Method for regulating adenosine content in body and Anti-tumor reagent

Abstract

The present invention provides a method for preparing a reagent for regulating the content of adenosine in the body, an anti-tumor reagent, a nanoparticle containing ADA, and a preparation method. The present invention explains for the first time that, under the influence of K-ras oncogene signals, tumor metabolism is reprogrammed, resulting in high accumulation of adenosine inside and outside tumor cells, thereby promoting tumor cell growth. Adenosine accumulated in the tumor microenvironment can significantly inhibit the function of immune cells, leading to immune escape and reducing the response rate to immunotherapy. The invention also provides a new immunotherapy combination therapy and a reagent, overcoming the problems of K-ras mutant tumors having low response rates to existing immunotherapy and limited clinical applications, and significantly improving the effect of anti-tumor immunotherapy.

Description

Method for regulating adenosine content in vivo and anti-tumor agent

[0001] This application claims priority to the prior Chinese application, application number: 2023112075775, filing date: September 18, 2023. Technical Field

[0002] The present invention relates to the field of biomedicine, specifically to the field of pharmaceutical preparations, and especially to a method for using K-ras gene to prepare a reagent for regulating adenosine content in the body and an anti-tumor reagent. Background Art

[0003] KRAS mutations are a major oncogenic driver, extensively studied over the past 30 years and implicated in approximately 90% of pancreatic cancers, 40% of colon cancers, and 20-30% of lung cancers. KRAS is one of the most important sensors, primarily involved in the activation of two key pathways: KRAS-RAF-MEK-ERK and KRAS-PI3K-AKT-mTORC. These pathways promote anabolic processes, including cell growth, protein translation, and proliferation, leading to tumorigenesis and malignant progression. Studies have shown that KRAS-mutant colorectal and pancreatic cancers are minimally responsive to immune checkpoint blockade. KRAS mutations can promote tumor immune evasion by affecting the tumor microenvironment and upregulating programmed cell death ligand 1 (PD-L1), resulting in resistance to anti-PD-1 therapy. However, the impact of KRAS on the tumor microenvironment, the role of KRAS-mediated tumor immune evasion, and treatment strategies for patients with KRAS-mutant tumors require further investigation.

[0004] Adenosine deaminase, an endogenous nucleosidase, is widely distributed throughout human tissues, primarily located in the cytoplasm. It is the primary catalytic enzyme in adenosine metabolism, converting adenosine to inosine. Excessive proliferation and invasion of cancerous tissues create a hypoxic tumor microenvironment, limiting the availability of energy sources and inducing the accumulation of extracellular ATP and the metabolite adenosine. High concentrations of extracellular adenosine bind to adenosine receptors on immune cells, hindering their activation and infiltration, creating an immunosuppressive microenvironment and significantly limiting the effectiveness of immunotherapy. In contrast to the immunosuppressive effects of adenosine, inosine supplementation has been shown to enhance T cell-mediated cytotoxicity. In addition, inosine can enhance immune checkpoint blockade, alleviate the metabolic restriction of tumors on T cells, and improve anti-tumor immunity.

[0005] Tumor immunotherapy is a new method of treating tumors. Under normal circumstances, the human immune system has the ability to recognize and eliminate mutated tumor cells. However, during the development and evolution of tumors, some cancer cells acquire the ability to adapt to their microenvironment to survive and grow, and through multiple signaling pathway changes and metabolic remodeling, produce an immunosuppressive tumor microenvironment to avoid detection and killing by the immune system. Tumor immunotherapy controls and kills tumor cells by stimulating or rebuilding the body's immune system. It is another effective tumor treatment after surgery, radiotherapy, chemotherapy, and targeted therapy. Immunotherapy for colorectal cancer has also made great progress in recent years, but a large proportion of colorectal cancer patients cannot benefit from immunotherapy, and low immunotherapy response rates and primary drug resistance remain the biggest challenges. Therefore, there is an urgent need to find more effective treatment strategies to improve the tumor immunosuppressive microenvironment and thus stimulate the body's powerful anti-tumor effect.

[0006] Considering the poor in vivo efficacy of most anticancer drugs, often associated with multiple side effects, poor bioavailability, poor clearance, and drug resistance, a variety of nanocarriers, such as polymer nanoparticles, drug-conjugated particles, liposomes, and microcells, have been developed to address these issues and improve drug delivery in vivo. Recent research has demonstrated that nanocarriers offer significant therapeutic advantages for tumor delivery, including reducing drug toxicity to normal cells, inhibiting drug resistance in tumor cells, controlling drug release, and improving drug bioavailability in tumors by enhancing drug penetration and release. Poly(lactic-co-glycolic acid) (PLGA) is a polymer of choice due to its biocompatibility, ease of surface loading, poor biodegradability, and lack of significant side effects. It is also an FDA-approved nanocarrier for in vivo studies. PLGA nanoparticles loaded with polyethylene glycol (PEG) are stable in solvents and have recently shown promising in vivo therapeutic potential against various solid tumors.

[0007] Summary of the Invention

[0008] The present invention's research discovered for the first time that, driven by the oncogenic factor of the tumor gene K-ras, tumor cells undergo metabolic reprogramming, leading to the accumulation of adenosine in tumor cells and promoting the growth of tumor cells. The accumulation of adenosine released from tumor cells into the tumor tissue microenvironment significantly inhibits the function of immune cells, which is an important mechanism leading to tumor immune escape and can result in a low response rate to immunotherapy. The present invention clarified for the first time the molecular mechanism by which K-ras promotes adenosine accumulation by promoting the expression of NT5E while inhibiting the expression of ADA. By using some inhibitory reagents for the K-ras gene or eliminating oncogenic factors, the growth and invasion ability of tumor cells can be eliminated and suppressed, and the inhibitory effect on immune cells can be lifted, which is specifically manifested in promoting the secretion of T cell immune factors, enhancing the ability of T cells to kill tumor cells, and at the same time reversing the cold tumor characteristics of colorectal cancer and increasing its sensitivity and response to PD-1 antibodies.

[0009] Therefore, in its first aspect, the present invention provides the use of a K-ras gene for preparing a reagent for regulating adenosine levels in a mammal. In some embodiments, the regulation includes reducing adenosine levels. In some embodiments, the regulation includes reducing the adenosine content or concentration outside of tumor cells, and of course also includes reducing adenosine content inside tumor cells, thereby reducing the amount of adenosine secreted outside the tumor by the tumor cells. In some embodiments, the tumor cells include one or more of colon cancer, rectal cancer, lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchial lung cancer, ovarian cancer, Wilms' tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, and medullary thyroid cancer cells. In some embodiments, the tumor cells are tumor cells with a K-ras mutation or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells. The mammalian subject herein includes mammals or humans.

[0010] In some embodiments, the reagent includes a reagent component capable of eliminating, knocking out, or knocking down K-ras gene expression. In some embodiments, the reagent includes a reagent capable of inhibiting K-ras gene expression, such as one or more of siRNA, shRNA, and the inhibitor LUMAKRAS (AMG-510), MRTX1133, GFH925, or a K-ras protein formulation.

[0011] In some embodiments, the agent includes an agent capable of inhibiting the activity of or reducing the level of K-ras protein.

[0012] In some embodiments, the K-ras gene regulates adenosine content by regulating ADA and NT5E.

[0013] In some embodiments, the K-ras gene increases the content of adenosine by reducing the content or activity of ADA and enhancing the content or activity of NT5E.

[0014] In some embodiments, the tumor cells are tumor cells with K-ras mutation or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells.

[0015] In some embodiments, the agent is capable of reducing the level of adenosine in the tumor tissue microenvironment, thereby relieving or reducing the immunosuppressive function of adenosine.

[0016] In some embodiments, the agent can increase the secretion of immune cytokines IFN-γ, TNF-α, and granzyme B in the cell co-culture system. In some embodiments, the agent can promote immunotherapy and exert a synergistic anti-tumor effect in combination with immunotherapy. In some embodiments, the tumor immunotherapy refers to a therapy that uses the body's immune system to fight tumor cells, including one of immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy. In some embodiments, the immunotherapy is an immune checkpoint inhibitor, including one of CTLA4 antibody, PD-1 antibody, and PD-L1 antibody.

[0017] In some embodiments, the agent comprises nanoparticles containing an adenosine-modulating drug.

[0018] In some embodiments, it is characterized in that the nanomaterial of the nanoparticles includes one or more of polyethylene glycol (PEG), polylactic acid-glycolic acid (PLGA), polycaprolactone (PCL), and polyvinyl alcohol (PVA). In some embodiments, the nanomaterial of the nanoparticles is polyethylene glycol (PEG) and polylactic acid-glycolic acid (PLGA). In some embodiments, the drug that regulates adenosine includes one of adenosine deaminase (ADA), inosine, and NT5E inhibitors. In some embodiments, the drug that regulates adenosine is adenosine deaminase (ADA). In some embodiments, the average particle size of the nanoparticles is less than 100 nm; the average particle size of the ADA nanoformulation is between 100-300 nm.

[0019] The present invention constructs and cultures a cell line in vitro that uses doxycycline to induce K-ras (K-ras / On) expression. Mass spectrometry is used to detect intracellular and extracellular adenosine levels. Induced activation of the mutant tumor gene K-ras significantly increases intracellular and extracellular adenosine levels. siRNA-mediated knockdown of K-ras expression significantly reduces adenosine levels inside and outside tumor cells. Simultaneously, the transcript levels and protein levels of adenosine metabolism-related enzymes in the constructed K-ras / On cell line and cell lines with siRNA-mediated knockdown or shRNA-mediated knockout were measured. This demonstrates that the K-ras gene increases adenosine content by reducing the expression of adenosine deaminase ADA and enhancing the content or activity of NT5E, thereby causing tumor immune escape.

[0020] In the second aspect of the present invention, the present invention designs and constructs a PEG-PLGA-loaded adenosine deaminase nanoparticle to achieve in vivo anti-tumor effects. Its function is to promote the metabolic degradation of adenosine through the metabolic enzyme function of ADA, thereby relieving or reducing its inhibitory effect on immune cells, thereby achieving the purpose of effectively improving the anti-tumor immunotherapy effect.

[0021] The purpose of the present invention is to provide an ADA nanoformulation, a preparation method thereof, and anti-tumor applications. The nanoformulation can prolong the half-life of adenosine deaminase in the body and prolong its retention in tumor tissues. Through the catalytic function of adenosine deaminase, it promotes the metabolic degradation of adenosine, relieves the immunosuppressive effect of adenosine, and thus promotes anti-tumor immune function, specifically by increasing the secretion of T cell immune factors, enhancing the ability of T cells to kill tumor cells, and effectively inhibiting tumor growth.

[0022] In a third aspect of the present invention, the ADA nanoformulation provided by the present invention is a PEG-PLGA loaded adenosine deaminase nanoparticle, and the preparation method thereof comprises the following steps:

[0023] (1) First, a W / O emulsion was prepared using a lipophilic emulsifier. The pre-prepared PLGA-PEG solution dissolved in 0.2 mL of ADA aqueous solution was transferred to 4 mL of ethyl acetate and ultrasonically emulsified for 5 minutes to obtain colostrum.

[0024] (2) Add the emulsion to the aqueous phase containing a hydrophilic emulsifier to obtain a W / O / W emulsion. Use 2 mL of 1% polyvinyl alcohol (PVA) for ultrasonic emulsification for 5 minutes, then gently drop the emulsion into 10 mL of 2% PVA and re-emulsify to obtain a double emulsion.

[0025] (3) After vacuum evaporation of the residual organic solvent, the mixture was centrifuged at 12,000 rpm for 10 min at room temperature, and then the PEG-PLGA-loaded adenosine deaminase nanoparticles were collected by ultracentrifuge.

[0026] In the present invention, the nanomaterial of the ADA nanoformulation includes polyethylene glycol (PEG), polylactic acid-glycolic acid (PLGA), polycaprolactone (PCL) or polyvinyl alcohol (PVA). Preferably, the nanomaterial of the ADA nanoformulation is polyethylene glycol (PEG) and / or polylactic acid-glycolic acid (PLGA).

[0027] In the present invention, the drug loaded in the nanoformulation is a drug that reduces intracellular adenosine content, including one of adenosine deaminase (ADA), inosine and NT5E inhibitors. Preferably, the drug loaded in the nanoformulation is adenosine deaminase (ADA).

[0028] In the present invention, the average particle size of the nano preparation is less than 100 nm; the average particle size of the ADA nano preparation is in the range of 100-300 nm.

[0029] In the present invention, the ADA nanoformulation can inhibit tumor growth, and the anti-tumor field includes one or more of lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchogenic carcinoma, ovarian cancer, Wilms' tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, and medullary thyroid cancer. Preferably, the tumor is a tumor with K-ras mutation or abnormal activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer.

[0030] In the present invention, the ADA nanoformulation can reduce the level of adenosine inside and outside cancer cells and in the tumor microenvironment in vivo.

[0031] In the present invention, the ADA nanoformulation increases the secretion of immune cytokines IFN-γ, TNF-α, and granzyme B in the cell co-culture system, promoting immunotherapy and exerting a synergistic anti-tumor effect in combination with immunotherapy. Immunotherapy refers to therapies that use the body's immune system to fight tumor cells, including immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy. The immune checkpoint inhibitors include but are not limited to CTLA4 antibodies, PD-1 antibodies, and PD-L1 antibodies. Preferably, they are PD-1 antibodies.

[0032] In a fourth aspect, the present invention provides a method for regulating adenosine levels in a mammal, comprising: controlling the K-ras gene in the mammal using a reagent, thereby regulating adenosine levels in the mammal. In some embodiments, the regulation comprises reducing adenosine levels. In some embodiments, the regulation comprises reducing the adenosine level or concentration outside of tumor cells or reducing the adenosine level or concentration in tumor cells.

[0033] In some embodiments, the reagent can eliminate, knock out, or reduce K-ras gene expression. In some embodiments, the reagent includes an agent capable of inhibiting K-ras gene expression, such as one or more of siRNA, shRNA, and the inhibitors LUMAKRAS (AMG-510), MRTX1133, GFH925, or K-ras protac preparations. In some embodiments, the reagent includes an agent capable of inhibiting the activity of or reducing the level of K-ras protein expressed.

[0034] In some embodiments, the K-ras gene regulates adenosine levels by regulating ADA and NT5E. In some embodiments, the K-ras gene increases adenosine levels by reducing ADA levels or activity and enhancing NT5E levels or activity.

[0035] In some embodiments, the sequence of the K-ras gene is the sequence shown by NCBI sequence number NM-001369786.1 or NCBI sequence number NM-001403240.1.

[0036] In some embodiments, the tumor cells include one or more of colon cancer, rectal cancer, lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchogenic carcinoma, ovarian cancer, Wilms' tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, and medullary thyroid cancer cells. In some embodiments, the tumor cells are tumor cells with K-ras mutation or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells.

[0037] In some ways, the agent can reduce the level of adenosine in the tumor tissue microenvironment, thereby relieving or reducing the immunosuppressive function of adenosine. In some ways, wherein, the agent can increase the secretion of immune cytokines IFN-γ, TNF-α and granzyme B in the cell co-culture system. In some ways, the agent can promote immunotherapy and combine immunotherapy to exert a synergistic anti-tumor effect. In some ways, the tumor immunotherapy refers to a therapy that uses the body's immune system to fight tumor cells, including one of immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy. In some ways, the immunotherapy is an immune checkpoint inhibitor, including one of CTLA4 antibodies, PD-1 antibodies, and PD-L1 antibodies.

[0038] In some embodiments, the reagent comprises nanoparticles containing a drug that regulates adenosine. In some embodiments, the nanomaterial of the nanoparticles comprises one or a combination of polyethylene glycol (PEG), polylactic-co-glycolic acid (PLGA), polycaprolactone (PCL), and polyvinyl alcohol (PVA). In some embodiments, the nanomaterial of the nanoparticles is polyethylene glycol (PEG) or polylactic-co-glycolic acid (PLGA).

[0039] In some embodiments, the drug that regulates adenosine includes one of adenosine deaminase (ADA), inosine, and NT5E inhibitors. In some embodiments, the drug that regulates adenosine is adenosine deaminase (ADA).

[0040] In some embodiments, the average particle size of the nanoparticles is less than 100 nm; the average particle size of the ADA nanoparticle preparation is

[0041] Between 100-300nm range.

[0042] A fifth aspect of the present invention provides a reagent for regulating adenosine levels in a mammal, comprising: a reagent component that controls the K-ras gene in the mammal. In some embodiments, the regulation includes reducing adenosine levels. In some embodiments, the regulation includes reducing the adenosine content or concentration outside of tumor cells or reducing the adenosine content or concentration in tumor cells. In some embodiments, the reagent component is capable of eliminating, knocking out, or knocking down the expression of the K-ras gene. In some embodiments, the reagent component includes an agent capable of inhibiting K-ras gene expression, such as: siRNA, shRNA, and one or more of the inhibitors LUMAKRAS (AMG-510), MRTX1133, GFH925, or K-ras protein preparations.

[0043] In some embodiments, the reagent components include an agent capable of inhibiting the activity of or reducing the level of K-ras protein. In some embodiments, the K-ras gene regulates adenosine levels by regulating ADA and NT5E. In some embodiments, the K-ras gene increases adenosine levels by reducing ADA levels or activity and enhancing NT5E levels or activity. In some embodiments, the K-ras gene sequence is the sequence set forth in NCBI Sequence Number NM-001369786.1 or NCBI Sequence Number NM-001403240.1. In some embodiments, the tumor cells include one or more of colon cancer, rectal cancer, lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchial lung cancer, ovarian cancer, Wilms' tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, or medullary thyroid cancer cells. In some embodiments, the tumor cells are cells harboring K-ras mutations or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells. In some embodiments, the agent can reduce adenosine levels in the tumor tissue microenvironment, thereby relieving or reducing the immunosuppressive function of adenosine. In some embodiments, the agent can increase the secretion of immune cytokines IFN-γ, TNF-α, and granzyme B in cell co-culture systems. In some embodiments, the agent can promote immunotherapy and exert a synergistic anti-tumor effect in combination with immunotherapy.

[0044] In some approaches, the tumor immunotherapy refers to a therapy that uses the body's immune system to fight tumor cells, including immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy. In some approaches, the immunotherapy is an immune checkpoint inhibitor, including one of CTLA4 antibodies, PD-1 antibodies, and PD-L1 antibodies.

[0045] In some embodiments, the reagent components include nanoparticles containing drugs that regulate adenosine. In some embodiments, the nanomaterial of the nanoparticles includes one or a combination of polyethylene glycol (PEG), polylactic acid-glycolic acid (PLGA), polycaprolactone (PCL), and polyvinyl alcohol (PVA). In some embodiments, the nanomaterial of the nanoparticles is polyethylene glycol (PEG) and polylactic acid-glycolic acid (PLGA). In some embodiments, the drug that regulates adenosine includes one of adenosine deaminase (ADA), inosine, and NT5E inhibitors. In some embodiments, the drug that regulates adenosine is adenosine deaminase (ADA). In some embodiments, the average particle size of the nanoparticles is less than 100 nm; the average particle size of the ADA nanoformulation is between 100-300 nm.

[0046] The beneficial effects of the present invention are:

[0047] (1) It was first elucidated that the K-ras gene reduces the content or activity of ADA in tumor cells and enhances the content or activity of NT5E, thereby increasing the accumulation of adenosine and leading to tumor immune escape.

[0048] (2) The preparation method of the PEG-PLGA-loaded adenosine deaminase nanoformulation of the present invention is simple, easy to operate, and suitable for scale-up production.

[0049] (3) The PEG-PLGA loaded adenosine deaminase nanoformulation of the present invention has good stability, and the selected excipients are all approved reagents, which lays a foundation for clinical development.

[0050] (4) Provides the application of adenosine deaminase and its nanoformulation in anti-tumor treatment, providing a new theoretical basis for the treatment of cancer and clinical application of adenosine deaminase.

[0051] (5) Provides adenosine deaminase to enhance the efficacy of tumor immunotherapy, providing a new combination therapy to guide immunotherapy, overcoming the shortcomings of low efficacy and limited clinical application of immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 shows experimental results demonstrating that the tumor gene K-ras promotes cell production and extracellular release of adenosine. (A) Schematic diagram and protein expression verification of doxycycline-induced K-ras expression (K-ras / On) in two cell lines harboring inducible K-ras mutations (HPNE / K-RasG12D and 293T-Rex / K-RasG12V). Adenosine levels in the extracellular medium (B) and intracellular (C) were measured compared with those in K-ras / Off cells. Data are the mean ± SD of three replicates.

[0053] Figure 2 shows experimental results demonstrating that siRNA-mediated knockdown of K-ras expression significantly reduces intracellular and extracellular adenosine levels in tumor cells. (A) Schematic diagram of siRNA-mediated knockdown of K-ras expression and measurement of intracellular and extracellular adenosine levels. (B) Extracellular adenosine levels were measured 48 hours after transfection of mouse cell lines CT26 and KPC with specific siRNA targeting K-ras. (C) Extracellular adenosine levels were measured 48 hours after transfection of human colon cancer cell lines DLD1 and HCT116 with specific siRNA targeting K-ras. Data are mean ± SD of three replicates.

[0054] Figure 3 shows experimental results demonstrating the effects of K-ras on the expression of key adenosine metabolic enzymes and key regulatory molecules in the adenosine metabolic pathway. (A) Key regulatory molecules in the adenosine metabolic pathway include adenosine deaminase ADA, which catalyzes the conversion of adenosine to inosine, and NT5E, which catalyzes the conversion of AMP to adenosine. (B) Quantification of mRNA levels of adenosine metabolism-related genes in CT26 and a KRAS-induced cell line (HPNE / 293) using qRT-PCR. (C) Effect of the oncogene K-ras on the expression of ADA and NT5E in HPNE cells. (D) Effect of the oncogene K-ras on the expression of ADA and NT5E in 293 cells. (E) Relative protein levels of ADA and NT5E in DLD1 cells transfected with 100 nM siRNA-KRAS and in NC control cells transfected with siRNA-Ctrl. (F) Relative protein levels in CT26 cells transfected with shRNA-Ctrl or shRNA-KRAS vectors (#1, #2, and #3).

[0055] Figure 4 shows the experimental results showing that knocking down NT5E reduces tumor adenosine, inhibits tumor growth in vivo, and enhances the immunotherapy efficacy of PD-1 antibodies; (A) Nt5e expression was knocked down in murine colorectal cancer cells CT26 (K-ras G12D mutation) using shRNA, and Nt5e mRNA and protein expression were detected by qRT-PCR and Western Blot, respectively; (B) Knockdown of Nt5e by shRNA resulted in a significant decrease in extracellular adenosine levels; (C) Balb / C mice were inoculated with CT26 cells stably transfected with Nt5e-shRNA or a control vector (5×105 cells / injection), treated once every 3 days with PD-1 monoclonal antibodies, and tumor volume was measured to depict tumor growth curves; (D) Photos of tumors in the control group and each treatment group at the end of the experiment; (E) Tumor weight (g).

[0056] Figure 5. Experimental results showing the effects of exogenous adenosine deaminase (ADA) on immune cells and tumor cells; (A) T lymphocytes were co-cultured with CT26 tumor cells, and T cells were collected after treatment with ADA (500 nM) for 48 h. The levels of IFN-γ, TNF-β, and granzyme B in the culture medium were detected by flow cytometry; (B) Mouse PBMC cells were co-cultured with ADA (concentration 500 nM) for 24 h, and the percentage of CFSE / PI-positive cells was detected by flow cytometry; (C) The effect of ADA on tumor cell viability was detected by the MTS assay.

[0057] Figure 6. Experimental results of the expression of adenosine metabolic enzymes ADA and NT5E in 387 human colorectal cancer clinical samples and their correlation with patient survival; (A) Correlation analysis between NT5E and KRAS expression; (B) Correlation analysis between ADA and KRAS expression; (C) Correlation analysis between NT5E expression level and colorectal cancer patient survival; (D) Correlation analysis between ADA expression level and colorectal cancer patient survival.

[0058] Figure 7. Preparation of PEG-PLGA nanoparticles loaded with adenosine deaminase ADA and experimental results of main properties; (A)

[0059] Preparation process of PEG-PLGA adenosine deaminase ADA nanoparticles; (B) Electron microscopy image and particle size detection of ADA nanoparticles; (C) Properties of PEG-PLGA-ADA nanoparticles prepared under different conditions; (D) Stability detection of enzyme content in PEG-PLGA-ADA nanoparticles.

[0060] Figure 8. Experimental results of the effects of adenosine deaminase ADA and its PEG-PLGA-loaded nanoformulations on cellular adenosine levels and immune cell function; (A) Free ADA and PEG-PLGA-ADA nanoformulations have equivalent effects on cellular adenosine levels; (B-D) PBMCs were co-cultured with colon cancer cells and treated with free ADA or PEG-PLGA-ADA nanoformulations to compare their effects on cytokine secretion by immune cells.

[0061] Figure 9. Experimental results showing that adenosine deaminase ADA nanoformulation significantly enhances the ability of immune cells to kill tumor cells; (A) PBMCs were co-cultured with the indicated colon cancer cells, treated with PEG-PLGA-ADA nanoformulation or empty nanoparticles, and then the proliferation ability of tumor cells was detected using a cell clone formation assay; (B) Quantitative results of the cell clone formation assay showed that ADA nanoformulations can significantly enhance the inhibitory effect of immune cells on multiple colon cancer cells.

[0062] Figure 10. Adenosine deaminase ADA and its PEG-PLGA loaded nanoformulation combined with PD-1 monoclonal antibody (aPD-1) inhibited the growth of mouse colon cancer CT26 tumors in vivo and the expression of adenosine, inosine and CD8 in tumor tissues. + Figure 2. Experimental results of the effect of T cells on the growth of CT26 xenografts in mice under different treatments. (AC) Comparison of tumor growth under different treatments. Data are shown as mean ± SEM, n = 6 mice / group. (D) Quantification of adenosine and inosine content in CT26 xenografts by mass spectrometry. (EH) Detection of CD8 T cells in tumor tissues by flow cytometry. + T cell content and CD8 with IFN-secreting function+ (I) Immunohistochemistry was used to detect the infiltration of CD8 T cells in tumor tissues. + T cells, scale bar is 100 μm. DETAILED DESCRIPTION

[0063] The present invention will be further described below in conjunction with the accompanying drawings and specific examples, but the embodiments do not limit the present invention in any form. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the relevant technical field. Similarly, unless otherwise stated, the reagents and starting materials used in the following examples are commercially available conventional reagents.

[0064] Example 1. The tumor gene K-ras regulates the expression of adenosine metabolic enzymes NT5E and ADA, promoting cellular adenosine production and adenosine accumulation in the tumor microenvironment. The main experimental steps and results of this embodiment are shown in Figures 1-3, as follows:

[0065] (1) Two K-ras mutant inducible expression cell models (293T-Rex / K-RAS G12V and HPNE / K-RAS G12D Cell lines, all obtained from ATCC and the Shanghai Cell Bank, were cultured in vitro and induced to express K-ras (K-ras / On) (high protein expression). A schematic diagram of the construction is shown in Figure 1A. Adenosine levels in the extracellular medium (adenosine released into the extracellular space) (Figure 1B) and intracellular adenosine levels (Figure 1C) were measured using mass spectrometry. The data showed that induced activation of the mutant tumor gene K-ras significantly increased intracellular and extracellular adenosine levels, suggesting that K-ras promotes the production and extracellular secretion of adenosine, increasing adenosine concentrations in the microenvironment.

[0066] (2) Using multiple tumor cell lines, including mouse intestinal cancer cell line CT26, mouse pancreatic cancer cell line KPC, and human intestinal cancer cell line HCT116 and DLD1, small molecule nucleic acid (siRNA) was used to specifically knock down the expression of K-ras (the specific process can be referred to Example 2). The schematic diagram is shown in Figure 2A. After 48 hours of transfection and culture, the adenosine content in the cell culture medium (adenosine content outside the tumor cells) was detected by mass spectrometry. The mouse siRNA target sequence is GGAAACAAGTAGTAATTGA (SEQ NO: 1). The human siRNA target sequence is TGTGGACGAATATGATCCAACAATA (SEQ NO: 2). The results showed that siRNA-mediated silencing of K-ras expression significantly reduced the extracellular adenosine levels of mouse tumor cell lines (CT26 and KPC cells, Figure 2B) and human colon cancer cell lines (DLD1 and HCT116 cells, Figure 2C), further demonstrating the important regulatory role of the tumor gene K-ras on adenosine metabolism.

[0067] Experiments have shown that low expression of this gene (inhibition, silencing or knockout, etc. are all ways to reduce expression) can reduce the level of adenosine outside tumor cells and also reduce the ability of tumors or cancer cells to produce adenosine.

[0068] (3) The two cell lines HPNE / K-RASG12D and 293T-Rex / K-RASG12V containing mutant K-ras inducible expression cell models described in (1) were cultured in vitro and induced to express K-ras with doxycycline. The cells were collected at specific time points (0, 3, and 7 days), and the RNA and protein of the K-ras gene were extracted for qRT-PCR and Western blot analysis. The results showed that the activation of K-ras significantly affected the expression of two enzymes closely related to adenosine metabolism (NT5E and ADA). As shown in Figure 3A, NT5E catalyzes the metabolic conversion of AMP to adenosine, while adenosine deaminase ADA catalyzes the metabolic conversion of adenosine to inosine. qRT-PCR results showed that after KRAS induction, the mRNA expression of NT5E continued to increase, while the mRNA expression of ADA continued to decrease. This change also existed in the cell line CT26 in which K-ras expression was silenced by siRNA-mediated in the above (2), as shown in Figure 3B. Western Blot analysis showed that the activation of K-ras (increased protein expression) promoted the expression of NT5E while inhibiting the expression of ADA (Figure 3C, 3D). The combined result was that adenosine in the cells accumulated abnormally and was secreted outside the cells, ultimately leading to an increase in the level of adenosine in the tumor microenvironment and exerting its immunosuppressive function. Conversely, inhibiting K-ras by knocking down or knocking out K-ras can promote the expression of ADA while inhibiting the expression of NT5E (Figure 3E, 3F), thereby reducing the adenosine level in the cells and ultimately leading to a decrease in the extracellular adenosine content or concentration. The shRNA-Kras target sequence is GCAATGAGGGACCAGTACATG (SEQ No: 3). The experimental results reveal the molecular mechanism by which K-ras promotes adenosine accumulation by promoting the expression of NT5E while inhibiting the expression of ADA.

[0069] Example 2. Improving immune cell function and anti-tumor effects by regulating the expression levels of adenosine metabolizing enzymes NT5E and ADA. The main steps and experimental results of this embodiment are shown in Figures 4-6, as follows:

[0070] (1) NT5E expression was knocked down in colorectal cancer cells CT26 using shRNA to obtain a stable knockdown cell line (shNT5E cells). Compared with the non-knockdown control group cells (NC cells), the expression of Nt5e mRNA and protein was detected by qRT-PCR and Western Blot, respectively (Figure 4A); the content of adenosine in the cell culture medium was detected by mass spectrometry. shRNA knockdown of Nt5e led to a significant decrease in extracellular adenosine levels (Figure 4B). shNT5E cells and NC cells were inoculated into Balb / C mice, and immunotherapy was performed with PD-1 antibody (αPD-1) (treatment once every 3 days). The growth of CT26 tumors in mice was observed regularly and the tumor growth curve was drawn (Figure 4C). The experiment was terminated after 3 weeks, and tumor tissues were isolated and tumor photos were taken (Figure 4D) and tumor weight was measured (Figure 4E). The results showed that knocking down NT5E expression in colorectal cancer cells could partially inhibit tumor growth in vivo and significantly enhance the anti-tumor effect of PD-1 antibody. It is worth noting that CT26 transplanted tumors are immune "cold tumors" and are insensitive to PD-1 antibodies (αPD-1). However, when NT5E of CT26 cells is knocked down, the tumor's sensitivity to PD-1 antibodies increases, suggesting that intervening in adenosine metabolism can improve the in vivo efficacy of immune checkpoint inhibitors such as PD-1 antibodies.

[0071] (2) Peripheral blood T lymphocytes were co-cultured with CT26 tumor cells and treated with adenosine deaminase ADA (500 nM) for 48 h before the T cells were collected. The levels of IFN-γ, TNF-β, and granzyme B in the culture medium were detected by flow cytometry as indicators of cellular immune function. The results showed that degradation of adenosine in the culture medium by adenosine deaminase ADA significantly increased T cell function (Figure 5A). Similarly, mouse PBMC cells were co-cultured with CT26 and treated with ADA (concentration 500 nM) for 24 h. The percentage of CFSE / PI-positive cells was detected by flow cytometry (Figure 5B), and the effect of ADA on tumor cell viability was detected by MTS assay (Figure 5C). The experimental results showed that exogenous adenosine deaminase ADA could promote immune cell function and inhibit tumor cell proliferation.

[0072] (3) Public databases were used to analyze the expression of adenosine metabolizing enzymes ADA and NT5E in human colorectal cancer clinical samples and their correlation with patient survival. The results showed that in 387 colorectal cancer samples, NT5E expression was positively correlated with KRAS expression (Figure 6A), while ADA expression was negatively correlated with KRAS expression (Figure 6B), which was consistent with the results of in vitro cell experiments (Figure 3). Importantly, high NT5E expression was negatively correlated with the survival time of colorectal cancer patients (Figure 6C), while high ADA expression was positively correlated with the survival time of colorectal cancer patients (Figure 6D).

[0073] These results suggest that improving the survival of cancer patients can be achieved by inhibiting NT5E or enhancing ADA enzyme activity. Accordingly, the present invention has designed ADA nanoparticles to increase ADA levels in tumor tissues in vivo. Through ADA's enzymatic activity, they degrade adenosine, thereby relieving the immunosuppressive effects of adenosine and enhancing anti-tumor efficacy. Specific implementation methods are detailed in Examples 3-6.

[0074] Example 3. Preparation and main properties of adenosine deaminase ADA nanoparticles loaded with PEG-PLGA. The main steps and experimental results of this embodiment are as follows:

[0075] (1) As shown in Figure 7A, a W / O emulsion was first prepared using a lipophilic emulsifier. The pre-prepared PLGA-PEG solution dissolved in an ADA aqueous solution was transferred to ethyl acetate and ultrasonically emulsified (250W, 5min) to obtain a primary emulsion.

[0076] (2) This emulsion is added to the aqueous phase containing a hydrophilic emulsifier to produce a W / O / W emulsion. Ultrasonic emulsification (350W, 5 min) is performed with polyvinyl alcohol (PVA, 2%), and then 2 ml of the emulsion is gently dropped into 10 mL of PVA (2%) for re-emulsification to obtain a secondary emulsion.

[0077] (3) After vacuum evaporation of the residual organic solvent, the mixture was centrifuged at room temperature (12,000 rpm, 10 min), and then the PEG-PLGA-loaded adenosine deaminase nanoparticles were collected by ultracentrifuge.

[0078] Figure 7B is a transmission electron micrograph of a prepared PEG-PLGA-loaded adenosine deaminase nanoparticle (top), and the PEG-PLGA-loaded adenosine deaminase nanoparticles were tested using a particle size analyzer (bottom). The particle size of the nanoparticles can be controlled by varying the preparation conditions to achieve peak values ​​of 50 nm, 75 nm, 150 nm, 250 nm, and other ranges as needed. Figures 7C-7D show the results of testing the particle size, enzyme activity, and stability of the PEG-PLGA-loaded adenosine deaminase nanoparticles using a particle size analyzer and an adenosine deaminase detection kit. The stability of the ADA enzyme in the nanoparticles was tested for 7 days, and the results showed that the enzyme activity of the nanoformulation was stable, with no decrease in enzyme activity observed over the 7 days (Figure 7D).

[0079] Example 4. Effects of PEG-PLGA-loaded adenosine deaminase ADA nanoparticles on tumor cell adenosine levels and on the secretion of immune cytokines TNF-α, IFN-γ, and Granzyme B in a tumor-immune cell co-culture system. The main steps and experimental results of this embodiment are as follows:

[0080] (1) Colorectal cancer CT26 cells were cultured in vitro, and pure adenosine deaminase (free ADA) or PEG-PLGA-loaded adenosine deaminase ADA nanoparticles were added and continued to be cultured. Then, a mass spectrometer was used to detect the difference in adenosine content in the tumor cell culture medium between the ADA (free) and PEG-PLGA-loaded ADA nanoparticles-treated groups and the control group. The results are shown in Figure 8A. Both free ADA and PEG-PLGA-loaded adenosine deaminase nanoparticles can significantly reduce the extracellular adenosine level.

[0081] (2) PBMCs were isolated and co-cultured with colon cancer cells in vitro. Purified free ADA or ADA nanoformulations loaded with PEG-PLGA were added and cultured for a long time. The function of immune cells in secreting immune factors (TNF-, IFN-, Granzyme B) was then detected using specific antibodies combined with flow cytometry.

[0082] The experimental results are shown in Figures 8B-8D. Compared with purified free ADA, PEG-PLGA-loaded ADA nanoformulations have the same or stronger effect of promoting immune cell secretion of cytokines. Figure 8B shows the use of flow cytometry to detect TNF-α, IFN-γ, and Granzyme B in the co-culture system; Figure 8C quantitatively shows the effects of free ADA and PEG-PLGA-loaded ADA nanoformulations on T cell secretion of TNF-α, I, IFN-γ, and Granzyme B in the PBMC+CT26 tumor cell co-culture system; Figure 8D quantitatively shows the effects of free ADA and PEG-PLGA-loaded ADA nanoformulations on T cell secretion of IFN-γ and TNF-α in the PBMC+HCT116 tumor cell co-culture system.

[0083] Example 5. Effect of PEG-PLGA-loaded adenosine deaminase ADA nanoparticles on the proliferation of immune cells in colorectal cancer cells (HCT116, DLD1, and CT26) in a co-culture system. The main steps and experimental results of this embodiment are as follows:

[0084] (1) Three colon cancer cell lines (DLD1, HCT116, and CT26) in the logarithmic growth phase were digested with 0.25% trypsin and perforated into single cells. The cells were then suspended in DMEM medium containing 10% fetal bovine serum for later use.

[0085] (2) Inoculation and culture: The cell suspension was diluted in gradient multiples, and each group of cells was inoculated into a dish containing 10 mL of 37°C pre-warmed culture medium at a gradient density of 50, 100, and 200 cells per dish. The cells were gently rotated to disperse the cells evenly, and PBMC and PEG-PLGA-loaded ADA nanoformulation were added for co-culture. A parallel control group (no ADA nanoformulation treatment) was set up and placed in a cell culture incubator at 37°C and 5% CO2 for about 2 weeks;

[0086] (3) Fixing cells: When visible colonies appear in the culture dish, terminate the culture. Discard the supernatant and carefully rinse twice with PBS. Add 4% paraformaldehyde to fix the cells for 15 minutes. Then remove the fixative and add an appropriate amount of crystal violet to stain for 10 to 30 minutes. Then slowly wash away the stain with running water and let it dry at room temperature. 4) Counting cell colonies: Invert the dish and overlay a gridded transparent film. Count the number of cell colonies under a microscope and calculate the clone formation rate (clone formation rate = number of clones / number of cells inoculated × 100%).

[0087] The experimental results are shown in Figure 9, with Figure 9A showing a photograph of cell clones and Figure 9B showing a quantitative bar graph of the cell clone number. The results demonstrate that the ADA nanoformulation significantly enhances the ability of immune cells to kill tumor cells, as evidenced by a significant decrease in the number of cell clones in the ADA nanoformulation-treated group compared to the control group.

[0088] Example 6. Adenosine deaminase ADA and its nanoformulation combined with PD-1 monoclonal antibody inhibit the growth of mouse colon cancer in vivo and its effects on adenosine and inosine levels in tumor tissue and CD8 + The main steps and experimental results of this embodiment are as follows:

[0089] (1) Mouse intestinal cancer CT26 cells were inoculated into Balb / C mice. After tumor formation, the mice were divided into 5 groups (6 mice per group) and treated as follows: 1) solvent control group; 2) purified free ADA; 3) PEG-PLGA-ADA nanoformulation; 4) PD-1 antibody (PD-1); 5) PD-1 + PEG-PLGA-ADA nanoformulation. During the treatment, the growth of CT26 tumors in mice was observed, the tumor volume was measured every 3 days, and the tumor growth curve was drawn (Figure 10A). The experiment was terminated after 3 weeks, the tumor tissue was isolated, the tumor was photographed and the tumor weight was weighed. The results are shown in Figures 10B and 10C. Compared with the mice in the control group, the tumor volume of the PEG-PLGA-ADA nanoformulation treatment group was significantly smaller, and the therapeutic effect was better than that of free ADA; importantly, the nanoformulation PEG-PLGA-ADA and PD-1 antibody combined treatment group had a significant inhibitory effect on tumor growth, suggesting that the two have a synergistic effect. Therefore, it is expected that the PEG-PLGA-ADA nanoformulation can improve the clinical immunotherapy effect of PD-1 antibody.

[0090] (2) The contents of adenosine and inosine in the CT26 transplanted tumors of each group of mice were detected by mass spectrometry. The results are shown in Figure 10D. Compared with the mice in the control group, the adenosine content in the tumor tissue of the PEG-PLGA-ADA nanoformulation treatment group was significantly reduced. The adenosine content in the tumor tissue of the simple (free) ADA treatment group was also reduced, but the degree was not as obvious as that of the PEG-PLGA-ADA nanoformulation treatment group. Consistent with this, the content of inosine (adenosine metabolite catalyzed by ADA) in the tissue showed a corresponding degree of increase (Figure 10D, Inosine). These results suggest that the in vivo therapeutic effect of the PEG-PLGA-ADA nanoformulation is better than that of simple (free) ADA.

[0091] (3) Flow cytometry was used to analyze the content of CD8+ T cells in the CT26 tumor tissues of mice in each group and their function of secreting interferon (IFN-), and immunohistochemical staining was used to show the infiltration of CD8+ T cells in the tumor tissues. The results are shown in Figures 10E-G. Compared with the control group, the CD8+ T cells in each treatment group were significantly increased. + The infiltration of T cells increased to varying degrees. The CD8 + The infiltration of T cells increased by nearly 5 times (Figure 10E). In addition, the CD8 T cells with IFN-γ secretion function in the tumor tissues of the PD-1 antibody treatment group and the PD-1 antibody and PEG-PLGA-ADA nanoformulation combined treatment group increased significantly. + The proportion of T cells was also significantly higher than that in the control group, increasing by 7-8 times (Figure 10F), which was consistent with the results of CD8 immunohistochemical staining of tumor sections (Figure 10G).

[0092] In summary, the results of multiple detection and analysis show that the use of PEG-PLGA-ADA nanoformulations can effectively reduce the content of adenosine in tumor tissues in vivo, relieve its immunosuppressive effects, thereby promoting the infiltration of CD8+ immune T cells in tumor tissues and enhancing their anti-tumor immune functions such as the secretion of interferon, effectively inhibiting the growth of colorectal cancer in mice in vivo; the combination of PEG-PLGA-ADA nanoformulations and PD-1 antibodies has a significant effect of enhancing immunotherapy.

Claims

1. A method for regulating adenosine content in a mammal, the method comprising: The reagent is used to control the K-ras gene in mammals, thereby regulating the adenosine content in the mammals.

2. The method according to claim 1, wherein: Said modulation includes reducing adenosine levels.

3. The method according to claim 2, wherein: The regulation includes reducing the adenosine content or concentration outside the tumor cells or reducing the adenosine content or concentration in the tumor cells.

4. The method according to claim 1, wherein: The reagent can eliminate, knock out, or knock down the expression of the K-ras gene.

5. The method according to claim 4, wherein: The reagents include reagents capable of inhibiting K-ras gene expression, such as: siRNA, shRNA and one or more of inhibitors LUMAKRAS (AMG-510), MRTX1133, GFH925 or K-ras protac preparations.

6. The method according to claim 4, wherein: The reagents include reagents capable of inhibiting the activity of the protein expressed by K-ras or reducing the content thereof.

7. The method according to claim 1, wherein: The K-ras gene regulates adenosine content by regulating ADA and NT5E.

8. The method according to claim 7, wherein: The K-ras gene increases the content of adenosine by reducing the content or activity of ADA and enhancing the content or activity of NT5E.

9. The method according to claim 1, wherein: The sequence of the K-ras gene is the sequence shown by the NCBI sequence number NM-001369786.1 or the NCBI sequence number NM-001403240.

1.

10. The method of claim 3, wherein: The tumor cells include one or more of colon cancer, rectal cancer, lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchial lung cancer, ovarian cancer, Wilms tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, and medullary thyroid cancer cells.

11. The method according to claim 10, wherein: The tumor cells are tumor cells with K-ras mutation or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells.

12. The method according to claim 3, wherein: The agent can reduce the adenosine level in the tumor tissue microenvironment, thereby relieving or reducing the immunosuppressive function of adenosine.

13. The method according to claim 1, wherein the agent is capable of increasing the secretion of immune cytokines IFN-γ, TNF-α and granzyme B in a cell co-culture system.

14. The method according to claim 1, characterized in that The reagent can promote immunotherapy and exert a synergistic anti-tumor effect in combination with immunotherapy.

15. The method according to claim 14, wherein: The tumor immunotherapy refers to a therapy that uses the body's immune system to fight tumor cells, including immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy.

16. The method according to claim 15, characterized in that The immunotherapy is an immune checkpoint inhibitor, including one of CTLA4 antibody, PD-1 antibody, and PD-L1 antibody.

17. The method of claim 1, wherein the agent comprises nanoparticles containing a drug that modulates adenosine.

18. The method according to claim 17, characterized in that The nanomaterial of the nanoparticles includes one or a combination of polyethylene glycol (PEG), polylactic acid-glycolic acid (PLGA), polycaprolactone (PCL), and polyvinyl alcohol (PVA).

19. The method according to claim 18, characterized in that The nanomaterials of the nanoparticles are polyethylene glycol (PEG) and polylactic acid-glycolic acid (PLGA).

20. The method according to claim 17, wherein: The adenosine-regulating drug includes one of adenosine deaminase (ADA), inosine and NT5E inhibitors.

21. The method according to claim 20, wherein: The drug that regulates adenosine is adenosine deaminase (ADA).

22. The method according to claim 17, wherein the average particle size of the nanoparticles is less than 100 nm; and the average particle size of the ADA nanoformulation is in the range of 100-300 nm.

23. An agent for regulating adenosine content in a mammal, comprising: A reagent composition for controlling the K-ras gene in mammals.

24. The reagent according to claim 23, wherein Said modulation includes reducing adenosine levels.

25. The reagent according to claim 24, wherein The regulation includes reducing the content or concentration of adenosine outside tumor cells or reducing the content or concentration of adenosine in tumor cells.

26. The reagent according to claim 23, wherein The reagent components can eliminate, knock out, or knock down the expression of the K-ras gene.

27. The reagent according to claim 26, wherein the reagent components include a reagent capable of inhibiting K-ras gene expression, such as: one or more of siRNA, shRNA and inhibitors LUMAKRAS (AMG-510), MRTX1133, GFH925 or K-ras protac preparations.

28. The reagent according to claim 23, wherein The reagent components include reagents capable of inhibiting the activity of the protein expressed by K-ras or reducing the content thereof.

29. The reagent according to claim 23, wherein The K-ras gene regulates adenosine content by regulating ADA and NT5E.

30. The reagent according to claim 29, wherein The K-ras gene increases the content of adenosine by reducing the content or activity of ADA and enhancing the content or activity of NT5E.

31. The reagent according to claim 23, wherein The sequence of the K-ras gene is the sequence shown by the NCBI sequence number NM-001369786.1 or the NCBI sequence number NM-001403240.

1.

32. The reagent of claim 25, wherein: The tumor cells include one or more of colon cancer, rectal cancer, lung cancer, breast cancer, liver cancer, acute leukemia and malignant lymphoma, breast cancer, bronchial lung cancer, ovarian cancer, Wilms tumor, soft tissue sarcoma, bladder cancer, testicular cancer, prostate cancer, gastric cancer, and medullary thyroid cancer cells.

33. The reagent according to claim 32, wherein The tumor cells are tumor cells with K-ras mutation or activation, including one or more of pancreatic cancer, lung cancer, and colorectal cancer cells.

34. The reagent according to claim 25, wherein The agent can reduce the adenosine level in the tumor tissue microenvironment, thereby relieving or reducing the immunosuppressive function of adenosine.

35. The reagent according to claim 23, wherein The reagent can increase the secretion of immune cytokines IFN-γ, TNF-α and granzyme B in a cell co-culture system.

36. The reagent according to claim 23, characterized in that The reagent can promote immunotherapy and exert a synergistic anti-tumor effect in combination with immunotherapy.

37. The reagent according to claim 36, wherein The tumor immunotherapy refers to a therapy that uses the body's immune system to fight tumor cells, including immune checkpoint inhibitor therapy, adoptive T cell therapy, and tumor vaccine therapy.

38. The reagent according to claim 36, characterized in that The immunotherapy is an immune checkpoint inhibitor, including one of CTLA4 antibody, PD-1 antibody, and PD-L1 antibody.

39. The reagent according to claim 23, wherein the reagent composition comprises nanoparticles containing a drug that regulates adenosine.

40. The reagent according to claim 39, characterized in that The nanomaterial of the nanoparticles includes one or a combination of polyethylene glycol (PEG), polylactic acid-glycolic acid (PLGA), polycaprolactone (PCL), and polyvinyl alcohol (PVA).

41. The reagent according to claim 40, characterized in that The nanomaterials of the nanoparticles are polyethylene glycol (PEG) and polylactic acid-glycolic acid (PLGA).

42. The reagent according to claim 17, wherein The adenosine-regulating drug includes one of adenosine deaminase (ADA), inosine and NT5E inhibitors.

43. The reagent according to claim 20, wherein The drug that regulates adenosine is adenosine deaminase (ADA).

44. The reagent according to claim 39, wherein the average particle size of the nanoparticles is less than 100 nm; and the average particle size of the ADA nanoformulation is in the range of 100-300 nm.

Images