Biological sample testing system, method, apparatus and kit, and use

Abstract

The present application relates to the technical field of biological testing, and in particular, to a biological sample testing method, system, apparatus and kit, and a use. The biological sample testing method comprises the following steps: taking a test probe and dissolving same in a solvent to prepare a test probe solution, and connecting the test probe solution to a test electrode; taking a blank solvent and connecting the blank solvent to a reference electrode; inputting power supply signals to the test electrode and the reference electrode, using a measurement module to test and record respective charging and discharging frequencies, setting a frequency difference to 0 by means of the measurement module, and disconnecting the test probe solution from the test electrode when the setting is completed; taking a biological sample to be tested, adding a test probe for specific binding, to prepare a test solution, and connecting the test probe solution to the test electrode; and inputting power supply signals to the test electrode and the reference electrode, using the measurement module to test and record respective charging and discharging frequencies, calculating a difference, and distinguishing different biological samples on the basis of the differences obtained by calculation. The method is accurate, efficient, and fast, so that the test time is greatly shortened and the test cost is saved.

Description

Biological sample detection system, detection method, detection device, kit and application Technical Field

[0001] The present application relates to the field of biological detection technology, and in particular to a biological sample detection system, detection method, detection device, kit and application. Background Art

[0002] Biological samples include but are not limited to nucleic acids, proteins, lipids, carbohydrates, cells, etc. Pretreatment is generally required before detection to enrich the molecules or cells to be detected in the biological sample. Detection usually uses targeted techniques and methods based on the characteristics of the molecules to be detected. For example, nucleic acids (DNA and RNA) are often amplified and measured using polymerase chain reaction (PCR), and further sequence information can be obtained through sequencing; proteins, lipids, carbohydrates and cells are often measured based on the mutual binding of target molecules or target cells with antibodies or ligands, such as commonly used enzyme-linked immunosorbent assays, immunofluorescence assays, Western hybridization, immunohistochemistry, etc. Drug screening requires binding to specific molecules to determine whether they can act on the receptor.

[0003] Taking the detection of the new coronavirus (SARS-CoV-2) as an example, existing testing methods mainly rely on detecting the virus's nucleic acid, antibodies, and antigens.

[0004] The nucleic acid of SARS-CoV-2 is mainly determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Since SARS-CoV-2 is an RNA virus, the viral RNA needs to be reverse transcribed into cDNA before PCR detection. qRT-PCR technology is used to isolate viral RNA from various types of samples such as body fluids, and exponentially amplify the trace amount of viral nucleic acid information in the sample through reverse transcription combined with polymerase chain reaction. Finally, the RNA is relatively quantitatively determined by the strength of the fluorescent signal. Based on the full genome sequence of SARS-CoV-2, relevant technologies recommend that three specific regions of SARS-CoV-2 (ORF1ab gene, N gene and E gene) are suitable as PCR amplification regions. However, since qRT-PCR technology requires strict experimental conditions and a long amplification time, the efficiency of nucleic acid detection is limited.

[0005] The protein (antigen) or antibody of SARS-CoV-2 is mainly determined by enzyme-linked immunosorbent assay. The widely used rapid antigen detection method is the colloidal gold method. This method uses pre-coated antibodies to detect the viral N protein (antigen) that may be present in the sample to be tested. The test results can generally be obtained in 10 to 15 minutes (min), which is convenient and easy. The main shortcomings are low detection sensitivity and throughput, and a certain false positive rate. Antibody detection is to detect IgM or IgG antibodies in the serum that are stimulated by the human body after viral infection. IgM antibodies appear earlier, and IgG antibodies appear later. The appearance of antiviral antibodies is generally delayed, and the population will also produce corresponding antibodies after vaccination. Therefore, antibody detection is generally not used for public health needs to control the epidemic.

[0006] Immunological detection methods, designed based on the principle of specific antibody-antigen binding, are widely used in the clinical, scientific, pharmaceutical, and food industries to detect various molecules, including proteins, lipids, carbohydrates, and cells. These methods involve complex biochemical or immunological detection systems, require multiple steps, and are time-consuming. When detecting trace amounts of molecules, the sensitivity and specificity of these methods can be affected by various factors.

[0007] In view of this, it is necessary to develop a biological sample detection method with high sensitivity and high detection efficiency, which can realize the rapid and specific detection of trace biological samples.

[0008] Summary of the Invention

[0009] Through extensive literature research and creative experimental exploration, this application proposes a method for detecting biological samples. This method is based on a detection system that can specifically identify the electrical characteristics of different biological samples to be tested. The system includes a test probe, a test electrode, a control electrode, and a measurement module. The detection method of the application achieves qualitative or quantitative detection by applying an AC signal to the biological sample to be tested and measuring the difference between the charge and discharge frequencies of the test electrode and the control electrode. It has the advantages of high sensitivity, strong specificity, and high detection efficiency.

[0010] This application utilizes the fact that the conductivity of a solution is proportional to the ion concentration in the solution. A high ion concentration means a strong electrical conductivity, while a low ion concentration means a weak electrical conductivity. In a standard RC charge-discharge circuit, the size of the resistor affects the charge and discharge time of the capacitor. The larger the resistance, the longer the capacitor charging time, and the smaller the resistance, the shorter the charging time. Based on this principle, if the resistor in the standard RC charge-discharge circuit is replaced by a conductive solution, the conductivity of the solution, i.e., its electrical conductivity, will also affect the charge and discharge time of the capacitor. In order to make the difference in charge and discharge time more obvious, repeated charge and discharge can be used to increase the cumulative difference, increase resolution, and improve measurement results.

[0011] In some specific embodiments of the present application, because changes in the conductivity of the test agent will affect the oscillation frequency of the RC resistor-capacitor charge-discharge circuit, an excitation source is generated by a microcontroller MCU, and the reagent is introduced into the oscillation circuit through electrodes in series. The current oscillation frequency feedback value is detected in real time to obtain the current change in the conductivity of the reagent. Furthermore, the specific circuit scheme uses the output and input pins of the microcontroller MCU to generate a periodic charge and discharge excitation source through software programming, and then uses the input pins of the MCU to count the number of interruptions per unit time to obtain the charge and discharge frequency value, thereby converting the conductivity value of the current reagent.

[0012] The electrode probe frequency difference can be used to characterize biochemical substances such as antibodies and antigens, and / or for applications involving one or more of DNA sequencing, DNA hybridization, real-time PCR, protein or other biological and chemical substance detection.

[0013] In the example embodiments disclosed in the present application, the frequency difference measured by the electrode probe can be used for applications such as DNA sequencing, DNA hybridization or protein detection, to detect a series of electrical signal parameter changes such as impedance caused by the pairing of biological molecules such as nucleic acids or proteins. For example, in nucleic acid and nucleic acid hybridization, the complex formed after specific binding occurs in protein-protein interaction and drug-protein interaction can be electrically equivalent to a cascade-shaped capacitance network under non-electrochemical electrostatic field conditions. The combination of different ligands or epitopes with receptors can cause changes in the capacitance network inside the solution. The change in the capacitance network can cause a series of electrical signal changes such as impedance and be associated with the incorporation of its internal interaction, and such changes can be used to detect various sequence complementarity and protein interaction events. If the nucleotides are injected in a known order, it is allowed to detect the interaction by impedance measurement, thereby determining the absolute and qualitative identification of complementary bases. Wherein biomolecules, such as single-stranded DNA, can be attached to the reactor or can be directly spotted into the reaction vessel.

[0014] The relative distance between the electrode probes is fixed. Theoretically, the physical position of the probes relative to the carrier can affect the frequency measurement value, for example. However, for this application, the relative distance between the electrode probes can be fixed, and only the number of current reversals (frequency) during the charge and discharge process at a fixed distance can be measured to reflect the impedance changes between biomolecular interactions. For example, if the system reacts in a homogeneous solution, and the distance between the electrode probes reflects the binding level of 1% of the total volume, the change in the reaction level relative to the total volume can be inferred.

[0015] Now referring to Figure 1, in order to measure the change in impedance caused by nucleic acid complementarity or protein interaction, the present application adopts a repeated charge and discharge method to increase the cumulative difference, increase the resolution, and improve the measurement effect. In some embodiments, the operating conditions are shown in Figure 2, depending on the basic concentration of the solution. At low concentrations, it is found that the biological solution has capacitive characteristics, while at high concentrations it has resistive characteristics. Therefore, the sample concentration is appropriately increased to eliminate other effects brought about by capacitance, but the inflection point data brought about by the different properties of different substances are also different. Figure 1 provides a diagram of some potential inflection point implementation methods. The present application can find the inflection point through reverse excitation, so as to better eliminate the capacitance effect generated by the biological sample itself and thus affect the specific parameters of sensitivity.

[0016] Furthermore, the required probes are coated on the plate in advance or dissolved in the reaction system, and are further placed in the test area, thereby further connected in series in the circuit.

[0017] Therefore, the electrodes need to be inside the solution to be tested in order to detect reactions between different antigens and reactions between different nucleic acids. The influence of the bulk reagent solution on the total impedance between the electrodes is minimized.

[0018] In some specific embodiments of the present application, antibodies and nucleic acid probes can be embedded on a flat surface, for example, by placing antibodies on a flat surface or placing ssDNA in a flat plate in advance. In such embodiments, the solution to be tested needs to be dripped into the plate, and the electrode probe is embedded in the flat surface in advance. The electrode can be close to the antibody and nucleic acid probe without any depressions or holes. In this way, in further embodiments, the reactor can be used for different applications, such as chemical concentration and detection. For example, embedding drug receptors in the plate can better react blood in the reactor to determine blood drug concentration.

[0019] In an alternative embodiment, if an electrode is attached directly to the plate, the probe electrode can be connected directly to the probe antibody. Instead of measuring the impedance change within the solution, this measures the impedance difference caused by a solid dissolving in a small amount of liquid.

[0020] In some embodiments of the present application, a ground signal and a shielding layer (or a low-impedance conductive layer that acts as a shield) are also present. In further embodiments, the grounding / shielding layer is connected to R29. The grounding / shielding layer can reduce signal interference from the bulk solution, thereby optimizing the signal passing through the electrode to measure impedance changes caused by binding of other epitopes or recognition of other nucleotides. The grounding / shielding layer can reduce signal interference from the bulk solution by preventing fluctuations or noise in the bulk solution from affecting electrodes not close to the sensor.

[0021] In some embodiments of the present application, electrodes are coupled to the plurality of solution capacitors being measured to prevent the effects of direct current (DC) bias levels from the driver circuit.

[0022] Electrode probes can be fabricated to connect to hydrogel composite pores or to electrospinning nozzles, allowing for the sequencing of single nucleotide molecules. Polymerases can also be attached to the probe surface to create nanopores that can then measure the nucleotides reacting to a DNA or RNA strand, resulting in a change in the frequency of an electrical signal in the solution, thereby detecting impedance.

[0023] In an alternative embodiment, electrospinning can be used to force nucleic acid sequences to single base sequence at 10,000V. This method can be used to detect single or multiple molecules for DNA or RNA sequencing.

[0024] In some embodiments of the present application, the signal is amplified by using an RC oscillator circuit. To make the difference in charge and discharge time more obvious, repeated charge and discharge can be used to increase the cumulative difference, increase resolution, and improve measurement results.

[0025] In some embodiments of the present application, the electrode probe can be operated by detecting the current reversal number signal after being excited by an excitation source. The measurement can be achieved by detecting changes in various electrical signals such as resistance, capacitance, inductance, etc. or electrical signals caused by changes in ion concentration between the two electrodes. In a specific embodiment, the size of the frequency signal is used as an indication of the reaction of the strength of the binding. For example, under different binding effects, the frequency signals obtained under different numbers of mutated DNA are different, that is, the higher the degree of binding, the higher the frequency signal output value. Such changes in sequencing can indicate the strength of nucleotide binding and judge the signals of different bases. Such changes occur due to impedance modulation associated with the ion concentration between the two electrodes.

[0026] In some embodiments of the present application, a buffer solution with stronger ionization ability can be used to increase the frequency. For such embodiments, a strong electrolyte such as hydrochloric acid can be used as an electrolysis buffer. In some embodiments, the concentration of the electrolyte solution is increased to increase the electron flow.

[0027] According to the characteristics of the output signal, the frequency signal is related to the resistance and capacitance, as described by the following formula:

[0028] Where R is the resistance, C is the capacitance, and N is a constant value.

[0029] In some embodiments of the present application, a single measurement is sufficient after the reaction is complete, providing flexibility and simplifying data flow and analysis. Furthermore, optimizing reaction conditions can yield long-term stable readings and support measurements in low-conductivity buffers, enhancing the signal and reducing the signal-to-noise ratio.

[0030] In one exemplary implementation, a pair of active dual-electrode tips with a fine spacing (up to 20 nanometers) are directly immersed in the reaction solution, achieving close coupling with the environment being measured. This design provides the sensor with exceptional performance, enabling it to accurately capture and quantify subtle fluctuations in resistance at femtomolar (fM) concentration levels.

[0031] In the above-mentioned embodiment, this electrode probe, as an ultra-sensitive local impedance biosensor device, works based on the direct correlation between subtle changes in local solution resistance and current response during biochemical reactions. Specifically, when events such as DNA incorporation, protein-specific binding, DNA hybridization, pH fluctuations, or other biochemical reactions occur, the accompanying changes in solution electron flow will cause tiny perturbations in the local solution resistance, thereby triggering corresponding changes in the electrical signal. The sensor monitors and analyzes these subtle current changes to indirectly and accurately detect and quantify the dynamic changes in impedance, providing strong technical support for the study of biomolecular interactions and monitoring of biochemical processes.

[0032] In some specific embodiments of the present application, an RC oscillator circuit can be used to generate a periodic frequency signal, the frequency of which is inversely proportional to the product of the resistance (R) and the capacitance (C) in the circuit. This characteristic enables it to respond to changes in certain parameters in the circuit (such as environmental variables indirectly measured by sensors). These changes can be simulated or realized by changing the resistance of the resistor R. The frequency of the periodic pulse signal generated by the oscillator can be accurately measured by counting the number of pulses within a preset time window. This counting result will directly correspond to the change in the resistance of the resistor R, thereby indirectly reflecting the changes in the external parameters (such as temperature, pressure, etc.) measured or simulated. By adjusting the numerical value of the resistor R or the capacitor C, the frequency range of the periodic pulse signal generated by the oscillator can be flexibly adjusted to meet different application requirements.

[0033] In the above-mentioned specific embodiment, an innovative measurement method for conductivity measurement was implemented using an RC oscillator circuit. This method, based on the positive correlation between frequency and conductance, accurately reflects conductance and, therefore, impedance changes, by directly reading the oscillation frequency. This mechanism, based on the principle that the RC time constant varies with conductance, is achieved through precise control of circuit parameters. In practical applications, this method simplifies the measurement process, eliminating the need for complex calculations and providing conductance information by directly reading the frequency value. This measurement method not only improves accuracy but also accelerates measurement speed, providing an efficient and reliable solution for conductivity measurement technology and meeting the demand for precise conductivity measurement in various fields.

[0034] The RC oscillator circuit's simple design eliminates the need for complex components, significantly reducing space requirements. This makes it particularly suitable for space-constrained applications. By introducing input multiplexing technology, the number of circuits can be effectively reduced, further improving system integration and measurement efficiency, resulting in greater efficiency and reliability.

[0035] The purpose of this application includes providing a biological sample detection method, a biological sample detection system, a biological sample detection device, a biological sample detection kit and their applications, which can be used for high-sensitivity detection and identification of trace biological samples.

[0036] The biological sample detection method comprises the following steps:

[0037] dissolving a test probe in a solvent to prepare a test probe solution, and connecting the test probe solution to a test electrode;

[0038] Take a blank solvent and connect the blank solvent to a reference electrode;

[0039] Inputting a power signal to the test electrode and the control electrode, testing and recording their respective charge and discharge frequencies using a measurement module, and setting the frequency difference to 0 through the measurement module. After the setting is completed, disconnecting the test probe solution from the test electrode;

[0040] Taking a biological sample to be tested, adding a test probe for specific binding to prepare a test solution, and connecting the test probe solution to the test electrode;

[0041] Power signals are input to the test electrode and the control electrode, and the respective charge and discharge frequencies are tested and recorded using a measurement module, and the difference is calculated. Different biological samples are distinguished by the calculated difference.

[0042] The biological sample solution to be tested described in the present application is a solution with resistance-capacitance characteristics. When an AC signal is applied to the biological sample solution to be tested, the internal charges continuously accumulate and move, which manifests as charging and discharging on a macroscopic scale. The frequency of its charging and discharging is related to its own electrical properties and the external environment. By detecting its charging and discharging frequency, sample solutions of different properties and concentrations can be further distinguished.

[0043] The frequency value described in this application refers to the overall effect of the interaction between the resistance and capacitance exhibited by the biological sample under an AC electric field. When an AC electric field passes through an aqueous solution containing a biological sample, it encounters some resistance and reverse potential. These effects can be quantitatively evaluated by measuring the response of the solution to the AC signal.

[0044] In some embodiments, the biological sample electrical property detection system achieves qualitative or quantitative detection of the biological sample by applying an AC signal to the sample to be tested and measuring the difference between its output signal (ie, transfer function) and the input signal.

[0045] Furthermore, the input power signal is AC or a mixed signal having both AC and DC components.

[0046] In the detection method of the present application, after the biological sample to be tested is energized, the reasons that cause its frequency to change include but are not limited to changes in the dielectric constant before and after the specific binding of the biological sample to the test probe, resulting in changes in the internal equivalent circuit of the solution, that is, changes in the electrical properties of the solution itself on a macroscopic scale, thereby affecting its charge and discharge frequency.

[0047] Furthermore, the electrical properties refer to changes in specific resistance, dielectric constant, magnetic permeability, and equivalent circuit before and after the biological sample to be tested specifically binds to the test probe.

[0048] In some embodiments, the change in charge and discharge frequency between the test electrode and the control electrode due to the specific binding of the test probe to the biological sample to be tested is detected by differential means, thereby eliminating the influence of other external environments on the charge and discharge frequency.

[0049] In some embodiments, the control solution and the solution containing the test probe are the same solution, and the ion concentrations in the solutions are the same.

[0050] In some embodiments, the biological sample to be tested is mixed with a buffer solution to prepare a biological sample solution to be tested, the biological sample solution to be tested is mixed with the test probe, and the test probe is electrically connected to the test electrode; the biological sample solution to be tested is electrically connected to the control electrode; an AC signal is input to the test electrode and the control electrode, and the difference in charge and discharge frequency between the test electrode and the control electrode is tested and output by the measurement module.

[0051] In some embodiments, the test electrode is externally connected to an AC signal.

[0052] In some embodiments, the test probe comprises at least one of a nucleic acid probe and a protein (antibody) probe.

[0053] In some embodiments, the nucleic acid probe comprises a DNA probe, further a single-stranded DNA (ssDNA) probe.

[0054] In some embodiments, the test probe comprises an antibody probe or a non-antibody protein probe (eg, a glycoprotein probe) that is conjugated to a drug.

[0055] In some embodiments, the sample to be tested includes at least one of a nucleic acid sample, a protein sample, a lipid sample, a cell sample, and a drug sample.

[0056] The frequency change of the nucleic acid sample solution is because the nucleic acid double helix molecule formed after the specific binding of the nucleic acid to be tested and the sequence-complementary nucleic acid probe can be electrically equivalent to a cascade-shaped capacitance network determined by the number of base pairs and the matching / mismatching state under non-electrochemical electrostatic field conditions. Different base pair bindings will cause changes in the capacitance network inside the solution.

[0057] The frequency of protein, lipid, cell, or drug sample solutions changes because the complex formed by the specific binding of the target protein, lipid, cell, or drug to the protein (antibody) probe can be electrically equivalent to a cascade-shaped capacitance network under non-electrochemical electrostatic field conditions, which is determined by the matching / mismatching state and strength of the ligand or epitope and receptor. Different ligand or epitope binding to the receptor will cause changes in the capacitance network within the solution.

[0058] The biological sample detection system includes a test probe, a test electrode, a control electrode and a measurement module;

[0059] Wherein, the test probe, the test electrode, the control electrode and the measurement module are as defined in any of the above technical solutions.

[0060] The biological sample detection device includes the biological sample detection system described above.

[0061] The biological sample detection kit includes the biological sample detection system or biological sample detection device described above.

[0062] The present application also relates to the application of the above-mentioned biological sample detection system or biological sample detection device in biological sample detection.

[0063] The detection method of the present application creatively uses electrical methods to detect the sample to be tested, and eliminates the influence of environmental factors on the solution frequency by measuring the difference in charge and discharge frequencies, effectively shortening the detection time, improving the detection efficiency, and saving the detection cost. This method has high accuracy and good sensitivity.

[0064] The detection method of the present application can compress the nucleic acid detection time to 1min to 3min, and the detection time of proteins, lipids, cells, and drugs to 1min to 10min, thereby effectively avoiding the use of longer technologies such as qRT-PCR, ELISA, and immunofluorescence. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the specific implementation methods or the description of the prior art. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0066] FIG1 is a schematic diagram illustrating various paths that can be detected by detection electrodes in different parts of a circuit under different biomolecule binding conditions, according to one embodiment of the present application; wherein C10 and R16 represent the current-limiting resistor and fixed capacitor under the excitation of pin 1, respectively; C12 and R24 represent the current-limiting resistor and fixed capacitor under the excitation of pin 2, respectively;

[0067] FIG2 is a frequency difference test result of RNA samples according to an embodiment of the present application;

[0068] FIG3 is a frequency difference test result of a DNA sample according to an embodiment of the present application;

[0069] FIG4 is a frequency difference test result of an LPS sample according to an embodiment of the present application;

[0070] FIG5 is a frequency difference test result of an IL-4 sample according to an embodiment of the present application;

[0071] FIG6 is a frequency difference test result of a cell sample according to an embodiment of the present application;

[0072] FIG7 is a drug detection test result according to an embodiment of the present application;

[0073] FIG8 is a schematic diagram of a detection circuit according to an embodiment of the present application;

[0074] FIG9 is a schematic diagram of a partial structural area of ​​a biological sample detection system according to an embodiment of the present application. DETAILED DESCRIPTION

[0075] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the following description and illustration of the biological sample detection method, detection system, detection device, kit and application of this application are provided in conjunction with the accompanying drawings and examples. It should be understood that the specific embodiments described herein are merely for explaining this application and are not intended to limit this application. Based on the embodiments provided in this application, all other embodiments obtained by persons of ordinary skill in the art without creative work are within the scope of protection of this application.

[0076] Obviously, the drawings described below are only some examples or embodiments of the present application. For those of ordinary skill in the art, the present application can also be applied to other similar scenarios based on these drawings without paying any creative work. In addition, it can also be understood that although the efforts made in this development process may be complex and lengthy, for those of ordinary skill in the art related to the content disclosed in this application, some changes in design, manufacturing or production based on the technical content disclosed in this application are just conventional technical means and should not be understood as insufficient content disclosed in this application. Mentioning "embodiment" in this application means that the specific features, structures or characteristics described in conjunction with the embodiment may be included in at least one embodiment of the present application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those of ordinary skill in the art that the embodiments described in this application can be combined with other embodiments without conflict.

[0077] Unless otherwise defined, the technical or scientific terms used in this application should have the ordinary meaning understood by a person of ordinary skill in the technical field to which this application belongs. The words "a", "an", "a", "the" and the like used in this application do not indicate a limit on quantity and may indicate the singular or plural. The terms "include", "comprise", "have" and any variations thereof used in this application are intended to cover non-exclusive inclusions; for example, a process, method, system, product or device that includes a series of steps or units (units) is not limited to the listed steps or units, but may also include steps or units that are not listed, or may also include other steps or units that are inherent to these processes, methods, products or devices. The words "connect", "connected", "coupled" and the like used in this application are not limited to physical or mechanical connections, but may include electrical connections, whether direct or indirect. The words "multiple" / "several" used in this application refer to two or more. "And / or" describes the association relationship between associated objects, indicating that three relationships can exist. For example, "A and / or B" can mean: A exists alone, A and B exist at the same time, or B exists alone. The character " / " generally indicates that the objects before and after are in an "or" relationship. The terms "first", "second", "third", etc. involved in this application are only used to distinguish similar objects and do not represent a specific order for the objects.

[0078] In one aspect of the present application, a biological sample detection method is provided, which achieves qualitative or quantitative detection by detecting and calculating the difference in the charge and discharge frequencies of the biological sample to be tested. Furthermore, the biological sample solution to be tested in the present application is a solution with resistance and capacitance characteristics. When an AC signal is applied to the biological sample solution to be tested, the internal charges continuously accumulate and move, which manifests as charge and discharge on a macroscopic scale. The frequency of charge and discharge is related to the electrical properties of the biological sample itself and the external environment. By detecting the charge and discharge frequency, sample solutions of different properties and concentrations can be distinguished.

[0079] The application relates to biological samples including nucleic acid samples, protein samples, lipid samples and cell samples. Nucleic acid sample solution frequency changes because the nucleic acid double helix molecule formed after the nucleic acid to be measured and the sequence complementary nucleic acid probe specific binding can be electrically equivalent to the capacitance network of the cascade morphology determined by base pair number and matching / mismatching state under non-electrochemical electrostatic field conditions, and different base pairs can cause the change of solution internal capacitance network in combination. Protein, lipid, cell sample solution frequency changes because the complex formed after the protein to be measured, lipid and cell etc. and the protein (antibody) probe specific binding can be electrically equivalent to the capacitance network of the cascade morphology determined by ligand or epi-position and receptor matching / mismatching state and intensity under non-electrochemical electrostatic field conditions. The combination of different ligands or epi-positions and receptor can cause the change of solution internal capacitance network.

[0080] The biological sample detection method of the present application comprises the following steps:

[0081] Dissolving the test probe in a solvent to prepare a test probe solution, and connecting the test probe solution to the test electrode;

[0082] Take blank solvent and connect the blank solvent to the reference electrode;

[0083] Input power signals to the test electrode and the control electrode, use the measurement module to test and record their respective charge and discharge frequencies, and set the frequency difference to 0 through the measurement module. After the setting is completed, disconnect the test probe solution and the test electrode;

[0084] Take the biological sample to be tested, add the test probe for specific binding to prepare the test solution, and connect the test probe solution to the test electrode;

[0085] Power signals are input to the test electrode and the control electrode, and the respective charge and discharge frequencies are tested and recorded using a measurement module, and the difference is calculated. Different biological samples are distinguished by the calculated difference.

[0086] In some embodiments, the power signal is an AC signal or a mixed signal having both an AC component and a DC component.

[0087] In some embodiments, the AC signal is converted from a DC power source through an RC oscillation circuit.

[0088] In some embodiments, the voltage of the DC power supply is 2V to 4V.

[0089] In some embodiments, the electrical properties include specific resistance, dielectric constant, magnetic permeability, and equivalent circuit of the biological sample to be tested before and after specific binding to the test probe.

[0090] In some embodiments, the equivalent circuit changes before and after the biological sample to be tested specifically binds to the test probe, thereby affecting its charge and discharge frequency.

[0091] In some embodiments, the influence of other external environments on the charge-discharge frequency is eliminated by differentially detecting the change between the test electrode and the control electrode, except for the change of internal factors caused by the specific binding of the test probe to the biological sample to be tested.

[0092] In some embodiments, the detection method comprises the following steps:

[0093] The biological sample to be tested is mixed with a buffer solution to prepare a biological sample solution to be tested, the biological sample solution to be tested is mixed with a test probe, and the solution is electrically connected to a test electrode; the biological sample solution to be tested is electrically connected to a control electrode; an AC signal is input to the test electrode and the control electrode, and the difference in charge and discharge frequency between the test electrode and the control electrode is tested and output by a measurement module. Furthermore, the parameters of the control electrode are completely consistent with those of the test electrode, eliminating the influence of the distance between the electrodes on the charge and discharge frequency.

[0094] In some embodiments, the detection method further comprises a baseline calibration.

[0095] In some embodiments, baseline calibration comprises the following steps:

[0096] Connect the probe solution to the test electrode and the control solution to the control electrode. Input an AC signal to the test and control electrodes and calibrate the frequency to "0". The control solution should have the same ion concentration as the sample to be tested.

[0097] Differential analysis is not only used to eliminate certain environmental factors but is also one of the primary methods for determining the presence of complementary base pairing and ligand-receptor specific binding. When an AC signal passes through a solution containing nucleic acid molecules and a control solution, the output signals differ slightly due to differences in solution frequency. This difference is related to factors such as ambient temperature, air pressure, and humidity. Therefore, the two output signals are input into the test module and then subtracted to eliminate the influence of these environmental factors.

[0098] In some embodiments, the temperature of the frequency change test is 20°C to 30°C.

[0099] In some embodiments, the sample to be tested includes at least one of a throat swab sample, a nasal swab sample, and anal swab sample.

[0100] In some embodiments, before the step of mixing the test sample with the test probe, the test sample is pre-treated by lysis.

[0101] In some embodiments, the lysis pretreatment comprises the following steps: mixing the test sample, lysis solution and proteinase K, vortexing and centrifuging.

[0102] In some embodiments, the vortexing time is 8 min to 11 min.

[0103] In some embodiments, the centrifugal speed is 10,000 rpm to 13,000 rpm.

[0104] In some embodiments, the centrifugation time is 2 min to 4 min.

[0105] In some embodiments, the biological sample detection system includes:

[0106] A test probe is added to a test solution containing a biological sample to be tested, and is used to specifically detect the electrical characteristics of the biological sample to be tested;

[0107] a test electrode electrically connected to the test probe;

[0108] a control electrode electrically connected to a control solution containing a biological sample to be tested; and

[0109] The measuring module outputs the difference in charge and discharge frequency between the test electrode and the reference electrode.

[0110] In some embodiments, the measurement module is electrically connected to the display module.

[0111] The modules of the detection system of the present application are described in detail below in conjunction with Figure 9. As shown in Figure 9, in some embodiments, the biological sample detection system includes a test electrode, a test area, a control electrode and a control area, a test probe is disposed in the test area and electrically connected to the test electrode, and a measurement module.

[0112] Furthermore, a sample solution is also provided in the test area.

[0113] Furthermore, a control solution is provided in the control area and is electrically connected to the control electrode.

[0114] Furthermore, an AC signal output device is connected between the control electrode and the test electrode.

[0115] Furthermore, the AC signal output device is composed of a DC power supply and an RC oscillator circuit. The DC signal generated by the DC power supply generates an AC signal of a certain frequency after passing through the RC oscillator circuit.

[0116] In some embodiments, the sample to be tested includes a nucleic acid sample, a protein sample, a lipid sample, a cell sample, or a drug sample.

[0117] In some embodiments, test probes include nucleic acid probes and protein probes.

[0118] Furthermore, protein probes include antibody probes and non-antibody protein probes that bind to drugs (such as influenza virus neuraminidase (NA) protein that can bind to oseltamivir).

[0119] In some embodiments, the test probe is a nucleic acid probe.

[0120] In some embodiments, the nucleic acid probe comprises a DNA probe; further, a ssDNA probe.

[0121] In some embodiments, the ssDNA probe targets the N gene of SARS-CoV-2. Further, the sequence of the ssDNA probe includes:

[0122]

[0123] In some embodiments, the method for synthesizing an ssDNA probe comprises the following steps:

[0124] S1: Mix the DNA template, primers, polymerase, dNTPs, and buffer to construct the first PCR system; perform a pre-denaturation of the first PCR system, followed by a three-step cycle of denaturation, annealing, and extension, followed by a final extension to amplify the target fragment and prepare dsDNA;

[0125] S2. Mix dsDNA, primers, and a premixed system to construct a second PCR system. Perform a pre-denaturation of the second PCR system, then cycle through three steps of denaturation, annealing, and extension, followed by a final extension to amplify the target fragment. The resulting amplified product is treated with UDG enzyme to prepare an ssDNA probe.

[0126] S1: Prepare dsDNA: Use SARS-CoV-2 genomic cDNA as template and primer pairs to amplify the DNA template with dATP, dCTP, dGTP, and dUTP.

[0127] Furthermore, the DNA template amplification method includes PCR amplification.

[0128] In some embodiments, the PCR amplification system in step S1 includes, with a total volume of 50 μL to 55 μL:

[0129] SARS-CoV-2 genomic cDNA (4.5 ng / μL to 6.5 ng / μL) 2.5 μL to 4.5 μL;

[0130] 5x Taq reaction buffer (without dNTP) 8 μL to 11 μL;

[0131] Taq enzyme (4.5U / μL~6.5U / μL) 0.5μL~2.5μL;

[0132] Forward primer (ATGTCTGATAATGGACCCCAAAATCAGCGAAATG, as shown in SEQ ID NO: 1) 0.5 μL to 2.5 μL;

[0133] Reverse primer (TTAGGCCTGAGTTGAGTCAGCACTGCTCATG, as shown in SEQ ID NO: 2) 0.5 μL to 2.5 μL;

[0134] dATP (10mM)0.15μL~0.75μL;

[0135] dCTP (10mM)0.15μL~0.75μL;

[0136] dGTP (10mM)0.15μL~0.75μL;

[0137] dUTP (10 mM) 0.3 μL to 0.95 μL; and

[0138] The balance is ddH2O.

[0139] Furthermore, the PCR amplification procedure includes:

[0140] Pre-denaturation, a cycle of denaturation, annealing, and extension, and final extension;

[0141] The pre-denaturation temperature is 90℃~97℃, and the pre-denaturation time is 4min~6min;

[0142] The denaturation temperature is 90℃~97℃, and the denaturation time is 15s~30s;

[0143] The annealing temperature is 62°C to 67°C, and the annealing time is 15s to 30s;

[0144] The extension temperature is 72°C and the extension time is 15s to 30s;

[0145] The number of cycles is 30 to 55 times;

[0146] The final extension temperature is 72°C, and the extension time is 4 min to 6 min.

[0147] S2 preparation of ssDNA: In step S2, dsDNA amplified in S1 is used as a template for PCR amplification to obtain single-stranded DNA, and then 0.05U or 0.025U of UDG enzyme is added for treatment to obtain the target single-stranded DNA.

[0148] In some embodiments, the PCR amplification system in step S2 comprises, with a total volume of 50 μL to 55 μL:

[0149] dATP (10mM)0.15μL~0.75μL;

[0150] dCTP (10mM)0.15μL~0.75μL;

[0151] dGTP (10mM)0.15μL~0.75μL;

[0152] dUTP (10 mM) 0.3 μL to 0.95 μL;

[0153] dsDNA(dU)(95ng / μL~107ng / μL)0.5μL~1.8μL;

[0154] 2xTaq Master Mix 23μL~29μL;

[0155] Forward primer (sequence shown in SEQ ID NO: 2: TTAGGCCTGAGTTGAGTCAGCACTGCTCATG) 0.5 μL to 1.8 μL; and

[0156] The balance is ddH2O.

[0157] Furthermore, the PCR amplification procedure includes:

[0158] Pre-denaturation, a cycle of denaturation, annealing, and extension, and final extension;

[0159] The pre-denaturation temperature is 90℃~97℃, and the pre-denaturation time is 4min~6min;

[0160] The denaturation temperature is 90℃~97℃, and the denaturation time is 15s~30s;

[0161] The annealing temperature is 62°C to 67°C, and the annealing time is 15s to 30s;

[0162] The extension temperature is 72°C and the extension time is 15s to 30s;

[0163] The number of cycles is 30 to 55 times;

[0164] The final extension temperature is 72°C, and the extension time is 4 min to 6 min.

[0165] Furthermore, the sequence of the target single-stranded DNA is:

[0166]

[0167] In some embodiments, the ssDNA probe is dissolved in 1.2 mL to 1.5 mL of DEPC water at 20° C. to 35° C. to obtain a colorless and transparent probe solution.

[0168] In some embodiments, the ssDNA probe is stored at 20°C to 35°C for three months.

[0169] In some embodiments, the ssDNA probe is stored at -20°C for more than six months.

[0170] In some embodiments, the control solution includes at least one of the following three control solutions 1) to 3):

[0171] 1) EDTA solution;

[0172] 2) sodium chloride solution; and

[0173] 3) Use a frequency value tester to prepare a control solution with the same frequency value as the probe solution.

[0174] In some embodiments, the pH of the EDTA solution is 7.8-8.2.

[0175] In some embodiments, the molar concentration of the EDTA solution is 0.8 mol / L to 1.2 mol / L.

[0176] In some embodiments, the molar concentration of the sodium chloride solution is 0.8 mol / L to 1.2 mol / L.

[0177] In some embodiments, the preparation of the EDTA solution comprises preparing a colorless and transparent probe solution and an EDTA salt solution into a mixed solution in a volume ratio of 1:1.

[0178] Furthermore, the preparation of EDTA solution includes the following steps: weighing 0.8 mol to 1.2 mol of ethylenediaminetetraacetic acid (EDTA) into 1 ml of ddH2O, and adjusting the pH thereof to 7.8 to 8.2.

[0179] In some embodiments, the test probe is an antibody probe.

[0180] In some embodiments, the sample to be tested includes at least one of a protein sample, a lipid sample, and a cell sample.

[0181] In some embodiments, the test probe is a glycoprotein probe, and the sample to be tested includes a drug sample that can bind to the glycoprotein probe.

[0182] The present application also relates to a biological sample detection device, which includes the biological sample detection system of any of the above technical solutions.

[0183] The present application also relates to a biological sample electrical property detection kit, which includes the above-mentioned biological sample electrical property detection system or biological sample detection device.

[0184] The present application also relates to the application of the biological sample detection method in any of the above technical solutions in biological sample detection or identification.

[0185] Furthermore, the biological samples used for detection or identification can be new coronavirus, interleukin 4 (IL-4), lipopolysaccharide (LPS), cells, oseltamivir, etc.

[0186] This application also relates to applications of biological sample detection systems, including:

[0187] (1) Nucleic acid testing;

[0188] (2) Protein detection;

[0189] (3) lipid detection;

[0190] (4) Cell detection;

[0191] (5) Cell genetic testing;

[0192] (6) Tissue genetic testing;

[0193] (7) Gene sequencing;

[0194] (8) antigen-antibody specificity detection; and

[0195] (9) Protein-protein interaction detection;

[0196] (10) Drug identification and testing.

[0197] In some embodiments, the measured difference is the change in the charge and discharge frequency of the solution, wherein the resistance value can be measured by a DC or AC power supply, and the capacitance and inductance values ​​need to be measured by an AC power supply.

[0198] In some embodiments, the test circuit is a resistor-capacitor oscillator circuit, which measures the conductivity of the solution and compensates for errors caused by external temperature changes by connecting an NTC thermistor to the spare X12 terminal.

[0199] In some implementations, a circuit diagram of a circuit acquisition portion used for testing is shown in FIG8 .

[0200] In some embodiments, the difference signal is displayed on an external screen, and by observing the size of the difference signal, the results of the tested sample are further compared with the positive control and the negative control. The difference in impedance value after the complementary reaction in the solution is used to amplify the tiny current to detect and distinguish between positive and negative samples.

[0201] The following are some specific embodiments of the present application.

[0202] The following examples are provided for the purpose of illustrating various embodiments of the present application and are not intended to limit the present application in any way. Those skilled in the art will understand that variations and other uses thereof are within the scope of the present application, as defined by the scope of the claims. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified. The promoter and terminator sequences mentioned in the examples can also be downloaded from NCBI. The specific sequence starting positions can be obtained based on the primers in the primer table.

[0203] Example 1

[0204] This embodiment is a detection method based on the electrical properties of biological samples. Specifically, single-stranded nucleic acid is used as a test probe to detect RNA or DNA complementary to the probe sequence. Furthermore, single-stranded DNA (ssDNA) probes are used to detect the RNA of the new coronavirus (SARS-CoV-2) and the viral cDNA formed after reverse transcription of RNA.

[0205] RNA or DNA solutions exhibit resistance-capacitance properties. When an AC signal is applied to an RNA or DNA solution, the internal charges continuously accumulate and move, forming an equivalent circuit that can be viewed as a capacitor cascade network. Macroscopically, this manifests as charging and discharging, with the frequency of this charging and discharging being related to its electrical properties and the external environment. When the RNA or DNA sample to be tested specifically binds to the single-stranded nucleic acid test probe, the electrical properties of the solution, including its specific resistance, dielectric constant, and magnetic permeability, change, altering the equivalent circuit and macroscopically affecting its charge and discharge frequency. By detecting changes in the charge and discharge frequency of the RNA or DNA sample solution to be tested, specific samples can be specifically detected.

[0206] The detection method of this embodiment consists of the following steps:

[0207] S1. Benchmark establishment:

[0208] S1.1. Preparation of single-stranded DNA probe: Using the full-length double-stranded DNA (dsDNA) of the SARS-CoV-2 N gene as a template, a single-stranded DNA probe was obtained by asymmetric PCR amplification.

[0209] The basic principle of asymmetric PCR is to use unequal amounts of a pair of primers to generate large amounts of single-stranded DNA (ssDNA). These two primers are called the limiting primer and the non-restricting primer, respectively; the optimal ratio is generally 1:50 to 1:100, with the absolute amount of the limiting primer being crucial. Too much or too little limiting primer is detrimental to the production of ssDNA. Conventional PCR can also be used to generate double-stranded DNA (dsDNA) from the target DNA. Using the ds-DNA as a template, single-primer PCR is then performed using only one of the excess primers to generate ssDNA. Due to their different molecular weights, the resulting dsDNA and ssDNA can be separated during electrophoresis, yielding pure ss-DNA.

[0210] The following steps provide an alternative preparation method to obtain the desired single-stranded DNA.

[0211] (1) Prepare the full-length double-stranded DNA (dsDNA) of the N gene using an appropriate method. The specific steps are as follows:

[0212] Using the SARS-CoV-2 genomic cDNA template, primer pairs were used to perform DNA template PCR amplification with dATP, dCTP, dGTP, and dUTP.

[0213] The PCR amplification system includes the following based on a total volume of 50 μL:

[0214] SARS-CoV-2 genomic cDNA (5 ng / μL) 3 μL;

[0215] 5x Taq reaction buffer (without dNTP) 10 μL;

[0216] Taq enzyme (5 U / μL) 2 μL;

[0217] Forward primer (ATGTCTGATAATGGACCCCAAAATCAGCGAAATG) 1.5 μL;

[0218] Reverse primer (TTAGGCCTGAGTTGAGTCAGCACTGCTCATG) 1.5 μL;

[0219] dATP (10 mM) 0.5 μL;

[0220] dCTP (10 mM) 0.5 μL;

[0221] dGTP (10 mM) 0.5 μL;

[0222] dUTP (10 mM) 0.5 μL; and

[0223] Add ddHO to 50 μL.

[0224] The PCR amplification procedure includes:

[0225] Pre-denaturation, a cycle of denaturation, annealing, and extension, and final extension;

[0226] The pre-denaturation temperature was 95°C and the pre-denaturation time was 5 min;

[0227] The denaturation temperature was 95°C and the denaturation time was 20 s;

[0228] The annealing temperature is 65°C and the annealing time is 20s;

[0229] The extension temperature was 72°C and the extension time was 20 s;

[0230] The number of cycles is 40;

[0231] The final extension temperature was 72°C and the extension time was 5 min.

[0232] (2) A single-stranded DNA probe is obtained by amplifying dsDNA as a template using an appropriate method. For details, please refer to the following steps:

[0233] Single-stranded DNA probes were obtained by asymmetric PCR amplification using dsDNA as a template. The PCR amplification system, with a total volume of 50 μL, included:

[0234] N gene dsDNA (100 ng / μL) 0.5 μL;

[0235] 2xTaq Master Mix 23 μL;

[0236] Forward primer(TTAGGCCTGAGTTTGAGTCAGCACTGCTCATG)0.5μL;

[0237] Add ddHO to 50 μL.

[0238] The PCR amplification procedure is as follows:

[0239] Pre-denaturation, a cycle of denaturation, annealing, and extension, and final extension;

[0240] The pre-denaturation temperature was 95°C and the pre-denaturation time was 1 min;

[0241] The denaturation temperature was 95°C and the denaturation time was 10 s;

[0242] The annealing temperature is 65°C and the annealing time is 15s;

[0243] The extension temperature was 72°C and the extension time was 1 min;

[0244] The number of cycles is 30;

[0245] The final extension temperature was 72°C and the extension time was 5 min.

[0246] The obtained single-stranded DNA probe sequence is:

[0247]

[0248] S1.2. Prepare the test probe solution: Add 1 ng of N gene single-stranded DNA test probe to 120 μl of 0.1 M EDTA solution to create the test probe solution. Submerge the test electrode into the test probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0249] Apply an AC signal between the test electrode and the reference electrode, and set the frequency difference reading to 0 through the measurement module. At this point, the reference solution can be considered to have the same charge and discharge frequency as the test probe solution.

[0250] S2. Sample preparation:

[0251] S2.1. RNA sample solution to be tested:

[0252] S2.1.1. Prepare a SARS-CoV-2-N pseudovirus specimen by diluting 1 mL of recombinant VSV virus containing the SARS-CoV-2N gene (hereinafter referred to as SARS-CoV-2-N pseudovirus) in 4 mL of nucleic acid preservation solution (guanidine salts) at 4°C.

[0253] S2.1.2. Place 200 μl of SARS-CoV-2-N pseudovirus sample in a lysis tube;

[0254] S2.1.3. Add 300 μl of viral lysis buffer (Trizol) and 500 μl of proteinase K solution to the lysis tube. Place the tube in a vortexer and vortex at 12,000 rpm for 10 minutes. After vortexing, centrifuge at 13,000 rpm for 4 minutes and transfer the supernatant.

[0255] S2.1.4. Extract RNA using a fully automated nucleic acid extractor;

[0256] S2.1.5. Use Nanodrop to determine the concentration of the extracted SARS-CoV-2-N pseudovirus RNA.

[0257] S2.2. Negative control RNA sample solution: According to steps S2.1.1-S2.1.5, the recombinant VSV virus containing the N gene of human coronavirus HCoV-HKU-1 (hereinafter referred to as HCoV-HKU-1-N pseudovirus) RNA and human B cell lymphoma A20 whole cell RNA were respectively extracted.

[0258] S2.3. Add equal amounts of RNA dropwise to the test probe solution and control solution over 1 minute to prepare 24 pairs of test sample solutions and control solutions. Place on ice. The RNA content in each solution is shown in Tables 1 and 2.

[0259] S2.4, SARS-CoV-2-N pseudovirus cDNA sample solution: Dissolve 4 μl of HiScript IIQ RT SuperMix for qPCR and 1 ng of SARS-CoV-2 RNA in RNase-free ddH2O to a total volume of 20 μl. Perform reverse transcription at 50°C for 15 min and then at 85°C for 5 s to obtain the DNA sample solution to be tested.

[0260] S2.5. Negative control cDNA sample solution: Dissolve 4 μl of HiScript IIQ RT SuperMix for qPCR and 1 ng of mouse B-cell lymphoma A20 whole-cell RNA in RNase-free ddH2O to a total volume of 20 μl. Reverse transcription was performed at 50°C for 15 min and then at 85°C for 5 s to obtain a negative control DNA sample solution.

[0261] S2.6. Add equal amounts of DNA solution dropwise to the test probe solution and control solution over 1 minute to prepare 12 pairs of test sample solutions and control solutions. Place on ice. The DNA content in each solution is shown in Table 3.

[0262] S3. Sample testing:

[0263] S3.1. The charge-discharge frequency difference between the test probe solution and the control solution with the RNA sample added was measured using a measurement module (test temperature was 25°C). The test results are shown in Table 2, Table 3, and Figure 2, which show the measurement results for the solution containing SARS-CoV-2-N pseudovirus RNA and the solution containing only negative control RNA, respectively.

[0264] Table 2 Concentration and measurement results of SARS-CoV-2-N pseudovirus RNA

[0265] Table 3 Concentration and measurement results of negative control RNA only

[0266] From the results of Table 2, Table 3 and Figure 2, it can be seen that when the RNA in the sample to be tested contains a sequence (SARS-CoV-2N gene) that is complementary to the test probe (SARS-CoV-2N gene single-stranded probe), the two specifically bind, so that the frequency difference measured between the test probe and the control probe is large. When the RNA in the sample (HCoV-HKU1, A20 cell-derived RNA) is not complementary to the test probe (SARS-CoV-2N gene single-stranded probe), there is no specific binding between the two, so that the frequency difference between the test probe and the control probe is only the background value. This example shows that by measuring the frequency difference, the properties of the RNA complementary to the test probe can be determined, and the detection of specific RNA, specifically, the detection of SARS-CoV-2, can be achieved.

[0267] S3.2. The charge-discharge frequency difference between the test probe solution and the control solution with the DNA sample added was measured using a measurement module (test temperature was 25°C). The test results are shown in Table 4 and Figure 3, which show the measurement results for the solution containing SARS-CoV-2N gene DNA and the solution containing only negative control DNA, respectively.

[0268] Table 4 Concentration and measurement results of DNA containing SARS-CoV-2N gene or negative control

[0269] From the results in Table 4 and Figure 3, it can be seen that when the DNA in the sample to be tested contains a sequence (SARS-CoV-2N gene) that is complementary to the test probe (SARS-CoV-2N gene single-stranded probe), the two specifically bind, resulting in a larger frequency difference between the test probe and the control probe. However, when the DNA in the sample (DNA derived from A20 cells) is not complementary to the test probe (SARS-CoV-2N gene single-stranded probe), there is no specific binding between the two, resulting in a frequency difference between the test probe and the control probe that is only the background value. This example shows that by measuring the frequency difference, the properties of the DNA complementary to the test probe can be determined, thereby enabling detection of specific DNA, specifically, detection of SARS-CoV-2 cDNA.

[0270] Example 2

[0271] This embodiment is a detection method based on the electrical properties of biological samples. Specifically, lipopolysaccharide (LPS) is detected using lipopolysaccharide (LPS) antibodies as a test probe. LPS solution has resistance-capacitance characteristics. When an AC signal is applied to the LPS sample solution to be tested, the internal charges continuously accumulate and move, and its equivalent circuit can be viewed as a capacitor cascade network. Macroscopically, it manifests as charge and discharge, and the frequency of this charge and discharge is related to its own electrical properties and the external environment. When the LPS sample to be tested specifically binds to the LPS antibody test probe, the electrical properties of the solution, including specific resistance, dielectric constant, and magnetic permeability, change, causing the equivalent circuit to change, which macroscopically affects its charge and discharge frequency. By detecting changes in the charge and discharge frequency of the LPS sample solution to be tested, different concentrations of LPS can be specifically detected.

[0272] The detection method of this embodiment consists of the following steps:

[0273] S1. Benchmark establishment:

[0274] S1.1. Prepare the specific test probe solution: Add 1 ng of LPS antibody test probe to 120 μl of 0.1 M EDTA solution to create the specific test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0275] S1.2. Prepare the negative control test probe solution: Add 1 ng of CD19 antibody test probe to 120 μl of 0.1 M EDTA solution to create the negative control test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution is 120 μl of 0.1 M EDTA solution.

[0276] S1.3. Apply an AC signal between the test electrode and the reference electrode, and set the frequency difference reading to 0 through the measurement module. At this point, the reference solution can be considered to have the same charge and discharge frequency as the test probe solution.

[0277] S2. Sample preparation:

[0278] S2.1. LPS Sample Solution to be Tested: Dissolve LPS in PBS to a 5 μg / mL LPS solution and place on ice. Add equal amounts of LPS solution dropwise to the test probe solution (specific or negative control) and control solution over 1 minute to achieve different final concentrations. Final LPS concentrations are shown in Table 5.

[0279] S2.2 Negative Control Sample Solution: Dissolve IL-4 protein in PBS to prepare a 20 μg / mL IL-4 solution and place on ice. Add equal amounts of IL-4 solution dropwise to the LPS antibody test probe solution and control solution over 1 minute to achieve different final concentrations. Final IL-4 concentrations are shown in Table 8.

[0280] S3. Sample testing:

[0281] S3.1. Detect LPS using a specific test probe: Pass an AC signal between the test electrode and the control electrode. Using the measurement module, measure the frequency difference at various LPS concentrations (test temperature: 25°C). Repeat the test once. See Table 5 and Figure 4 for test results.

[0282] Table 5. Frequency difference test results at various LPS concentrations (test temperature: 25°C)

[0283] The above test probe solutions containing different amounts of LPS were incubated at 37°C for 10 minutes and then tested again (test temperature was 25°C). The test was repeated once. The test results are shown in Table 6 and Figure 4.

[0284] Table 6. Frequency difference test results at various LPS concentrations after incubation at 37°C for 10 minutes (test temperature is 25°C)

[0285] From the results in Tables 5 and 6 and Figure 4 , it can be seen that LPS can be determined dose-dependently by frequency difference, and LPS as low as 0.0390625 μg / mL can be detected after incubation at 37°C for 10 min.

[0286] S3.2. Detect LPS using a negative control test probe: Pass an AC signal between the test electrode and the control electrode. Measure the frequency difference at various LPS concentrations using the measurement module (test temperature: 25°C). Repeat the test once. See Table 7 for test results.

[0287] Table 7. Frequency difference test results of negative control probe at various LPS concentrations (test temperature: 25°C)

[0288] From the results in Table 6, it can be seen that the negative control antibody cannot detect LPS as a test probe.

[0289] S3.3. Detection of IL-4 protein negative control using LPS antibody test probe: The above test solutions containing different amounts of IL-4 were tested using the LPS antibody test probe (test temperature was 25°C) and the test was repeated once. The test results are shown in Table 8.

[0290] Table 8. Frequency difference test results of LPS antibody test probe at various IL-4 concentrations (test temperature is 25°C)

[0291] From the results in Table 8, it can be seen that the negative control IL-4 protein cannot be detected using the LPS antibody test probe.

[0292] The above test results show that the detection method based on the electrical properties of biological samples described in this embodiment has excellent specificity and sensitivity.

[0293] Example 3

[0294] This embodiment is a detection method based on the electrical properties of biological samples. Specifically, IL-4 is detected using an IL-4 antibody as a test probe. The IL-4 solution has resistance-capacitance characteristics. When an AC signal is applied to the IL-4 sample solution to be tested, the internal charge continuously accumulates and moves, and its equivalent circuit can be viewed as a capacitor cascade network. Macroscopically, this manifests as charge and discharge, and the frequency of this charge and discharge is related to its own electrical properties and the external environment. When the IL-4 sample solution to be tested specifically binds to the IL-4 antibody test probe, the electrical properties of the solution, including specific resistance, dielectric constant, and magnetic permeability, change, causing the equivalent circuit to change, which macroscopically affects its charge and discharge frequency. By detecting changes in the charge and discharge frequency of the IL-4 sample solution to be tested, different concentrations of IL-4 can be specifically detected.

[0295] The detection method of this embodiment consists of the following steps:

[0296] S1. Benchmark establishment:

[0297] S1.1. Prepare the specific test probe solution: Add 0.001 ng of IL-4 antibody test probe to 120 μl of 0.1 M EDTA solution to create the test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0298] S1.2. Apply an AC signal between the test electrode and the reference electrode, and set the frequency difference reading to 0 through the measurement module. At this point, the reference solution can be considered to have the same charge and discharge frequency as the test probe solution.

[0299] S2. Sample preparation:

[0300] S2.1. IL-4 Sample Solution to be Tested: Dissolve IL-4 protein in PBS to a 20 μg / mL IL-4 solution and place on ice. Add varying amounts of IL-4 to the test probe solution and control solution over a 1-minute period to achieve varying final concentrations. See Table 8 for final IL-4 concentrations.

[0301] S2.2 Negative Control Sample Solution: Dissolve LPS in PBS to prepare a 5 μg / mL LPS solution and place on ice. Add equal amounts of LPS solution dropwise to the IL-4 antibody test probe solution and control solution over 1 minute to achieve different final concentrations. Final LPS concentrations are shown in Table 10.

[0302] S3. Sample testing:

[0303] S3.1. Detecting IL-4 using a specific test probe: Pass an AC signal between the test electrode and the control electrode. Using the measurement module, measure the frequency difference at various IL-4 concentrations (test temperature: 25°C). Repeat the test once. See Table 9 and Figure 5 for test results.

[0304] Table 9 Frequency difference test results at various IL-4 concentrations (test temperature is 25°C)

[0305] The above test probe solutions containing different amounts of IL-4 were incubated at 37°C for 30 minutes and then tested again (test temperature was 25°C). The test was repeated once. The test results are shown in Table 10 and Figure 5.

[0306] Table 10 Frequency difference test results at various IL-4 concentrations after incubation at 37°C for 30 minutes (test temperature is 25°C)

[0307] From the results in Tables 9 and 10 and FIG5 , it can be seen that IL-4 can be measured dose-dependently by frequency difference, and IL-4 as low as 0.0000002 μg / mL can be measured after incubation at 37° C. for 30 minutes.

[0308] S3.2. LPS negative control using IL-4 antibody test probe: The above test solutions containing different amounts of LPS were tested using the IL-4 antibody test probe (test temperature: 25°C) and the test was repeated once. The test results are shown in Table 11.

[0309] Table 11 Frequency difference test results of IL-4 antibody test probe at various LPS concentrations (test temperature is 25°C)

[0310] From the results in Table 11, it is known that the LPS negative control could not be detected using the IL-4 antibody test probe.

[0311] The above test results show that the detection method based on the electrical properties of biological samples described in this embodiment has excellent specificity and sensitivity.

[0312] Example 4

[0313] The present embodiment is a kind of detection method based on the electrical properties of biological samples, specifically, utilizes CD19 antibody as test probe to detect the A20 cells of CD19 positive on cell surface.Cell suspension is a resistance-capacitance characteristic solution. When the cell suspension sample to be measured is fed into an AC signal, the internal charge continuously gathers and moves, and its equivalent circuit can be seen as the form of a capacitor cascade network, which is macroscopically manifested as charge and discharge, and the frequency of its charge and discharge is related to its own electrical properties and external environment.After the cell suspension sample to be measured is specifically bound to the CD19 antibody probe, the electrical properties of the solution include specific resistance, dielectric constant, and magnetic permeability, which change the equivalent circuit and affect its charge and discharge frequency macroscopically.Different types of cells can be specifically measured by the charge and discharge frequency change of the cell suspension sample to be measured.

[0314] The detection method of this embodiment consists of the following steps:

[0315] S1. Benchmark establishment:

[0316] S1.1. Prepare the specific test probe solution: Add 2 ng of CD19 antibody test probe to 120 μl of 0.1 M EDTA solution to create the test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0317] S1.2. Prepare the negative control test probe solution: Add 2 ng of CD11b antibody test probe to 120 μl of 0.1 M EDTA solution to create the negative control test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0318] S1.3. Apply an AC signal between the test electrode and the reference electrode, and set the frequency difference reading to 0 through the measurement module. At this point, the reference solution can be considered to have the same charge and discharge frequency as the test probe solution.

[0319] S2. Sample preparation:

[0320] S2.1, take 10 6 A20 cells were suspended in 1 mL of 1640 culture medium, centrifuged at 500 g for 5 min at 4°C to pellet the cells, and the supernatant was discarded; the cells were resuspended in 200 μL of PBS solution.

[0321] S3. Sample testing:

[0322] S3.1. Detection using a specific test probe: Pass an AC signal between the test electrode and the control electrode. Measure the frequency difference using the measurement module (test temperature: 25°C). Repeat the test once. See Table 12 and Figure 6 for test results.

[0323] S3.2. Test using the negative control probe: Pass an AC signal between the test electrode and the control electrode. Measure the frequency difference using the measurement module (test temperature is 25°C). Repeat the test once. The test results are shown in Table 12 and Figure 6.

[0324] Table 12. Frequency difference test results of A20 cell samples

[0325] The results in Table 12 show that B-cell lymphoma A20 cells carry CD19 protein on their surface, which specifically binds to the CD19 antibody. On the other hand, CD11b is a marker protein on the surface of macrophages, and A20 cells lack CD11b on their surface, so the CD11b antibody does not specifically bind to A20 cells. In other words, the frequency difference can be used to determine whether the test antibody specifically binds to the cell.

[0326] From this example, we know that this technology can be used to identify different types of cells by detecting cell surface proteins.

[0327] Example 5

[0328] The present embodiment is a detection method based on the electrical properties of biological samples. Specifically, influenza virus neuraminidase (NA) protein is used as a test probe to detect oseltamivir. Oseltamivir solution is a resistance-capacitance characteristic solution. When the oseltamivir sample solution to be measured is fed with an AC signal, the internal charge continuously gathers and moves, and its equivalent circuit can be seen as the form of a capacitor cascade network. Macroscopically, it is shown as charge and discharge, and the frequency of its charge and discharge is related to its own electrical properties and external environment. After the oseltamivir sample to be measured is specifically bound to the NA protein test probe, the electrical properties of the solution, including specific resistance, dielectric constant, and magnetic permeability, change, so that the equivalent circuit changes, and macroscopically affects its charge and discharge frequency. The combination of oseltamivir and NA protein can be specifically detected by detecting the charge and discharge frequency change of the oseltamivir sample solution to be measured.

[0329] The detection method of this embodiment consists of the following steps:

[0330] S1. Benchmark establishment:

[0331] S1.1. Prepare the specific test probe solution: Add 0.1 ng of NA protein test probe to 120 μl of 0.1 M EDTA solution to create the test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution consists of 120 μl of 0.1 M EDTA solution.

[0332] S1.2. Preparation of negative control test probe solution: Add 0.1 ng of Sars-CoV-2 (N) test probe to 120 μl of 0.1 M EDTA solution to prepare the negative control test probe solution. Submerge the test electrode into the probe solution and the control electrode into the control solution. The control solution is 120 μl of 0.1 M EDTA solution.

[0333] S1.3. Apply an AC signal between the test electrode and the reference electrode, and set the frequency difference reading to 0 through the measurement module. At this point, the reference solution can be considered to have the same charge and discharge frequency as the test probe solution.

[0334] S2. Sample preparation:

[0335] S2.1. Oleltamivir sample solution to be tested: Dissolve oseltamivir in PBS to prepare a 0.005 μg / mL oseltamivir solution.

[0336] S3. Sample testing:

[0337] S3.1. Detection of oseltamivir using a specific test probe: An AC signal was passed between the test electrode and the control electrode, and the frequency difference was measured using a measurement module (test temperature was 25°C). The test results are shown in Table 13 and Figure 7.

[0338] Table 13 Osoltamivir frequency difference test results (test temperature: 25°C)

[0339] From the results in Table 13 and Figure 7, it was found that the binding of oseltamivir to NA protein could be determined by frequency difference, and oseltamivir concentrations as low as 0.005 μg / mL could be measured.

[0340] The above test results show that the detection method based on the electrical properties of biological samples described in this embodiment has excellent specificity and sensitivity.

[0341] In summary, the present invention can perform qualitative and quantitative detection of trace samples by amplifying tiny currents without the need for amplification; it can eliminate the influence of environmental factors on the solution frequency by means of differential analysis, thus achieving high accuracy; and it can achieve discrimination based on the binding specificity between different types of biological samples and probes. The detection method of the present invention is highly efficient and time-efficient, and can compress the detection time of nucleic acids to 1 to 3 minutes, and the detection time of proteins, lipids, and cells to 1 to 10 minutes, thereby effectively avoiding the use of time-consuming techniques such as qRT-PCR, ELISA, and immunofluorescence.

[0342] The various technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. In order to make the description concise, not all possible combinations of the various technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of the description in this specification.

[0343] The above-described embodiments merely illustrate several embodiments of the present application and do not limit the implementation methods and protection scope of the present application. Those skilled in the art should be aware that any solutions obtained by equivalent substitutions and obvious changes made using the description and drawings of the present application should be included in the protection scope of the present application.

Claims

1. A method for detecting a biological sample, characterized in that: The steps include: Dissolving the test probe in a solvent to obtain a test probe solution, and connecting the test probe solution to a test electrode; Take a blank solvent, and connect the blank solvent to a reference electrode; Input power signals to the test electrode and the control electrode, test and record the respective charge and discharge frequencies with a measurement module, and set the frequency difference to 0 through the measurement module. After the setting is completed, disconnect the test probe solution and the test electrode; Taking a biological sample to be tested, adding a test probe for specific binding to prepare a test solution, and connecting the test probe solution to the test electrode; A power supply signal is input to the test electrode and the control electrode, and the respective charge and discharge frequencies are tested and recorded by a measurement module, and the difference is calculated, and different biological samples are distinguished by the calculated difference.

2. The method for detecting biological samples according to claim 1, characterized in that: The power supply signal is an AC signal or a mixed signal having both an AC component and a DC component.

3. The method for detecting biological samples according to claim 2, characterized in that: The AC signal is converted from a DC power source through an RC oscillation circuit.

4. The method for detecting biological samples according to claim 3, characterized in that: The RC oscillation circuit generates an excitation source through a microcontroller MCU.

5. The method for detecting biological samples according to claim 4, characterized in that: The test probe operates by detecting a current commutation times signal after being excited by an excitation source.

6. The method for detecting biological samples according to claim 3, characterized in that: The test probe is coated on a plate in advance or dissolved in a reaction system, and is further placed in a test area, thereby further connected in series in a circuit.

7. The method for detecting biological samples according to claim 3, characterized in that: The RC oscillator circuit also has a ground signal and a shielding layer to reduce signal interference from the bulk solution.

8. The method for detecting biological samples according to claim 3, characterized in that: The test electrodes are coupled to the plurality of solution capacitors being measured to prevent influence due to a DC bias level from a driver circuit.

9. The method for detecting biological samples according to claim 1, characterized in that: The electrical properties of the biological sample include specific resistance, dielectric constant, magnetic permeability and equivalent circuit before and after the biological sample to be tested specifically binds to the test probe.

10. The biological sample detection method according to claim 9, characterized in that: The equivalent circuit changes before and after the biological sample to be tested specifically binds to the test probe, thereby affecting its charge and discharge frequency.

11. The method for detecting biological samples according to claim 10, characterized in that: The change of the charge-discharge frequency between the test electrode and the control electrode due to the specific binding of the test probe to the biological sample to be tested is detected in a differential manner, thereby eliminating the influence of other external environments on the charge-discharge frequency.

12. The method for detecting biological samples according to claim 1, characterized in that: The test probes include nucleic acid probes and protein probes.

13. The method for detecting biological samples according to claim 12, characterized in that: The nucleic acid probe includes a DNA probe; further, a ssDNA probe.

14. The method for detecting biological samples according to claim 12, characterized in that: The protein probes include antibody probes and non-antibody protein probes combined with drugs.

15. The method for detecting biological samples according to claim 1, characterized in that: The biological samples to be tested include nucleic acid samples, protein samples, lipid samples, cell samples, and drug samples.

16. A biological sample detection system, characterized in that: It includes a test probe, a test electrode, a reference electrode and a measurement module; Wherein, the test probe, the test electrode, the reference electrode and the measurement module are as defined in any one of claims 1 to 15.

17. A biological sample detection device, characterized in that: Includes the biological sample detection system as described in claim 16.

18. A biological sample detection kit, characterized in that: Comprising the biological sample detection system according to claim 16 or the biological sample detection device according to claim 17.

19. Use of the detection method according to any one of claims 1 to 15, or the biological sample detection system according to claim 16 in biological sample detection and identification.

20. The use according to claim 19, characterized in that The biological samples to be tested or identified include the new coronavirus, interleukin-4, lipopolysaccharide, cells, and drugs.

21. Use of the detection method according to any one of claims 1 to 15, or the biological sample detection system according to claim 16 in the detection of trace biological samples, characterized in that: The applications described include: (1) Nucleic acid testing; (2) Protein detection; (3) Lipid detection; (4) Cell detection; (5) Cell genetic testing; (6) Organize genetic testing; (7) Gene sequencing; (8) Antigen-antibody specificity detection; (9) Protein-protein interaction detection; and (10) Drug identification testing.

Images