherein the two different siRNAs or their salts are connected to a ligand for delivering nucleic acid to form a whole, each of the siRNAs is a dsRNA consisting of a positive strand and an antisense strand, and the two different genes are selected from two of angiotensinogen (AGT), proprotein convertase subtilisin / kexin type 9 (PCSK9) and angiopoietin-like 3 (ANGPTL3); The base composition of the siRNA targeting the angiotensinogen gene is selected from any of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: A) 1167f: the sense strand thereof is shown in SEQ ID NO: 59, and the antisense strand thereof is shown in SEQ ID NO: 60; B) 1167b: the sense strand thereof is shown in SEQ ID NO: 51, and the antisense strand thereof is shown in SEQ ID NO: 52; C) 1165d: the sense strand thereof is shown in SEQ ID NO: 39, and the antisense strand thereof is shown in SEQ ID NO: 40; D) 1165f: the sense strand thereof is shown in SEQ ID NO: 43, and the antisense strand thereof is shown in SEQ ID NO: 44; The base composition of the siRNA targeting the proprotein convertase subtilisin protease 9 gene is selected from any of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: E) 11040a: the sense strand thereof is shown in SEQ ID NO: 375, and the antisense strand thereof is shown in SEQ ID NO: 376; F) 11002d: the sense strand thereof is shown in SEQ ID NO: 259, and the antisense strand thereof is shown in SEQ ID NO: 260; G) 11002a: the sense strand thereof is shown in SEQ ID NO: 253, and the antisense strand thereof is shown in SEQ ID NO: 254; The base composition of the siRNA targeting angiopoietin-like protein 3 is selected from any of the following dsRNA sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: H) 7061f: the sense strand thereof is as shown in SEQ ID NO: 579, and the antisense strand thereof is as shown in SEQ ID NO: 580; I) 7061b, the sense strand of which is shown in SEQ ID NO: 571, and the antisense strand of which is shown in SEQ ID NO:

572.

2. The dual-targeting siRNA agent according to claim 1, characterized in that The two genes targeted are AGT and any one selected from PCSK9 and ANGPTL3, preferably AGT and PCSK9.

3. The dual-targeting siRNA agent according to claim 1, characterized in that The nucleotides of the sense strand and the antisense strand are modified, the sense strand comprises no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the sense strand comprise 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2'-fluorine modified nucleotides, reverse abasic residues, and the 5'-end and 3'-end of the sense strand contain 0, or 1, or 2, or 3 phosphorothioate bonds; and the antisense strand comprises no more than 3, 2, 1 or 0 unmodified Nucleotides, the modified nucleotides in the antisense chain include 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluorine modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinyl phosphoric acid-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinyl phosphoric acid-3'-phosphate) or other VPU derivatives, and the 5'-end and 3'-end of the antisense chain each contain 1-3 phosphorothioate bonds.

4. The dual-targeting siRNA agent according to claim 3, characterized in that The siRNA targeting the angiotensinogen gene is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: a) 1167.25-19: Its 5'-3' sense strand is Invab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, whose 5'-3' antisense strand is VPU- S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG; b) 1167.27-21: Its 5'-3' sense strand is Invab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC; c) 1165.5-14: Its 5'-3' sense strand is Invab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, its 5'-3' antisense strand is VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG; d) 1165.5-16: Its 5'-3' sense strand is Invab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, its 5'-3' antisense strand is VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

5. The dual-targeting siRNA agent according to claim 3 or 4, characterized in that: The siRNA targeting the proprotein convertase subtilisin 9 gene is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: e) 11040.10-23, whose 5'-3' sense strand is Invab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAInvab, its 5'-3' antisense strand is VPU-S*fG*mCmUmAmCmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG; f) 11002.17-21, whose 5'-3' sense strand is Invab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG; g) 11002.10-23, whose 5'-3' sense strand is Invab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

6. The dual-targeting siRNA agent according to claim 3 or 4, characterized in that: The siRNA targeting the angiopoietin-like protein 3 gene is modified, and the siRNA is selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: h) 7061.18-14: Its 5'-3' sense strand is Invab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG; i) 7061.4-16: Its 5'-3' sense strand is Invab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

7. The dual-targeting siRNA agent according to claim 5, characterized in that: When targeting AGT and PCSK9 genes, each siRNA of the dual-targeted siRNA agent is selected from any dual-targeted siRNA of DT03081, DT03086, DT03103, DT03099, DT03085, DT03101, DT03082, DT03097, DT03100 or DT03102 in Table 45.

8. The dual-targeting siRNA agent according to claim 6, characterized in that When targeting AGT and ANGPTL3 genes, each siRNA of the dual-targeting siRNA agent is selected from any one of the dual-targeting siRNAs in DT02043 or DT02047 in Table 45.

9. The dual-targeting siRNA agent according to claim 3, characterized in that: When targeting ANGPTL3 and PCSK9 genes, each siRNA of the dual-targeting siRNA agent is selected from any one of the dual-targeting siRNAs of DT09001, DT09003 and DT09005 in Table 45.

10. The dual-targeting siRNA agent according to any one of claims 1 to 4, characterized in that: The pharmaceutically acceptable salt is a sodium salt or a potassium salt.

11. The dual-targeting siRNA agent according to any one of claims 1 to 4, characterized in that: The ligand is N-acetylgalactosamine (GalNAc) or a derivative thereof.

12. The dual-targeting siRNA agent according to claim 11, characterized in that: The N-acetylgalactosamine derivative is connected to the 3' ends of the sense strands of the two siRNAs respectively through chemical bonds, preferably, the chemical bonds are phosphate bonds or phosphorothioate bonds.

13. The dual-targeting siRNA agent according to claim 12, characterized in that: The N-acetylgalactosamine derivative has the following structure, and is connected to the 3' end of the sense strand of each siRNA in the following manner: in It represents siRNA targeting a modified sequence of the AGT gene, PCSK9 gene or ANGPTL3 gene.

14. Use of the dual-targeted siRNA agent according to any one of claims 1 to 13 in the preparation of a product for simultaneously inhibiting the expression of any two target genes AGT, PCSK9 and ANGPTL3 in cells, preferably, the product is a biological preparation or a pharmaceutical preparation.

15. A biological agent or pharmaceutical agent for simultaneously inhibiting the expression of any combination of two target genes of AGT, PCSK9 and ANGPTL3, characterized in that: The active ingredient thereof comprises the dual-targeting siRNA agent according to any one of claims 1 to 13.

16. Use of the dual-targeted siRNA agent according to any one of claims 1 to 13 in the preparation of a drug for preventing and / or treating diseases related to hypertension and / or lipid disorders, characterized in that: The hypertension is mediated by the AGT gene, and the lipid disorder-related disease is mediated by the PCSK9 gene or the ANGPTL3 gene.

17. The use according to claim 16, characterized in that: The hypertension is critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and unstable hypertension or any other disease mediated by the AGT gene.

18. The use according to claim 16, characterized in that: The lipid disorder-related disease is mediated by the PCSK9 gene and is selected from hyperlipidemia, atherosclerosis, non-alcoholic fatty hepatitis, and non-alcoholic fatty liver disease.

19. The use according to claim 16, characterized in that: The lipid disorder-related disease is mediated by the ANGPTL3 gene and is selected from any one of hyperlipidemia, hypertriglyceridemia, lipid and / or cholesterol metabolism disorders, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, cardiometabolic disease, obesity, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, and pancreatitis caused by hypertriglyceridemia.

20. A method for simultaneously inhibiting the expression of any two target genes of AGT, PCSK9 and ANGPTL3 in cells in vivo or in vitro, characterized in that: The method comprises: (a) contacting in vivo or in vitro cells with the dual-targeting siRNA agent according to any one of claims 1 to 13 or the biological agent or pharmaceutical agent according to claim 15; and (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of mRNA transcripts expressed by any two target genes among AGT, PCSK9 and ANGPTL3, thereby simultaneously inhibiting the expression of any two target genes among AGT, PCSK9 and ANGPTL3 in the cells.

21. A method for treating a disease associated with AGT and / or PCSK9 and / or ANGPTL3, characterized in that: The method comprises administering to the subject a therapeutically effective amount of the dual-targeting siRNA agent according to any one of claims 1 to 13 or the biological agent or pharmaceutical agent according to claim 15, thereby treating the subject.

22. An siRNA targeting AGT gene or a pharmaceutically acceptable salt thereof, characterized in that: The sequence is selected from one of the following, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: A) 1167f: the sense strand thereof is shown in SEQ ID NO: 59, and the antisense strand thereof is shown in SEQ ID NO: 60; B) 1167b: the sense strand thereof is shown in SEQ ID NO: 51, and the antisense strand thereof is shown in SEQ ID NO: 52; C) 1165d: the sense strand thereof is shown in SEQ ID NO: 39, and the antisense strand thereof is shown in SEQ ID NO: 40; D) 1165f, the sense strand of which is shown in SEQ ID NO:43, and the antisense strand of which is shown in SEQ ID NO:

44.

23. The siRNA targeting the AGT gene or a pharmaceutically acceptable salt thereof according to claim 22, wherein: The siRNA is modified and selected from one of the following sequences, or a sense strand or antisense strand sequence that differs therefrom by no more than 1 nucleotide: a) 1167.25-19: Its 5'-3' sense strand is Invab*mU*mGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, and the 5'-3 antisense strand is VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mG; b) 1167.27-21: Its 5'-3' sense strand is Invab*mG*mCmCmGmAmCmCmAfGfCfUfUmGfUmUmUmGmUmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmAmCmAmAmAmCmAmAdGmCfUmGfGmUmCmG*mG*mC; c) 1165.5-14: Its 5'-3' sense strand is Invab*mG*mAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, its 5'-3' antisense strand is VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG; d) 1165.5-16: Its 5'-3' sense strand is Invab*mC*mCmAmAmGmAmAmCfCfAfGfUmGfUmUmUmAmGmCmGmAInvab, its 5'-3' antisense strand is VPU-S*fC*mGmCmUmAmAmAmCmAmCdTmGfGmUfUmCmUmU*mG*mG; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

24. A siRNA targeting PCSK9 gene or a pharmaceutically acceptable salt thereof, characterized in that: The siRNA is selected from one of the following sequences, or a sense strand or antisense strand sequence that differs therefrom by no more than 1 nucleotide: E) 11040a: the sense strand thereof is shown in SEQ ID NO: 375, and the antisense strand thereof is shown in SEQ ID NO: 376; F) 11002d: the sense strand thereof is shown in SEQ ID NO: 259, and the antisense strand thereof is shown in SEQ ID NO: 260; G) 11002a: Its sense strand is shown in SEQ ID NO: 253, and its antisense strand is shown in SEQ ID NO:

254.

25. The siRNA targeting PCSK9 gene or a pharmaceutically acceptable salt thereof according to claim 24, characterized in that: The siRNA is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: e) 11040.10-23, whose 5'-3' sense strand is Invab*mC*mUmUmAmUmUmCmUfGfGfGfUmUfUmUmGmUmAmGmCmAInvab, its 5'-3' antisense strand is VPU-S*fG*mCmUmAmCmAmAmAmAmCdCmCfAmGfAmAmUmA*mA*mG; f) 11002.17-21, whose 5'-3' sense strand is Invab*mG*mCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mG*mG; g) 11002.10-23, whose 5'-3' sense strand is Invab*mC*mUmAmCmAmGmCmCfAfAfCfUmUfUmUmCmUmAmGmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mCmUmAmGmAmAmAmAmGdTmUfGmGfCmUmGmU*mA*mG; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

26. An siRNA targeting ANGPTL3 gene or a pharmaceutically acceptable salt thereof, characterized in that: The siRNA is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: H) 7061f: the sense strand thereof is shown in SEQ ID NO: 579, and the antisense strand thereof is shown in SEQ ID NO: 580; I) 7061b, the sense strand of which is shown in SEQ ID NO: 571, and the antisense strand of which is shown in SEQ ID NO:

572.

27. The siRNA targeting the ANGPTL3 gene or a pharmaceutically acceptable salt thereof according to claim 26, characterized in that: The siRNA is modified and selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: h) 7061.18-14: Its 5'-3' sense strand is Invab*mU*mAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mG; i) 7061.4-16: Its 5'-3' sense strand is Invab*mG*mCmCmAmCmUmUmGfAfAfCfUmCfAmAmCmUmCmAmAmAInvab, its 5'-3' antisense strand is VPU-S*fU*mUmGmAmGmUmUmGmAmGdTmUfCmAfAmGmUmG*mG*mC; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, fA is 2'-fluoroadenosine-3'-phosphate, and fU is 2'- fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, Invab is an inverted abasic residue, and * is a phosphorothioate bond.

28. An siRNA agent targeting AGT, characterized in that The siRNA agent is formed by linking the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 22 to 23 with a ligand for delivering nucleic acid.

29. A siRNA agent targeting PCSK9, characterized in that The siRNA agent is formed by linking the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 24 to 25 with a ligand for delivering nucleic acid.

30. An siRNA agent targeting ANGPTL3, characterized in that The siRNA agent is formed by linking the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 26 to 27 with a ligand for delivering nucleic acid.

31. The siRNA agent according to any one of claims 28 to 30, characterized in that The ligand is N-acetylgalactosamine or its derivatives. Preferably, the structural formula of the ligand is as follows:

32. The siRNA agent according to claim 31, characterized in that The ligand is connected to the 3' end of the sense strand via a chemical bond, preferably, the chemical bond is a phosphate bond or a phosphorothioate bond, and the connection method is as follows:

Images