Synthetic TGF-beta redirectors and uses thereof in chimeric antigen receptor-mediated cell therapy and others

Abstract

Synthetic TGFβ receptors are provided which function as TGFβ signal redirectors to redirector immunosuppressive TGFβ signal to an immunostimulatory signal in immune cells. In various embodiments, synthetic TGFβ receptors comprise fusion proteins of an extracellular domain of TGFβ receptor and an intracellular domain of interleukin receptor, typically with a transmembrane domain derived from transmembrane domain of the interleukin receptor. Host cells are also provided, which express the synthetic TGFβ receptors. In various embodiments, T cells expressing the synthetic TGFβ receptors also contain a recombinant expression vector encoding a chimeric antigen receptor (CAR) endowed with specificity against a disease-associated antigen. In further embodiments, the CAR is driven by a thermo-responsive promoter, optionally operably linked to a NF-kB or STAT response element. Ultrasound or focused ultrasound may be used in stimulating expression of the vector in these cells.

Description

SYNTHETIC TGF-BETA REDIRECTORS AND USES THEREOFIN CHIMERIC ANTIGEN RECEPTOR-MEDIATED CELL THERAPY AND OTHERSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application includes a claim of priority under 35 U.S.C. §119(e) to U.S. provisional patent application No. 63 / 539,382, fded September 20, 2023, the entirety of which is hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant no. GM140929, HL121365, and CA262815, awarded by the (NIH) National Institutes of Health. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING

[0003] This application contains a Sequence Listing submitted as a computer readable form named “065715_000162WOPT_SequenceListing.xml”, having a size in bytes of 37,014 bytes, and created on September 19, 2024. The information contained in this computer readable form is hereby incorporated by reference in its entirety.FIELD OF INVENTION

[0003] This invention relates to engineered receptor-type, protein molecules derived from TGFP receptors and interleukins, which redirects TGFP signal from an inhibitory signaling to a stimulatory signaling, and more specifically their use in cell therapies.BACKGROUND

[0004] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0005] Chimeric Antigen Receptor T-cell (CAR-T) therapy holds great potential in treating hematological malignancies, yet its efficacy in solid tumors is often compromised by an immunosuppressive tumor microenvironment (TME), characterized by inhibitory factors such as transforming growth factor-beta (TGFP). TGFP is one of the most well-known factors that exert systemic immune suppression by directly suppressing T cell proliferation, cytolysis,and inducing the differentiation of T cells into the inhibitory regulatory phenotype. Previous efforts have attempted to mitigate the inhibitory effect of immunosuppressive cytokines, including engineering CAR-T cells to be less sensitive to those immunosuppressive cytokines. One example is the use of a TGFp-dominant-negative receptor (TGFp DNR) engineered to be overexpressed in CAR-T cells targeting prostate-specific membrane antigen (PSMA). The TGFp DNR PSMA-CAR T cells have shown increased proliferation, enhanced cytokine secretion, resistance to exhaustion, long-term in vivo persistence, and efficient induction of tumor eradication in preclinical studies. Knocking out endogenous TGFp receptor II in CAR- T cells using CRISPR / Cas9 can reduce Treg conversion and prevent the exhaustion of CAR-T cells, leading to better in vivo tumor elimination efficacy. Another approach involves engineering CAR-T cells that co-express a bispecific combined anti-PD-1 scFV and TGFp binding protein, which inhibits PD-1 receptors and sequesters TGFP from the local TME. This combination of PD-1 blockade and TGFp trapping allows for increased proliferation and improved effector cytokine secretion in CAR-T cells. In the above-mentioned method, clinical applications of the TGFP DNR CAR-T cells have been deemed feasible and generally safe in the treatment of metastatic castration-resistant prostate cancer (mCRPC); however, in a later study, two out of nine mCRPC patients showed fatal toxicities such as ICANS and multi-organ failure (MOF), and the underlying mechanisms of these immune-mediated toxicities remain unclear. Thus, the design of a molecule that can overcome the inhibitory effects of TGFp is needed.

[0006] Besides the systemic immune suppression by TGFP, the short duration of CAR on T-cells after induction limits its clinical translation, which have so far often necessitated multiple injections and stimulations. In fact, the CAR downmodulation is one of the major limiting factors of CAR-T functionality, as data showed marked downregulation of CAR expression on tumor-infiltrated CAR-T cells even with a strong constitutive promoter. Hence, the limited persistence of CAR molecules on T-cell surfaces within these inducible systems restricts their clinical utility.

[0007] Additionally, “on-target off-tumor toxicity” presents a substantial challenge in CAR-T therapy, where the engineered T cells attack healthy tissues expressing the target antigen. This toxicity can occur if the target antigen is also expressed on non-tumor cells, leading to the unintended destruction of healthy tissues. On-target off-tumor toxicity has been reported in clinical trials of CAR-T cell therapy, with some patients experiencing severe adverse effects.

[0008] Therefore, it is an object of the present invention to provide compositions that may redirect TGFP signal from an inhibitory one to a stimulatory one.

[0009] It is another object of the present invention to provide CAR-mediated cell therapies modified with compositions that redirect TGFp signal to a stimulatory one and / or for reinforcing CAR expression or activity.

[0010] It is another object of the present invention to provide methods of using or preparing the compositions and / or CAR-mediated cell therapies therewith for use in treatment of cancer or other malignancies.SUMMARY OF THE INVENTION

[0011] The following embodiments and aspects thereof are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope.

[0012] One or more polynucleotides are provided which encode fusion polypeptides comprising: (a) a TGFpR2-derived polypeptide comprising: an extracellular domain of transforming growth factor beta (TGFP) receptor 2 (TGFPR2), a first transmembrane domain, and an intracellular domain of a first interleukin (IL) receptor chain; and (b) a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFP receptor 1 (TGFpRl), a second transmembrane domain, and an intracellular domain of a second IL receptor chain.

[0013] In some embodiments, the one or more polynucleotides is one single polynucleotide encoding the TGFpR2-derived polypeptide - a self-cleaving 2A peptide - the TGFpRl-derived polypeptide. In other embodiments, the one or more polynucleotides is two polynucleotides, wherein one encodes the TGFpR2-derived polypeptide and the other encodes the TGFpRl-derived polypeptide.

[0014] In various aspects, the first IL receptor chain and the second IL receptor chain form an IL receptor complex. In various embodiments, the TGFpR2-derived polypeptide and the TGFpRl-derived polypeptide when co-expressed in a cell increases IL receptor signal transduction in the presence of extracellular TGFp.

[0015] In some embodiments, the extracellular domain of TGFPR2 comprises an amino acid sequence of SEQ ID NO:9. In some embodiments, the extracellular domain of TGFPR2 comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:9. In some embodiments, the extracellular domain of TGFPR2 comprises an amino acid sequence of residues 74-191 of SEQ ID NO:9.

[0016] In some embodiments, the extracellular domain of TGFpRl comprises an amino acid sequence of SEQ ID NOTO. In some embodiments, the extracellular domain of TGFpRlcomprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 10. In some embodiments, the extracellular domain of TGFPR1 comprises an amino acid sequence of residues 35-125 of SEQ ID NO:10.

[0017] In some embodiments, the extracellular domain of TGFPR2 comprises an amino acid sequence of SEQ ID NO:9; the extracellular domain of TGF R1 comprises an amino acid sequence of SEQ ID NO: 10; and the first transmembrane domain comprises a transmembrane domain of the first IL receptor chain, and the second transmembrane domain comprises a transmembrane domain of the second IL receptor chain. In some embodiments, the extracellular domain of TGFPR2 comprises an amino acid sequence of residues 74-191 of SEQ ID NO:9; the extracellular domain of TGFpRl comprises an amino acid sequence of residues 35-125 of SEQ ID NO: 10; and the first transmembrane domain comprises a transmembrane domain of the first IL receptor chain, and the second transmembrane domain comprises a transmembrane domain of the second IL receptor chain.

[0018] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-18 receptor beta chain (IL-18RP) and IL-18 receptor alpha chain (IL-18Ra). In some embodiments, the first IL receptor chain is the IL-18RP, and the second IL receptor chain is the IL-18Ra. In other embodiments, the first IL receptor chain is the IL-18Ra, and the second IL receptor chain is the IL-18RP. In some embodiments, the transmembrane domain of the IL- 18RP and the intracellular domain of the IL-18RP, when fused together, has an amino acid sequence of SEQ ID NO: 11 or at least 95% sequence identity thereto; and the transmembrane domain of the IL-18Ra and the intracellular domain of the IL-18Ra, when fused together, has an amino acid sequence SEQ ID NO: 12 of having at least 95% sequence identity thereto.

[0019] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-2 receptor beta chain (IL-2RP) and IL-2 receptor gamma chain (IL-2RY). In some embodiments, the first IL receptor chain is the IL-2RP, and the second IL receptor chain is the IL-2Ry. In other embodiments, the first IL receptor chain is the IL-2RY, and the second IL receptor chain is the IL-2RP. In some embodiments, the transmembrane domain of the IL-2RP and the intracellular domain of the IL-2RP, when fused together, has an amino acid sequence of SEQ ID NO: 13 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL-2Ry and the intracellular domain of the IL-2Ry, when fused together, has an amino acid sequence of SEQ ID NO: 14 or having at least 95% sequence identity thereto.

[0020] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-3 receptor alpha chain (IL-3Ra) and IL-3 receptor beta chain (IL-3RP). In some embodiments, the first IL receptor chain is the IL-3Ra and the second IL receptor chain is theIL-3Rp. In other embodiments, the first IL receptor chain is the IL-3RP and the second IL receptor chain is the IL-3Ra. In some embodiments, the transmembrane domain of the IL-3Ra and the intracellular domain of the IL-3Ra, when fused together, has an amino acid sequence of SEQ ID NO: 15 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL-3RP and the intracellular domain of the IL-3R , when fused together, has an amino acid sequence of SEQ ID NO: 16 or having at least 95% sequence identity thereto.

[0021] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-6 receptor alpha chain (IL-6Ra) and IL-6 cytokine family signal transducer (IL6ST). In some embodiments, the first IL receptor chain is the IL-6Ra, and the second IL receptor chain is the IL6ST. In other embodiments, the first IL receptor chain is the IL6ST, and the second IL receptor chain is the IL-6Ra. In some embodiments, the transmembrane domain of the IL-6Ra and the intracellular domain of the IL-6Ra, when fused together, has an amino acid sequence of SEQ ID NO: 17 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL6ST and the intracellular domain of the IL6ST, when fused together, has an amino acid sequence of SEQ ID NO: 18 or having at least 95% sequence identity thereto.

[0022] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-7 receptor alpha chain (IL-7Ra) and IL-7 receptor gamma chain (IL-7Ry). In some embodiments, the first IL receptor chain is the IL-7Ra, and the second IL receptor chain is the IL-7Ry. In other embodiments, the first IL receptor chain is the IL-7Ry, and the second IL receptor chain is the IL-7Ra. In some embodiments, the transmembrane domain of the IL-7Ra and the intracellular domain of the IL-7Ra, when fused together, has an amino acid sequence of SEQ ID NO: 19 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL-7Ry and the intracellular domain of the IL-7Ry, when fused together, has an amino acid sequence of SEQ ID NO:22 or having at least 95% sequence identity thereto.

[0023] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-21 receptor alpha chain (IL-21Ra) and IL-21 receptor gamma chain (IL-21Ry). In some embodiments, the first IL receptor chain is the IL-21Ra, and the second IL receptor chain is the IL-2 IRy. In other embodiments, the first IL receptor chain is the IL-2 IRy, and the second IL receptor chain is the IL-21Ru. In some embodiments, the transmembrane domain of the IL- 21Ra and the intracellular domain of the IL-21Ra, when fused together, has an amino acid sequence of SEQ ID NO:20 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL-2 IRy and the intracellular domain of the IL-2 IRy, when fusedtogether, has an amino acid sequence of SEQ ID NO:22 or having at least 95% sequence identity thereto.

[0024] In some embodiments, the first IL receptor chain and the second IL receptor chain are IL-23 receptor (IL-23R) and IL- 12 receptor beta 1 subunit (IL-12Rpi). In some embodiments, the first IL receptor chain is the IL-23R, and the second IL receptor chain is the IL-12Rpi. In other embodiments, the first IL receptor chain is the IL-12Rpi, and the second IL receptor chain is the IL-23R. In some embodiments, the transmembrane domain of the IL- 23R and the intracellular domain of the IL-23R, when fused together, has an amino acid sequence of SEQ ID NO:21 or having at least 95% sequence identity thereto; and the transmembrane domain of the IL-12Rpi and the intracellular domain of the IL-12Rpi, when fused together, has an amino acid sequence of SEQ ID NO:22 or having at least 95% sequence identity thereto.

[0025] In some embodiments, the TGFpR2-derived polypeptide further comprises a first linker, in a configuration from N- to C-terminus: the extracellular domain of the TGFPR2 - the first linker - the transmembrane domain of an IL receptor - the intracellular domain of an IL receptor. In some embodiments, the TGFpRl -derived polypeptide further comprises a second linker, in a configuration from N- to C-terminus: the extracellular domain of the TGFpRl - the second linker - the transmembrane domain of an IL receptor - the intracellular domain of an IL receptor.

[0026] In some embodiment, the one or more polynucleotides further encodes a protein of interest in an expression cassette driven by a promoter, wherein the promoter is operably linked to one or more of a heat-shock element (HSE), a nuclear factor-kappa B (NF-kB) response element (NF-kB-RE), and a signal transducers and activators of transcription (STAT) response element. In some embodiment, the one or more polynucleotides further encodes a protein of interest in an expression cassette driven by a promoter, wherein the promoter is operably linked to HSE and NF-kB-RE, or linked to HSE and STAT RE.

[0027] In some embodiments, the NF-kB-RE comprises a nucleic acid sequence OF SEQ ID NO:2 or having at least 95% sequence identity thereto. In some embodiments, the HSE comprises a nucleic acid sequence of SEQ ID NO:1 or having at least 95% sequence identity thereto. In some embodiments, the STAT response element comprises a nucleic acid sequence of SEQ ID NO:4 or 5 or having at least 95% sequence identity to either one of SEQ ID NO:4 and 5.

[0028] A combination of polynucleotides is further provided, which includes one or more polynucleotides described above, and another polynucleotide encoding a chimericantigen receptor (CAR). Typically, a CAR comprises: an scFv specific for an antigen associated with a disease; a transmembrane domain; and a CD3 zeta intracellular signaling domain; and optionally one or more of: a signal peptide at the N-terminus of the CAR, an extracellular spacer domain, positioned between the scFv and the transmembrane domain, and one or more co-stimulatory signaling domains selected from CD28, 4-1BB, CD137, CD134, NKG2D, CD27, TLR2, ICOS, or a combination thereof

[0029] In some embodiments, the first IL receptor chain and the second IL receptor chain in the one or more polypeptides in the combination are IL-18R and IL-18Ra, and the CAR in an expression cassette is driven by a promoter including an NF-kB-RE, or both NF- kB-RE and HSE.

[0030] In some embodiments, the first IL receptor chain and the second IL receptor chain in the one or more polypeptides in the combination are IL-2RP and IL-2Ry, or IL-3Ra and IL-3RP, or IL-6Ra and IL6ST, or IL-7Ra and IL-7Ry, or IL-21Ra and IL-21Ry, or IL-23R and IL-12Rpi, and the CAR in an expression cassette is driven by a promoter including a STAT response element, or both of an HSE and STAT response element.

[0031] Engineered cells are also provided, which contains (or are engineered with) one or more polynucleotides or combinations of polynucleotides disclosed above. In some embodiments, the engineered cell is a T lymphocyte (T-cell). In some embodiments, the engineered cell is a natural killer cell or a macrophage. In some embodiments, the engineered cell is an induced pluripotent stem cell (iPSC) or an embryonic stem cell.

[0032] Methods are provided for modifying a cell in which an extracellular TGFP signal is redirected to induce a stimulatory response in the cell, and the methods include: transfecting or transducing the cell with one or more expression vectors comprising the one or more polynucleotides or combinations of polynucleotides disclosed herein; and expressing the fusion polypeptides encoded by the one or more polynucleotides and / or the CAR or protein or interest. In further embodiments, the CAR or the protein of interest is in an expression cassette driven by a promoter that includes an NF-kB-RE or a STAT response element, and the cell also expresses a TGFp signal redirector receptor formed from a TGF[3R2-derived polypeptide and a TGFPR1 -derived polypeptide, thereby resulting in the CAR being present on the engineered cell surface or the expression of the protein of interest for a prolonged period of time, when the cell is exposed to TGFp or cells or tumor cells secreting TGFp, compared to without the NF- kB-RE or STAT response element. In some embodiments, the prolonged period of time is longer by at least 10%. In some embodiments, the prolonged period of time is longer by at least 20%. In some embodiments, the prolonged period of time is longer by at least 30%. In someembodiments, the prolonged period of time is longer by at least 40%. In some embodiments, the prolonged period of time is longer by at least 50%. In some embodiments, the prolonged period of time is longer by at least 75%. In some embodiments, the prolonged period of time is longer by at least 100%. In some embodiments, the prolonged period of time is longer by at least 200%. In some embodiments, the prolonged period of time is longer by at least 300%.

[0033] Methods are further provided for treating a subject having a tumor or inhibiting growth of tumor, and the methods include administering a therapeutically effective quantity of engineered cells to the subj ect. In some embodiments, the engineered cells express CAR having a binding domain specific for an antigen expressed by the tumor. In some embodiments, the CAR is in an expression cassette driven by a heat-inducible promoter, and the treatment methods further include applying ultrasound, optionally focused ultrasound, to the subject.

[0034] In some embodiments of the treatment methods, the quantity of the engineered cells is administered to the tumor or to peritumoral region, and the ultrasound is applied at site of the tumor. In some embodiments, the engineered cells for use in the methods comprise T cells obtained from the subject or T cells derived from induced pluripotent stem cells.

[0035] Other features and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, various features of embodiments of the invention.BRIEF DESCRIPTION OF THE FIGURES

[0036] Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.

[0037] Figures 1A-1D depict that TGFp redirector 18 converts TGFP signaling to IL 18- NFKB signaling. (1A) The design principle of the TGFP redirector. (Top) TGFP binding to its receptors activates SMAD signaling in T cells, which inhibits T cell function. (Middle) IL- 18 signaling causes its receptor to dimerize, leading to the activation of downstream stimulatory NFKB signaling in T cells. (Bottom) A schematic of the TGFP redirector design, combining the extracellular domain of TGFp receptors with the transmembrane and intracellular domain of IL receptors, using the IL18 receptor as a representative. (IB) Schematic of TGFP redirector constructs. Three different variants were designed with varying extracellular domains. The amino acids we used for the design of TGFp receptor were listed. Their surface expression and the ability to redirect the inhibitory signal to the stimulatory signal upon TGFP stimulation are marked as yes or no. (1C) Flow cytometry data of TGFP redirectors in HEK cells that were transiently transfected with different variants. APC-anti-TGFpRII was used to stain theextracellular domain of TGFp redirectors. (ID) NFKB-responsive elements were used to drive the expression of EGFP as a reporter to test the rewiring function of TGFP redirectors in Jurkat T cells. Jurkat T cells expressing the reporter only, variant 2, and variant 3 together with the reporter were exposed to 0 ng / ml, 2 ng / ml, or 10 ng / ml TGFp. After 24 hours, GFP signals were analyzed using a flow cytometer.

[0038] Figures 2A-2G depict that TGFp redirector mediates T Cell phenotype change after TGFp treatment. (2A) A schematic illustrating the cell experimental groups. The native T cells and TGI 8-positive T cells were cultured either with or without 2 ng / ml TGFp. In addition to the external TGFP, the T cells will also secrete TGFp. The cells, after 24 hours of treatment, will be collected for downstream analysis. (2B) Real-time RT-PCR analysis of IL2, IFNy, and TNFa in cells from different groups. The gene expression was normalized to the GAPDH gene. (2C) A Heat map of differentially expressed genes in plain T cells or TGI 8 T cells before and after TGFp treatment. The color scale indicates the normalized Z-score for each gene. (2D) Volcano plots displaying differential gene expression in TG18-T cells after TGFP treatment compared to plain T cells after TGF treatment. Each point represents the average value of one transcript in two replicate experiments, and red dots illustrate the significantly overexpressed genes, and the blue dots illustrate the significantly downregulated genes in the TG18-T cells group. (2E) The enriched gene ontology (GO)-terms of the significantly up-regulated genes in TGI 8 T cells after TGFp treatment. The enriched GO-terms were arranged according to -loglO adjusted P value. BP, MF, and CC represent Biological Process, Molecular Function, and Cellular Component groups of GO, respectively. (2F, 2G) GSEA plots of the KRAS signaling pathway UP (2F), interferon a response, and interferon y response (2G), identified between the TG18-T cells and plain T cells after TGFp treatment. These gene sets are enriched in the TG18-T cells treated with TGFP compared to plain T cells treated with TGFp.

[0039] Figures 3A-3G depict that TGFP redirector can be customized to activate STAT3 or STAT5 signaling pathway in T cells. (3 A) A schematic illustrating the different designs of the TGFp redirector that can lead to a customized T cell phenotype by altering the intrinsic cell signaling after TGFP exposure. (3B) The classification of Interleukin receptors. Representatives from different families, such as IL-2, IL-7, and IL-21 from the common y family; IL-3 from the common p family; IL-6 from the common gpl30 family; and IL-23, were selected to engineer potential TGFP redirectors, as highlighted in magenta. (3C, 3D) Flow cytometric analysis of phospho-STAT3 (Tyr 705, 3C) or phospho-STAT5 (Tyr 694, 3D) in T cells expressing different TGFp redirectors before and after exposure to TGFp. While theJurkat T cells expressing TG2, TG6, TG21 showed STAT3 activation, the cells expressing TG23 showed the best activation of STAT3 signaling after TGFP treatment. Similarly, while the Jurkat T cells expressing TG6, TG7 showed STAT5 activation, the cells expressing TG3 showed the best activation of STAT5 signaling after TGFp treatment. The red line represents the cell group with TGFp treatment. (3E, 3F) The Quantification of mean fluorescent intensity of phosphorylated STAT3 and STAT5 in T cells expressing TG23 (3E) or TG3 (3F) before and after TGFp treatment. (3G) Validation of STAT3 or STAT5 activation in Jurkat T cells expressing TG23 or TG3 after TGFp treatment using a luciferase reporter assay. In this assay, the STAT3 or STAT5 responsive elements were used to drive the expression of firefly luciferase, and a constitutive Renilla Luciferase was used as a reference.

[0040] Figure 4 depicts that the TGFp redirector function depends on the dimerization of synthetic molecules. T cells were engineered to express a single-chain version of R1 and R2 from the TGFp Redirectors. These cells were subsequently treated with 5 ng / ml of TGFp. Flow cytometric analysis of STAT3 phosphorylation was performed to assess signaling activation. n=3 in each group.

[0041] Figures 5A-5F depict that TGI 8 redirector enhances the efficacy of FUS-GD2 CAR T cells in vivo. (5A) The function of the TGI 8 redirector in the context of FUS CAR. Ultrasound generates local heat (43 °C) in the tumor region, activating the expression of the CAR molecule through heat shock factor 1 (HSF1). The expressed CAR on the T cell surface mediates cytotoxicity towards the tumor cells. Simultaneously, TGFP secreted by tumor cells activates the TGI 8 receptor, triggering the endogenous NF-KB signaling pathway and thereby enhancing CAR T cell activity. (5B) Timeline of the animal experiment. IxlO6U87 tumor cells were inoculated into the hindlimb of NSG mice. After 7 days, IxlO6preheated T cells were locally injected at the tumor site. FUS treatment was administered on days 11 and 15 posttumor injection. Tumor progression was monitored using both a caliper and bioluminescence imaging. (5C) Analysis of the tumor BLI images over time, showcasing tumor progression in groups injected with plain T cells, FUS-GD2 CAR, or FUS-GD2 CAR + TG18. (5D) Quantification of the tumor BLI signal on day 15. (5E) Tracking of tumor size over time using a caliper. (5F) Quantification of tumor size on day 15.

[0042] Figures 6A-6F depict that TGFP redirector acts as a signal amplifier for CAR- T signaling. (6A) Inducibility and sustainability are important factors for FUS CAR T cells. By integrating a feedback design, both inducibility and sustainability see marked improvements, widening the therapeutic window for FUS-CAR T therapy. (6B) Schematic representation of the feedback loop design. In addition to heat-induced CAR expression, theNF-KB response element is positioned downstream of the heat shock element. When the TGI 8 receptor is activated by TGF0, the NF-KB signaling pathway further promotes CAR expression via the NF-KB response element. Concurrently, CAR signaling can also activate NF-KB, leading to enhanced CAR expression. (6C) Dynamics of CAR surface expression post heat shock across different groups when co-cultured with GD2-positive U87-MG tumor cells. (6D) Timeline of the animal experiment. IxlO6U87 tumor cells were implanted into the hindlimb of NSG mice. Seven days later, IxlO6preheated T cells were locally injected into the tumor site. FUS treatment was administered on days 11 and 15 post-tumor injection. Tumor progression was monitored using both a caliper and bioluminescence imaging. (6E) Analysis of the tumor BLI images over time, illustrating tumor progression in groups injected with either FUS-GD2 CAR or FUS-NF-KB GD2 CAR + TGI 8. (6F) Quantification of the tumor BLI signal on day 15.DESCRIPTION OF THE INVENTION

[0043] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rded., Revised, J. Wiley & Sons (New York, NY 2006); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 7thed., J. Wiley & Sons (New York, NY 2013); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4thed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2012), provide one skilled in the art with a general guide to many of the terms used in the present application.

[0044] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

[0045] The term “expression cassette” or “nucleic acid cassette” refers to a nucleic acid molecule composed of one or more genes and the sequences controlling their expression. In various embodiments, an expression cassette comprises: a promoter sequence, an open reading frame, and a 3’ untranslated region that, in eukaryotes, usually contains a polyadenylation site. In another embodiment, an expression cassette contains one or more expression control sequences, e.g., a promoter, enhancer, poly(A) sequence, and a gene(s) of interest, e.g., a polynucleotide(s) of interest. Vectors may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleic acid cassettes.

[0046] The term “promoter” as used herein refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. An RNA polymerase initiates and transcribes polynucleotides operably linked to the promoter. In particular embodiments, promoters operative in mammalian cells comprise an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated and / or another sequence found 70 to 80 bases upstream from the start of transcription, a CNCAAT region where N may be any nucleotide.

[0047] The term “enhancer” refers to a segment of DNA which contains sequences capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence. An enhancer can function cooperatively or additively with promoters and / or other enhancer elements.

[0048] The term “operably linked”, refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. In one embodiment, the term refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, and / or enhancer) and a second polynucleotide sequence, e.g., a polynucleotide-of-interest, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.

[0049] “Ectodomain” refers to the domain of a membrane protein that extends into the extracellular space. The extracellular domain of a receptor is the part of the receptor protein that extends outside the cell membrane, and is primarily responsible for ligand recognition and binding. Unless otherwise specified, “extracellular domain” and “ectodomain” is used interchangeably. For example, an extracellular domain of a TGFp receptor as disclosed herein may also be called ectodomain of TGFp receptor. In various embodiments, an extracellular domain of a TGF receptor is a TGFP-binding domain, also called as an extracellular TGFP- binding domain or a TGFp-specific binding domain or an extracellular TGFp-specific binding domain. These terms are used interchangeably to provide a polypeptide with the ability specifically bind to the TGFp. The binding domain may be derived either from a natural, synthetic, semi-synthetic, or recombinant source.

[0050] An “intracellular domain” of a receptor, also known as the cytoplasmic domain, relays signals to the interior of a cell or organelle.

[0051] The term “response element,” “promoter element,” “cis-acting DNA regulatory element,” or “cis-regulatory element” refers to a short sequence of DNA within (or being operably linked to) a gene promoter or enhancer region which a specific transcription factor may bind to and as a result regulates transcription of genes. In various embodiments, one ormore defined response elements are joined, or operably linked, to a minimal promoter (e.g., TATA-box), thereby controlling expression of a gene of interest. In some embodiments, a response element is a tandem repeats of a specific transcriptional response element (TRE).

[0052] The term “promoter” as used herein refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. An RNA polymerase initiates and transcribes polynucleotides operably linked to the promoter. The term “minipromoter,” “minimal promoter,” or “compact promoter” refers to short DNA sequences that control expression of adjacent DNA in specific cells or tissues.

[0053] “Polynucleotide,” “polynucleotide sequence,” or “nucleic acid” may be used interchangeably unless otherwise specified, which includes but is not limited to DNA, RNA, cDNA (complementary DNA), mRNA (messenger RNA), rRNA (ribosomal RNA), shRNA (small hairpin RNA), snRNA (small nuclear RNA), snoRNA (short nucleolar RNA), miRNA (microRNA), genomic DNA, synthetic DNA, synthetic RNA, and / or tRNA.

[0054] “Polypeptide,” “peptide” and “protein” are used interchangeably, unless specified to the contrary, and according to conventional meaning, i.e., as a sequence of amino acids. In one embodiment, a “polypeptide” includes fusion polypeptides and other variants. Polypeptides can be prepared using any of a variety of well-known recombinant and / or synthetic techniques. Polypeptides are not limited to a specific length, e.g., they may comprise a full-length protein sequence, a fragment of a full length protein, or a fusion protein, and may include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like, as well as other modifications known in the art, both naturally occurring and non-naturally occurring. In particular embodiments, polypeptides include polypeptides having at least about 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 86%, 97%, 98%, or 99% amino acid identity to any of the reference sequences contemplated herein, typically where the variant maintains at least one biological activity of the reference sequence. Fusion polypeptides and fusion proteins refer to a polypeptide having at least two, three, four, five, six, seven, eight, nine, or ten polypeptide segments.

[0055] “Single chain variable fragment”, “single-chain antibody variable fragments” or “scFv” antibodies refer to forms of antibodies comprising the variable regions of only the heavy and light chains, connected by a linker peptide.

[0056] An “antibody” refers to a binding agent that is a polypeptide comprising at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes andbinds an epitope of an antigen. Antibodies include antigen binding fragments thereof, such as Camel Ig, Ig NAR, Fab fragments, Fab' fragments, F(ab)'2 fragments, F(ab) '3 fragments, Fv, single chain Fv proteins (“scFv”), bis-scFv, (scFv)2, minibodies, diabodies, triabodies, tetrabodies, disulfide stabilized Fv proteins (“dsFv”), and single-domain antibody (sdAb, Nanobody) and portions of full length antibodies responsible for antigen binding.

[0057] Mammalian heavy chains are classified as a, 5, E, y, and p. Mammalian light chains are classified as or K. Immunoglobulins comprising the a, 5, s, y, and p heavy chains are classified as immunoglobulin (Ig)A, IgD, IgE, IgG, and IgM. The complete antibody forms a “Y” shape. The stem of the Y consists of the second and third constant regions (and for IgE and IgM, the fourth constant region) of two heavy chains bound together and disulfide bonds (inter-chain) are formed in the hinge. Heavy chains y, a and 8 have a constant region composed of three tandem (in a line) Ig domains, and a hinge region for added flexibility; heavy chains p and s have a constant region composed of four immunoglobulin domains. The second and third constant regions are referred to as “CH2 domain” and “CH3 domain”, respectively. Each arm of the Y includes the variable region and first constant region of a single heavy chain bound to the variable and constant regions of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding.

[0058] Light and heavy chain variable regions contain a “framework” region interrupted by three hypervariable regions, also called “complementarity -determining regions” or “CDRs.” The CDRs can be defined or identified by conventional methods, such as by sequence according to Kabat et al. (Wu, T T and Kabat, E. A., J Exp Med. 132(2):211-50, (1970); Borden, P. and Kabat E. A., PNAS, 84: 2440-2443 (1987); (see, Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991, which is hereby incorporated by reference), or by structure according to Chothia et al (Chothia, C. and Lesk, A. M., J Mol. Biol., 196(4): 901-917 (1987), Chothia, C. et al, Nature, 342: 877- 883 (1989)).

[0059] The term “transmembrane domain” or “TM domain” refers a domain that anchors a polypeptide to the plasma membrane of a cell. The TM domain may be derived either from a natural, synthetic, semi-synthetic, or recombinant source. In various embodiments, the TM domain is an IL receptor TM domain.

[0060] The term “intracellular signaling domain” refers to the portion of a protein which transduces the effector function signal and that directs the cell to perform a specialized function. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire domain. To the extent that a truncated portion of anintracellular signaling domain is used, such truncated portion may be used in place of the entire domain as long as it transduces the effector function signal. The term intracellular signaling domain is meant to include any truncated portion of the intracellular signaling domain sufficient to transducing effector function signal.

[0061] The term “effector function” or “effector cell function” refers to a specialized function of an immune effector cell. Effector function includes, but is not limited to, activation, cytokine production, proliferation and cytotoxic activity, including the release of cytotoxic factors, or other cellular responses elicited with antigen binding to the receptor expressed on the immune effector cell.

[0062] “Vector”, “cloning vector” and “expression vector” refer to the vehicle by which a polynucleotide sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include plasmids, phages, viruses, etc.

[0063] ‘Chimeric antigen receptor” or “CAR” or “CARs” refers to engineered receptors, which graft an antigen specificity onto cells (for example T cells such as naive T cells, central memory T cells, effector memory T cells or combination thereof). CARs are also known as artificial T-cell receptors, chimeric T-cell receptors or chimeric immunoreceptors. In various embodiments, a CAR comprises a ligand-binding (or antigen-specific targeting) region, an extracellular domain, a transmembrane domain, one or more co-stimulatory domains, and an intracellular signaling domain. Further description of CAR structures is provided in US Patent No. 9447, 194 and US Patent Application Publication No. US20230310601, which are incorporated by reference herein. “Ligand-binding region / domain” or “antigen-specific targeting region” refers to the region of a CAR which targets specific ligands or antigens; and it typically includes an antibody or a functional equivalent thereof or a fragment thereof or a derivative thereof. “Co-stimulatory domain” (CSD) refers to the portion of the CAR which enhances the proliferation, survival and / or development of memory cells; and exemplary CSD comprises the costimulatory domain of any one or more of, for example, members of the TNFR superfamily, CD28, CD137 (4-1BB), CD134 (0X40), DaplO, CD27, CD2, CD5, ICAM-1, LFA-l(CDl la / CD18), Lek, TNFR-I, TNFR-II, Fas, CD30, CD40 or combinations thereof. “Extracellular spacer domain” (ESD) may be included in a CAR; and ESD refers to the hydrophilic region which is between the ligand-binding (or antigen-specific targeting) region and the transmembrane domain; and exemplary ESD comprises any one or more of (i) a hinge, CH2 and CH3 regions of IgG4, (ii) a hinge region of IgG4, (iii) a hinge and CH2 of IgG4, (iv) a hinge region of CD8a, (v) a hinge, CH2 and CH3 regions of IgGl, (vi) a hinge region ofIgGl or (vi) a hinge and CH2 region of IgGl. “Intracellular signaling domain” (ISD) or “cytoplasmic domain” of a CAR transduces the effector function signal and directs the cell to perform its specialized function; and exemplary ISD include but are not limited to the chain of the T-cell receptor complex or any of its homologs (e.g., r| chain, FceRlyand [3 chains, MB1 (Iga) chain, B29 (IgP) chain, etc.), human CD3 zeta chain, CD3 polypeptides (A, 5 and e), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lek, Fyn, Lyn, etc.) and other molecules involved in T-cell transduction, such as CD2, CD5 and CD28. “Transmembrane domain” (TMD) of a CAR is the transmembrane region of a transmembrane protein (for example Type I transmembrane proteins), an artificial hydrophobic sequence or a combination thereof.

[0064] The term “specifically binding,” or “selectively binding,” refers to the interaction between binding pairs. In some embodiments, the interaction has an affinity constant of at most 10'6moles / liter, at most 10'7moles / liter, or at most 10'8moles / liter. In other embodiments, the phrase “specifically binds” or “selectively binding” refers to the specific binding of one protein to another protein or ligand, wherein the level of binding is statistically significantly higher than the background control for the assay. In one embodiment, the affinity of specific binding is about 2 times greater than background binding, about 5 times greater than background binding, about 10 times greater than background binding, about 20 times greater than background binding, about 50 times greater than background binding, about 100 times greater than background binding, or about 1000 times greater than background binding or more.

[0065] “Linker” (L) or “linker domain” or “linker region” as used herein refer to an oligo- or polypeptide region from about 1 to 100 amino acids in length, which links together any of the domains / regions of the CAR of the invention. In various embodiments, a “linker” is a plurality of amino acid residues between the various polypeptide domains, e g., between VH and VL domains in an scFv, or between extracellular antigen-specific binding domain and transmembrane domain, added for appropriate spacing and conformation of the molecule. Linkers may be composed of flexible residues like glycine and serine so that the adjacent protein domains are free to move relative to one another. In some embodiments, a linker is a GlySer linker, such as (GGGGS (SEQ ID NO:31 ))n, wherein n = 1, 2, 3, 4, or 5. Alternatively, flexible linkers can be rationally designed using a computer program capable of modeling both DNA-binding sites and the peptides themselves (Desjarlais & Berg, PNAS 90:2256-2260 (1993), PNAS 91 :11099-11103 (1994) or by phage display methods.

[0066] A “hinge domain,” refers to a polypeptide that plays a role in positioning the antigen binding domain away from the effector cell surface to enable proper cell / cell contact, antigen binding and activation. In particular embodiments, polypeptides may comprise one or more hinge domains between the binding domain and the multimerization domain, between the binding domain and the transmembrane domain (TM), or between the multimerization domain and the transmembrane domain. The hinge domain may be derived either from a natural, synthetic, semi-synthetic, or recombinant source. The hinge domain can include the amino acid sequence of a naturally occurring immunoglobulin hinge region or an altered immunoglobulin hinge region.

[0067] A “multimerization domain” refers to a polypeptide that preferentially interacts or associates with another polypeptide directly or via a bridging molecule, wherein the interaction of different multimerization domains substantially contributes to or efficiently promotes multimerization (i.e., the formation of a dimer, trimer, or multipartite complex, which may be a homodimer, heterodimer, homotrimer, heterotrimer, homomultimer, heteromultimer). A multimerization domain may be derived either from a natural, synthetic, semi-synthetic, or recombinant source. For example, an IL receptor chain (or its intracellular domain, or its transmembrane - intracellular domain) may interact or associate with another IL receptor chain (or its intracellular domain, or its transmembrane - intracellular domain), to form a complex and confer signaling transduction capability. For example, in various embodiments, a TGFP signal redirector as disclosed herein has two multimerizable chains, wherein a TGFpR2-derived polypeptide may interact or associate with a TGF PR 1 -derived polypeptide, to form a receptor complex in a cell (positioned across cell membrane), which increases IL receptor signal transduction in the presence of extracellular (exogenous) TGFp.

[0068] The terms, “patient”, “individual” and “subject” are used interchangeably herein. A “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. In various embodiment, the subject is a human in the methods.

[0069] The phrase “disease, condition, or a (pathogenic) infection” refers to an infection, an organ disease, a blood disease, an immune system disease, a cancer, a brain and nervous system disease, an endocrine disease, a pregnancy or childbirth-related disease, an inherited disease, or an environmentally-acquired disease. In various embodiments, the disease state is cancer. An “immune disorder” refers to a disease that evokes a response from the immune system. In particular embodiments, the term “immune disorder” refers to a cancer, anautoimmune disease, or an immunodeficiency. In one embodiment, immune disorders encompasse infectious disease.

[0070] “Cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to B-cell lymphomas (Hodgkin’s lymphomas and / or non-Hodgkins lymphomas), brain tumor, breast cancer, colon cancer, lung cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer, and prostate cancer, including but not limited to androgen-dependent prostate cancer and androgen-independent prostate cancer. A “cancer cell” refers to an individual cell of a cancerous growth or tissue. Cancer cells include both solid cancers and liquid cancers. A “tumor” or “tumor cell” refers generally to a swelling or lesion formed by an abnormal growth of cells, which may be benign, pre-malignant, or malignant. Most cancers form tumors, but liquid cancers, e.g., leukemia, do not necessarily form tumors. For those cancers that form tumors, the terms cancer (cell) and tumor (cell) are used interchangeably. The amount of a tumor in an individual is the “tumor burden” which can be measured as the number, volume, or weight of the tumor. In some embodiments, the tumor or cancer is a glioblastoma.

[0071] ‘Immune cell” as used herein refers to the cells of the mammalian immune system including but not limited to antigen presenting cells, B-cells, basophils, cytotoxic T- cells, dendritic cells, eosinophils, granulocytes, helper T-cells, leukocytes, lymphocytes, macrophages, mast cells, memory cells, monocytes, natural killer cells, neutrophils, phagocytes, plasma cells and T-cells.

[0072] An “increased” or “enhanced” amount is typically a “statistically significant” amount, and may include an increase that is 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) the response produced by vehicle or a control composition. By “enhance” or “promote,” or “increase” or “expand” refers generally to the ability of a composition contemplated herein to produce, elicit, or cause a greater physiological response (i.e., downstream effects) compared to the response caused by either vehicle or a control molecule / composition. A measurable physiological response may include an increase in T cell expansion, activation, persistence, cytokine secretion, and / or an increase in cancer cell killing ability, among others apparent from the understanding in the art and the description herein.

[0073] A “decrease” or “reduced” amount is typically a “statistically significant” amount, and may include an decrease that is 1.1, 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) the response (reference response) produced by vehicle, a control composition, or the response in a particular cell lineage. By “decrease” or “lower,” or “lessen,” or “reduce,” or “abate” refers generally to the ability of composition contemplated herein to produce, elicit, or cause a lesser physiological response (i.e., downstream effects) compared to the response caused by either vehicle or a control molecule / composition.

[0074] The term “treatment” or “treating” includes any beneficial or desirable effect on the symptoms or pathology of a disease or pathological condition, and may include even minimal reductions in one or more measurable markers of the disease or condition being treated. Treatment can involve optionally either the reduction of the disease or condition, or the delaying of the progression of the disease or condition, e.g., delaying tumor outgrowth. “Treatment” does not necessarily indicate complete eradication or cure of the disease or condition, or associated symptoms thereof.

[0075] Herein, a class of customized, protein-based synthetic molecules derived from TGFP receptor are provided, which function as a TGFP signal redirector to reprogram inhibitory signaling into stimulatory signaling. Preferably, the synthetic molecules are based on human proteins. In various embodiments, these TGFP signal redirector receptors (also called TGFP redirectors or TGFP signal redirectors) establish a synthetic signaling feedback loop to prolong the CAR molecules in T cells. Specifically, TGFP signal redirector receptors are constructed by combining the extracellular domain of TGFP receptors, a transmembrane domain, and the intracellular domain of an interleukin receptor. Our results showed these human protein-based TGFP signal redirector receptors have successfully rewired T-cell function in the immunosuppressive TME upon TGFP exposure. This process achieved the customized transformation of inhibitory TGFP signaling into endogenous stimulatory NFKB signaling or JAK / STAT signaling, and we have demonstrated tailored T cell phenotype in immunotherapy for solid tumors by implementing different designs of TGFP redirectors. Furthermore, TGFP redirectors can be utilized as signal amplifiers in FUS-CAR-T cells, allowing prolonged CAR molecule lifetime, and have been validated in a mouse tumor model. Specifically, a synthetic positive feedback loop using responsive elements corresponding to specific TGFP redirectors has been developed to extend the CAR half-life on the T cell surface and significantly enhance the tumor elimination efficiency of FUS-responsive CAR-T cells in vivo. In various aspects, the wholly human protein-based nature of these TGFP redirectors holdsignificant potential for clinical applications over other synthetic receptors. As TGFp plays a vital role in cellular development, TGFP redirectors have a great potential for broad applications in controlling cellular processes in other research areas. We conceive its applications in other means of CAR-T cell therapy and other immune cell type such as macrophages which is susceptive to the inhibitory TGFp molecule.

[0076] In various aspects, to mitigate the on-target off-tumor toxicity, FUS-CAR technology is utilized, in which FUS is used to control the activation of CAR-T cells for which CAR-T cells are engineered with a heat-sensitive promoter that responds to FUS-generated heat. This switch activates CAR-T cells through mild temperature increase generated by focused ultrasound and allows for precise control over CAR-T cell activity, limiting their activation to the tumor site and minimizing the risk of side effects.

[0077] Therefore in various embodiments, the compositions and methods provided herein address two challenges in ultrasound inducible CAR-T cell therapy for cancer: the inhibitory effects of the tumor microenvironment mediated by TGFp, and the limited sustainability of CAR molecules on FUS-CAR-T cells. In various embodiments, fully human transgene molecules (functioning as TGFp signal switches) are provided to rewire T-cell function in an immunosuppressive microenvironment, converting inhibitory TGFP signaling to endogenous stimulatory MyoD-NFicB signaling or JAK / STAT signaling (or another signaling of choice) when coupled with different signaling motifs to achieve tailored T phenotype. For instance, when coupled with the IL18 signaling motif, T cells with TGFP redirector convert TGFP signaling to NF-kB signaling and allow for more efficient tumor elimination by FUS-responsive CAR-T cells. In additional embodiments, by incorporation of a NF-kB response element as a responsive element in the promoter to drive CAR expression, TGFP signal redirectors function as a signal amplifier of CAR-T signaling that not only activates the endogenous stimulatory signaling pathway after TGFp treatment but also converts TGFP signaling into CAR molecule expression on the T cell surface, leading to sustained CAR half-life on T cells and improved tumor-killing efficacy.

[0078] Various embodiments provide TGFp signal redirector receptors, which transduces an immunostimulatory signal upon exposure to TGFp. In some embodiments, a TGFP signal redirector receptor is a complex formed from fusion polypeptides. In preferably embodiments, a TGFp signal redirector receptor is a heterodimeric complex. In various embodiments, a TGFp signal redirector receptor includes a first fusion polypeptide (or denoted as ‘TGFpR2-derived polypeptide’) and a second fusion polypeptide (or denoted as ‘TGFPR1- derived polypeptide’), wherein the TGFpR2-derived polypeptide includes an extracellularTGFp-binding domain of TGFp receptor 2 (TGFPR2), a first transmembrane domain, and an intracellular domain of a first chain (subunit) of an interleukin (IL) receptor; and the TGFPR1- derived polypeptide includes an extracellular TGFp-binding domain of the TGFp receptor 1 (TGFpRl), a second transmembrane domain, and an intracellular domain of a second chain of the IL receptor.

[0079] In other embodiments, the TGFpR2-derived polypeptide includes an extracellular TGFp-binding domain of TGFPR2, a first transmembrane domain, and an intracellular signaling domain of an immune receptor, such as a cytokine receptor, a pattern recognition receptor, a toll-like receptor, or an interleukin receptor; and the TGFpRl -derived polypeptide includes an extracellular TGFp-binding domain of TGFpRl, a second transmembrane domain, and an intracellular signaling domain of an immune receptor, such as a cytokine receptor, a pattern recognition receptor, a toll-like receptor, or an interleukin receptor.

[0080] In various embodiments, TGFPR2 is human TGFPR2. In some embodiments, human TGFPR2 is homo sapiens transforming growth factor beta receptor II isoform 2, which has a GenBank ID: ALQ33818.1. For example, extracellular domain of the human TGFPR2 of GenBank ID: ALQ33818.1 is shown in SEQ ID NO:9. In various embodiments, the extracellular TGFP-binding domain of TGFPR2 has an amino acid sequence of SEQ ID NO:9 or at least 95% sequence identity to SEQ ID NO:9. In some embodiments, the extracellular TGFP-binding domain of TGFPR2 is an N-terminus truncated fragment compared to SEQ ID NO:9, wherein signal peptide or the first about 10, 20, 30, 40, 50, 60, or 70 residues at the N- terminus of SEQ ID NO:9 is absent. In preferably embodiments, the extracellular TGFP- binding domain of TGFPR2 comprises at least residues 74-191 of SEQ ID NO:9, or a sequence having at least 95% identity to residues 74-191 of SEQ ID NO:9.

[0081] In some embodiments, TGFpRl is human TGFpRl. In some embodiments, human TGFpRl is homo sapiens TGF-beta receptor type-1 isoform 5, which has an NCBI accession number NP_001394346.1. For example, extracellular domain of the human TGFpRl of NCBI accession number NP_001394346.1 is shown in SEQ ID NO: 10. In various embodiments, the extracellular TGFP-binding domain of TGFpRl has an amino acid sequence of SEQ ID NO: 10 or at least 95% sequence identity to SEQ ID NOTO. In some embodiments, the extracellular TGFp-binding domain of TGFpRl is an N-terminus truncated fragment compared to SEQ ID NOTO, wherein signal peptide or the first about 10, 20, 30, or 33 residues at the N-terminus of SEQ ID NOTO is absent. In preferably embodiments, the extracellularTGFp-binding domain of TGFpRl comprises at least residues 34-125 of SEQ ID NO: 10, or a sequence having at least 95% identity to residues 34-125 of SEQ ID NO:10.

[0082] In some embodiments of a TGFp signal redirector receptor, the extracellular TGFp-binding domain of TGFPR2 comprises an amino acid sequence of SEQ ID NO:9 or at least residues 74-191 of SEQ IDNO:9; and the extracellular TGFp-binding domain of TGF Rl comprises an amino acid sequence of SEQ ID NO: 10 or at least residues 34-125 of SEQ ID NOTO.

[0083] In other embodiments, TGFPR2 and / or TGFpRl of a different isoform or even of a different organism is included, whose extracellular domain or extracellular TGFP-binding domain is known or assessable via techniques like X-ray crystallography in the art. Exemplary additional TGFPR2 isoforms (homo sapiens) include those with UniProt IDs: A3QNQ0, P37173, D2JYI1. Exemplary additional TGFpRl isoforms (homo sapiens) include those with UniProt IDs: P36897, Q5T7S2.

[0084] In some embodiments, transmembrane and intracellular signaling domains in a fusion protein disclosed herein include, but are not limited to, transmembrane and intracellular signaling domains isolated from an IL-18 receptor, an IL-1 receptor, an IL-33 receptor, an IL- 2 receptor, an IL-7 receptor, an IL-21 receptor, an IL-3 receptor, an IL-5 receptor, an IL- 6 receptor, an IL- 11 receptor, an IL-27 receptor, an IL- 12 receptor, an IL-23 receptor, an IL- 36 receptor, a type I IFN receptor, a TLR1 receptor, a TLR2 receptor, a TLR3 receptor, a TLR4 receptor, a TLR5 receptor, a TLR6 receptor, a TLR7 receptor, a TLR8 receptor, a TLR5 receptor, or a TLR10 receptor.

[0085] In further embodiments, transmembrane and intracellular signaling domains in a fusion protein disclosed herein include, but are not limited to, transmembrane and intracellular signaling domains isolated from IL-18RP (NCBI Reference Sequence / accession number: NP_001380417.1) , IL-18Ra (NCBI Reference Sequence / accession number: NP_001358351.1), IL-2RP (NCBI Reference Sequence / accession number: NP_000869.1), IL- 2Ry (GenBank ID: KAI2599896.1), IL-3Ra (NCBI Reference Sequence / accession number: NP_001254642.1), IL-3RP (NCBI Reference Sequence / accession number: NP_000386.1), IL- 6Ra (GenBank: EAW53201.1), IL6ST (NCBI Reference Sequence / accession number: NP_001351204.1), IL- 7Ra (GenBank ID: EAW55924.1), IL-2Ry (GenBank: KAI2599896.1), IL-21Ra (NCBI Reference Sequence / accession number: NP 068570.1), IL-23R (GenBank ID: AAM44229.1), or IL-12RP1 (NCBI Reference Sequence / accession number: NP 005526.1).Redirector receptors that redirects TGFft signal to IL-18-mediated signal

[0086] In some embodiments, a TGFp signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-18 receptor chain; a polypeptide cleavage signal; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL- 18 receptor chain.

[0087] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFP 2, a first transmembrane domain, and an intracellular domain of a first IL-18 receptor chain; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL- 18 receptor chain.

[0088] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL- 18 receptor P chain (IL-18RP); and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-18 receptor a chain (IL-18Ra). Alternatively, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-18Ra; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-18RP.

[0089] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 18Ra or IL-18RP. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-18Ra transmembrane domain, and an IL-18Ra intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-18RP transmembrane domain, and an IL-18RP intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-18RP transmembrane domain, and an IL-18RP intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-18Ra transmembrane domain, and an IL-18Ra intracellular signaling domain.

[0090] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and anIL-18Ra intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-18RP intracellular signaling domain In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-18RP intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-18Ra intracellular signaling domain.

[0091] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus- 1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfi signal to IL-2-mediated signal

[0092] In some embodiments, a TGFp signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-2 receptor chain; a polypeptide cleavage signal; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-2 receptor chain.

[0093] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-2 receptor chain; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-2 receptor chain.

[0094] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-2 receptor P chain (IL-2RP); and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-2 receptor y chain (IL-2Ry). Alternatively, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-2Ry; and a TGFpRl-derivedpolypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-2RP.

[0095] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 2Rp or IL-2Ry. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-2RP transmembrane domain, and an IL-2RP intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGF Rl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-2RP transmembrane domain, and an IL-2RP intracellular signaling domain.

[0096] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-2RP intracellular signaling domain; and a TGF Rl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGF R2, a TGF R2 transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-2RP intracellular signaling domain.

[0097] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus-1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfl signal to IL-3-mediated signal

[0098] In some embodiments, a TGFp signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-3 receptor chain; a polypeptide cleavage signal; and a TGFpRl-derived polypeptide comprising: anextracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-3 receptor chain.

[0099] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-3 receptor chain; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-3 receptor chain.

[0100] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-3 receptor a chain (IL-3Ra); and a TGF Rl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-3 receptor P chain (IL-3RP). Alternatively, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-3 RP; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-3Rot.

[0101] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 3Ra or IL-3Rp. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-3Ra transmembrane domain, and an IL-3Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-3RP transmembrane domain, and an IL-3RP intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-3RP transmembrane domain, and an IL-3RP intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-3Ra transmembrane domain, and an IL-3Ra intracellular signaling domain.

[0102] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-3Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-3RP intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembranedomain, and an IL-3RP intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR1, a TGFPR1 transmembrane domain, and an IL-3Ra intracellular signaling domain.

[0103] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus-1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfi signal to IL-6-mediated signal

[0104] In some embodiments, a TGFP signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-6 receptor chain; a polypeptide cleavage signal; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-6 receptor chain.

[0105] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-6 receptor chain; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-6 receptor chain.

[0106] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-6 receptor a chain (IL-6Ra); and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-6 cytokine family signal transducer (IL6ST). Alternatively, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL6ST; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-6Ra.

[0107] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 6Ra or IL6ST. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellularTGFp-binding domain of TGFPR2, an IL-6Ra transmembrane domain, and an IL-6Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, an IL6ST transmembrane domain, and an IL6ST intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFp-binding domain of TGFPR2, an IL6ST transmembrane domain, and an IL6ST intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, an IL-6Ra transmembrane domain, and an IL-6Ra intracellular signaling domain.

[0108] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFp-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-6Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL6ST intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL6ST intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-6Ra intracellular signaling domain.

[0109] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus- 1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfi signal to IL-7 -mediated signal

[0110] In some embodiments, a TGFP signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-7 receptor chain; a polypeptide cleavage signal; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-7 receptor chain.

[0111] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domainof TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-7 receptor chain; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-7 receptor chain

[0112] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-7 receptor a chain (IL-7Ra); and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-2 receptor y chain (fL-2Ry). Alternatively, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of ZL-2Ry; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-7Rot.

[0113] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 7Rot or fL-2Ry. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFp-binding domain of TGFPR2, an IL-7Ra transmembrane domain, and an IL-7Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, an IL-7Ra transmembrane domain, and an IL-7Ra intracellular signaling domain.

[0114] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-7Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-7Ru intracellular signaling domain.

[0115] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus-1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfi signal to IL-21 -mediated signal

[0116] In some embodiments, a TGFP signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-21 receptor chain; a polypeptide cleavage signal; and a TGFPR1 -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-21 receptor chain.

[0117] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-21 receptor chain; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-21 receptor chain.

[0118] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-21 receptor a chain (IL-21Ra); and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-2 receptor y chain (IL-2Ry). Alternatively, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-2Ry; and a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-21Ra.

[0119] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 21Ra or IL-2Ry. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-21Ra transmembrane domain, and an IL-21Ra intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGF R2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an ZL-2Ry transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-21Ra transmembrane domain, and an IL-21Ra intracellular signaling domain.

[0120] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-21Ra intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-2Ry intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-2Ry intracellular signaling domain; and a TGFpRl-derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-21Ra intracellular signaling domain.

[0121] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asigna virus (TaV) (T2A) peptide, a porcine teschovirus- 1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Redirector receptors that redirects TGFfi signal to IL-23-mediated signal

[0122] In some embodiments, a TGFP signal redirector receptor comprises a fusion polypeptide comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFpR2, a first transmembrane domain, and an intracellular domain of a first IL-23 receptor chain; a polypeptide cleavage signal; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-23 receptor chain.

[0123] In some embodiments, a TGFP signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of a first IL-23 receptor chain; and a TGFpRl-derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of a second IL-23 receptor chain.

[0124] In some embodiments, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-23 receptor (IL- 23R); and a TGF PR 1 -derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL- 12 receptor P 1 subunit (IL- 12Rpi). Alternatively, a TGFp signal redirector receptor is a complex of polypeptides comprising: a TGFpR2-derived polypeptide comprising: an extracellular domain of TGFPR2, a first transmembrane domain, and an intracellular domain of IL-12RP1; and a TGFpRl- derived polypeptide comprising: an extracellular domain of TGFpRl, a second transmembrane domain, and an intracellular domain of IL-23R.

[0125] In some embodiments, a polypeptide comprises a transmembrane domain of IL- 23R or IL-12RP1. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFp-binding domain of TGFPR2, an IL-23R transmembrane domain, and an IL- 23R intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, an IL-12RP1 transmembrane domain, and an IL-12Rpi intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, an IL-12RP1 transmembrane domain, and an IL-12RP1 intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, an IL-23R transmembrane domain, and an IL-23R intracellular signaling domain.

[0126] In other embodiments, a polypeptide comprises a transmembrane domain of TGFPR2 or TGFpRl. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-23R intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFp-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-12RP1 intracellular signaling domain. In one embodiment, a TGFpR2-derived polypeptide comprises an extracellular TGFP-binding domain of TGFPR2, a TGFPR2 transmembrane domain, and an IL-12Rpi intracellular signaling domain; and a TGFpRl -derived polypeptide comprises an extracellular TGFP-binding domain of TGFpRl, a TGFpRl transmembrane domain, and an IL-23R intracellular signaling domain.

[0127] In some embodiments, the polypeptide cleavage signal is a viral self-cleaving polypeptide; more preferably, a viral self-cleaving 2A polypeptide; and more preferably a viral self-cleaving polypeptide selected from the group consisting of: a foot-and-mouth disease virus (FMDV) (F2A) peptide, an equine rhinitis A virus (ERAV) (E2A) peptide, a Thosea asignavirus (TaV) (T2A) peptide, a porcine teschovirus- 1 (PTV-1) (P2A) peptide, a Theilovirus 2A peptide, and an encephalomyocarditis virus 2A peptide. In one embodiment, the polypeptide cleavage signal is a P2A or T2A viral self-cleaving polypeptide.Chimeric antigen receptors (CARs) and TGFfi signal redirector receptors

[0128] Some embodiments provide a polypeptide comprising a chimeric antigen receptor (CAR), a polypeptide cleavage signal, and a TGFp signal redirector receptor. Other embodiments provide a polypeptide comprising an engineered T cell receptor (TCR), a polypeptide cleavage signal, and a TGFp signal redirector receptor. Some embodiments provide that a polynucleotide or vector encoding a TGFP signal redirector receptor is introduced into a cell that comprises a CAR. In another embodiment, a CAR and a TGFp signal redirector receptor are introduced and co-expressed in a same immune effector cell or population of cells to increase resistance of the immune effector cells to the tumor microenvironment and potentiate and increase the efficiency, potency, and / or durability of the immune effector cell response.

[0129] CARs are molecules that combine antibody-based specificity for a target antigen (e.g., tumor antigen) with a T cell receptor-activating intracellular domain to generate a chimeric protein that exhibits a specific anti-tumor cellular immune activity. In various embodiments, cells are provided comprising a CAR and a TGFP signal redirector receptor. In one embodiment, T cells are engineered by introducing a polynucleotide or vector encoding a CAR and a TGFp signal redirector receptor separated by one or more polypeptide cleavage signals. In one embodiment, T cells are engineered by introducing a polynucleotide or vector encoding a CAR and a polynucleotide or vector encoding a TGFp signal redirector receptor. In one embodiment, T cells are engineered to express a CAR are further engineered by introducing a polynucleotide or vector encoding a TGFP signal redirector receptor.

[0130] Typically a CAR comprises an extracellular domain that binds to a specific target antigen (also referred to as a binding domain or antigen-specific binding domain), a transmembrane domain and an intracellular signaling domain. In some aspects, the CARs comprise linker residues between the various domains. In some aspects, the linker is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids long.

[0131] In various aspects, the extracellular binding domain comprises an antibody or antigen binding fragment thereof. In one preferred embodiment, the extracellular binding domain is an scFv. In another preferred embodiment, the extracellular binding domain is a camelid antibody. In some embodiments, the CAR comprises an extracellular domain thatbinds a tumor antigen. In some embodiments, the CAR comprises an scFv that binds disialoganglioside GD2, or comprises an extracellular GD2-binding domain having an amino acid sequence of SEQ ID NO:26 or at least 95% sequence identity to SEQ ID NO:26. In some embodiments, the CAR comprises an extracellular domain that binds an antigen selected from the group consisting of: alpha folate receptor, 5T4, av 6 integrin, BCMA, B7-H3, B7-H6, CAIX, CD 16, CD 19, CD20, CD22, CD30, CD33, CD44, CD44v6, CD44v7 / 8, CD70, CD79a, CD79b, CD123, CD138, CD171, CEA, CSPG4, EGFR, EGFR family including ErbB2 (HER2), EGFRvIII, EGP2, EGP40, EPCAM, EphA2, EpCAM, FAP, fetal AchR, FRa, GD2, GD3, Glypican-3 (GPC3), HLA-A1+MAGE1, HLA-A2+MAGE1, HLA-A3+MAGE1, HLA- A1+NY-ES0-1, HLA-A2+NY-ES0-1, HLA-A3+NY-ES0-1, IL-l lRa, IL-13Ra2, Lambda, Lewis- Y, Kappa, Mesothelin, Mucl, Mucl6, NCAM, NKG2D Ligands, NY-ESO-1, PRAME, PSCA, PSMA, R0R1, SSX, Survivin, TAG72, TEMs, VEGFR2, and WT-1.

[0132] In some aspects, the binding domain of the CAR is followed by one or more “spacer domains,” which refers to the region that moves the antigen binding domain away from the effector cell surface to enable proper cell / cell contact, antigen binding and activation. A CAR generally comprises one or more hinge domains between the binding domain and the transmembrane domain (TM). Exemplary spacer domains include but are not limited to one or more heavy chain constant regions, e.g., CH2 and CH3, and amino acid sequence of an immunoglobulin hinge region. For example, a CAR comprises a hinge region derived from CD8a or CD4. In some embodiments, the hinge domain comprises a CD8ot hinge region.

[0133] In some aspects, a CAR comprises a transmembrane domain between the extracellular binding domain and intracellular signaling domain. Exemplary transmembrane domains of CARs include but are not limited to transmembrane region(s) of the alpha or beta chain of the T-cell receptor, CD35, CD3s, CD3y, CD3^, CD4, CD5, CD8a, CD9, CD 16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD 134, CD137, CD152, CD 154, AMN, and PD-1. In some embodiments, a CAR comprises a transmembrane domain derived from CD28, or having an amino acid sequence of SEQ ID NO:28 or at least 95% sequence identity to SEQ ID NO:28.

[0134] In some aspects, a CAR comprises an intracellular signaling domain. The term intracellular signaling domain is meant to include any truncated portion of the intracellular signaling domain sufficient to transducing effector function signal. In preferred embodiments, a CAR comprises an intracellular signaling domain that further comprises one or more costimulatory signaling domains, in addition to primary signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptortyrosine-based activation motifs or ITAMs. Exemplary ITAMs containing primary signaling domains for use in CARs include but are not limited to those derived from FcRy, FcRP, CD3y, CD35, CD3E, CD3< CD22, CD79a, CD79b, and CD66d In one embodiment, a CAR comprises CD3^ primary signaling domain or an amino acid sequence of SEQ ID NO:30 or one having at least 95% sequence identity to SEQ ID NO:30; and a costimulatory signaling domain. Exemplary costimulatory signaling domains include but are not limited to TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (0X40), CD137 (4-1BB), CD278 (ICOS), DAP10, LAT, NKD2C, SLP76, TRIM, and ZAP70. In one embodiments, a CAR comprises a tumor antigen-specific binding domain; a transmembrane domain isolated from CD28 or having an amino acid sequence of SEQ ID NO:28 or one having at least 95% sequence identity to SEQ ID NO:28; CD3(^ primary signaling domain or an amino acid sequence of SEQ ID NO:30 or one having at least 95% sequence identity to SEQ ID NO: 30; and a CD28 costimulatory domain or an amino acid sequence of SEQ ID NO:29 or one having at least 95% sequence identity to SEQ ID NO:29.Polynucleotides

[0135] Various embodiments provide polynucleotides encoding TGFP signal redirector receptors, or TGFP signal redirector receptors and CAR molecules, or fusion proteins comprising TGFP signal redirector receptors and CAR molecules; as well as expression vectors, viral vectors, and transfer plasmids comprising polynucleotides. Polynucleotides may be single-stranded or double-stranded, deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and DNA / RNA hybrids.

[0136] In some embodiments, a polynucleotide comprises an DNA encoding a polypeptide disclosed herein. In some embodiments, a polynucleotide comprises an mRNA encoding a polypeptide disclosed herein. In certain embodiments, the mRNA comprises a cap, one or more nucleotides, and a poly (A) tail. It is appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are different nucleotide sequences that encode a polypeptide, or fragment of variant thereof, as described herein.

[0137] Polynucleotides disclosed herein may be combined with other DNA sequences, such as promoters and / or enhancers, untranslated regions (UTRs), signal sequences, Kozak sequences, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, internal ribosomal entry sites (IRES), recombinase recognition sites (e.g., LoxP, FRT, and Att sites), termination codons, transcriptional termination signals, and polynucleotides encoding self-cleaving polypeptides, or epitope tags.

[0138] Exemplary vectors include but are not limited to plasmid, autonomously replicating sequences, transposable elements (Sleeping Beauty, PiggyBac), phagemids, cosmids, artificial chromosomes such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or Pl -derived artificial chromosome (PAC), bacteriophages such as lambda phage or Ml 3 phage, and animal viruses. Exemplary viruses useful as vectors include but are not limited to retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, baculovirus, papillomavirus, and papovavirus (e.g., SV40). Exemplary expression vectors include, but are not limited to pClneo vectors (Promega) for expression in mammalian cells; pLenti4 / V5-DEST™, pLenti6 / V5- DEST™, and pLenti6.2 / V5-GW / lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. In some embodiments, coding sequences of polypeptides disclosed herein are ligated into such expression vectors for the expression of the polypeptides in mammalian cells.

[0139] Various embodiments provide that a polynucleotide disclosed herein includes a promoter that is operably linked to one or more of a heat-shock element (HSE), a nuclear factorkappa B (NF-kB) response element (NF-kB-RE), and a signal transducers and activators of transcription (STAT) response element. In various embodiments, a polynucleotide disclosed herein includes an inducible promoter.

[0140] In some embodiments, a polynucleotide encoding a CAR molecule further includes a promoter operably linked to one or more of a heat-shock element (HSE), a nuclear factor-kappa B (NF-kB) response element (NF-kB-RE), and a signal transducers and activators of transcription (STAT) response element.

[0141] In some embodiment, a polynucleotide disclosed herein includes a heat inducible (or heat sensitive) promoter. In various aspects, a heat-sensitive promoter is a mammalian or human promoter activated by increased temperature, e.g., temperature increased to between about 40 °C and 48 °C, or to between about 42 °C and 45 °C, or to about 43 °C. In some embodiments, a heat-sensitive promoter is a mammalian or human promoter (also called ‘core promoter’) operably linked to a heat-shock element (HSE). Exemplary HSEs and heatsensitive promoters are further described in Miller et al., Nat Biomed Eng. 2021 November; 5(11): 1348-1359. HSEs comprise multiple inverted repeats of the consensus sequence 5'- nGAAn-3' and are arrayed upstream of the transcription start site of heat-shock proteins (HSPs) to allow their upregulation following thermal stress. Exemplary core promoters, suitable for operably linking with HSEs, include HSPB1 core promoter, HSPA1A core promoter, HSPH1 core promoter, HSPA6 core promoter, and synthetic core promoter (e.g., YB). In someembodiments, HSE for operably linking with a core promoter is seven tandem repeats of 5’- nGAAnnTTCnnGAAn-3’. In some embodiments, HSE for operably linking with a core promoter is two tandem repeats of 5’-nGAAnnTTCnnGAAn-3’. In some embodiments, HSE for operably linking with a core promoter is three tandem repeats of 5’-nGAAnnTTCnnGAAn- 3’. In some embodiments, HSE for operably linking with a core promoter is four, five, or six, or more tandem repeats of 5’-nGAAnnTTCnnGAAn-3’.

[0142] In some embodiments, a heat sensitive promoter comprises 7H-YB. 7H-YB promoter comprises 7 repeats of a heat-shock element (HSE) operably linked to and upstream of YB -TATA promoter.

[0143] In some embodiments, a YB-TATA promoter comprises a nucleic acid sequence of SEQ ID NO:3 or at least 95% sequence identity to SEQ ID NOB. In some embodiments, a YB-TATA promoter has a sequence of: GCGATTAATCCATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACC AGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO:32). In some embodiments, a YB-TATA promoter is used in its shorter version TCTAGAGGGTATATAATGGGGGCCA (SEQ ID NO:33). Accordingly, wherever YB- TATA is referred to as a component of an inducible promoter herein, an equivalent sequence with sYB-TATA substituted in place of YB-TATA is also considered to be an alternative embodiment of the invention. Further description of YB-TATA promoter or similar mini promoters are provided in US Patent Application Publication No. US20230167458, which is hereby incorporated by reference.

[0144] In some embodiments, a heat-sensitive promoter is or comprises a human heat shock protein 70B (Hsp) promoter, and optionally the human heat shock protein 70B (Hsp) promoter has a sequence as set forth in SEQ ID NO:34: GTCGAGGCGCGTCCTCAGAGCCAGCCGGGAGGAGCTAGAACCTTCCCCGCGTTT CTTTCAGCAGCCCTGAGTCAGAGGCGGGCTGGCCTGGCATAGCCGCCCAGCCTCT CGGCTCACGGCCCGATCCGCCCGAACCTTCTCCCGGGGTCAGCGCCGCGCTGCGC CGCCCGGCTGACTCAGCCCGGGCGGGCGGGCGGGAGGCTCTCGACTGGGCGGGA AGGTGCGGGAAGGTTCGCGGCGGCGGGGTCGGGGAGGTGCAAAAGGATGAAAA GCCCGTGGAAGCGGAGCTGAGCAGATCCGAGCCGGGCTGGCGGCAGAGAAACC GCAGGGAGAGCCTCACTGCTGAGCGCCCCTCGACGGCGGAGCGGCAGCAGCCTC CGTGGCCTCCAGCATCCGACAAGAAGCTCTCTAGTCGACGGTATCGAT (SEQ ID NO:34).

[0145] In some embodiment, a polynucleotide disclosed herein includes an inducible promoter comprising a nuclear factor-KB (NF-kB) response element. NF-KB exerts its role as transcription factor by binding to variations of the consensus DNA sequence of 5'-GGGRNYY YCC-3' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide) known as KB sites. In some embodiments, a vector includes one or more copies of an NF-kB response element. In some embodiments, a polynucleotide includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the consensus DNA sequence of 5'-GGGRNYY YCC-3 ' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide). In some embodiment, an NF-kB response element comprises a nucleic acid sequence of SEQ ID NO:2 or at least having 95% sequence identity to SEQ ID NO:2.

[0146] In some embodiment, a polynucleotide disclosed herein includes an inducible promoter comprising a signal transducer and activator of transcription 3 (STAT3) response element, also called STAT3-responsive element. For example, STAT3 may bine to a 15-base pair (bp) response element termed human serum-inducible element (hSIE) in the promoter region of the c-fos gene. A variant sequence of hSIE has been identified for improved binding with STAT3, specifically the sequence 5’-CATTTCCCGTAAATC-3’ (SEQ ID NO:35). In some embodiments, a polynucleotide includes a STAT3 response element comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of 5’-CATTTCCCGTAAATC-3’ (SEQ ID NO:35). In some embodiments, a STAT3 response element comprises a nucleic acid sequence of SEQ ID NO:4 or at least having 95% sequence identity to SEQ ID NO:4.

[0147] In some embodiment, a polynucleotide disclosed herein includes an inducible promoter comprising a signal transducer and activator of transcription 5 (STAT5) response element. For example, STAT5 exerts its role as transcription factor by binding to variations of the consensus DNA sequence of 5’-TTCnnnGAA-3’ (in which n is any nucleotide). In some embodiments, a polynucleotide includes a STAT5 response element comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the consensus DNA sequence of 5’-TTCnnnGAA-3’ (in which n is any nucleotide). In some embodiments, a STAT5 response element comprises a nucleic acid sequence of SEQ ID NO: 5 or at least having 95% sequence identity to SEQ ID NO: 5.

[0148] Some embodiments provide one or more polynucleotides encoding a protein of interest and a TGFP signal redirector receptor that redirects TGFP signal to an IL-18, IL-1, or IL-33 signal, wherein the protein of interest is in an expression cassette driven by a promoter including an NF-kB response element. In some embodiments, one or more polynucleotides encoding a protein of interest and a TGFP signal redirector receptor that redirects TGFP signalto inducing NF-kB, wherein the protein of interest is in an expression cassette driven by a promoter including an NF-kB response element.

[0149] Some embodiments provide one or more polynucleotides encoding a protein of interest and a TGFp signal redirector receptor that redirects TGFp signal to an IL-2, IL-7, IL- 21, IL-3, IL-5, IL-6, IL-11, IL-27, IL-12, or IL-23 signal, wherein the protein of interest is in an expression cassette driven by a promoter including a STAT3 response element and / or a STAT5 response element. In some embodiments, one or more polynucleotides encoding a protein of interest and a TGFp signal redirector receptor that redirects TGFp signal to inducing STAT, wherein the protein of interest is in an expression cassette driven by a promoter including a STAT3 response element and / or a STAT5 response element.

[0150] In further embodiments, the protein of interest comprises a chimeric antigen receptor (CAR). Some embodiments provide one or more polynucleotides encoding a CAR and a TGFp signal redirector receptor that redirects TGFp signal to an IL-18, IL-1, or IL-33 signal, wherein the CAR is in an expression cassette driven by a promoter including an NF-kB response element. Other embodiments provide one or more polynucleotides encoding a CAR and a TGFp signal redirector receptor that redirects TGFp signal to an IL-2, IL-7, IL-21, IL-3, IL-5, IL-6, IL-11, IL-27, IL-12, or IL-23 signal, wherein the CAR is in an expression cassette driven by a promoter including a STAT3 response element and / or a STAT5 response element.

[0151] In yet further embodiments, the protein of interest is driven by at least one of a heat-inducible promoter and a promoter including an NF-kB response element or a STAT response element. Some embodiments provide one or more polynucleotides encoding a protein of interest (e.g., CAR) and a TGFp signal redirector receptor that redirects TGFp signal to an IL-18, IL-1, or IL-33 signal, wherein the protein of interest is in an expression cassette driven by a promoter including a heat shock element and an NF-kB response element. Some embodiments provide one or more polynucleotides encoding a protein of interest (e.g., CAR) and a TGFP signal redirector receptor that redirects TGFP signal to an IL-2, IL-7, IL-21, IL-3, IL-5, IL-6, IL-11, IL-27, IL-12, or IL-23 signal, wherein the protein of interest is in an expression cassette driven by a promoter including a heat shock element and one or both of a STAT3 response element and a STAT5 response element.

[0152] Viral vectors comprising polynucleotides disclosed herein can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application. Non-viral delivery of polynucleotides may be used, such as through electroporation, sonoporation, lipofection, microinjection, biolistics, virosomes, liposomes,immunoliposomes, nanoparticles, polycation or lipid ucleic acid conjugates, naked DNA, artificial virions, DEAE-dextran-mediated transfer, gene gun, and heat-shock. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., mobilized peripheral blood, lymphocytes, bone marrow aspirates, tissue biopsy, etc.) or induced pluripotent stem cells derived from cells explanted from an individual patient or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient. Engineered cells (genetically modified cells)

[0153] Various embodiments provide cells modified to express TGFp signal redirector receptor polypeptides, or a combination of TGFP signal redirector receptor polypeptides and CARs. Cells may be non-genetically modified to express the polypeptides disclosed, or in preferred embodiments, cells may be genetically modified to carry the polynucleotides disclosed herein or express the polypeptides disclosed herein. Modified or engineered cells may be for use in treatment of cancer or another disease.

[0154] In some embodiments, the TGFp signal redirector receptor polypeptides disclosed herein are introduced and expressed in immune effector cells to improve the resistance of the cells to the immunosuppressive signals in the tumor microenvironment mediated by TGFp. In particular embodiments, TGFP signal redirector receptor polypeptides are introduced and expressed in immune effector cells that have been redirected to a target cell by virtue of co-expressing an engineered antigen receptor in the cell.

[0155] An immune effector cell includes any cell of the immune system that has one or more effector functions (e.g., cytotoxic cell killing activity, secretion of cytokines, induction of ADCC and / or CDC). Exemplary immune effector cells include but are not limited to T lymphocytes, in particular cytotoxic T cells (CTLs; CD8+ T cells), TILs, and helper T cells (HTLs; CD4+ T cells. In one embodiment, immune effector cells include natural killer (NK) cells. In one embodiment, immune effector cells include natural killer T (NKT) cells. Immune effector cells can be autologous / autogeneic (“self’) or non-autologous (“non-self,” e.g., allogeneic, syngeneic or xenogeneic). Immune effector cells also include progenitors of effector cells wherein such progenitor cells can be induced to differentiate into an immune effector cells in vivo or in vitro. Thus, in some embodiments, immune effector cell includes hematopoietic stem cells (HSCs) contained within the CD34+population of cells derived from cord blood, bone marrow or mobilized peripheral blood which upon administration in a subject differentiate into mature immune effector cells, or which can be induced in vitro to differentiate into mature immune effector cells.

[0156] In further embodiments, polynucleotides disclosed herein are introduced into induced pluripotent stem cells or embryonic stem cells, which may subsequently be differentiated into an immune effector cell.

[0157] In order to achieve sufficient therapeutic doses of T cell compositions, T cells are often subjected to one or more rounds of stimulation, activation and / or expansion. T cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7, 144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041, each of which is incorporated herein by reference in its entirety. In some embodiments, T cells are activated and expanded for about 6 hours, about 12 hours, about 18 hours or about 24 hours prior to introduction of vectors or polynucleotides encoding the TGFp signal redirector receptor polypeptides, optionally in combination with an engineered antigen receptor disclosed herein. In one embodiment, T cells are activated at the same time that they are modified.

[0158] In some embodiments, polynucleotide(s) encoding a TGFP signal redirector receptor and an engineered antigen receptor are introduced into a population of T cells. In a one embodiment, polynucleotide encoding a TGFp signal redirector receptor is introduced into a population of T cells that express an engineered antigen receptor. The polynucleotides may be introduced into the T cells by microinjection, transfection, lipofection, heat-shock, electroporation, transduction, gene gun, microinjection, DEAE-dextran-mediated transfer, and the like. In one embodiment, polynucleotides are introduced into a T cell by viral transduction.

[0159] Various embodiments provide immune effector cells modified to express a TGFp signal redirector receptor and an engineered antigen receptor (e.g., CAR), wherein TGFp signal redirector receptor increases NF-kB or STAT in response to exposure to extracellular TGFP or tumor cells, wherein expression of the engineered antigen receptor is driven by a promoter including an NF-kB response element or a STAT response element, and wherein the engineered antigen receptor’s cell surface residence time is increased by at least 10%, compared to without the NF-kB response element and the STAT response element. In some embodiments, immune effector cells modified to express a TGFp signal redirector receptor and an engineered antigen receptor (e.g., CAR), wherein TGFP signal redirector receptor increases NF-kB or STAT in response to exposure to extracellular TGFP or tumor cells and wherein expression of the engineered antigen receptor is driven by a promoter including an NF-kB response element or a STAT response element, have an increased engineered antigen receptor’s cell surface residence time by 1-10%, 10-20%, 20-30%, 30-40%, 40-50%, or more than 50%, compared to without the NF-kB response element and the STAT response element. In someembodiments, the immune effector cells have an increased engineered antigen receptor’s cell surface residence time by at least 20%, compared to without the NF-kB response element and the STAT response element. In some embodiments, the immune effector cells have an increased engineered antigen receptor’s cell surface residence time by at least 30%, compared to without the NF-kB response element and the STAT response element. In some embodiments, the immune effector cells have an increased engineered antigen receptor’s cell surface residence time by atleast40%, compared to without the NF-kB response element and the STAT response element. In some embodiments, the immune effector cells have an increased engineered antigen receptor’s cell surface residence time by at least 50%, compared to without the NF-kB response element and the STAT response element.

[0160] Exemplary viral vector systems suitable for introducing a polynucleotide into an immune effector cell or CD34+ cell include, but are not limited to adeno-associated virus (AAV), retrovirus, herpes simplex virus, adenovirus, vaccinia virus vectors for gene transfer.

[0161] In one embodiment, polynucleotides are introduced into a T cell by AAV transduction. In one embodiment, polynucleotides are introduced into a T cell by retroviral transduction. In one embodiment, polynucleotides are introduced into a T cell by lentiviral transduction. In one embodiment, polynucleotides are introduced into a T cell by adenovirus transduction. In one embodiment, polynucleotides are introduced into a T cell by herpes simplex virus transduction. In one embodiment, polynucleotides are introduced into a T cell by vaccinia virus transduction.Compositions and Formulations

[0162] The compositions contemplated herein may comprise one or more polypeptides, polynucleotides, vectors comprising same, or genetically modified immune effector cells. Compositions include, but are not limited to pharmaceutical compositions. A pharmaceutical composition is a composition formulated in pharmaceutically-acceptable or physiologically- acceptable solutions. A pharmaceutical composition may be used for administration to a cell or an animal, either alone, or in combination with one or more other modalities of therapy. It will be understood that, if desired, the compositions may be administered in combination with other agents as well, such as, e.g., cytokines, growth factors, hormones, small molecules, chemotherapeutics, pro-drugs, drugs, antibodies, or other various pharmaceutically-active agents.

[0163] Pharmaceutically acceptable carrier refers to a diluent, adjuvant, excipient, or vehicle which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response,or other problem or complication, commensurate with a reasonable benefit / risk ratio. Examples of pharmaceutical carriers can be sterile liquids, such as cell culture media, water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. In some embodiments suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

[0164] In one embodiment, a composition comprising a pharmaceutically acceptable carrier is suitable for administration to a subject. In particular embodiments, a composition comprising a carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal or intramuscular administration. In particular embodiments, a composition comprising a pharmaceutically acceptable carrier is suitable for intraventricular, intraspinal, or intrathecal administration. Pharmaceutically acceptable carriers include sterile aqueous solutions, cell culture media, or dispersions.

[0165] In particular embodiments, compositions comprise genetically modified T cells and a pharmaceutically acceptable carrier. The compositions may be formulated in a suspension in a nontoxic pharmaceutically acceptable medium. For example, modified cells are dispersed within an acceptable liquid medium or solution, e.g., saline or serum-free medium, in an intravenous (IV) bag or the like. Acceptable diluents include, but are not limited to water, PlasmaLyte, Ringer's solution, isotonic sodium chloride (saline) solution, serum-free cell culture medium, and medium suitable for cryogenic storage, e.g., Cryostor® medium.

[0166] In some embodiments, compositions comprise polynucleotides disclosed herein and a pharmaceutically acceptable carrier.Methods of Uses

[0167] In various embodiments, immune effector cells comprising a TGFP signal redirector receptor disclosed herein, including CAR T cells, provide improved methods of adoptive immunotherapy for use in the prevention, treatment, and amelioration of cancers, or for preventing, treating, or ameliorating at least one symptom associated with a cancer. In some embodiments, immune effector cells comprising a TGFP signal redirector receptor disclosed herein, including CAR modified cells, provide improved methods of adoptive immunotherapy for use in the prevention, treatment, and amelioration of an infectious disease, an autoimmune disease, an inflammatory disease, an immunodeficiency, or GVHD,

[0168] In some embodiments, the modified immune effector cells are used in the treatment of solid tumors or cancers. Solid tumors or cancers include, but are not limited to, adrenal cancer, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain / CNS cancer, breast cancer, bronchial tumors, cardiac tumors, cervical cancer, cholangiocarcinoma, chondrosarcoma, chordoma, colon cancer, colorectal cancer, craniopharyngioma, ductal carcinoma in situ (DCIS) endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, fallopian tube cancer, fibrous histiosarcoma, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), germ cell tumors, glioma, glioblastoma, head and neck cancer, hemangioblastoma, hepatocellular cancer, hypopharyngeal cancer, intraocular melanoma, kaposi sarcoma, kidney cancer, laryngeal cancer, leiomyosarcoma, lip cancer, liposarcoma, liver cancer, lung cancer, non-small cell lung cancer, lung carcinoid tumor, malignant mesothelioma, medullary carcinoma, medulloblastoma, menangioma, melanoma, Merkel cell carcinoma, midline tract carcinoma, mouth cancer, myxosarcoma, myelodysplastic syndrome, myeloproliferative neoplasms, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oligodendroglioma, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic islet cell tumors, papillary carcinoma, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pinealoma, pituitary tumor, pleuropulmonary blastoma, primary peritoneal cancer, prostate cancer, rectal cancer, retinoblastoma, renal cell carcinoma, renal pelvis and ureter cancer, rhabdomyosarcoma, salivary gland cancer, sebaceous gland carcinoma, skin cancer, soft tissue sarcoma, squamous cell carcinoma, small cell lung cancer, small intestine cancer, stomach cancer, sweat gland carcinoma, synovioma, testicular cancer, throat cancer, thymus cancer, thyroid cancer, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vascular cancer, vulvar cancer, and Wilms Tumor. In some embodiments, the modified immune effector cells are used in the treatment of solid tumors or cancers including, without limitation, liver cancer, pancreatic cancer, lung cancer, breast cancer, bladder cancer, brain cancer, bone cancer, thyroid cancer, kidney cancer, or skin cancer.

[0169] In some embodiments, modified immune effector cells are used in the treatment of liquid cancers or hematological cancers. In some embodiments, the modified immune effector cells are used in the treatment of B-cell malignancies, including but not limited to, leukemias, lymphomas, and multiple myeloma.

[0170] Preferred cells for use in the methods include autologous / autogeneic (“self’) cells, preferably hematopoietic cells, more preferably T cells, and more preferably immune effector cells.

[0171] In one embodiment, an effective amount of modified immune effector cells provided to a subject is at least 2xl06cells / kg, at least 3* 106cells / kg, at least 4x106cells / kg, at least 5 xlO6cells / kg, at least 6x 106cells / kg, at least 7x l06cells / kg, at least 8x l06cells / kg, at least 9xl06cells / kg, or at least 10xl06cells / kg, or more cells / kg, including all intervening doses of cells. One of ordinary skill in the art would recognize that multiple administrations of the compositions contemplated in particular embodiments may be required to effect the desired therapy. For example, a composition may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times over a span of 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 5, years, 10 years, or more.

[0172] In one embodiment, a method of treating a subject with a cancer comprises obtaining immune effector cells from the subject, modifying the immune effector cells by introducing one or more vectors encoding an CAR and a TGFP signal redirector receptor, producing a population of modified immune effector cells, and administering the population of modified immune effector cells to the same subject. The methods for administering the cell compositions include any method which is effective to result in reintroduction of ex vivo modified immune effector cells or on reintroduction of the modified progenitors of immune effector cells that on introduction into a subject differentiate into mature immune effector cells. One method comprises modifying peripheral blood T cells ex vivo by introducing one or more vectors encoding an engineered antigen receptor and a TGFp signal redirector receptor, and returning the transduced cells into the subject.

[0173] In some embodiments, a method of treating a subject comprises administering to the subject a therapeutically effective amount of immune effector cells modified to express a CAR and a TGFP signal redirector receptor, wherein expression of the CAR is driven by a heat-inducible promoter, and apply ultrasound or focused ultrasound or heat to the subject. In some embodiments, a method of treating a subject having a tumor includes: administering to the subject a therapeutically effective amount of immune effector cells modified to express a CAR and a TGFP signal redirector receptor, wherein expression of the CAR is driven by a heat-inducible promoter, and stimulating the tumor cell or nearby tumor tissue with ultrasound or heat, thereby activating the heat-inducible promoter for expression of its operably linked nucleotide sequence.

[0174] In various embodiments, fusion proteins are provided, wherein a fusion protein contains an extracellular domain of a transforming growth factor beta (TGFP) receptor fused with an intracellular domain of an interleukin (IL) receptor. In various aspects, the fusion protein further includes a transmembrane domain of the IL receptor, and the configuration is from N to C-terminus: extracellular domain of TGFp receptor - transmembrane domain of the IL receptor - intracellular domain of the IL receptor. Typically the fusion proteins provided function as synthetic receptors, which are expressible for dimerization or multimerization as a cell surface receptor, capable of binding to TGFp and redirecting TGFp signal to one induced by an IL that otherwise activates the IL receptor (e.g., redirecting TGFP signal from an inhibitory one to a stimulating one in the cell). Therefore the fusion proteins may also be referred to as TGFp signal redirector receptors. In various embodiments, the extracellular domain of the TGFP receptor and the intracellular domain of the IL receptor are: an extracellular domain of TGFp receptor 1 (TGFpRl) and an intracellular domain of an alpha chain of the IL receptor, respectively, wherein the IL receptor comprises IL- 18 receptor, IL-2 receptor, IL-7 receptor, IL-21 receptor, IL-3 receptor, IL-6 receptor, or IL-23 receptor. In various embodiments, the extracellular domain of the TGFp receptor and the intracellular domain of the IL receptor are: an extracellular domain of TGFP receptor 2 (TGFPR2) and an intracellular domain of a beta chain of the IL receptor , respectively; wherein the IL receptor comprises IL- 18 receptor, IL-2 receptor, IL-7 receptor, IL-21 receptor, IL-3 receptor, IL-6 receptor, or IL-23 receptor.

[0175] In some embodiments, the extracellular domain of the TGFP receptor and the intracellular domain of the IL receptor are: an extracellular domain of TGFP receptor 1 (TGFpRl) and an intracellular domain of IL- 18 receptor alpha chain (IL-18Ra), respectively; an extracellular domain of TGFp receptor 2 (TGFPR2) and an intracellular domain of IL18 receptor beta chain (IL-18RP), respectively; an extracellular domain of the TGFpRl and an intracellular domain of the IL-18RP, respectively; or an extracellular domain of the TGFPR2 and an intracellular domain of the IL-18Ra, respectively.

[0176] Polynucleotides encoding the fusion proteins are also provided. In some embodiments, the polynucleotide is in an expression cassette. In some embodiments, the polynucleotide is in a recombinant expression vector.

[0177] Engineered cells, e.g., immune cells such as T cells, NK cells, or macrophages, are also provided, which express (or have been engineered with a polynucleotide encoding) a TGFp signal redirector receptor.

[0178] In various embodiments, an immune cell provided herewith includes a chimeric antigen receptor (CAR) cassette. For example, the CAR contains an antigen-specific targeting region that targets GD2, CD 19, EGFR, HER2, or another antigen associated with a disease, a cancer, or an immune cell malignancy. In various embodiments, an immune cell includes a CAR expression cassette which is under the control of a thermo-responsive promoter (or a mammalian or a human promoter or transcriptional activator activated by increased temperature). In some embodiments, a thermo-responsive promoter is a promoter for a heatshock protein, also called a heat shock protein promoter. In some embodiments, a thermo- responsive promoter is human heat shock protein 70B (Hsp) promoter. In some embodiments, the human heat shock protein 70B promoter has an amino acid sequence described in US Patent Application Publication No. 20220298515. In some embodiments, CAR-T cells are provided, in which the CAR cassette is under the control of a promoter for the heat-shock protein. In some embodiments, short pulses of ultrasound are applied to a subject / patient (e.g., human patient) which has been administered with CAR-T cells whose CAR expression cassette is under the control of a promoter for heat-shock protein. In some embodiments, focused ultrasound (FUS) is applied to drive expression of a CAR cassette in T cells under the control of a promoter for heat-shock protein; and focused ultrasound is removed, and the CAR cassette in the T cells is not expressed, hence reversibly controlling the expression of the CAR cassette. Additional description of FUS and CAR-T cells or CAR-immune cells is provided in US2022 / 0298515, US 2022 / 0354891, and US. Patent No. 11,504,427, which are hereby incorporated by reference in their entireties.

[0179] In further embodiments, a gene of interest (e.g., an open reading frame encodingCAR) is driven by a hybrid promoter - also denoted as an “IF-BETTER” gate. In some embodiments, a hybrid promoter contains an NFkB responsive element and a heat shock promoter. In some embodiments, a hybrid promoter has an NFkB responsive element being 5’ to a heat shock promoter. In other embodiments, a hybrid promoter has a heat shock promoter being 5’ to an NFkB responsive element. In some embodiments, no nucleic acid linker is included in the hybrid promoter between two elements.

[0180] Methods of treating a patient with cancer, and / or inhibiting growth of tumor in the patient are also provided, which includes administering to the patient a therapeutically effective quantity of the engineered immune cells provided herewith, and if the engineeredimmune cells contain a recombinant expression vector encoding a genetic element driven by a thermo-responsive promoter or being operably linked to a transcriptional activator activated by increased temperature, the method further includes stimulating the cells with heat, such as applying ultrasound or preferably focused ultrasound to the patient especially at tumor site to generate heat, so as to express or activate expression of the genetic element. In some embodiment, the genetic element is a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor has a tumor antigen-specific targeting region.

[0181] Exemplary cancers or tumors to be treated with by the systems or compositions disclosed herein include but are not limited to glioblastoma, glioblastoma multiforme, nonsmall cell lung carcinoma, colorectal cancer, prostate cancer, and gastric carcinoma. In some embodiments, the cancer has increased expression TGFp compared to normal cells. In some embodiments, the cancer has a higher expression of TGFP compared to an average of a pool of at least 5, 6, 7, 8, 9, or 10 types of cancers.

[0182] Exemplary self-cleaving peptides are 2A self-cleaving peptides, including P2A, E2A, F2A, and T2A.

[0183] Exemplary NFkB responsive promoters are described in Badr et al., Mol Imaging. 2009 Sep-Oct; 8(5): 278-290.EXAMPLES

[0184] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.1. TGFp redirector converts TGF signaling to IL18-MyoD-NFicB signaling

[0185] To test the idea of TGFp signal redirector (also denoted as TGF redirector), we started with the redirecting of inhibitory TGFP signaling to IL18 receptor-mediated MyoD / NFKB signaling. Previous studies have implicated IL18 pathway in enhancing T-cell survival in solid tumors. We engineered the chimeric protein receptor that integrates the extracellular domain of the TGFP receptor with the intracellular domain of the Interleukin 18 (IL 18) receptor, specifically TGFP receptor 1 (TGF R1) with IL18 receptor alpha chain (IL 18Ra) as well as TGFp receptor 2 (TGFPR2) with IL 18 receptor beta chain (IL 18RP). Based on this design, we expect that upon extracellular stimulation by external TGFP in the tumor microenvironment, the TGFP receptor will cluster as the conventional TGFP receptor but initiate downstream stimulatory signaling via the IL 18 receptor-mediated MyoD-NFkBpathway (Figure 1A). Since different extracellular domains may affect its structural function in the chimeric receptor, we tested various combinations of extracellular domains by combining the transmembrane (TM) domain and intracellular domain of IL 18 receptors During the initial testing, we have two selection criteria which are 1) successful expression of the TGFp redirector on the cell membrane and 2) the ability to redirect the inhibitory signal to the stimulatory signal upon TGFp stimulation (Figure IB). To test the signaling rewiring function of TGFp redirectors with IL18 signaling motifs, we used an NFkB reporter in Jurkat T-cells (or human T-cells) in which NFkB responsive elements were used to drive the expression of EGFP. We have tested three variants and our results revealed that variant 1 failed to express as a membrane protein, while variant 2, although expressed on the cell membrane (Figure 1C), was unable to achieve signal transduction (Figure ID). Variant 3 was found can meet both criteria successfully; specifically, without exogenous TGFP stimulation, the reporter was nonexpressing, illustrating the low activity level of the NFkB signaling in naive or T cells expressing the TGFp redirector with IL18 signaling motifs, namely TG18. Upon adding 2ng / ml of exogenous TGFP, we observed over 45% of the cells have a significant amount of reporter expression when cultured in starvation conditions, representing the activation of NFkB signaling (Figure ID). Since T cells inherently secrete TGFP and the FBS in the complete medium contains soluble TGFP, T cells expressing the TGI 8 redirector cultured in normal conditions showed a low level of activated NFkB signal, which have around 13% EGFP positive cells, demonstrating the TGI 8 redirector is sensitive to respond to low-level endogenous TGFp. In summary, we have demonstrated the successful engineering of the TGFP redirector capable of rewiring the inhibitory TGFp signal into the stimulatory IL18-NFkB signal pathway in T cells.2. TGFp redirector mediates T cell phenotype change after TGFp treatment

[0186] Next, we tested whether TGFp redirector can alter the phenotype of primary human T cells in response to TGFP (Figure 2A). We first compared cell phenotype by analyzing key genes IL2, ZFNy, and TNFa, which have been reported to play crucial roles in T cell-mediated tumor clearance. We found that adding TGFp to T cells inhibited the secretion of IL2, IFNy and TNFa (Figure 2B). Conversely, when TGI 8 was expressed, TGFP treatment induced the secretion of IL2, IFNy, and mitigated the inhibitory effect of TGFP on the secretion of TNFa (Figure 2B). To systematically characterize the T cell phenotype, RNAseq method was adopted for the analysis of cells from different groups. Significant phenotypic differences were observed between plain T cells and TGI 8 T cells before and after TGFP treatment (Figure 2C). Specifically, there are 655 significantly upregulated genes and 555 significantlydownregulated genes in TGI 8 T cells after TGFp treatment compared to the naive T cells treated with TGFP (Figure 2D). Gene Ontology (GO) analysis revealed that the most significantly upregulated genes in TG18 T cells after TGFp treatment were enriched in T-cell activation, enhancing its granule production and cell-cell adhesion (Figure 2E). Gene Set Enrichment Analysis (GSEA) found that after cells were stimulated with TGFp, the inflammatory response, some kinase signaling pathways, such as the KRAS signaling, and Interferon related signaling pathways, such as Interferon a response, Interferon y response, were significantly enriched in TGI 8-positive T cells comparing to the naive T cells (Figure 2F- 2G), proving the successful rewiring of these signaling pathways. Based on these results, we demonstrated that TGI 8 successfully rewires T cell response in the immunosuppressive tumor microenvironment at the transcriptome level; specifically, instead of inhibiting T cell function, TGFP activates TG18-T cells.3. TGFp redirector is customizable to redirect inhibitory TGFp signaling into different stimulatory signaling

[0187] The treatment of T cells with different interleukins affects the phenotype of CAR-T cells and also affects the effectiveness of CAR-T therapy. Interleukin receptors can be categorized into various families. Since the design of the TGFp redirector is based on the natural heterodimer properties of the TGFP receptor and interleukin receptor, we are wondering whether we can change the T cell phenotype under TGFp stimulation by altering the intracellular domain of the TGFP redirector to redirect to customized interleukin signaling pathway whose activation relies on the dimerization of its receptor (Figure 3 A). We picked one or more representative receptor from the different families, which includes IL-2, IL-7, and IL- 21 from the common y family, IL-3 from the common P family, IL-6 from the common gpl30 family, and IL-23 as potential TGFP redirectors TGns, and named them as TG2, TG7, TG21, TG3, TG6, TG21, and TG23, respectively (Figure 3B). These cytokine receptors dimerize upon ligand binding and initiate downstream signaling pathways, mainly JAK / STAT signaling. The surface expression of different TGns was confirmed using anti-TGFBR2 antibodies in HEK293T cells. (293T (or HEK 293T) is a derivative human cell line that expresses a mutant version of the SV40 large T antigen.) After constructing these TGn redirectors, we aimed to screen and select a redirector that can rewire the TGFP signaling to the STAT3 or STAT5 signaling pathways, as these two signaling pathways play a crucial role in the proliferation, activation, and antitumor activity of CAR-T cells.

[0188] T cells expressing different TGns were treated with 5ng / ml TGFP, and three hours later, the phosphorylation of STAT3 or STAT5 was accessed using flow cytometry(Figure 3C-3D). Notably, TG3 and TG23 exhibited significant activation of the STAT5 and STAT3 signaling pathways, respectively, upon TGFP treatment (Figure 3C-3F). These observations are consistent with canonical IL3 and IL-23 signaling pathways in which IL3 receptor mainly activates STAT5 and IL23 receptor mainly activates STAT3 when binds to its ligand. To further validate our findings and test the STAT signaling responsive elements, we employed the STAT3 and STAT5 responsive elements to drive the expression of a luciferase reporter. Consistent with the staining result, TG23 robustly drove the luciferase expression under STAT3 responsive elements, while TG3 promoted the luciferase expression under STAT5 responsive elements (Figure 3G). The above results demonstrated we can customize the T cell phenotype when responding to soluble TGFp by changing the intracellular domain of TGFp redirectors.

[0189] To further elucidate the dependency of TGFP redirector function on the dimerization of synthetic molecules, a single-chain version of receptor 1 (Rl) and receptor 2 (R2) from the TGFp redirector-TG23 was engineered and expressed in T cells. Following treatment with 5 ng / ml of TGFP, no activation of the STAT3 signaling pathway was observed (Fig 4), which is typically induced upon effective TGFp signaling (Fig.3E). The absence of STAT3 activation in this context demonstrates that the functional activation of the TGFP redirectors is reliant on the dimerization of signal molecules, thereby highlighting the important role of this molecular interaction in the proper function of the redirectors.4. TGFp redirector enhances the therapeutic efficacy of FUS CAR in vivo

[0190] We have demonstrated TGFP redirector could redirect inhibitory TGFP signaling to stimulatory signaling in T cells in response to soluble TGFp, which is highly expressed in glioblastoma multiforme (GBM) patients. To further test whether TGFP could enhance the CAR-T cell therapy. In this study, we tested the TGFP redirector in a glioblastoma multiforme (GBM) model, in which high levels of TGFp expression were observed, and disialoganglioside GD2 can be chosen as an effective CAR targeting antigen. We choose to use a high-affinity anti-GD2 scFv to engineer the CAR molecule due to its significantly enhanced tumor clearance efficacy in vitro. Amino acid sequence of the anti-GD2 scFv is seen in Table ID, SEQ ID NO:26. It was derived from antibody 14G2a, with “mutation” / substitution of amino acid(s) to have a higher affinity for the antigen. The CAR molecule has a configuration of: CD8 signal peptide - anti-GD2 scFv - CD28 extracellular domain - transmembrane domain - CD28 co-stimulatory domain - CD3Z domain; the sequence(s) of which included in the Table ID. However, this high-affinity ant-GD2CAR was reported to have high tonic signaling, elevated cytokine expression, and lethal toxicity when used in vivo,potentially due to the low GD2 expression in healthy brain tissue in one study. We expressed the TGI 8 redirector in T cells, which contains a FUS-GD2-CAR cassette, which can respond to FUS stimulation and express a CAR that specifically targets the GD2 on the glioblastoma. This CAR-T cell will have two layers of engineering control, which are 1) heat shock promoter (7HE) can respond to the heat generated by the ultrasound and lead to the expression of GD2 CAR, and 2) the TGFp secreted by the tumor cells is redirected to the NF-KB signaling pathway, which enhances the functions of the T cells (Figure 5A). We evaluated this design in NSG mice bearing the U87 tumors (human U87MG glioblastoma cells). The plain T cells (control group), or FUS-CAR T cells engineered with or without TG18, were injected 7 days after the U87 tumor inoculation, and the focused ultrasound heating was performed on day 11 and Day 15 after tumor injection, with a 4-day interval between sessions (Figure 5B). All these three groups received FUS treatment. The heating was conducted using the focused ultrasound system integrated with a thermosprobe which can provide a feedback signal to tune the power of FUS via proportional-integral-derivative (PID) control. The tumor growth was monitored by measuring the tumor size and the bioluminescence signal. We found when comparing the tumor progression among the control group and FUS-CAR groups, FUS-CAR has shown tumor inhibitory effects compared to the control group, but there was no significant difference between these two groups (Figure 5C-5F). In contrast, TG18-FUS CAR demonstrated the best tumor control among these groups and has shown significantly enhanced efficacy compared to the control group (Figure 5C-5F). The above results demonstrated that, when applied in vivo, TGI 8 improved the therapeutic efficacy of FUS CAR-T cells.5. TGFp redirector can be used as the signal amplifier of CAR-T signaling

[0191] During the in vivo study, significant tumor mitigation was observed in the FUS- CAR with TGI 8 expression. We reasoned that the insufficient tumor inhibition is due to the short CAR duration time on the T cell surface (Figure 6A). The binding of an antigen to a CAR molecule facilitates the internalization of the CAR, a mechanism that impacts the future applicability of controllable CAR-T cells. This was supported by our results that with our initial FUS CAR, after heat shock and co-culture with tumor cells, CAR is swiftly internalized, and surface molecules are reduced to basal level within 24 hours. To solve this problem, we further investigated whether we can utilize TGFP redirector and its synthetic signaling pathway to engineer an “IF -BETTER” gate by integrating an NFkB responsive element with the heat shock promoter to form a hybrid promoter, in which, if there is the presence of TGF , it will further activate the CAR expression via the NFkB responsive elements in the hybrid promoter (Figure 6B). (We conceive every order combination for elements in a hybrid promoter.) Elements in ahybrid promoter may independently drive the expression of the open reading frame; and so if TGFP and FUS are both present, the expression is higher than that when only TGFP is present without the FUS or when only FUS is present without the TGFp. In this design, the TGFp redirector not only activates the endogenous signaling pathways to alter cell phenotypes but also stimulates the expression of CAR molecules through a synthetic responsive element (Figure 6B). We found after the inclusion of the NFkB element, the CAR-T cell can still have around 90% induction rate of CAR, which indicates additional NFkB responsive elements do not influence the induction efficiency of the 7HE promoter in response to heat. After adding the NFkB responsive element and TGI 8 as an IF -BETTER control system, we found even after two days of co-cultivation with tumor cells, the CAR’s surface residence time remains high as 45% positive cells, measured by live cell anti-CAR antibody staining. This prolongation is attributable to the interaction between TGI 8 and TGFP, as in the absence of TGI 8, the basal expression of NFkB-CAR is low and unresponsive to TGFp (Figure 6C). Based on these results, we demonstrate that by activating the endogenous signaling pathways utilizing TGI 8, we can design an “IF-BETTER” gate to redirect the TGFP signaling into CAR expression as a way to prolong the CAR retention time on the T cell surface. This pathway can simultaneously respond to TGF or FUS, ensuring a long-term expression of CAR molecules on the cell surface. We further evaluated the efficacy of the positive feedback FUS-CAR in the animal model (Figure 6D). The pre-heated T cells were injected into the mice four days after tumor inoculation and heated via ultrasound at 4-day intervals. We found the “IF-BETTER” gate FUS CAR design effectively controls tumor growth, surpassing the performance of the original FUS CAR (Figure 6E-6F). Thus, we have demonstrated the dual functionality of the TGI 8 redirector, as it not only converts inhibitory TGFP signals into activation signals but also serves as a signal amplifier, sustaining CAR expression and considerably enhancing the overall efficacy of FUS CAR T therapy.

[0192] In summary, using a synthetic approach, we have engineered a series of fully human transgene switches to rewire T-cell function in an immunosuppressive microenvironment. This allows for customized T cell signaling in response to TGFp, facilitating efficient tumor control of FUS-controllable CAR-T cells or other heat-inducible CAR-immune cells.

[0193] Various embodiments of the invention are described above in the Detailed Description. While these descriptions directly describe the above embodiments, it is understood that those skilled in the art may conceive modifications and / or variations to the specific embodiments shown and described herein. Any such modifications or variations thatfall within the purview of this description are intended to be included therein as well. Unless specifically noted, it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art(s).

[0194] The foregoing description of various embodiments of the invention known to the applicant at this time of filing the application has been presented and is intended for the purposes of illustration and description. The present description is not intended to be exhaustive nor limit the invention to the precise form disclosed and many modifications and variations are possible in the light of the above teachings. The embodiments described serve to explain the principles of the invention and its practical application and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out the invention.

[0195] While particular embodiments of the present invention have been shown and described, it will be obvious to those skilled in the art that, based upon the teachings herein, changes and modifications may be made without departing from this invention and its broader aspects and, therefore, the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g, the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc ). As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). Although the open-ended term “comprising,” as a synonym of terms such as including, containing, or having, is used herein to describe and claim the invention, the present invention, or embodiments thereof, may alternatively be described using alternative terms such as “consisting of’ or “consisting essentially of.”

[0196] The term “about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term “about” or “approximately” refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.Table 1A Hybrid DNA promoter-related sequences (RE: responsive element).Table IB Amino Acid Sequence (extracellular domain (ECD) of TGFb Receptors)Table 1C Amino Acid Sequence (transmembrane (TM) and intracellular (IC) domain of IL receptors)Table ID Exemplary anti-GD2 CAR-related amino acid sequences

Claims

WHAT IS CLAIMED IS:

1. One or more polynucleotides encoding fusion polypeptides, the fusion polypeptides comprising:(a) a TGFpR2-derived polypeptide comprising: an extracellular domain of transforming growth factor beta (TGFP) receptor 2 (TGF R2), a first transmembrane domain, and an intracellular domain of a first interleukin (IL) receptor chain, and(b) a TGFpRl -derived polypeptide comprising: an extracellular domain of TGFp receptor 1 (TGFpRl), a second transmembrane domain, and an intracellular domain of a second IL receptor chain; wherein the first IL receptor chain and the second IL receptor chain form an IL receptor complex.

2. The one or more polynucleotides of claim 1, being a single polynucleotide encoding the TGFPR2 -derived polypeptide - a self-cleaving 2A peptide - the TGFpRl -derived polypeptide.

3. The one or more polynucleotides of claim 1, wherein the TGFpR2-derived polypeptide and the TGFpRl -derived polypeptide when co-expressed in a cell increases IL receptor signal transduction in the presence of extracellular TGFp.

4. The one or more polynucleotides of claim 1, wherein the extracellular domain of TGFPR2 comprises an amino acid sequence of residues 74-191 of SEQ ID NO:9.

5. The one or more polynucleotides of claim 1, wherein the extracellular domain of TGFPR2 comprises an amino acid sequence having at least 95% sequence identity to SEQ ID N0:

96. The one or more polynucleotides of claim 1, wherein the extracellular domain of TGFpRl comprises an amino acid sequence of residues 35-125 of SEQ ID NOTO.

7. The one or more polynucleotides of claim 1, wherein the extracellular domain of TGFpRl comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 10.

8. The one or more polynucleotides of claim 1, wherein the extracellular domain of TGFPR2 comprises an amino acid sequence of residues 74-191 of SEQ ID NO:9; wherein the extracellular domain of TGFpRl comprises an amino acid sequence of residues 35-125 of SEQ ID NOTO; and wherein the first transmembrane domain comprises a transmembrane domain of the first IL receptor chain, and the second transmembrane domain comprises a transmembrane domain of the second IL receptor chain.

9. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL- 18 receptor beta chain (IL-18RP) and IL- 18 receptor alpha chain (IL- 18Ra).

10. The one or more polynucleotides of claim 8, wherein the first IL receptor chain is the IL-18RP, and the second IL receptor chain is the IL-18Ra.

11. The one or more polynucleotides of claim 9, wherein the transmembrane domain of the IL-18RP and the intracellular domain of the IL-18RP, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 11; and wherein the transmembrane domain of the IL-18Ra and the intracellular domain of the IL-18Rot, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 12.

12. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-2 receptor beta chain (IL-2RP) and IL-2 receptor gamma chain (IL-2Ry).

13. The one or more polynucleotides of claim 8, wherein the first IL receptor chain is the IL-2RP, and the second IL receptor chain is the IL-2Ry.

14. The one or more polynucleotides of claim 12, wherein the transmembrane domain of the IL-2RP and the intracellular domain of the IL-2RP, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 13; and wherein the transmembrane domain of the IL-2Ry and the intracellular domain of the IL-2Ry, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 14.

15. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-3 receptor alpha chain (IL-3Ra) and IL-3 receptor beta chain (IL-3RP).

16. The one or more polynucleotides of claim 8 wherein the first IL receptor chain is the IL-3Ra and the second IL receptor chain is the IL-3Rp.

17. The one or more polynucleotides of claim 15, wherein the transmembrane domain of the IL-3Ra and the intracellular domain of the IL-3Ra, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 15; and the transmembrane domain of the IL-3RP and the intracellular domain of the IL-3RP, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 16.

18. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-6 receptor alpha chain (IL-6Ra) and IL-6 cytokine family signal transducer (IL6ST).

19. The one or more polynucleotides of claim 8, wherein the first IL receptor chain is the IL-6Ra, and the second IL receptor chain is the IL6ST.

20. The one or more polynucleotides of claim 18, wherein the transmembrane domain of the IL-6Ra and the intracellular domain of the IL-6Ra, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 17; and wherein the transmembrane domain of the IL6ST and the intracellular domain of the IL6ST, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 18.

21. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-7 receptor alpha chain (IL-7Ra) and IL-7 receptor gamma chain (IL-7Ry).

22. The one or more polynucleotides of claim 8 wherein the first IL receptor chain is the IL-7Ra, and the second IL receptor chain is the IL-7Ry.

23. The one or more polynucleotides of claim 21, wherein the transmembrane domain of the IL-7Ra and the intracellular domain of the IL-7Ra, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 19; and wherein the transmembrane domain of the IL-7Ry and the intracellular domain of the IL-7Ry, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 22.

24. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-21 receptor alpha chain (IL-21Ra) and IL-21 receptor gamma chain (IL-21Ry).

25. The one or more polynucleotides of claim 8, wherein the first IL receptor chain is the IL-21Ra, and the second IL receptor chain is the IL-21Ry.

26. The one or more polynucleotides of claim 24, wherein the transmembrane domain of the IL-21Ra and the intracellular domain of the IL-21Ra, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NQ:20; and wherein the transmembrane domain of the IL-21Ry and the intracellular domain of the IL-21Ry, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO:22.

27. The one or more polynucleotides of claim 1, wherein the first IL receptor chain and the second IL receptor chain are IL-23 receptor (IL-23R) and IL- 12 receptor beta 1 subunit (IL-I2RP1).

28. The one or more polynucleotides of claim 8, wherein the first IL receptor chain is the IL-23R, and the second IL receptor chain is the IL-12RP1.

29. The one or more polynucleotides of claim 27, wherein the transmembrane domain of the IL-23R and the intracellular domain of the IL-23R, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO:21; and wherein the transmembrane domain of the IL-12RP1 and the intracellular domain of the IL-12Rpi, when fused together, has an amino acid sequence having at least 95% sequence identity to SEQ ID NO:22.

30. The one or more polynucleotides of claim 1, wherein the TGFpR2-derived polypeptide further comprises a first linker, in a configuration from N- to C-terminus: the extracellular domain of the TGFPR2 - the first linker - the transmembrane domain of the IL receptor - the intracellular domain of the IL receptor.

31. The one or more polynucleotides of claim 1, further encoding a protein of interest in an expression cassette driven by a promoter, wherein the promoter is operably linked to one or more of a heat-shock element (HSE), a nuclear factor-kappa B (NF-kB) response element (NF-kB-RE), and a signal transducers and activators of transcription (STAT) response element.

32. The one or more polynucleotides of claim 31, wherein the NF-kB-RE comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO:2, the HSE comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO:1, and the STAT response element comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO:4 or 5.

33. A combination of polynucleotides, comprising the one or more polynucleotides of any one of claims 1-32, and another polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises: an scFv specific for an antigen associated with a disease; a transmembrane domain; and a CD3 zeta intracellular signaling domain; and optionally one or more of: a signal peptide at the N-terminus of the CAR,an extracellular spacer domain, positioned between the scFv and the transmembrane domain, and one or more co-stimulatory signaling domains selected from CD28, 4- 1BB, CD137, CD134, NKG2D, CD27, TLR2, ICOS, or a combination thereof.

34. The combination of polynucleotides of claim 33, wherein the first IL receptor chain and the second IL receptor chain are IL-18RP and IL-18Ra, and wherein the CAR in an expression cassette is driven by a promoter including an NF-kB-RE and one or both of a STAT response element and an HSE.

35. The combination of polynucleotides of claim 33, wherein the first IL receptor chain and the second IL receptor chain are IL-2RP and IL-2Ry, or IL-3Ra and IL-3RP, or IL-6Ra and IL6ST, or IL-7Ra and fL-7Ry, or IL-21Rot and IL-21Ry, or IL-23R and IL-12RP1, and wherein the CAR in an expression cassette is driven by a promoter including one or both of an HSE and a STAT response element.

36. An engineered cell, comprising one or more polynucleotides of any one of claims 1-32.

37. An engineered cell, comprising the combination of polynucleotides of claim 34 or 35, wherein the engineered cell is a T lymphocyte (T-cell), a natural killer cell, a macrophage, an induced pluripotent stem cell (iPSC), or an embryonic stem cell.

38. A method of modifying a cell in which an extracellular TGFP signal is redirected to induce a stimulatory response in the cell, the method comprising: transfecting or transducing the cell with one or more expression vectors comprising the one or more polynucleotides of any one of claims 1-32; and expressing the fusion polypeptides encoded by the one or more polynucleotides.

39. A method of treating a subject having a tumor, the method comprising: administering a therapeutically effective quantity of the engineered cells of claims 37 to the subject.

40. The method of claim 39, wherein the scFv of the CAR is specific for a cell-surface antigen expressed by the tumor.

41. The method of claim 39, wherein the CAR is in an expression cassette driven by a heatinducible promoter, and the method further comprises applying ultrasound, optionally focused ultrasound, to the subject.

42. The method of claim 41, wherein the quantity of the engineered cells is administered to the tumor or to peritumoral region, and the ultrasound is applied at site of the tumor.

43. The method of claim 39, wherein the engineered cells comprise T cells obtained from the subject or T cells derived from induced pluripotent stem cells.

Images