Compounds and methods for inhibiting lpa

Abstract

Provided are oligomeric agents, methods, and pharmaceutical compositions for reducing the amount or activity of LPA RNA in a cell or animal, and in certain instances reducing the amount of Lp(a) in a subject. Such oligomeric agents, methods, and pharmaceutical compositions are useful to treat or manage inflammatory, cardiovascular and / or metabolic diseases, disorders or conditions.

Description

[0001] COMPOUNDS AND METHODS FOR INHIBITING LPA

[0002] Cross-Reference to Related Applications

[0003] This application claims the benefit of priority to US Provisional Application No. 63 / 584,474, filed September 21, 2023, which is incorporated by reference herein in its entirety for any purpose. Sequence Eisting

[0004] The present application is being filed concurrently with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0474SEQ.xml, created on August 21, 2024, which is 2,838 KB in size. The contents of the electronic format of the sequence listing are incorporated herein by reference in their entirety.

[0005] Field

[0006] Provided herein are oligomeric agents, compositions, and uses therefor, including methods for modulating the amount and / or activity of ApoA expression, LPA RNA, and / or Lp(a), as well as methods for treating or managing inflammatory, cardiovascular and / or metabolic diseases, disorders or conditions, and in certain embodiments, ameliorating at least one symptom of an inflammatory, cardiovascular and / or metabolic disease, disorder or condition.

[0007] Background

[0008] The lipoprotein(a) [Lp(a)] particle comprises a unique LDL particle in which one apolipoprotein B (apoB) protein is linked via a disulfide bond to a single apolipoprotein(a) [apo(a)] protein. The apo(a) protein shares a high degree of homology with plasminogen, particularly within the kringle IV type 2 repetitive domain. Levels of circulating Lp(a) are inversely proportional to the number of kringle IV type 2 variable repeats present in the molecule and, as both alleles are co-expressed within individuals, can display heterozygous plasma isoform profiles among individuals (Kraft et al., Eur J Hum Genet, 1996; 4(2): 74-87). It is thought that the kringle repeat domain in apo(a) may be responsible for its pro- thrombotic and anti-fibrinolytic properties, potentially enhancing atherosclerotic progression. Apo(a) has been shown to preferentially bind oxidized phospholipids and potentiate vascular inflammation (Bergmark et al., J Lipid Res 2008; 49:2230-2239; Tsimikas et al., Circulation. 2009; 119(13): 1711— 1719). Further, studies suggest the Lp(a) particle may also stimulate endothelial permeability, induce plasminogen activator inhibitor type- 1 expression and activate macrophage interleukin-8 secretion (Koschinsky and Marcovina, Curr Opin Lipidol 2004; 15: 167-174). Importantly, genetic association studies revealed that Lp(a) was an independent risk factor for myocardial infarction, stroke, peripheral vascular disease and abdominal aortic aneurysm (Rifai et al., Clin Chem 2004; 50: 1364-71; Erqou et al., JAMA 2009;302:412-23; Kamstrup et al., Circulation 2008;l 17: 176-84). Further, the Precocious Coronary Artery Disease (PROCARDIS) study, Clarke et al. (Clarke et al., NEJM (2009)361; 2518- 2528) described robust and independent associations between coronary heart disease and plasma Lp(a) concentrations; and Solfrizzi et al., suggested that increased serum Lp(a) may be linked to an increased risk for Alzheimer’s Disease (AD) (Solfrizzi et al., J Neurol Neurosurg Psychiatry 2002, 72:732-736. Examples of indirect apo(a) inhibitors for treating cardiovascular disease in a clinical setting include aspirin, Niaspan, Mipomersen, Anacetrapib, Epirotirome and Lomitapide which reduce plasma Lp(a) levels by 18%, 39%, 32%, 36%, 43% and 17%, respectively. Lp(a) apheresis has also been used in the clinic to reduce apo(a) containing Lp(a) particles. To date, proposed therapeutic strategies to treat cardiovascular disease by directly targeting apo(a) levels have been described (e.g., U.S. Patent Nos. 5,877,022, 8,138,328, 8,673,632 and 7,259,150; U.S. Patent Publication No. US20040242516; International patent application publication nos. W02005 / 000201, W02003 / 014397, WO2013 / 177468, WO 2014 / 179625, WO2017 / 059223, W02020 / 099476 and WO 2022 / 032288; and Merki et al., J Am Coll Cardiol 2011; 57: 1611-1621., and Tsimikas et al. (Lancet. 2015 Oct 10; 386: 1472-83)). Although in development, no approved therapies indicated to reduce risk of cardiovascular events through reductions in Lp(a) have been approved for commercial use. High plasma Lp(a) concentration is genetically defined, remains at stable levels, cannot be controlled by habit modifications (diet, exercise, or other environmental factors), and is not effectively controlled by any of the currently available lipid reducing medications. There thus remains a need for agents which can potently and selectively lower Lp(a) levels in subjects, including in patients at enhanced risk for cardiovascular events due to chronically elevated plasma Lp(a) levels. In particular, new therapeutic agents that enable safe, low frequency administration for treatment and prevention of cardiovascular disease are desired.

[0009] Summary

[0010] Provided herein are modified oligonucleotides, oligomeric agents, pharmaceutical compositions, and methods of use for reducing the amount or activity of LPA RNA and reducing the expression of Apo(a) protein in a cell or subject and / or Lp(a) in a subject. In certain embodiments, a subject has a disease or disorder associated with misregulation of lipoproteins or a mutation in lipoprotein regulation pathway. In certain embodiments, the subject has elevated lipoprotein (a). In certain embodiments the subject has or is at risk for a severe a cardiovascular disease, disorder or condition. In certain embodiments, the subject has or is at risk for a metabolic or inflammatory disease, disorder or condition. In certain embodiments, agents useful for reducing the amount or activity of LPA RNA are antisense oligomeric agents comprising modified antisense oligonucleotides. In certain embodiments, agents useful for decreasing expression of Apo(a) or levels of lipoprotein (a) are antisense oligomeric agents comprising modified antisense oligonucleotides.

[0011] Provided are oligomeric agents comprising modified oligonucleotides and compositions comprising them, including, but not limited to, antisense agents, oligomeric agents, and pharmaceutical compositions comprising modified oligonucleotides. In certain embodiments, a modified oligonucleotide provided herein comprises a nucleobase sequence at least 80% complementary to an equal length portion of a LPA nucleic acid. In certain embodiments, a modified oligonucleotide consists of 12 to 50 linked nucleosides targeting LPA nucleic acid. In certain embodiments, a modified oligonucleotide provided herein comprises a sequence of nucleobases complementary to an equal length portion of the nucleobase sequence of SEQ ID NO: 1. In certain embodiments, provided oligomeric agents comprise a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 3-41 or at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 294-355, wherein each of the nucleosides of the modified oligonucleotide comprises a modified sugar moiety or sugar surrogate and / or at least one modified intemucleoside linkage. In certain embodiments, a modified oligonucleotide provided herein comprises at least one modified sugar moiety and / or at least one modified intemucleoside linkage. In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide conjugated to a cell targeting agent. Modified oligonucleotides and compositions comprising them, including, but not limited to, oligomeric agents, antisense agents and pharmaceutical compositions, described herein are useful for reducing or inhibiting LPA expression in a cell, organ, tissue, system, organism or subject.

[0012] In certain embodiments provided are oligomeric agents comprising a modified oligonucleotide comprising a nucleobase sequence selected from any one of SEQ ID NO: 3-41, and 294-355, wherein the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all except 0, 1, or 2 intemucleoside linkage modifications are identical to the intemucleoside linkage motif. In certain embodiments provided are oligomeric agents comprising a modified oligonucleotide comprising a sequence comprising at least 15 or at least 16 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 232-293. In certain embodiments provided are oligomeric agents comprising a modified oligonucleotide comprising a sequence comprising at least 18, at least 19, or at least 20 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 42-231.

[0013] Additionally provided are methods for reducing or inhibiting LPA expression, LPA RNA levels and / or Apo(a) protein levels and / or Lp(a) activity in a cell, tissue, organ or subject. In certain embodiments, methods include contacting a cell or subject with a composition provided herein, comprising a modified oligonucleotide, and / or oligomeric agent. In certain embodiments, the subject is a human who has or is at risk of having a cardiovascular, metabolic, or inflammatory disease, disorder, condition or injury associated with increased lipoprotein a levels, misregulation of lipoprotein turnover or a mutation in LPA. In certain embodiments, the subject is a human who has or is at risk of having hypertriglyceridemia. In certain embodiments, the subject is a human who has or is at risk of having atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0014] Provided herein are methods of treating a disease, disorder, condition or injury associated with lipoprotein metabolism misregulation, regulation of lipoprotein turnover or a mutation in LPA. In certain embodiments, a method of treating a disease, disorder, condition or injury associated with lipoprotein metabolism misregulation, regulation of Lp(a) levels or a mutation in LPA comprises administering to a subject, e.g., a human subject, having, or at risk of having, a disease, disorder or condition associated with elevated Lp(a), a provided oligomeric agent, modified oligonucleotide, or composition provided herein, wherein the disease, disorder, condition or injury is selected from a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, or an inflammatory disease disorder or condition. In certain embodiments, the subject has or is at risk for developing cardiovascular disease (CVD) coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke. In certain embodiments, methods of treating provided herein result in ameliorating (whether by reduced frequency, severity) a at least one symptom of a disease, disorder, condition or injury associated with lipoprotein metabolism misregulation. In certain embodiments, methods of treating provided herein result in preventing, delay or postponing, or slowing the development or progression of at least one symptom of a disease, disorder or condition associated with elevated Lp(a).

[0015] Also provided are methods useful for ameliorating at least one symptom of a disorder associated with lipoprotein metabolism misregulation. In certain embodiments the disorder is severe hypertriglyceridemia, hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia. In certain embodiments, a symptom of hypertriglyceridemia, hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia include, but are not limited to, abdominal pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, or hepatosplenomegaly, or a combination of two or more of the foregoing in the subject. In certain embodiments, methods provided herein for preventing, treating, ameliorating, delaying the onset of, or reducing frequency of at least one symptom of hypertriglyceridemia, , hyperlipidemia, dyslipidemia, and / or hyperlipoproteinemia include administering to a subject, e.g., a human subject, having or at risk of having at least one symptom a composition provided herein, e.g., a modified oligoncleotide, oligomeric agent or pharmaceutical composition provided herein.

[0016] Detailed Description

[0017] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0018] DEFINITIONS

[0019] The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant invention. Unless specific definitions are provided herein, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, certain terms have the following meanings: As used herein, a substituent at the “2 '-position” means that the substituent is directly attached to the carbon at the 2'-position of a furanosyl sugar moiety.

[0020] As used herein, “2'-deoxynucleoside” means a nucleoside comprising a 2'-deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2'-deoxynucleoside is a 2'-p-D-deoxynucleoside which comprises a 2'-P-D-deoxyribosyl sugar moiety, which is in the P-D configuration in naturally occurring deoxyribonucleic acid (DNA). A 2'-deoxynucleoside or a nucleoside comprising an unmodified 2'- deoxyribosyl sugar moiety may be abasic, comprise a modified nucleobase, or may comprise an RNA nucleobase (uracil).

[0021] As used herein, “2'-deoxy sugar moiety” means a 2'-H(H) deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2'-deoxy sugar moiety is a 2'-P-D-deoxyribosyl sugar moiety, which has the P-D stereochemical configuration in naturally occurring deoxyribonucleic acid (DNA).

[0022] As used herein, “2'-M0E” means a 2'-OCH2CH2OCH3 group at the 2'-position of a furanosyl sugar moiety. A “2'-M0E sugar moiety” means a sugar moiety with a 2'-OCH2CH2OCH3 group at the 2'- position of a furanosyl sugar moiety. Unless otherwise indicated, a 2'-M0E sugar moiety is in the P-D- ribosyl stereochemical configuration. “MOE” means O-methoxyethyl.

[0023] As used herein, “2'-M0E nucleoside” or “2'- OCH2CH2OCH3 nucleoside” means a nucleoside comprising a 2'-M0E sugar moiety (or 2'-OCH2CH2OCH3furanosyl sugar moiety).

[0024] As used herein, “2'-0Me” means a 2’-O-methyl or 2'-OCH3group at the 2'-position of a furanosyl sugar moiety. A “2'-0Me sugar moiety” means a sugar moiety with a 2’-O-methyl or a 2'- OCH3 group at the 2'-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2'-0Me sugar moiety is in the P-D-ribosyl stereochemical configuration.

[0025] As used herein, “2'-0Me nucleoside” means a nucleoside comprising a 2'-0Me sugar moiety.

[0026] As used herein, “2'-F” means a 2'-fluoro group at the 2'-position of a furanosyl sugar moiety. A “2'-F sugar moiety” means a sugar moiety with a 2'-F group at the 2'-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2'-F sugar moiety is in the P-D-ribosyl configuration.

[0027] As used herein, “2'-F nucleoside” means a nucleoside comprising a 2'-F sugar moiety.

[0028] As used herein “2'-NMA” means a 2'-OCH2C(=O)-N(H)CH3 group at the 2'-position of a furanosyl sugar moiety. A “2'-NMA sugar moiety” means a sugar moiety with a 2'-OCH2C(=O)-N(H)CH3 group at the 2'-position of a furanosyl sugar moiety.

[0029] As used herein, “2'-NMA nucleoside” means a nucleoside comprising a 2'-NMA sugar moiety.

[0030] As used herein, “2'-substituted nucleoside” means a modified nucleoside comprising a 2'- substituted furanosyl sugar moiety. 2'-substituted nucleosides include, but are not limited to, a 2'-0Me nucleoside, a 2'-M0E nucleoside, a 2'-F nucleoside, a 2'-NMA nucleoside, a cEt nucleoside, and a LNA nucleoside.

[0031] As used herein, “2 ’-substitution” or “2'-substituted sugar moiety” means a modified furanosyl sugar moiety wherein the 2'-position is attached to at least one substituent other than H or OH. A 2'- substituted sugar moiety includes a bicyclic sugar moiety wherein the second ring is joined to the furanosyl ring at the 2'-position. 2'-substituted sugar moieties include, but are not limited to, 2'-0Me sugar moieties, 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties.

[0032] As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the

[0033] 5 position. A 5-methylcytosine is a modified nucleobase.

[0034] As used herein, “abasic nucleoside” means a modified nucleoside in which the sugar moiety is not attached to a nucleobase.

[0035] As used herein, “acyclic sugar surrogate nucleoside” means a nucleoside having Formula II, Formula III, or Formula Illa:

[0036] Formula Illa wherein

[0037] X is O, S, C(R5R6), N(EI), NC(=O)-(EI); each Ji and J2 are independently H or Ci-Ce alkyl; n is 0, 1 or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; s is 0 or 1;

[0038] Ri is H, OH, halogen, Ci-Ce alkyl, Ci-Ce alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2)qR8;

[0039] R2, R3, and R4 are each independently H, OH, halogen, Ci-Ce alkyl, Ci-Ce alkoxy, C2-C6 alkenyl,

[0040] C2-C6 alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qRs; Ei is H, Ci-Ce alkyl or substituted Ci-Ce alkyl;

[0041] Rs and Re are independently H, OH, Ci-Ce alkyl, or N(R7): wherein if R5is OH, then Re is not OH; R7is H, Ci-Ce alkyl, or C(=O)Rg, wherein R9is Ci-Ce alkyl;

[0042] Rs is OH, halogen, methoxy, ethoxy, azido, C2-C6 alkenyl, or C2-C6 alkynyl, and q is 1, 2, or 3; and

[0043] Bx is a nucleobase.

[0044] As used herein, “acyclic sugar surrogate” means the sugar moiety of an acyclic sugar surrogate nucleoside and is represented by Formula Ila or Illa herein.

[0045] As used herein, “ameliorate” with reference to a symptom of a disease, means improvement in, or lessening, or preclusion of, at least one symptom of a disease. Amelioration may be reduction in severity or frequency of a symptom or the delayed onset, prevention of occurrence of, or slowing of progression in the severity or frequency of, a symptom. Progression, frequency, or severity indicators, may be determined by subjective or objective measures known in the art and / or described herein.

[0046] As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to hybridization of an antisense oligonucleotide to a target nucleic acid. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay; or, for example compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. Herein, antisense activity is a reduction or inhibition in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the oligonucleotide.

[0047] As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide.

[0048] As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region that is complementary to a target nucleic acid (a “targeting region”).

[0049] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the ring of the furanosyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein.

[0050] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

[0051] As used herein, “cell-targeting moiety” means a conjugate group or portion of a conjugate group that has affinity for a particular cell type or particular cell types. For example, a cell-targeting moiety may have affinity for a cell surface moiety, such as a cell surface receptor on a particular cell type.

[0052] As used herein, “cleavable moiety” means a group of atoms comprising at least one bond that is cleaved under physiological conditions, e.g., in a cell, in a subject. For example, a cleavable moiety cleaved inside a cell or sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases. A cleavable moiety may be cleaved by endogenous change in conditions such as pH.

[0053] As used herein, “complementary nucleobase(s)” or “complementary” in reference to nucleobase(s) means nucleobases that form hydrogen bonds with another when two regions of linked nucleosides (e.g., an oligonucleotide and a target nucleic acid; two oligonucleotides). Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methylcytosine (mC) and guanine (G). Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. For example, hypoxanthine, the nucleobase of the nucleoside inosine (I), can pair with adenine, cytosine, thymine, or uracil. Herein, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C).

[0054] As used herein, “complementary sequence(s)” or “complementary” in reference to sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two sequences are complementary nucleobases when the sequences are aligned. A “nucleobase sequence” means the order of contiguous nucleobases in a strand of linked nucleosides or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or intemucleoside linkage modification. Complementary nucleobase sequences may be nucleobase sequences of two separate strands of linked nucleosides or region thereof (e.g., an oligonucleotide and a region of a target nucleic acid); or complementary nucleobase sequences may be two regions of a single strand of linked nucleosides (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first nucleobase sequence (e.g., an oligonucleotide) or region thereof is described as being complementary to a second nucleobase sequence (e.g., a target nucleic acid or another oligonucleotide), it means that a majority of nucleobases of the first nucleobase sequence or region thereof base pair with complementary nucleobases of the second nucleobase sequence when aligned. Not every pair of nucleobases in the aligned nucleobase sequences needs to be a base pair match for the two sequences to be “complementary.” Rather, some mismatches are tolerated. Where complementarity is expressed as a percent, such percent represents the percent of nucleobases within one nucleobase sequence that are complementary to nucleobases within an equal length second sequence when the sequences are aligned. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases, and there are 4 mismatches when the sequences are aligned. If a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases, and there are 0-4 mismatches when the sequences are aligned. As used herein, “fully complementary” or “100% complementary” means that each nucleobase pair of two nucleobase sequences is complementary when the equal length sequences are aligned. As used herein, “conjugate group” means a group of atoms including a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0055] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0056] As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0057] As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a P-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the -D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration.

[0058] As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety.

[0059] As used herein a “cyclic sugar surrogate nucleoside” is a nucleoside having Formula I:

[0060] Formula I

[0061] Wherein

[0062] J is H, Ci-Ce alkyl, or C2-Ce alkenyl;

[0063] X is O, S, C(RIR2), N(R3), C(RI)=C(R2), C(RIR2)-C(RIR2), O-C(RIR2), C(RIR2)-O, S-C(RIR2),

[0064] C(RIR2)-S, N(R3)-C(RIR2), or C(RIR2)-N(R3);

[0065] Y is C(RIR2), C(RI)=C(R2), or C(RIR2)-C(RIR2);

[0066] Z is C(GIG2), C(GI)=C(RI), C(RI)=C(GI), C(GIG2)-C(RIR2), C(RIR2)-C(GIG2), or C(GIG2)- C(RIR2)-C(RIR2); or C(RIR2)-C(RIR2)-C(GIG2);

[0067] Q is CH orN; each Ri and R2is independently H, OH, Ci-Ce alkyl, or N(IG); wherein if Ri is OH, then R2is not

[0068] OH; each R3and R4 is independently H, Ci-Ce alkyl, or C(=O)R5, wherein R5 is Ci-Ce alkyl; each Gi and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if Gi is OH, then G2is not OH; each ; and R7 is, independently, H, halogen, Ci-Ce alkyl or substituted Ci-Ce alkyl; each XGis O, S or N(Ei);

[0069] Rs is H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-Ce alkenyl, substituted C2-Ce alkenyl, C2-Ce alkynyl, substituted C2-Ce alkynyl or N(E2)(E3); Ei, E2and E3are each, independently, H, Ci-Ce alkyl or substituted Ci-Ce alkyl; n is 0 or 1; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1;

[0070] Bx is a nucleobase; and provided that if X is O, Z is C(GIG2), and Q is CH, then m is 1.

[0071] As used herein, “cyclic sugar surrogate” means the sugar moiety of a cyclic sugar surrogate nucleoside, and is represented by Formula la herein.

[0072] As used herein, “deoxy region” means a region of 5-12 contiguous nucleosides, wherein at least 70% of the nucleosides are DNA nucleosides comprising an unmodified DNA sugar moiety, and may optionally comprise a modified or modified nucleobase, including but not limited to, e.g., a uracil nucleobase, a modified nucleobase, an abasic nucleoside. Each nucleoside of a deoxy region is selected from a 2'-deoxynucleoside and 2'-substituted nucleoside. A deoxy region supports RNase H activity.

[0073] As used herein, “double-stranded” refers to paired complementary regions, including those between two separate strands of linked nucleosides (e.g., an antisense oligonucleotide and a sense oligonucleotide) and those within a single strand of linked nucleosides (e.g., a hairpin oligonucleotide). Paired complementary regions of two separate strands of linked nucleosides form a duplex of the separate strands. Paired complementary regions of a single strand of linked nucleosides form a “hairpin”.

[0074] As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring and optional substituents, and is numbered according to the structure below, with optional additional substituents at any of the 1', 2', 3', 4', and 5' positions.

[0075] As used herein, “hybridization” means the process of two complementary sequences annealing to form a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0076] As used herein, “intemucleoside linkage” means the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “unmodified intemucleoside linkage” means a phosphodiester intemucleoside linkage. As used herein, “modified intemucleoside linkage” means any intemucleoside linkage other than a phosphodiester intemucleoside linkage. A “phosphorothioate intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate intemucleoside linkage” is a modified intemucleoside linkage in which one of the nonbridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, and in the context of linked nucleosides each comprising a furanosyl sugar moiety, an intemucleoside linkage joins the 3 '-carbon of one furanosyl sugar moiety to the 5 '-carbon of the other furanosyl sugar moiety.

[0077] As used herein, “inverted nucleoside” means a nucleoside having a 3' to 3' and / or 5' to 5' intemucleoside linkage.

[0078] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (z.e., nucleosides immediately adjacent to one another, no additional nucleosides are presented between those that are linked).

[0079] As used herein, a “mismatch” between two aligned strands of linked nucleosides means that two nucleobases at a specified position of the aligned nucleobase sequences are not complementary nucleobases as defined herein.

[0080] As used herein, “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or absent.

[0081] As used herein, “modified sugar moiety” means a sugar moiety other than a P-D-ribosyl sugar moiety in RNA or a -D-deoxyribosyl sugar moiety in DNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a cyclic sugar surrogate, an acyclic sugar surrogate, or a sugar mimic.

[0082] As used herein, a “modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5 -methylcytosine” is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine.

[0083] As used herein, “motif’ means a pattern of independently unmodified and / or independently modified sugar moieties, nucleobases, and / or intemucleoside linkages in an oligonucleotide.

[0084] As used herein, “non-bicyclic modified sugar moiety” means a modified furanosyl sugar moiety comprising a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase.

[0085] As used herein, “the nucleobase sequence of’ a reference SEQ ID NO, refers only to the order of contiguous nucleobases provided in such SEQ ID NO, independent of any sugar or intemucleoside linkage modifications and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each intemucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO.

[0086] As used herein, “nucleoside” means an “unmodified nucleoside” or a “modified nucleoside”.

[0087] As used herein, "oligomeric agent" means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; (b) one or more terminal groups; and (c) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other;. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct intemucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct intemucleoside linkages cannot be described as two separate covalently linked oligonucleotides.

[0088] As used herein, “oligonucleotide” means a strand of linked nucleosides, wherein, independently each nucleoside and / or independently each intemucleoside linkage of the strand of linked nucleosides may be independently modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 12-50 linked nucleosides. Unless otherwise indicated, no more than 10% of the nucleosides of an oligonucleotide are abasic nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside and / or intemucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester intemucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired.

[0089] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. A pharmaceutical composition may show activity in certain cell lines.

[0090] As used herein, “pharmaceutically acceptable carrier or diluent” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “carrier” or “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition.

[0091] As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0092] As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded, or RNase H agents may be double -stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2. An “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double -stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

[0093] As used herein, “single -stranded” in reference to a nucleic acid (e.g., an oligonucleotide) means that the strand or region is unpaired; that is, the strand of linked nucleosides is not part of a duplex, not part of a double-stranded region. Single-stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing to complementary nucleic acids to form duplexes, at which point they are no longer single -stranded.

[0094] As used herein, “stabilized phosphate moiety” means a 5 '-phosphate analog that is metabolically more stable than a 5 '-phosphate as naturally occurs on DNA or RNA.

[0095] As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The absolute stereochemical configuration of a chiral center can be controlled by using stereochemically-pure starting materials, e.g., using P-D-ribosyl nucleoside monomers for oligonucleotide synthesis. In contrast, the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (.S') configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). The stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to the action of non-chiral reagents near the enriched stereochemistry of an adjacent sugar moiety. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate intemucleoside linkage.

[0096] As used herein, a “strand” or “strand of linked nucleosides” means contiguous linked nucleosides connected via intemucleoside linkages. A strand of linked nucleosides has a nucleobase sequence.

[0097] As used herein, “subject” means a human or a non-human animal.

[0098] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.

[0099] As used herein, “sugar mimic” means a group of atoms forming the portion of a nucleoside corresponding to the P-D-ribosyl sugar in RNA other than a modified furanosyl sugar moiety, a cyclic sugar surrogate, or an acyclic sugar surrogate.

[0100] As used herein, “sugar surrogate nucleoside” means a cyclic sugar surrogate nucleoside or an acyclic sugar surrogate nucleoside.

[0101] As used herein, “symptom” of a disease means any manifestation, indication, sign, or evidence of a disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent upon diagnostic testing, and in certain instances only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones. Symptoms may include but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever. As used herein, “target nucleic acid” means a LPA nucleic acid that an antisense oligonucleotide is designed to affect. As used herein, “target RNA” means an LPA RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified.

[0102] As used herein, “target region” refers to a portion of a target nucleic acid that is complementary to the targeting region of an antisense oligonucleotide.

[0103] As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0104] As used herein, “therapeutic index” means the ratio of a measure of toxicity or intolerability divided by a measure of potency or activity. Typically, the therapeutic index is expressed as the ratio between the concentration (or dose) at which a compound becomes toxic or induces unacceptable adverse effects (or the highest concentration or dose at which a compound is not toxic, or is tolerated, before it becomes toxic or induces unacceptable adverse effects) to a subject and the concentration (or dose) at which the compound is pharmacologically effective or produces the desired effect.

[0105] As used herein, “treating,” or “treatment,” with respect to a disease, means administering a compound or agent to a subject having or at risk for developing such disease. Treating a disease may result in amelioration of at least one symptom of such disease. Treatment may reduce, improve, and / or prevent one or more symptom(s) such that a symptom of the disease is diminished or is no longer apparent.

[0106] As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G).

[0107] As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase.

[0108] As used herein, “unmodified sugar moiety” means a 2'-0H(H) P-D-ribosyl sugar moiety, as found in RNA, or a 2'-H(H) -D-deoxyribosyl sugar moiety, as found in DNA. Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the P-D- stereochemical configuration, and have one hydrogen at each of the T, 3 ', and 4' positions, an oxygen at the 3 ' position, two hydrogens at the 5 ' position, and two hydrogens (DNA) or a hydrogen and an OH (RNA) at the 2' position.

[0109] EMBODIMENTS

[0110] 1. An oligomeric agent comprising a modified oligonucleotide consisting of 13 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises i) at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 3-41; or ii) at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs:294-355; and wherein the modified oligonucleotide comprises at least one modified sugar moiety or sugar surrogate and / or at least one modified intemucleoside linkage.

[0111] 2. The oligomeric agent of embodiment 1, wherein the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all except 0, 1, or 2 intemucleoside linkage modifications are identical to the intemucleoside linkage motif.

[0112] 3. The oligomeric agent of embodiment 1, wherein the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss.

[0113] 4. The oligomeric agent of embodiment 1, wherein the modified oligonucleotide comprises a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; eeeeeddddddddddeeeee and sssssssssssssssssss; and kkkddddddddddkkk and sssssssssssssss.

[0114] 5. The oligomeric agent of embodiment 4, wherein the modified oligonucleotide comprises a nucleobase sequence of any one of SEQ ID NO: 3 -41 and the modified oligonucleotide comprises a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; and eeeeeddddddddddeeeee and sssssssssssssssssss.

[0115] 6. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises i) at least 16 contiguous nucleobases of and all except 0, 1, or 2 nucleobases are identical to the nucleobase sequence of any one of SEQ ID NOs:3-41; or ii) at least 13 contiguous nucleobases of, and all except 0, 1, or 2 nucleobases are identical to the nucleobase sequence of SEQ ID NOs:294-355; wherein the modified oligonucleotide comprises at least one modified sugar moiety or sugar surrogate and / or at least one modified intemucleoside linkage; and wherein each of the sequences of the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss.

[0116] 7. The oligomeric agent of any one of embodiments 1-6, wherein the sequence of the modified oligonucleotide comprises at least 15 or at least 16 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 232-293.

[0117] 8. The oligomeric agent of any one of embodiments 1-6, wherein the sequence of the modified oligonucleotide comprises at least 18, at least 19, or at least 20 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 42-231. 9. The oligomeric agent of any one of embodiments 1-6, wherein the sequence of the modified oligonucleotide comprises the sequence of any one of SEQ ID NOs: 42-293.

[0118] 10. The oligomeric agent of any one of embodiments 1-6, wherein the sequence of the modified oligonucleotide consists of the sequence of any one of SEQ ID NOs: 42-293.

[0119] 11. The oligomeric agent of any one of embodiments 1-10, wherein the agent comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

[0120] 12. The oligomeric agent of embodiment 11, wherein the conjugate group comprises a cell-targeting moiety.

[0121] 13. The oligomeric agent of embodiment 12, wherein the conjugate group comprises a liver cell targeting moiety.

[0122] 14. The oligomeric agent of embodiment 13, wherein the agent comprises a conjugate moiety that binds asialoglycoprotein receptor (ASGPR).

[0123] 15. The oligomeric agent of embodiment 14, wherein the conjugate moiety is selected from a GalNAc moiety.

[0124] 16. The oligomeric agent of embodiment 15, wherein the GalNAc conjugate moiety is selected from Table A.

[0125] 17. The oligomeric agent of embodiment 15, wherein the conjugate group consists of a GalNAc ligand and a conjugate linker.

[0126] 18. The oligomeric agent of embodiment 15, wherein the GalNAc ligand has the structure:

[0127] 19. The oligomeric agent of embodiment 15, wherein the conjugate group has the structure: or a salt thereof, wherein the conjugate linker is covalently connected to an oligonucleotide.

[0128] 20. The oligomeric agent of embodiment 15, wherein the conjugate group has the structure: or a salt thereof, wherein the conjugate linker is covalently connected to an oligonucleotide.

[0129] 21. The oligomeric agent of any one of embodiments 11-20, wherein the conjugate group is conjugated directly to the modified oligonucleotide.

[0130] 22. The oligomeric agent of embodiment 21, wherein the conjugate group is conjugated to the 5’ end or 3’ end of the modified oligonucleotide.

[0131] 23. The oligomeric agent of embodiment 22, wherein the conjugate group is attached to the 5’- terminal nucleoside of the modified oligonucleotide.

[0132] 24. The oligomeric agent of embodiment 22, wherein the conjugate group is attached to the 3’- terminal nucleoside of the modified oligonucleotide.

[0133] 25. The oligomeric agent of embodiment 11, wherein the conjugate linker of the conjugate group consists of a single bond.

[0134] 26. The oligomeric agent of embodiment 11, wherein the conjugate linker of the conjugate group is cleavable.

[0135] 27. The oligomeric agent of embodiment 11, wherein the conjugate linker comprises 1 to 3 linker- nucleosides.

[0136] 28. The oligomeric agent of embodiment 23, wherein the conjugate group having the structure: or a salt thereof, is attached to the 5 ’-terminal nucleoside of the modified oligonucleotide.

[0137] 29. The oligomeric agent of embodiment 24, wherein the conjugate group having the structure: or a salt thereof, is attached to the 3 ’-terminal nucleoside of the modified oligonucleotide.

[0138] 30. A population of oligomeric agented of any one of embodiments 1-29, wherein the population is enriched for and / or modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.

[0139] 31. The population of embodiment 30, wherein the population is enriched for and / or modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.

[0140] 32. A pharmaceutical composition comprising the oligomeric agent of any one of embodiments 1-29, or the population of any one of embodiments 30-31, and a pharmaceutically acceptable diluent or carrier.

[0141] 33. The pharmaceutical composition of embodiment 32, wherein the pharmaceutically acceptable diluent is water or phosphate-buffered saline.

[0142] 34. The pharmaceutical composition of embodiment 32, wherein the pharmaceutical composition consists essentially of the oligomeric agent and water or phosphate-buffered saline.

[0143] 35. A method of decreasing the amount of LPA RNA or Lipoprotein(a) protein in a cell, tissue, organ or subject, comprising contacting the cell, tissue, organ or subject with the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34.

[0144] 36. The method of embodiment 35, wherein the cell is a liver cell.

[0145] 37. A method comprising administering to a subject the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34; wherein the subject has or is at risk for developing cardiovascular disease (CVD) coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke.

[0146] 38. A method of preventing or treating a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, and / or an inflammatory disease disorder or condition in a subject, comprising administering to a subject having, or at risk of having, a cardiovascular, metabolic, and / or inflammatory disease, disorder, or condition, an oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34; wherein the disease, disorder, condition or injury is hypertriglyceridemia, lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve calcification, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina, cerebrovascular atherosclerosis, cerebrovascular disease, or venous thrombosis..

[0147] 39. A method of decreasing the amount of LPA RNA and / or Lipoprotein(a) protein in the liver of a subject having or at risk of developing a disease, disorder or condition associated with elevated Lp(a), comprising administering to a subject having, or at risk of having, a disease, disorder or condition associated with lipoprotein(a) metabolism misregulation, an oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34; wherein the disease, disorder, condition or injury is a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, and / or an inflammatory disease disorder or condition.

[0148] 40. The method of any one of embodiments 35-39, wherein the amount of LPA RNA and / or lipoprotein(a) protein in liver and / or plasma of the subject is decreased.

[0149] 41. The method of any one of embodiments 35-39, wherein the disease, disorder or condition is hypertriglyceridemia or atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0150] 42. The method of embodiment 41, wherein at least one symptom of a disease, disorder or condition associated with elevated lipoprotein(a) is episodes of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive cutaneous xanthomata, and hepatosplenomegaly or a combination thereof.

[0151] 43. The method of any one or embodiments 35-39, wherein the method prevents or protects against progression of atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

[0152] 44. The method of any one of embodiments 129-143, wherein administering of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 improves hypertriglyceridemia, hyperlipidemia, dyslipidemia hyperlipoproteinemia abdominal pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, or hepatosplenomegaly, or a combination of two or more of the foregoing in the subject.

[0153] 45. The method of any one of embodiments 35-39, wherein administering of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 is parenteral.

[0154] 46. The method of any one of embodiments 35-39, wherein administering of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 is subcutaneous. 47. The method of any one of embodiments 35-39, wherein administering of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 is co-administering with a second agent.

[0155] 48. The method of any one of embodiment 47, wherein administering of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 and the agent are administered concomitantly.

[0156] 49. Use of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 for treating or preventing a disease, disorder or condition associated with lipoprotein metabolism misregulation or postponing a symptom of a disease, disorder or condition associated with elevated lipoprotein(a).

[0157] 50. Use of the oligomeric agent of any one of embodiments 1-29, the population of any one of embodiments 30-31, or the pharmaceutical composition of any one of embodiments 32-34 in the manufacture of a medicament for treating or preventing a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, or an inflammatory disease disorder or condition.

[0158] I. Oligomeric Agents

[0159] Provided herein are oligomeric agents comprising or consisting of a modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; (b) one or more terminal groups; and (c) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other. In some embodiments, provided herein are oligomeric agents comprising or consisting of a modified antisense oligonucleotide complementary to UPA RNA. In certain such embodiments, an oligomeric agent consists of a modified antisense oligonucleotide complementary to UPA RNA and a conjugate group attached to the modified antisense oligonucleotide. Modified antisense oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase and / or lacking a nucleobase) and / or at least one modified intemucleoside linkage.

[0160] A. Modified Nucleosides

[0161] Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or a combination thereof. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified antisense oligonucleotides described herein.

[0162] / . Modified Sugar Moieties

[0163] Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non- bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0164] In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions, as numbered based on ribose:

[0165] In certain embodiments, the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (z.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.

[0166] In certain embodiments, non-bicyclic modified sugar moieties are 2'-substituted sugar moieties and comprise a substituent group at the 2'-position. Examples of substituent groups suitable for the 2'- position of modified sugar moieties include but are not limited to: 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE” or “O-methoxyethyl”). In certain embodiments, 2'-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cw alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S- alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, ©(CFE^SCFE, O(CH2)2ON(Rm)(Rn) or 0CH2C(=0)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, - O(CH2)2ON(CH3)2 (“DMAOE”), or 2'-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). Synthetic methods for some of these 2'-substituent groups may be found, e.g., in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0167] In certain embodiments, a 2'-substituted sugar moiety comprises a non-bridging 2 '-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

[0168] In certain embodiments, a 2'-substituted sugar moiety comprises a non-bridging 2 '-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments, a 2'-substituted sugar moiety comprises a non-bridging 2 '-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3(“NMA”).

[0169] In certain embodiments, a 2'-substituted sugar moiety comprises a 2'-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

[0170] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2'- deoxyfiiranosyl sugar moiety ( / . e. , 2'-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring P-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2020 / 072991, incorporated by reference herein. A 2'-modified sugar moiety has an additional stereocenter at the 2'-position relative to a 2'-deoxyfiiranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the -D-ribosyl stereochemical configuration unless otherwise specified.

[0171] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4'-position. Examples of substituent groups suitable for the 4'-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128, which is incorporated herein by reference.

[0172] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3 '-position. Examples of substituent groups suitable for the 3 '-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0173] In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5 '-position. Examples of substituent groups suitable for the 5 '-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkynyl, allyl, and alkyl (e.g., methyl (R or .8). ethyl (R or 5)).

[0174] In certain embodiments, non-bicyclic modified sugar moieties comprise more than one nonbridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties, such as described in Migawa et al., US 2010 / 0190837, which is incorporated herein by reference; or alternative 2'- and 5'-modified sugar moieties as described in Rajeev et al., US 2013 / 0203836, which is incorporated herein by reference.

[0175] Certain modified sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2- O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'- CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-O-N(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and analogs thereof, 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-O-N(R)-2', 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)- 0-2', wherein each R, R „ and Rb is, independently, H, a protecting group, or C1-C12 alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S. 7,427,672; Swayze et al., U.S. 7,741,457; Swayze et al., U.S. 8,022,193; Seth et al., U.S. 8,278,283; Prakash et al., U.S. 8,278,425; and Seth et al., U.S. 8,278,426, each of which are incorporated herein by reference.

[0176] In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, - C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted Ci- C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=O)-Ji); and each Ji and J2is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0177] In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 5' and the 3' furanose ring atoms. Examples of such 5' to 3' bridging sugar substituents include, but are not limited to, 5'-(CH2)2-3' (bcDNA), 5'-(CH2)3-3' (bc43DNA), 5'-C(F)=CH-CH2-3', and 5'-CH2-CHQ-3', wherein Q is an attachment to an intemucleoside linkage.

[0178] Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S. 8,080,644; Ramasamy et al., U.S. 6,525,191; Seth et al., U.S. 7,547,684; and Seth et al., U.S. 7,666,854, which are each incorporated herein by reference.

[0179] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by stereochemical configuration. For example, an ENA nucleoside (described herein) may be in the a-L configuration or in the P-D configuration.

[0180] LNA (p-D-configuration) LNA (a-L-configuration) bridge = 4'-CH2-O-2' bridge = 4'-CH2-O-2' a-L-methyleneoxy (4'-CH2-O-2') or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Res. 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al. Nucleic Acids Res. 2005, 33(1), 439-447; Mook, O. R. et al. Mol. Cane. Ther. 2007, 6(3), 833-843; Grunweller, A. et al. Nucleic Acids Res. 2003, 37(12), 3185- 3193). Herein, general descriptions of bicyclic nucleosides include both stereochemical configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the -D stereochemical configuration, unless otherwise specified.

[0181] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars).

[0182] In certain embodiments, modified sugar moieties are sugar surrogates, selected from cyclic sugar surrogates and acyclic sugar surrogates.

[0183] A cyclic sugar surrogate is represented by Formula la:

[0184] Formula la

[0185] Wherein:

[0186] J is H, Ci-Ce alkyl, or C2-C6 alkenyl;

[0187] X is O, S, C(R1R2), N(R3), C(RI)=C(R2), C(R1R2)-C(R1R2), O-C(RIR2), C(RIR2)-O, S-C(RIR2), C(RIR2)-S, N(R3)-C(RIR2), or C(RIR2)-N(R3);

[0188] Y is C(RIR2), C(RI)=C(R2), or C(RIR2)-C(RIR2);

[0189] Z is C(GIG2), C(GI)=C(RI), C(RI)=C(GI), C(GIG2)-C(RIR2), C(RIR2)-C(GIG2), C(GIG2)- C(R1R2)-C(R1R2), or C(R1R2)-C(R1R2)-C(G1G2);

[0190] Q is CH orN; each Ri and R2is independently H, OH, Ci-Ce alkyl, or N(Ri); wherein if Ri is OH, then R2is not OH; each R3and R4 is independently H, Ci-Ce alkyl, or C(=O)Rs, wherein R5 is Ci-Ce alkyl; each Gi and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if

[0191] Gi is OH, then G2is not OH; each Re and R7 is, independently, H, halogen, Ci-Ce alkyl or substituted Ci-Ce alkyl; each XGis O, S or N(Ei);

[0192] Rs is H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-Ce alkenyl, substituted C2-Ce alkenyl, C2-Ce alkynyl, substituted C2-Ce alkynyl or N(E2)(E3);

[0193] Ei, E2and E3are each, independently, H, Ci-Ce alkyl or substituted Ci-Ce alkyl; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1; and with the proviso that if X is O, Z is C G1G2), and Q is CH, then m is 1.

[0194] In certain embodiments, the oxygen atom of a sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom (X is S, C(RIR2), or N(Rs)). In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4 '-sulfur atom and a substitution at the 2 '-position and / or the 5' position.

[0195] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”), where X is 0-C(RIR2), p is 1, Z is C(GIG2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (Gi=OH; G2=H; “ANA”), and fluoro HNA:

[0196] FHNA

[0197] (Gi=F; G2=H; “FHNA”, see e.g., Egli, M. et al. J. Am. Chem. Soc. 2011, 733(41), 16642-16649; Swayze et al., U.S. 8,088,904; and Swayze et al., U.S. 8,440,803); FHNA can also be referred to as a F-THP or 3 '-fluoro tetrahydropyran or 3 '-FHNA), each of which are incorporated herein by reference.

[0198] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having Formula la, above, wherein X is O, Y and Z are each CH2, and Q is N. In certain embodiments, a morpholino is modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholines.”

[0199] In certain embodiments, sugar surrogates are acyclic sugar surrogates and have Formula Ila or Illa:

[0200] Formula Ila

[0201] Formula Illa

[0202] Wherein:

[0203] X is O, S, C R4R5), N(Ei), N(Ei)-C(=O); each Ji and J2 is independently H or Ci-Ce alkyl; n is 0, 1 or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1;

[0204] Ri is H, OH, halogen, Ci-Ce alkyl, Ci-Ce alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2)qR7

[0205] R2 and R3 are each independently H, OH, halogen, Ci-Ce alkyl, Ci-Ce alkoxy, C2-C6 alkenyl, C2- Ce alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR7;

[0206] Ei is H, Ci-Ce alkyl or substituted Ci-Ce alkyl;

[0207] R4 and R5 are independently H, OH, Ci-Ce alkyl, or N(R„): wherein if Riis OH, then R5 is not OH; Re is H, Ci-Ce alkyl, or C(=O)R«, wherein Rs is Ci-Ce alkyl;

[0208] R7 is OH, halogen, methoxy, ethoxy, azido, and C2-C6 alkenyl, or C2-C6 alkynyl, and q is 1, 2, or 3.

[0209] In certain embodiments, acyclic sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0210] In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides, having Formula Ila wherein n is 1, m and o are 0, s is 1, and J2, R2, and R3 are each H, or the butyl as found in acyclic butyl nucleic acid, having Formula Ila wherein n is 2, m and o are 0, s is 1, and J2, R2, and R3 are each H. In certain embodiments, acyclic sugar surrogates are also known as “C3 spacers” and have Formula Ila wherein n and o are 1; m and s are 0, and Ji, J2, Ri, and R3 are each H.

[0211] Further acyclic sugar surrogates include those described in Manoharan et al., U.S. 10,913,767; US patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940.

[0212] In certain embodiments, modified oligonucleotides include one or more sugar mimic, in which a group of atoms other than a “furanosyl sugar moiety” or a “sugar surrogate” form the portion of a nucleoside corresponding to the P-D-ribosyl sugar in RNA. In certain embodiments, a sugar mimic is a portion of the backbone of a peptide nucleic acid, while the remainder of the backbone of the peptide nucleic acid is an intemucleoside linkage. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. 2. Modified Nucleobases

[0213] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more abasic nucleoside. In certain embodiments, modified oligonucleotides contain only nucleosides comprising nucleobases. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (z.e., nucleosides comprising a hypoxanthine nucleobase). In certain embodiments modified oligonucleotides comprise one or more nucleosides comprising a 5- methylcytosine.

[0214] Unless otherwise indicated, modified adenine has structure (I):

[0215] I wherein: R2Ais H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce thioalkyl, or substituted Ci-Ce thioalkyl, Ci-Ce alkyloxy, or substituted Ci-Ce alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O- phenyl; Y7Ais N and R7Ais absent or is Ci-Ce alkyl; or Y7Ais C and R7Ais H, Ci-Ce alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; Raand Rbare each independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R2Ais H, and R6Ais NH2(unmodified adenine).

[0216] Unless otherwise indicated, modified guanine has structure (II):

[0217] II wherein: R2Gis N(Ra)(Rb); R6Gis oxo and R1Gis H, or R6Gis O-Ci-Ce alkyl or S-Ci-Ce alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is Ci-Ce alkyl; or Y7Gis C and R7Gis H, Ci-Ce alkyl, or N(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; Raand Rbare independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, and R6Gis =0 (unmodified guanine).

[0218] Unless otherwise indicated, modified thymine or modified uracil has structure (III):

[0219] III wherein: X is O or S and R5Uis H, OH, halogen, O-C1-C20 alkyl, O-C1-C12 substituted alkyl, Ci- C12 alkyl, substituted C1-C12 alkyl, C1-C12 alkenyl, substituted C1-C12 alkenyl, C1-C12 alkynyl, or substituted C1-C12 alkynyl; wherein if each X is O, R5Uis not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0220] Unless otherwise indicated, modified cytosine has structure (IV):

[0221] IV wherein: X is O or S; R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12 alkyl, O-C1-C12 substituted alkyl, C1-C12 alkyl , substituted C1-C12 alkyl, C1-C12 alkenyl, or substituted C1-C12 alkenyl; Raand Rbare independently H, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-Ce alkenyl, C1-C12 alkynyl, substituted C1-C12 alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2 and R5Cis H (unmodified cytosine).

[0222] In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5 -substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5 -methylcytosine, hypoxanthine, 1 -methylpseudouridine, 2-aminopropyladenine, 5- hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2- propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CU-CHs) uracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5 -ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7- methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3- deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5- methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one, and 9-(2- aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed. 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442- 443.

[0223] Preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases are known in the art and can be readily identified in publications that include without limitation, Rogers etal., U.S. 5,134,066 ; Benner etal., U.S. 5,432,272; Matteucci etal., U.S. 5,502,177 ; Froehler et al. , U.S. 5,594,121 ; and Cook et al., U.S. 5,681,941.

[0224] In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, andmC.

[0225] 3. Modified Internucleoside Linkages

[0226] In certain embodiments, oligomeric agents provided herein comprise or consist of a modified oligonucleotide comprising at least one modified intemucleoside linkage. The naturally occurring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Herein, all intemucleoside linkages between furanosyl sugar moieties are 3' to 5' intemucleoside linkages unless otherwise indicated. In certain embodiments, nucleosides of modified oligonucleotides are linked together using one or more modified intemucleoside linkages. The two main classes of intemucleoside linkages are defined by the presence or absence of a phosphoms atom. Representative phosphorus-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphoms containing intemucleoside linkages include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphodiester linkages, may be used to alter, typically increase, nuclease resistance of the oligonucleotide.

[0227] In certain embodiments, a modified intemucleoside linkage is any of those described in WO 2021 / 030778, incorporated by reference herein. In certain embodiments, a modified intemucleoside linkage has the formula: wherein independently for each intemucleoside linkage of the modified oligonucleotide:

[0228] X is selected from O and S;

[0229] Ri is selected from H, Ci-Ce alkyl, and substituted Ci-Ce alkyl; and

[0230] T is selected from SO2R2, C(=O)Rs, and P(=O)R4R5, wherein:

[0231] R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a Ci-Ce alkoxy, Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl, substituted Ci-Ce alkyl, substituted Ci-Ce alkenyl, substituted

[0232] Ci-Ce alkynyl, and a conjugate group;

[0233] Rs is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group;

[0234] R4 is selected from OCH3, OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, and a conjugate group; and Rs is selected from OCH3, OH, Ci-Ce alkyl, and substituted Ci-Ce alkyl.

[0235] In certain embodiments, a modified oligonucleotide comprises a mesyl phosphoramidate linkage having a formula:

[0236] Certain intemucleoside linkages having reduced charge (referred to as “neutral intemucleoside linkages”) have been described. Such neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP) (see US 9,926,556), and thioformacetal (3'-S-CH2-O-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research,' Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CPE component parts.

[0237] In certain embodiments, a modified oligonucleotide comprises an intemucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, a modified oligonucleotide comprises an intemucleoside linkage having a formula: which may be stereorandom or may be enriched for the Rp or Sp configuration.

[0238] In certain embodiments, intemucleoside linkages are not 3'-to-5' intemucleoside linkages.

[0239] In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 3' to 3' and / or 5' to 5', as shown below:

[0240] wherein each Bx independently represents any nucleobase.

[0241] In certain embodiments, an inverted nucleoside is terminal (i. e. , the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide.

[0242] In certain embodiments, inverted nucleosides lack a nucleobase (are abasic nucleosides). In certain such embodiments, additional features (e.g., a conjugate group) are attached to the inverted abasic nucleoside. A terminal inverted nucleoside may be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleosides are linked 2' to 5' rather than the 3' to 5' linkage. Such a linkage is illustrated below. wherein each Bx represents any nucleobase.

[0243] In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non-furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’, as shown below:

[0244] In certain embodiments, intemucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates.

[0245] The mesyl phosphoramidate intemucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase:

[0246] The phosphorothioate intemucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or ( Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase:

[0247]

[0248] Modified oligonucleotides comprising intemucleoside linkages having a chiral center may be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising intemucleoside linkages containing chiral centers in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate and / or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate and / or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka, N., et al. J. Am. Chem. Soc. 2003, 125, 8307-8317; Wan, W. B., et al. Nucleic Acids Res. 2014, 42, 13456. and WO 2017 / 015555.

[0249] As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and / or mesyl phosphoramidate in the (.S'p) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration. In certain embodiments, the chiral center is at positions 1', 2', 3', and / or 4' of a furanosyl sugar moiety. In certain embodiments, each chiral center of each furanosyl sugar moiety is enriched such that the sugar moieties have the P-D ribosyl stereochemical configuration. In certain embodiments, modified oligonucleotides of a population are enriched for -D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom and all of the mesyl phosphoramidate intemucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for P-D ribosyl sugar moieties, at least one particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration is enriched, and all of the mesyl phosphoramidate intemucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for P-D ribosyl sugar moieties, at least one particular mesyl phosphoramidate intemucleoside linkage in a particular stereochemical configuration is enriched, and all of the phosphorothioate intemucleoside linkages are stereorandom. In certain embodiments, modified oligonucleotides of a population are enriched for both P-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration and at least one particular mesyl phosphoramidate intemucleoside linkage in a particular stereochemical configuration is enriched.

[0250] B. Motifs

[0251] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In certain such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif, and / or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the nucleobase sequence).

[0252] 1. Sugar Motifs

[0253] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein. In certain embodiments, the sugar moiety of at least one nucleoside of an antisense oligonucleotide is a modified sugar moiety.

[0254] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety and the oligonucleotide is referred to as a fully modified oligonucleotide. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide is a 2'-substituted nucleoside comprising the same 2'-substituent. In certain embodiments, every other nucleoside of a fully modified oligonucleotide comprises the same 2'-substitutent, resulting in alternating 2'-substituents.

[0255] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a deoxynucleoside. In certain embodiments, each nucleoside of the deoxy region is a 2'-P-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety. In certain embodiments, at least one nucleoside of the deoxy region comprises a 2'-OMe sugar moiety. In certain embodiments, more than one nucleoside of the deoxy region comprises a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside of the deoxy region comprises a cEt sugar moiety. In certain embodiments, exactly one nucleoside of the deoxy region comprises a cEt sugar moiety.

[0256] In certain embodiments, the deoxy region is flanked on the 5 '-side by a 5 '-region consisting of linked 5'-region nucleosides and on the 3'-side by a 3'-region consisting of linked 3'-region nucleosides; wherein the 3 '-most nucleoside of the 5 '-region comprises a modified sugar moiety and the 5 '-most nucleoside of the 3 '-region is comprises a modified sugar moiety. The three regions (the 5 '-region, the deoxy region, and the 3 '-region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3 '-most nucleoside of the 5 '-region and the sugar moiety of the 5 '-most nucleoside of the 3 '-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5 '-region, the deoxy region, and the 3 '-region. In certain embodiments, each nucleoside of the 5 '-region and each nucleoside of the 3 '-region comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of the 5'-region and at least two nucleosides of the 3 '-region comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of the 5 '-region and at least three nucleosides of the 3 '-region comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each nucleoside of the 5 '-region and each nucleoside of the 3 '-region comprises a modified sugar moiety. In certain embodiments, each of the nucleosides within the 5 '-region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 5'-region comprise two or more different modified sugar moieties. In certain embodiments, each of the nucleosides within the 3 '-region comprise the same modified sugar moiety. In certain embodiments, the nucleosides within the 3 '-region comprise two or more different modified sugar moieties.

[0257] In certain embodiments, the 5 '-region and the 3 '-region of a modified oligonucleotide each consist of 1-8 nucleosides. In certain embodiments, the 5'-region consists of 1-7 nucleosides. In certain embodiments, the 5'-region consists of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 5'- region consists of 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3 '-region consists of 1- 7 nucleosides. In certain embodiments, the 3'-region consist of 1-6, 2-6, 3-6, or 3-5 nucleosides. In certain embodiments, the 3'-region consists of 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0258] In certain embodiments, the deoxy region consists of 8, 9, 10, 11, or 12 nucleosides, with each nucleoside comprising a 2'-P-D-deoxyribosyl sugar moiety. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. Herein, the lengths (number of nucleosides) of the 5'- region, the deoxy region, and the 3 '-region of an oligonucleotide may be provided using the notation [# of nucleosides in the 5 '-region] - [# of nucleosides in the deoxy region] - [# of nucleosides in the 3'- region]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of the 5 '-region and the 3 '-region and the gap nucleosides comprise 2'- P-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-M0E nucleosides in the 5 '-region (or “wing”), 10 linked 2'-P-D-deoxynucleosides in the deoxy region (or “gap”), and 5 linked 2'-M0E nucleosides in the 3 '-region (or “wing”). A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5 '-region, 8 linked 2'-P-D-deoxynucleosides in the deoxy region, and 5 linked nucleosides comprising a modified sugar moiety in the 3'-region. A 5-8-5 mixed gapmer has at least two differently modified sugar moieties in the 5'- and / or the 3'-regions. A 3-10-3 gapmer consists of 3 linked nucleosides comprising a modified sugar moiety in the 5 '-region, 10 linked 2'-P-D-deoxynucleosides in the deoxy region, and 3 linked nucleosides comprising a modified sugar moiety in the 3'-region. A 3-10-3 mixed gapmer has at least two differently modified sugar moieties in the 5'- and / or the 3'-regions. A 4-12-4 gapmer consists of 4 linked nucleosides comprising a modified sugar moiety in the 5 '-region, 12 linked 2'-P-D-deoxynucleosides in the deoxy region, and 4 linked nucleosides comprising a modified sugar moiety in the 3'-region. A 4-12-4 mixed gapmer has at least two differently modified sugar moieties in the 5'- and / or the 3 '-regions.

[0259] In certain embodiments, modified oligonucleotides disclosed herein are modified by a specific sugar motif. In certain embodiments, modified oligonucleotides have a sugar motif, wherein each sugar moiety is represented by: each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-M0E sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, eeeeeddddddddddeeeee, kkkddddddddddkkk, and eeeddddddddddeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D- deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, eeeeeddddddddddeeeee, kkkddddddddddkkk, and eeeddddddddddeee, wherein all modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety. In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee, wherein all modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety.

[0260] 2. Nucleobase Motifs

[0261] In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, at least one nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, at least one purine and / or at least pyrimidine is modified. In certain embodiments, at least one adenine is modified. In certain embodiments, at least one guanine is modified. In certain embodiments, at least one thymine is modified. In certain embodiments, at least one uracil is modified. In certain embodiments, at least one cytosine is modified. In certain embodiments, at least one of the cytosine nucleobases in a modified oligonucleotide is 5 -methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5 -methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, one or two of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is selected from 5 -methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. In certain embodiments, each nucleobase is selected from 5- methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine. In certain embodiments, each nucleobase is selected from 5 -methylcytosine, unmodified cytosine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from 5 -methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In certain embodiments, each nucleobase is selected from 5-methylcytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine.

[0262] 3. Internucleoside Linkage Motifs

[0263] In certain embodiments, oligonucleotides comprise modified and unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each intemucleoside linkage is a phosphodiester intemucleoside linkage. In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is a phosphorothioate intemucleoside linkage. In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage, a mesyl phosphoramidate intemucleoside linkage, and a phosphodiester intemucleoside linkage. In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and a phosphodiester intemucleoside linkage. In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is independently selected from a mesyl phosphoramidate intemucleoside linkage and a phosphorothioate intemucleoside linkage. In certain embodiments, each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (.S'p) phosphorothioate, and a ( / ?p) phosphorothioate. In certain embodiments, each mesyl phosphoramidate intemucleoside linkage is independently selected from a stereorandom mesyl phosphoramidate, a (.S'p) mesyl phosphoramidate, and a ( / ?p) mesyl phosphoramidate .

[0264] In certain embodiments, the modified oligonucleotide has an intemucleoside linkage motif independently selected from (5' to 3') of: zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all except 0, 1, or 2 intemucleoside linkage modifications are identical to the intemucleoside linkage motif, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, the modified oligonucleotide has an intemucleoside linkage motif independently selected from (5' to 3') of: zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all linkage modifications are identical to the intemucleoside linkage motif, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, the modified oligonucleotide has an intemucleoside linkage motif independently selected from (5' to 3') of: zzzzzssssssssszzzzz, and sssssssssssssssssss, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage.

[0265] Provided oligomeric agents comprise one or more modifications, (e.g., a modified sugar moiety, a modified nucleobase, a modified intemucleoside linkage), and / or combinations thereof, incorporated into a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of a modified oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, intemucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the intemucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the intemucleoside linkages or intemucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence.

[0266] In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, eeeeeddddddddddeeeee, kkkddddddddddkkk, and eeeddddddddddeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety; and the modified oligonucleotide has an intemucleoside linkage motif independently selected from (5' to 3') of: zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all except 0, 1, or 2 intemucleoside linkage modifications are identical to the intemucleoside linkage motif, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments a modified oligonucleotide comprises a modified sugar motif independently selected from one of from 5' to 3'): kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, eeeeeddddddddddeeeee, kkkddddddddddkkk, and eeeddddddddddeee, wherein all modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-MOE sugar moiety, and each “k” represents a cEt sugar moiety; and the modified oligonucleotide has an intemucleoside linkage motif independently selected from (5' to 3') of: zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all modifications are identical to the intemucleoside linkage motif, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage.

[0267] In certain embodiments a modified oligonucleotide comprises a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; and eeeeeddddddddddeeeee and sssssssssssssssssss; wherein all modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D- deoxyribosyl sugar moiety, and each “e” represents a 2'-M0E sugar moiety, and each “k” represents a cEt sugar moiety; and wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments a modified oligonucleotide comprises a nucleobase sequence of any one of SEQ ID NO:3-41, a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; and eeeeeddddddddddeeeee and sssssssssssssssssss; wherein all modifications are identical to the sugar motif; wherein each “d” represents a 2'-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2'-M0E sugar moiety, and each “k” represents a cEt sugar moiety; and wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside and each “z” represents a mesyl phosphoramidate intemucleoside linkage.

[0268] In certain embodiments, an oligomeric agent comprises a modified oligonucleotide, wherein the sequence of the oligomeric agent comprises at least 15 or at least 16 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 232-293. In certain embodiments an oligomeric agent comprises a modified oligonucleotide, wherein the sequence of the oligomeric agent comprises at least 18, at least 19, or at least 20 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 42-231. In certain embodiments an oligomeric agent comprises a modified oligonucleotide, wherein the sequence of the oligomeric agent comprises the sequence of any one of SEQ ID NOs: 42-293. In certain embodiments an oligomeric agent comprises a modified oligonucleotide, wherein the sequence of the oligomeric agent consists of the sequence of any one of SEQ ID NOs: 42-293.

[0269] C. Lengths

[0270] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf etal. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309, a series of oligonucleotides 13-25 nucleobases in length were tested fortheir ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X< Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to

[0271] 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to

[0272] 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to

[0273] 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to

[0274] 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to

[0275] 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to

[0276] 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to

[0277] 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to

[0278] 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to

[0279] 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to

[0280] 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to

[0281] 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to

[0282] 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to

[0283] 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to

[0284] 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to

[0285] 30, or 29 to 30 linked nucleosides.

[0286] In certain embodiments, modified oligonucleotides consist of 13 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 14 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 15 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 16 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 17 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 18 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 19 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 20 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 21 linked nucleosides. In certain embodiments, modified oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 23 linked nucleosides. In certain embodiments, the modified oligonucleotides have no more than 1 to 3 mismatches to a target nucleic acid.

[0287] In certain embodiments, antisense oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 13-25 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 15-23 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 16-22 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18-21 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 19-21 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18-20 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 13-20 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 14-18 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 15-18 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 14-17 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 15-17 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 16 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 19 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 20 linked nucleosides.

[0288] D. Nucleobase Sequence

[0289] In certain embodiments, modified oligonucleotides are further described by their nucleobase sequence. In certain embodiments, modified oligonucleotides have a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides (e.g., an identified reference nucleic acid, such as a target nucleic acid) or a region thereof. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked nucleosides or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of a second strand of linked nucleosides or region thereof.

[0290] II. Conjugates

[0291] In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotide and one or more conjugate groups. In certain embodiments, an oligomeric agent optionally further comprises one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker. A conjugate group may be attached at the 3' end and / or the 5' end of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified intemucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker.

[0292] A. Conjugate Groups

[0293] In certain embodiments, a conjugate group comprises a conjugate moiety and a conjugate linker. Conjugate Moieties

[0294] In certain embodiments, a conjugate moiety modifies one or more properties of an attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, a conjugate moiety imparts a new property on the attached oligonucleotide.

[0295] In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety can bind the cell-surface receptor or the cell-surface moiety. In certain embodiments, an agent comprising a cell-targeting moiety is capable of being internalized when it interacts with or binds the cell-surface receptor or the cell-surface moiety. In certain embodiments, a cell-targeting moiety comprises a liver cell targeting moiety or a liver cell ligand. In certain embodiments, a liver cell-targeting moiety consists of a cell-targeting moiety having affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, the cell-targeting moiety comprises more than one ligand, and each ligand has affinity for the ASGP-R. In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetyl galactosamine (GalNAc), mannose, glucose, glucosamine, and fucose.

[0296] In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., “Design and Synthesis of Novel A- Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” Med. Chem. 2004, 47, 5798-5808). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, a-D-galactosamine, P-muramic acid, 2-deoxy-2- methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy- 2-sulfoamino-D-glucopyranose and A'-sulfo-D-gliicosaminc. and '-glycoloyl-a-ncuraminic acid. For example, thio sugars may be selected from 5-Thio-P-D-glucopyranose, methyl 2,3,4-tri-O-acetyl- 1 -thio- 6-O-trityl-a-D-glucopyranoside, 4-thio-P-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy- 1,5-dithio-a-D-g / Mco-heptopyranoside.

[0297] In certain embodiments, each ligand is N-acetyl galactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises one GalNAc ligand. In certain embodiments, the celltargeting moiety comprises two GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises a GalNAc ligand cluster. In certain embodiments, the cell-targeting moiety comprises a three GalNAc ligand cluster. In certain embodiments, the cell-targeting moiety is any one of those described in US 9,127,276, the entire contents of which is incorporated herein by reference. In certain embodiments, a conjugate groups comprises a cell-targeting moiety selected from any one of the formula set forth in TABLE A:

[0298] Conjugate Linkers

[0299] In certain embodiments, oligomeric agents comprise an oligonucleotide and a conjugate group, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. In certain embodiments, the conjugate linker links the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chemical group. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide.

[0300] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0301] In certain embodiments, conjugate linkers, including the conjugate linkers described herein, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate moieties to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on a parent compound and the other is selected to react with a peptide extender. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0302] In certain embodiments, conjugate linkers comprise chemical groups that are formed upon a reaction between a first functional group and a second functional group. In certain embodiments, a modified oligonucleotide is attached to the first functional group during synthesis, and a conjugate moiety is attached to a second functional group during synthesis. Then, the two compounds are mixed under specific conditions to yield the final oligomeric agent. Such reactions that are compatible with both oligonucleotide and peptide chemistry have been previously described and are often called “bioconjugation” reactions. These reactions include strain promoted azido-alkyne cycloaddition (SPAAC), copper-catalyzed click reaction (CuAAC), active ester conjugation to an amino modified oligonucleotide, maleimide -thiol Michael addition, ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thio ether formation, disulfide formation, reductive alkylation, catalyst-free N- arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels Alder reaction. Certain such reactions are described in, e.g., Jbara, et al., “Oligonucleotide Bioconjugation with Bifunctional Palladium Reagents”, Angew. Chem. Int. Ed. 2021, 60(21)12109-12115; Dong, et al., “Sulfiir(VI) Fluoride Exchange (SuFEx): Another Good Reaction for Click Chemistry,” Angew. Chem. Int. Ed. 2014, 53(36):9430-9448.4; Zhang, et al., “Arylation Chemistry for Bioconjugation,” Angew. Chem. Int. Ed. Engl. 2019; 58(15): 4810-4839; Walsh, et al., “Site-selective modification strategies in antibody-drug conjugates” Chem. Soc. Rev., 2021, 50: 1305-1353; Tiefenbrunn, et al., “Chemoselective ligation techniques: modem applications of time-honored chemistry”, Biopolymers, 2010, 94( 1): 95- 106; Drake, et al., Bioconjug. Chem. 2014, 25(7): 1331-1341; Bode, Acc. Chem. Res., 2017, 50, 9, 2104-2115; J. Magano, B. Bock, et al, Org. Proc. Res. Dev. 2014, 18: 142-151; Craig S. McKay and M.G. Finn, “Click Chemistry in Complex Mixtures: Bioorthogonal Bioconjugation”, Chemistry & Biology 2014; Mitchell P. Christy et al., Org. Lett. 2020, 22: 2365; Ren et al., Angew. Chem. Int. Ed. Engl. 2009, 48, 9658-9662; Rohrbacher, F. et al., Helv. Chim. Acta. 2018, 101; Baalmaan, et al, “A Bioorthogonal Click Chemistry Toolbox for Targeted Synthesis of Branched and Well-Defined Protein-Protein Conjugates”, Angew. Chem. Int. Ed.2Q2Q (59): 12885-12893; Lang, et al, “Biorthogonal Reactions for Labeling Proteins”, J. Am. Chem. Soc, 2014, 9(1): 16-20; Nair, et al., “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry”, Chem. Mater. 2013 26( 1): 724- 744; Kalia and Raines, “Hydrolytic Stability of Hydrazones and Oximes”, Angew. Chem. Int. Ed., 2008, 47:7523-7526.

[0303] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cw alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0304] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker- nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N- benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric agent after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric agent through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0305] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric agent comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric agent also comprises a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric agent may comprise (1) an oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate linker comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric agent is more than 30. Alternatively, an oligomeric agent may comprise an oligonucleotide consisting of 8-30 nucleosides and no conjugate linker. The total number of contiguous linked nucleosides in such an oligomeric agent is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0306] In certain embodiments, it is desirable for a conjugate moiety to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate moiety be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0307] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety.

[0308] In certain embodiments, a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric agent through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'- deoxy nucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0309] In certain embodiments, oligomeric agents described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligomeric agent is prepared using Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate intemucleoside linkages on an oligomeric agent attached to a solid support are converted into the 1,2,3-triazolylphosphonate intemucleoside linkages and then cleaved from the solid support (Krishna et al., J. Am. Chem. Soc. 2012, 134(28), 11618-11631), which is incorporated by reference herein in its entirety. Additional conjugate linkers suitable for use in several embodiments are prepared by Click chemistry described in “Click Chemistry for Biotechnology and Materials Science” Ed. Joerg Laham, Wiley 2009, which is incorporated by reference herein in its entirety.

[0310] In certain embodiments, compounds comprise an oligonucleotide, a cell-targeting moiety, and a conjugate linker. In certain embodiments, oligomeric agents comprise an oligonucleotide, a hepatic asialoglycoprotein receptor (ASGP-R) ligand, and a conjugate linker. In certain embodiments, oligomeric agents comprise an oligonucleotide, aN-acetyl galactosamine (GalNAc) ligand, and a conjugate linker. In certain embodiments, oligomeric agents comprise an oligonucleotide, a GalNAc trimer, a branching group, a conjugate linker, and optionally modifications to the GalNAc ligands. In certain embodiments, oligomeric agents comprise an oligonucleotide, two or more GalNAc ligands, a branching group, a conjugate linker, and optionally modifications to the GalNAc ligands. In certain embodiments, a conjugate linker connects GalNAc ligand to an oligonucleotide.

[0311] In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 3’ end of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 3’ end of an oligonucleotide. In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 5’ end of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to the 5’ end of an oligonucleotide. In certain embodiments, two or more GalNAc ligands are covalently connected to a conjugate linker, and the conjugate linker is covalently connected to an internal position of an oligonucleotide. In certain embodiments, a three GalNAc cluster is covalently connected to a conjugate linker, and the conjugate linker is covalently connected to an internal position of an oligonucleotide. In certain embodiments, an internal position of an oligonucleotide is a 2 ’-position of a modified sugar moiety of a nucleoside within the internal region of an oligonucleotide that is not the 5 ’ terminal nucleoside or the 3’ terminal nucleoside. In certain embodiments, an internal position of an oligonucleotide is a modified intemucleoside linkage of the oligonucleotide.

[0312] In certain embodiments, a modified oligonucleotide is conjugated to a THA -GalNAc conjugate group attached to the 5'-OH of the oligonucleotide. The structure of THA-GalNAc is:

[0313] In certain embodiments a modified oligonucleotide is conjugated to a HPPO-GalNAc conjugate group attached to the 3'-OH of the oligonucleotide. The structure of HPPO-GalNAc is: B. Certain Terminal Groups

[0314] Examples of a terminal group include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified, wherein one or more groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3’ and / or 5 ’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3 ’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5 ’-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3 ’-end of the oligonucleotide and one or more terminal groups is attached at the 5 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3’ and / or 5 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 3 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached near the 5 ’-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3 ’-end of the oligonucleotide and a terminal group is attached at the 5 ’-end of the oligonucleotide.

[0315] In certain embodiments, an oligomeric agent comprises one or more terminal groups. In certain embodiments, an oligomeric agent comprises a terminal group comprising a stabilized 5 ’-phosphate. Stabilized 5 ’-phosphates include, but are not limited to 5 ’-phosphonates, including, but not limited to 5’- vinylphosphonate, 5’-methylphosphonate. In certain embodiments, a terminal group comprises one or more abasic sugar moieties. In certain embodiments, a terminal group comprises one or more inverted sugar moieties and / or inverted nucleosides. In certain embodiments, a terminal group comprises one or more 2 ’-linked nucleosides or sugar moieties. In certain embodiments, the 2 ’-linked terminal group is an abasic sugar moiety. In certain embodiments, an antisense oligonucleotide comprises a vinylphosphonate. In certain particular embodiments, each antisense oligonucleotide has a vinyl phosphonate moiety on the 5'-end (5 ’-VP).

[0316] III. Target Nucleic Acids

[0317] A. LPA

[0318] In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of a target nucleic acid, wherein the target nucleic acid is LPA. In certain embodiments, LPA nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (the complement of GENBANK Accession No. NC_000006.12, truncated from nucleoside 160528001 to nucleoside 160669000) or SEQ ID NO: 2 (GENBANK Accession No. NM_005577.2), or to both. In certain embodiments, contacting a cell with an oligomeric agent comprising a modified oligonucleotide comprising a targeting region that is complementary to an equal-length target region of SEQ ID NO: 1 and / or SEQ ID NO: 2 inhibits LPA RNA in the cell, and in certain embodiments inhibits apo(a) protein or Lp(a) produced in the cell. In certain embodiments, the modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and a conjugate group. In certain embodiments, the oligomeric agent consists of an antisense oligonucleotide and one or more terminal group(s). In certain embodiments, the oligomeric agent consists of a modified antisense oligonucleotide, a conjugate group, and one or more terminal group(s).

[0319] In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of a LPA nucleic acid. In certain embodiments, oligomeric agents comprise an antisense oligonucleotide comprising a targeting region that is complementary to a target region of an LPA nucleic acid.

[0320] In certain embodiments, the target nucleic acid is an endogenous LPA RNA molecule. In certain embodiments, the LPA nucleic acid encodes apo(a) protein. In certain embodiments, the LPA nucleic acid is a precursor to a nucleic acid that encodes apo(a) protein or Lp(a). In certain such embodiments, the LPA nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions. In certain embodiments, the LPA RNA is a mature mRNA. In certain embodiments, the LPA nucleic acid is a pre-mRNA.

[0321] In certain embodiments, antisense oligonucleotides provided herein are complementary to a target region of a LPA nucleic acid over the entire length of the modified oligonucleotide. In certain embodiments, antisense oligonucleotides are at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal length portion of the LPA nucleic acid. In certain embodiments, antisense oligonucleotides are at least 80% complementary to a target region of the LPA nucleic acid over the entire length of the antisense oligonucleotide and comprise a targeting region that is 100% or fully complementary to the target region of the LPA nucleic acid.

[0322] In certain embodiments, atargeting region is from 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 nucleobases in length. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases. In certain embodiments, the targeting region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region constitutes all of the nucleosides of the antisense oligonucleotide. In certain embodiments, the targeting region of the antisense oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to a target region of the LPA nucleic acid. In certain embodiments, the targeting region of the antisense oligonucleotide is 100% complementary to a target region of the LPA nucleic acid.

[0323] In certain embodiments, antisense oligonucleotides comprise one or more mismatches relative to the target region of the LPA nucleic acid. In certain embodiments, antisense activity against the target is reduced by such a mismatch, and activity against a non-target is reduced. In certain embodiments, activity against the non-target is reduced by a greater amount than activity against the target. Thus, in certain embodiments selectivity of the antisense oligonucleotides is improved. In certain embodiments, antisense oligonucleotides are at least 80% complementary to the target region of the LPA nucleic acid over the entire length of the antisense oligonucleotide and comprise no more than one to three mismatches with the LPA nucleic acid. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80% complementary to a target region of the LPA nucleic acid over the entire length of the targeting region, and the targeting region comprises no more than one to three mismatches with the target region. In certain embodiments, antisense oligonucleotides comprise a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target region of the LPA nucleic acid over the entire length of the targeting region. In certain embodiments, additional mismatches may be present at a terminus or at both termini of the antisense oligonucleotide, outside of the targeting region. In certain embodiments, a mismatch is specifically positioned within an antisense oligonucleotide. In certain embodiments, a mismatch is at position 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5'-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 from the 3 '-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 1, 2, 3, or 4 from the 5 '-end of the antisense oligonucleotide. In certain embodiments, a mismatch is at position 4, 3, 2, or 1 from the 3 '-end of the antisense oligonucleotide.

[0324] B. Target Nucleic Acids in Certain Tissues

[0325] In certain embodiments, oligomeric agents comprise or consist of a modified oligonucleotide comprising a targeting region that is complementary to a target region in a LPA nucleic acid, wherein the LPA nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the LPA nucleic acid is expressed in the liver.

[0326] C. Oligonucleotide sequences

[0327] Provided herein are oligomeric agents comprising modified oligonucleotides complementary to a target region in a LPA nucleic acid, such as, for example, a human LPA nucleic acid, such as SEQ ID NO: 1 (the complement of GENBANK Accession No. NC_000006. 12, truncated from nucleoside 160528001 to nucleoside 160669000) or SEQ ID NO: 2 (GENBANK Accession No. NM_005577.2), or to both and compositions comprising such oligomeric agents. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a region of SEQ ID NOs: 1 and / or 2. In certain embodiments, a modified oligonucleotide has a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a target region of SEQ ID NOs: 1 and / or 2. In certain embodiments, a modified oligonucleotide has a targeting region that is 100% complementary to a target region of SEQ ID NOs: 1 and / or 2. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of a complementary region that is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% complementary to a targeting region that is 100% complementary to a target region of SEQ ID NOs: 1 and / or 2. In certain embodiments, a modified oligonucleotide has a nucleobase sequence comprising or consisting of any of SEQ ID NO: 3-355.

[0328] IV. Methods and Uses

[0329] A. Antisense Activity

[0330] In certain embodiments, oligomeric agents provided herein comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric agents are antisense agents.

[0331] In certain antisense activities, hybridization of an antisense oligonucleotide to a target nucleic acid results in recruitment of a protein, e.g. , RNase H or Argonaute, that cleaves the target nucleic acid. Certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, oligomeric agents are antisense agents that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA- like nucleosides in the antisense agent are tolerated and RNase H activity is retained. In certain embodiments, such antisense agents reduce or inhibit expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay.

[0332] In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense oligonucleotide to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in exon inclusion or exon exclusion. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in retained intron exclusion.

[0333] In certain embodiments, hybridization of an antisense agent to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid (e.g., miRNA, IncRNA, sncRNA). In certain embodiments, hybridization of an antisense agent to a target nucleic acid results in modulation of translation of the target nucleic acid. In certain embodiments, hybridization of an oligomeric agent to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in increased translation of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in reduced translation of the target nucleic acid.

[0334] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or animal.

[0335] Certain embodiments provide compositions and methods for reducing LPA RNA levels. Certain embodiments provide compositions and methods for reducing apo(a) and / or Lp(a) levels. In certain embodiments, reducing apo(a) levels in a tissue, organ and / or subject improves the ratio of LDL to HDL or the ratio of TG to HDL. In certain embodiments, provided are methods for using an oligomeric antisense agent targeted to an apo(a) nucleic acid for modulating the expression of apo(a) in a subject. In certain embodiments, expression of apo(a) is reduced.

[0336] In certain embodiments, inhibition of apo(a) or Lp(a) expression occurs in a cell, tissue or organ. In certain embodiments, inhibition of apo(a) or Lp(a) occurs in a cell, tissue or organ in a subject. In certain embodiments, inhibition is a reduction in apo(a) mRNA level. In certain embodiments, inhibition is a reduction in apo(a) protein level. In certain embodiments, both apo(a) mRNA and protein levels are reduced. In certain embodiments, inhibition is a reduction in Lp(a) level. Such reduction may occur in a time -dependent or in a dose-dependent manner.

[0337] In certain embodiments, a method of modulating expression of LPA or modulating apo(a) protein or Lp(a) in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a LPA nucleic acid. In certain embodiments, a method of inhibiting expression of LPA or inhibiting apo(a) protein or Lp(a) protein in a cell comprises contacting the cell with an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region having a nucleobase sequence complementary to a target region of a LPA nucleic acid. In certain embodiments, the cell is a hepatocyte.

[0338] In certain embodiments, provided herein are methods of inhibiting or reducing LPA expression, LPA RNA levels and / or apo(a) protein or Lp(a) levels and / or activity, in a subject having, or at risk of having, a disease, disorder, condition or injury associated with LPA and / or apo(a) protein or Lp(a), such as a disease, disorder, condition or injury associated with inflammatory cardiovascular disease, wherein the method includes administering to the subject an oligomeric agent comprising or consisting of an oligomeric antisense agent comprising a modified oligonucleotide targeting a LPA nucleic acid thereby inhibiting expression of LPA nucleic acid in the subject. In certain embodiments, expression of LPA nucleic acid is inhibited. In certain embodiments, administering an oligomeric agent inhibits LPA expression, LPA RNA levels and / or apo(a) protein or Lp(a) levels and / or activity in the plasma / serum blood. In certain embodiments, administering an oligomeric agent inhibits or reduces LPA expression, LPA RNA levels, and / or apo(a) protein or Lp(a) levels, and / or activity in the liver. In certain embodiments, administering such an oligomeric agent inhibits or reduces LPA expression, LPA RNA levels and / or apo(a) protein or Lp(a) levels and / or activity in the plasma / serum blood and the liver of the subject. In certain embodiments, detectable amount of the LPA RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of SEQ ID NO: 1 or SEQ ID NO: 2 is capable of decreasing or reducing a detectable amount of a apo(a) protein or Lp(a) in a cell, organ or tissue, e.g., the liver of the subject, when the compound is administered to the cell, a tissue, and / or subject. In certain embodiments, detectable amount of the apo(a) protein or Lp(a) may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments an oligomeric agent has LPA RNA and / or apo(a) protein or Lp(a) reduction activity, and, in particular embodiments, liver LPA RNA and / or apo(a) protein or Lp(a) reduction activity, that is comparable to or greater than the LPA RNA and / or apo(a) protein or Lp(a) reduction activity of a comparator agent. In certain embodiments, the comparator agent is an agent that comprises a comparator modified oligonucleotide having a targeting region complementary to a target region of LPA. In certain embodiments, the comparator modified oligonucleotide is complementary to the same or a similar target region as the modified oligonucleotide of the oligomeric agent. In certain embodiments, the comparator modified oligonucleotide is complementary to a different target region from the modified oligonucleotide of the oligomeric agent. In some embodiments, the amount of LPA RNA is reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% in a cell (e.g., hepatocyte), organ (e.g., lively), or subject (e.g., animal) that has been contacted with or administered an oligomeric agent provided herein (or a composition comprising such an oligomeric agent) compared to a control (e.g., a cell, organ, tissue, system or subject that has not been contacted with or administered the oligomeric agent, or was contacted with or administered a control substance (e.g., PBS)). In some embodiments, the percentage of LPA RNA decrease or reduction in a cell (e.g., a hepatocyte), organ (e.g., a lively), tissue, system, or subject (e.g., animal) contacted with or administered an oligomeric agent or composition provided herein is 0.1% to 30% greater than or less than, 0.1% to 25% greater than or less than, 0.1% to 20% greater than or less than, 0.1% to 15% greater than or less than, 0.1% to 10% greater than or less than, or 0. 1% to 5% greater than or less than, 0.1% to 1% greater than or less than, 5% to 40% greater than, 5% to 35% greater than, 10% to 40% greater than, at least 5% greater than, at least 10% greater than, at least 15% greater than, at least 20% greater than, at least 25% greater than, or at least 30% greater than the percentage of LPA RNA decrease or reduction in a cell (e.g., a cardiomyocyte), organ (e.g., a heart), tissue, system or subject (e.g., animal) contacted with or administered the same concentration or dose of a comparator agent.

[0339] B. Therapeutic indications, methods

[0340] Atherosclerotic cardiovascular disease is highly prevalent and continues to be the highest cause of mortality worldwide despite the widespread use of low-density lipoprotein (LDL)- lowering therapies. Though LDL-lowering therapies reduce the risk of major cardiac events, residual cardiovascular risk encountered in some patients with low LDL levels implies other mechanisms of cardiovascular pathology. Over the last decade, compelling evidence from epidemiological studies and meta-analyses, Mendelian randomization studies, and genome wide association studies have shown that elevated serum Lp(a) concentration is associated with a higher risk of coronary artery disease and atherosclerosis-related disorders (Clarke et al., N. Engl. J. Med., Vol. 361 :2518-2528, 2009; Kamstrup etal., JAMA, Vol. 301 :2331-2339, 2009; Nordestgaard et al., European Heart Journal, Vol. 31 :2844-2853, 2010; Helgadottir et al., J. Am. Coll. Cardiol, Vol. 60:722-729, 2012; Thanassoulis etal., J. Am. Coll. Cardiol., Vol. 55:2491- 2498, 2010; Kamstrup et al., J. Am. Coll. Cardiol., Vol. 63:470-477, 2014; Kral et al., Journal of Cardiology, Vol. 118:656-661, 2016; Thanassoulis et al., J. Lipid Res., Vol. 57: 917-924, 2016; Tsimikas et al., J. Am. Coll. Cardiol., Vol. 69:692-711, 2017). It has been noted that this risk relationship is continuous and becomes proportionally more impactful with higher Lp(a) levels, and the association persists after correction for other lipid parameters (Emerging Risk Factors Collaboration, JAMA, Vol. 302:412-423, 2009). LPA gene mutations can increase LPA RNA levels, result in abnormal apo(a) cleavage that leads to increased apo(a) levels (and Lp(a) levels), or decreased degradation and clearance, and / or abnormal interactions between Lp(a) and other proteins or other endogenous or exogenous substances (e.g., plasminogen receptor) such that Lp(a) level is increased or degradation is decreased. A condition associated with high Lp(a) levels may be relatively insensitive to lifestyle changes and common statin drugs, and therefore hard to treat.

[0341] Subjects with high Lp(a) levels are at a significant risk of disease (Lippi et al., Clinica Chimica Acta, 2011, 412:797-801; Solfrizz et al.). For example, subjects will Lp(a) levels greater than > 75 nanomole s / liter (nmol / L) or > 30 mg / dL are considered to have increased risk for various diseases. In many subjects with high Lp(a) levels, current treatments cannot reduce Lp(a) levels to safe levels. Apo(a) plays a vital role in the formation of Lp(a), hence reducing apo(a) can reduce Lp(a) and prevent, treat or ameliorate a disease associated with Lp(a). In certain embodiments, treatment with oligomeric agents and methods provided herein is indicated for a subject with elevated apo(a) levels and / or Lp(a) levels. In certain embodiments, the subject has apo(a) levels > 10 mg / dL, > 20 mg / dL, > 30 mg / dL, > 40 mg / dL, > 50 mg / dL, > 60 mg / dL, > 70 mg / dL, > 80 mg / dL, > 90 mg / dL or > 100 mg / dL. In certain embodiments, the subject has Lp(a) levels > 10 mg / dL, > 15 mg / dL, > 20 mg / dL, > 25 mg / dL, > 30 mg / dL, > 35 mg / dL, > 40 mg / dL, > 50 mg / dL, > 60 mg / dL, > 70 mg / dL, > 80 mg / dL, > 90 mg / dL, > 100 mg / dL, > 110 mg / dL, > 120 mg / dL, > 130 mg / dL, > 140 mg / dL, > 150 mg / dL, > 160 mg / dL, > 170 mg / dL, > 175 mg / dL, > 180 mg / dL, > 190 mg / dL, > 200 mg / dL. In certain embodiments, a subject has apo(a) level greater than the upper limit of normal, e.g. wherein the subject has apo(a) levels > 30 mg / dL, > 35 mg / dL, > 40 mg / dL, > 50 mg / dL, > 60 mg / dL, > 70 mg / dL, > 80 mg / dL, > 90 mg / dL, > 100 mg / dL, > 110 mg / dL, > 120 mg / dL, > 130 mg / dL, > 140 mg / dL, > 150 mg / dL, > 160 mg / dL, > 170 mg / dL, > 175 mg / dL, > 180 mg / dL, > 190 mg / dL, > 200 mg / dL.

[0342] In certain embodiments, provided herein are methods for preventing, treating, or delaying or preventing the development or progression of, diseases, disorders, conditions or injuries associated with LPA and / or apo(a) protein or Lp(a) increased levels, wherein the method comprises administering to a subject an oligomeric agent described herein (e.g., an antisense agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a LPA nucleic acid). Also provided are methods of ameliorating, preventing, or delaying the onset of, one or more symptoms associated with diseases, disorders, conditions or injuries associated with LPA or apo(a) protein and / or Lp(a), wherein the method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a nucleobase sequence complementary to a nucleobase sequence in a LPA nucleic acid. A Lp(a)-associated condition may be, e.g., a cardiovascular condition, a metabolic condition, an inflammatory condition. In certain embodiments an Lp(a)-associated condition is an inflammatory, cardiovascular or metabolic disease or disorder. In certain embodiments, an Lp(a) associated condition or lipoprotein metabolism disorder is a cardiometabolic disorder. In some embodiments, an oligomeric agent described herein is used to treat a subject with a cardiovascular disease (CVD) such as hypertriglyceridemia and / or other condition selected from lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapobetalipoproteinemia, chronic heart disease, including coronary artery disease (CAD) or any symptoms or conditions associated with a CVD, e.g., hypercholesterolemia (e.g., statin-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia) myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular atherosclerosis, cerebrovascular disease, or stroke.

[0343] Thus, in certain embodiments, a method comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a LPA nucleic acid. In certain embodiments, the subject has or is at risk for developing a cardiovascular, metabolic and / or inflammatory injury, disease, condition or disorder. In certain embodiments, the subject has or is at risk for developing cardiovascular disease (CVD) such as hypertriglyceridemia and / or other condition selected from lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapobetalipoproteinemia, chronic heart disease, including coronary artery disease (CAD) or any symptoms or conditions associated with a CVD, e.g., hypercholesterolemia (e.g., statin-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia) myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular atherosclerosis, cerebrovascular disease, or stroke. In certain embodiments, at least one symptom of the cardiovascular injury, disease, condition, or disorder is ameliorated. In certain embodiments, the at least one symptom is selected from include, but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever. In certain embodiments, administration of an oligomeric agent provided herein (e.g., a modified antisense oligonucleotide and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one at least one symptom of aortic stenosis. Certain embodiments provide compositions and methods for preventing, delaying, slowing the progression of apo(a) related diseases, disorders, and conditions in a subject in need thereof. Certain embodiments provide compositions and methods for ameliorating apo(a) related diseases, disorders, and conditions in a subject in need thereof. Certain embodiments provide compositions and methods for preventing, delaying, slowing the progression Lp(a) related diseases, disorders, and conditions in a subject in need thereof. Certain embodiments provide compositions and methods for ameliorating Lp(a) related diseases, disorders, and conditions in a subject in need thereof. In certain embodiments, such diseases, disorders, and conditions include inflammatory, cardiovascular and / or metabolic diseases, disorders, and conditions.

[0344] In certain embodiments, provided are methods of treating an individual with an apo(a) related disease, disorder or condition comprising administering a therapeutically effective amount of one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has elevated apo(a) levels. In certain embodiments, provided are methods of treating an individual with an Lp(a) related disease, disorder or condition comprising administering a therapeutically effective amount of one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has elevated Lp(a) levels. In certain embodiments, the individual has an inflammatory, cardiovascular and / or metabolic disease, disorder or condition. In certain embodiments, administration of a therapeutically effective amount of an oligomeric agent is accompanied by monitoring of apo(a) or Lp(a) levels. In certain embodiments, administration of an oligomeric agent is accompanied by monitoring of markers of inflammatory, cardiovascular and / or metabolic disease, or other disease process associated with the expression of apo(a), to determine an individual’s response to an oligomeric agent. An individual’s response to administration of an oligomeric agent can be used by a physician to determine the amount and duration of therapeutic intervention with an oligomeric agent.

[0345] In certain embodiments, provided herein are methods of treating a subject comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, a method of treating comprises administering an oligomeric agent for inhibiting or reducing expression of LPA nucleic acid, such as RNA, in a subject having or at risk of a disease, injury, condition or disorder associated with LPA, comprising administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a LPA nucleic acid, thereby inhibiting or reducing expression of LPA nucleic acid in the subject. In certain embodiments, the individual has an apo(a) related disease. In certain embodiments, the individual has an Lp(a) related disease. In certain embodiments, the individual has an inflammatory, cardiovascular and / or a metabolic disease, disorder or condition.

[0346] In certain embodiments, a method of treating a subject comprises administering to a subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a LPA nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing cardiovascular, metabolic, and / or inflammatory disease or disorder. In certain embodiments, administering the therapeutically effective amount of the oligomeric agent improves one or more symptoms of the cardiovascular, metabolic, and / or inflammatory disease or disorder in the subject. In certain embodiments, at least one symptom of the cardiovascular, metabolic, and / or inflammatory disease or disorder is ameliorated. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one or more symptoms.

[0347] In certain embodiments cardiovascular diseases, disorders or conditions include, but are not limited to, aortic stenosis, aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral artery disease, peripheral artery occlusive disease), retinal vascular occlusion, stroke, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), calcific aortic valve stenosis associated with high Lp(a), and the like. Certain embodiments provide compositions and methods for preventing, delaying, slowing the progression of aortic stenosis. Certain embodiments provide compositions and methods for ameliorating aortic stenosis.

[0348] In certain embodiments, an oligomeric agent modulates physiological markers or phenotypes of a cardiovascular disease, disorder or condition. For example, administration of an oligomeric agent to a human can decrease Lp(a), LDL and cholesterol levels compared to untreated subjects. In certain embodiments, modulation of the physiological markers or phenotypes can be associated with inhibition of apo(a) by an oligomeric agent. In certain embodiments, physiological markers of the cardiovascular disease, disorder or condition can be quantifiable. For example, Lp(a), LDL or cholesterol levels can be measured and quantified by, for example, standard lipid tests. For such markers, in certain embodiments, the marker can be decreased by about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

[0349] Provided herein are methods for treating a symptom associated with a cardiovascular disease, disorder or condition in a subject in need thereof, disease, disorder. In certain embodiments, treating results in reducing the rate of onset of a symptom associated with the cardiovascular disease, disorder or condition. In certain embodiments, treating results in reducing the severity of a symptom associated with the cardiovascular or condition. A cardiovascular disease, disorder or condition can be characterized by numerous physical symptoms. Any symptom known to one of skill in the art to be associated with the cardiovascular disease, disorder or condition can be prevented, treated, ameliorated or otherwise modulated with the compounds and methods described herein. In certain embodiments, the symptom can be any of, but not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen or fever.

[0350] In certain embodiments, a method of treatment of a subject comprises administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a LPA nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk for developing a cardiovascular disease, e.g., an atherosclerotic cardiovascular disease, an atherosclerotic cerebrovascular disease, a hyperlipidaemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles. In certain embodiments, treatment is to prevent and / or reduce the risk of suffering from and / or treat stroke, atherosclerosis, thrombosis calcific aortic stenosis such as calcific aortic stenosis, ischaemic stroke, coronary artery disease, peripheral arterial disease, abdominal aortic aneurysm, heart failure secondary to ischaemic cardiomyopathy, or familial hypercholesterolaemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles.

[0351] In certain embodiments treatment with an oligomeric agent is to prevent and / or reduce the risk of suffering from and / or treat or cardiovascular disease such as coronary heart disease and any other disease or pathology associated with elevated levels of Lp(a)-containing particles. In certain embodiments treament is to prevent and / or reduce a risk of suffering from and / or treat, a cardiovascular disease, e.g., an atherosclerotic cardiovascular disease, an atherosclerotic cerebrovascular disease, a hyperlipidaemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles. In certain embodiments, treatment is to prevent and / or reduce the risk of suffering from and / or treat stroke, atherosclerosis, thrombosis calcific aortic stenosis such as calcific aortic stenosis, ischaemic stroke, coronary artery disease, peripheral arterial disease, abdominal aortic aneurysm, heart failure secondary to ischaemic cardiomyopathy, or familial hypercholesterolaemia, wherein the disease is associated with elevated levels of Lp(a)-containing particles.

[0352] In certain embodiments treatment with an oligomeric agent results in reducing the risk of a cardiovascular event in a patient with atherosclerotic cardiovascular disease. In certain embodiments the cardiovascular event is cardiovascular death, myocardial infarction, stroke, and / or coronary revascularization. In certain embodiments, a subject has a history of coronary revascularization, a history of coronary artery bypass grafting, a diagnosis of coronary artery disease, a diagnosis of atherosclerotic cerebrovascular disease, a diagnosis of peripheral artery disease, and / or a history of myocardial infarction. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one of stroke, atherosclerosis, thrombosis calcific aortic stenosis such as calcific aortic stenosis, ischaemic stroke, coronary artery disease, peripheral arterial disease, abdominal aortic aneurysm, heart failure secondary to ischaemic cardiomyopathy, or familial hypercholesterolaemia. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one of angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever, or a combination thereof. In certain embodiments treatment with an oligomeric agent is to ameliorate one or more symptoms of cardiovascular disease such as coronary heart disease and / or other disease or pathology associated with elevated levels of Lp(a) containing particles. In certain embodiments treatment is to ameliorate symptoms associated with a cardiovascular disease such as coronary artery disease, carotid artery disease, peripheral artery disease, myocardial infarction, cerebrovascular disease, stroke, aortic valve stenosis, stable or unstable angina, atrial fibrillation, heart failure, hyperlipidemia, heterozygous familial hypercholesterolemia, or homozygous familial hypercholesterolemia. In certain embodiments a subject is diagnosed with or at risk of a cardiovascular disease; diagnosed myocardial infarction, acute coronary syndrome. In certain embodiments, the symptoms include, but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever. Certain embodiments provide a method of reducing at least one symptom of aortic stenosis.

[0353] In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, and optionally one or more conjugate and / or terminal groups) to the subject ameliorates or reduces one or more symptoms of at least one of stroke, atherosclerosis, thrombosis calcific aortic stenosis such as calcific aortic stenosis, ischaemic stroke, coronary artery disease, peripheral arterial disease, abdominal aortic aneurysm, heart failure secondary to ischaemic cardiomyopathy, or familial hypercholesterolaemia. In certain embodiments, administration of a pharmaceutical composition comprising an oligomeric agent (e.g., a modified oligonucleotide, and optionally one or more conjugate and / or terminal groups) to the subject ameliorates one or more symptoms of angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever, or a combination thereof.

[0354] In certain embodiments, metabolic diseases, disorders or conditions include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, metabolic syndrome and diabetic dyslipidemia.

[0355] In certain embodiments, an oligomeric agent modulates physiological markers or phenotypes of a metabolic disease, disorder or condition. For example, administration of an oligomeric agent to humans can decrease glucose and insulin resistance levels in those subjects compared to untreated subjects. In certain embodiments, the modulation of the physiological markers or phenotypes can be associated with inhibition of apo(a) by an oligomeric agent. In certain embodiments, physiological markers of the metabolic disease, disorder or condition can be quantifiable. For example, glucose levels or insulin resistance can be measured and quantified by standard tests known in the art. For such markers, in certain embodiments, the marker can be decreased by about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In another example, insulin sensitivity can be measured and quantified by standard tests known in the art. For such markers, in certain embodiments, the marker can be increase by about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.

[0356] Provided herein are methods for treating a symptom associated with the metabolic disease, disorder or condition in a subject in need thereof. In certain embodiments, treating results in reducing the rate of onset of a symptom associated with the metabolic disease, disorder or condition. In certain embodiments, treating results in reducing the severity of a symptom associated with the metabolic disease, disorder or condition. A metabolic disease, disorder or condition can be characterized by numerous physical symptoms. Any symptom known to one of skill in the art to be associated with the metabolic disease, disorder or condition can be prevented, treated, ameliorated or otherwise modulated with the compounds and methods described herein. In certain embodiments, a symptom can be any of, but not limited to, excessive urine production (polyuria), excessive thirst and increased fluid intake (polydipsia), blurred vision, unexplained weight loss and lethargy.

[0357] In certain embodiments, inflammatory diseases, disorders or conditions may overlap with cardiometabolic disorders or conditions, and include, but are not limited to, elevated Lp(a) associated CVD risk, recurrent cardiovascular events with elevated Lp(a), aortic stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), coronary artery disease (CAD), Alzheimer’s Disease and thromboembolic diseases, disorder or conditions. Certain thromboembolic diseases, disorders or conditions include, but are not limited to, stroke, thrombosis, myocardial infarction and peripheral vascular disease.

[0358] In certain embodiments, an oligomeric agent modulates physiological markers or phenotypes of an inflammatory disease, disorder or condition. For example, administration of an oligomeric agent to a human can decrease inflammatory cytokine or other inflammatory markers levels in compared to untreated subjects. In certain embodiments, the modulation of the physiological markers or phenotypes can be associated with inhibition of apo(a) by an oligomeric agent. In certain embodiments, physiological markers of the inflammatory disease, disorder or condition can be quantifiable. For example, cytokine levels can be measured and quantified by standard tests known in the art. For such markers, in certain embodiments, the marker can be decreased by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%, or a range defined by any two of these values.

[0359] Provided herein are methods for treating a symptom associated with an inflammatory disease, disorder or condition in a subject in need thereof. In certain embodiments, treating results in reducing the rate of onset of a symptom associated with the inflammatory disease, disorder or condition. In certain embodiments, treating results in reducing the severity of a symptom associated with the inflammatory disease, disorder or condition.

[0360] In certain embodiments, an oligomeric agent has greater LPA RNA and / or protein reduction activity (i.e., greater specificity of action) in a target cell / organ / tissue / system (e.g., hepatocytes, liver) LPA than a non-target (e.g., plasminogen). For example, in some embodiments, administration of an oligomeric agent provided herein reduces the amount or activity of LPA RNA and / or protein at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to a control and has no, or a non-significant, effect on (e.g., reduction in) the amount or activity of plasminogen.

[0361] In certain embodiments, administration of an oligomeric agent results in reduction of LPA expression by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%, or a range defined by any two of these values. In certain embodiments, apo(a) expression is reduced to at least < 100 mg / dL, < 90 mg / dL, < 80 mg / dL, < 70 mg / dL, < 60 mg / dL,

[0362] < 50 mg / dL, < 40 mg / dL, < 30 mg / dL, <20 mg / dL or < 10 mg / dL. In certain embodiments, administration of an oligomeric agent results in reduction of apo(a) by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%, or a range defined by any two of these values. In certain embodiments, Lp(a) containing particles in serum is reduced to at least < 200 mg / dL, < 190 mg / dL, < 180 mg / dL, < 175 mg / dL, < 170 mg / dL, < 160 mg / dL,

[0363] < 150 mg / dL, < 140 mg / dL, < 130 mg / dL, < 120 mg / dL, < 110 mg / dL, < 100 mg / dL, < 90 mg / dL, < 80 mg / dL, < 70 mg / dL, < 60 mg / dL, < 55 mg / dL, < 50 mg / dL, < 45 mg / dL, < 40 mg / dL, < 35 mg / dL, < 30 mg / dL, < 25 mg / dL, < 20 mg / dL, < 15 mg / dL, or < 10 mg / dL.

[0364] In certain embodiments, provided are methods for using an oligomeric agent in the preparation of a medicament. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent are used for the preparation of a medicament for treating a patient suffering or susceptible to an inflammatory, cardiovascular and / or a metabolic disease, disorder or condition. In certain embodiments, the subject has or is at risk for developing cardiovascular disease (CVD) such as hypertriglyceridemia and / or other condition selected from lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapobetalipoproteinemia, chronic heart disease, including coronary artery disease (CAD) or any symptoms or conditions associated with a CVD, e.g., hypercholesterolemia (e.g., statin-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia) myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular atherosclerosis, cerebrovascular disease, or stroke. In certain embodiments, at least one symptom of the cardiovascular injury, disease, condition, or disorder is ameliorated. In certain embodiments, the at least one symptom is selected from include, but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever. In certain embodiments, administration of an oligomeric agent provided herein (e.g., a modified antisense oligonucleotide and optionally one or more conjugate and / or terminal groups) to the subject reduces or delays the onset or progression of at least one at least one symptom of aortic stenosis.

[0365] Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a LPA nucleic acid, for the manufacture or preparation of a medicament for ameliorating, or delaying or preventing development or progression of a disease, disorder, condition or injury and / or for ameliorating, preventing or delaying the onset of one or more symptoms of a disease, disorder, condition or injury, wherein the disease, disorder, condition or injury is associated with cardiovascular disease (CVD) such as hypertriglyceridemia and / or other condition selected from lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, hyperapobetalipoproteinemia, chronic heart disease, including coronary artery disease (CAD) or any symptoms or conditions associated with a CVD, e.g., hypercholesterolemia (e.g., statin-resistant hypercholesterolemia, heterozygous or homozygous familial hypercholesterolemia) myocardial infarction (MI), acute coronary syndrome, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, cerebrovascular atherosclerosis, cerebrovascular disease, or stroke. In certain embodiments, the disease is aortic stenosis In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving one or more symptoms selected from angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever.

[0366] In certain embodiments, prophylactic administration of an oligomeric agent or composition provided herein to a subject at risk for cardiovascular, metabolic, and / or inflammatory disease, is able to prevent, ameliorate, postpone or delay a symptom and / or development or progression of cardiovascular, metabolic, an / or inflammatory disease progression. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving angina, chest pain, shortness of breath, palpitations, weakness, dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling in the lower extremities, cyanosis, fatigue, fainting, numbness of the face, numbness of the limbs, claudication or cramping of muscles, bloating of the abdomen, and fever.

[0367] In any of the methods or uses described herein, the oligomeric agent be any oligomeric agent (e.g., an oligomeric agent comprising or consisting of a modified oligonucleotide, an antisense oligonucleotide, and optionally one or more conjugate and / or terminal groups) described herein.

[0368] In certain embodiments an oligomeric agent is administered parenterally. In certain embodiments, an oligomeric agent is administered intravenously, subcutaneously, intramuscularly, or intrathecally. In certain embodiments, an oligomeric agent or composition is co-administered with a second agent or therapy. In certain embodiments, the oligomeric agent or composition and second agent are administered concomitantly. In certain embodiments, a second agent is a glucose-lowering agent. In certain embodiments, a second agent is a LDL, TG or cholesterol lowering agent. In certain embodiments, a second agent is an anti-inflammatory agent. In certain embodiments, a second agent can be, but is not limited to, a non-steroidal anti-inflammatory drug (NSAID e.g., aspirin), niacin (e.g., Niaspan), nicotinic acid, ezetimibe, an apoB inhibitor (e.g., Mipomersen), a CETP inhibitor (e.g., Anacetrapib), an apo(a) inhibitor, a thyroid hormone analog (e.g., Eprotirome), a HMG-CoA reductase inhibitor (e.g., a statin), a fibrate (e.g., Gemfibrozil), a microsomal triglyceride transfer protein inhibitor (e.g., Lomitapide), a PCSK9 inhibitor (e.g., inclisiran), as well as therapies in development, e.g., an ANGPTL3 inhibitor, an APOC3 inhibitor. In certain embodiments a therapy can be, but is not limited to, Lp(a) apheresis. In certain embodiments, a second agent is an alzheimer disease drug. Agents or therapies can be co-administered or administered concomitantly. Agents or therapies can be sequentially or subsequently administered.

[0369] V. Pharmaceutical Compositions

[0370] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agent described herein, wherein each oligomeric agent comprises or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent consists of or comprises an antisense oligonucleotide. In certain embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric agent. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide) provided herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide) provided herein and phosphate- buffered saline (PBS). In certain embodiments, sterile PBS is pharmaceutical grade PBS.

[0371] In certain embodiments, a pharmaceutical composition comprises an oligomeric agent comprising or consisting of a modified oligonucleotide and sterile saline. In certain such embodiments, a pharmaceutical composition consists of such oligomeric agent and sterile saline. In certain embodiments, a pharmaceutical composition consists essentially of such oligomeric agent and sterile saline. In certain embodiments, the sterile saline is sterile PBS. In certain embodiments, the sterile saline is pharmaceutical grade. In certain embodiments, the sterile fluid is pharmaceutical grade. In certain embodiments, the pH of a solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7. 1-7.3, or to about 7.2.

[0372] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agent and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0373] In certain embodiments, an oligomeric agent may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0374] In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salts of the oligomeric agent, esters of the oligomeric agent, or salts of such esters. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent comprising or consisting of one or more modified oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents provided herein, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.

[0375] In certain embodiments, oligomeric agents are lyophilized and isolated, e.g., as sodium salts. In certain embodiments, a sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS. In certain embodiments, a sodium salt of an oligomeric agent is mixed with PBS.

[0376] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, a nucleic acid, such as an oligomeric agent comprising a modified oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to muscle tissue.

[0377] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0378] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more oligomeric agents to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0379] In certain embodiments, a pharmaceutical composition is prepared for administration of an oligomeric agent to a subject. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intrathecal, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier or diluent and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, diluents, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0380] Under certain conditions, certain compounds disclosed herein function as acids. Although such compounds may be drawn or described in protonated (free acid) form or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” herein is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0381] In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of a solution is adjusted with NaOH and / or HC1 to achieve a desired pH.

[0382] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent (e.g., modified oligonucleotide, antisense agent) in milligrams indicates the mass of the free acid form of the compound. As described herein, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the oligomeric agent (e.g., modified oligonucleotide) exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where an oligomeric agent (e.g., modified oligonucleotide) is in solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

[0383] Nonlimiting disclosure and incorporation by reference

[0384] Section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0385] All documents, websites, URLs, or portions thereof, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated- by-reference for the portions of the document discussed herein and in their entirety.

[0386] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0387] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2 ’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2 ’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligonucleotides having other modified nucleobases, such as “AT^CGAUCG,” whereinmC indicates a cytosine base comprising a methyl group at the 5-position.

[0388] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (.S'), as a or p such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0389] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ’H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of ’H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric agent that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging. EXEMPLIFICATION The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated. Example 1: Design and effect of oligomeric agents complementary to human LPA RNA

[0390] Oligomeric agents comprising a modified oligonucleotide targeting human LPA RNA attached to a GalNAc conjugate moiety were designed. The modified oligonucleotides are shown in Table 1 below. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (the complement of GENBANK Accession No. NC_000006.12, truncated from nucleoside 160528001 to nucleoside 160669000), to SEQ ID NO: 2 (GENBANK Accession No. NM_005577.2), or to both, except for any nucleobase mismatches identified in Table 1.

[0391] The modified oligonucleotides in Table 1A and Table IB below are GalN Ac-conjugated modified oligonucleotides with modifications as indicated in Intemucleoside Motif and Sugar Motif, wherein “e” represents a 2'-M0E sugar moiety, “k” represents a cEt sugar moiety, and “d” represents a 2'-deoxy sugar moiety; and wherein each “z” represents a mesyl phosphoramidate intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5- methylcytosine. The mismatched nucleobase is bolded and underlined in the column labeled Nucleobase Sequence (5 ' to 3'). Each modified oligonucleotide has a [HPPO-GalNAc] conjugate group attached to the 3 '-end, the structure of which is:

[0392] SEQ ID NOs are indicated for the compound (SID cpd) as well as for the nucleobase sequence (SID nb)

[0393] Table 1A: Oligomeric agents targeting LPA

[0394] Example 2: Single dose effects on LPA RNA in primary human hepatocytes

[0395] Oligomeric agents targeting human LPA RNA were tested for single dose effects on LPA RNA in primary human hepatocytes in vitro. Oligomeric agents consisting of GalNAc-conjugated modified oligonucleotides as described in Example 1 were tested in a series of experiments.

[0396] Primary human hepatocytes (sourced from BioIVT, M0095-P, lot ZFW) were treated with oligomeric agent at a concentration of 3,000 nM by free uptake at a density of 20,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and LPA RNA levels were measured by quantitative real-time RTPCR. LPA RNA levels were measured using human primer- probe set hAPO(a)12kB (forward sequence CCACAGTGGCCCCGGT, designated herein as SEQ ID NO: 356; reverse sequence ACAGGGCTTTTCTCAGGTGGT, designated herein as SEQ ID NO: 357; probe sequence CCAAGCACAGAGGCTCCTTCTGAACAAG, designated herein as SEQ ID NO: 358). LPA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of LPA RNA are presented in Table 2 below as percent LPA RNA relative to the amount of LPA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.

[0397] Table 2: LPA activity of oligomeric agent in primary human hepatocytes

[0398]

[0399] Example 3: In vitro effect of oligomeric agents on human LPA RNA

[0400] Oligomeric agents consisting of GalNAc-conjugated modified oligonucleotides (see Example 1) were tested for single dose effects on LPA RNA in transgenic primary mouse hepatocytes. Transgenic mice containing a 110-kb human LPA gene, an apo(a)-like gene and greater than 60 kb of 5' and 3' flanking DNA previously described in Lrazer K, et. al., The apolipoprotein (a) gene is regulated by sex hormones and acute-phase inducers in YAC transgenic mice; Nature Genetics, 1995, 9: 424-431 (Lrazer et al. (1995)) were used. Restriction analysis of the LPA gene in the construct used to generate the mice reportedly indicates that it contains 12 kringle IV-like repeats (see Frazer et al. (1995)). Mice used as a source of human LPA gene transgenic mouse primary hepatocytes in the studies described herein were derived by Taconic Biosciences.

[0401] Mouse hepatocytes were treated with oligomeric agent at a concentration of 3,000 nM by free uptake at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and LPA RNA levels were measured by quantitative real-time RTPCR. LPA RNA levels were measured using human primer-probe set hAPO(a)12kB (described in Example 2). LPA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of LPA RNA is presented in the table below as percent LPA RNA relative to the amount of LPA RNA in untreated control cells (% UTC). Each separate experiment is presented in a separate sub-table 3A, 3B, and 3C.

[0402] Table 3: Effect of oligomeric agents on LPA RNA in transgenic primary mouse hepatocytes

[0403] 3A 3B 3C

[0404] Example 4: Dose-dependent inhibition of human LPA RNA in primary human hepatocytes

[0405] Oligomeric agents consisting of GalNAc -conjugated modified oligonucleotides selected from the single-dose studies in human and transgenic mouse primary hepatocytes described in Examples 2 and 3 were tested at various doses in primary human hepatocytes.

[0406] Primary human hepatocytes (sourced from BioIVT, M0095-P, lot ZFW) plated at a density of 20,000 cells per well were treated by free uptake with various concentrations of oligomeric agent as specified in Table 4. After a treatment period of approximately 48 hours, LPA RNA levels were measured by quantitative real-time RTPCR. LPA RNA levels were measured using human primer-probe set hAPO(a)12kB (described herein above). LPA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of LPA RNA are presented in the table below as percent LPA RNA relative to the amount of LPA RNA in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of each oligomeric agent was calculated using a linear regression on a log / linear plot of the data in Excel and is also presented in the Table 4. Each separate experiment described in this example is presented in 4A and 4B.

[0407] Table 4: Dose-dependent reduction of human LPA RNA in primary human hepatocytes

[0408] 4A. 4B

[0409] Example 5: Dose-dependent inhibition human LPA in primary human hepatocytes

[0410] Oligomeric agents consisting of GalNAc -conjugated modified oligonucleotides described above were tested at various doses in primary human hepatocytes (BioIVT, Part M0095-P, lot ZFW). Primary human hepatocytes plated at a density of approximately 16,000 cells per well were treated by free uptake with various concentrations of oligomeric agent as specified in the table below. After a treatment period of approximately 72 hours, total RNA was isolated from the cells, and LPA RNA levels were measured by quantitative real-time RTPCR using human LPA primer-probe set hAPO(a)12kB (described in Example 2). LPA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of LPA RNA levels is presented Table 5 below as percent LPA RNA, relative to the amount of LPA RNA in untreated control cells (% UTC), wherein each separate experiment is presented in a separate sub-table 5A, 5B, 5C and 5D. The half maximal inhibitory concentration (IC50) of each oligomeric agent was calculated using GraphPad Prism and is also presented. In some cases, IC50 could not be reliably calculated, and such cases are denoted by “N.C.” (Not Calculated). ‘N.D.’ indicates that the %UTC value is not defined in that instance.

[0411] Table 5A: Dose-dependent inhibition of LPA RNA in primary human hepatocytes

[0412] Table 5B: Dose-dependent inhibition of LPA RNA in primary human hepatocytes

[0413] Table 5C: Dose-dependent inhibition of LPA RNA in primary human hepatocytes 1801784 | 112 | 81 | 82 | 97 | 84 | 50 | 39 | 13 | 6 | 5 | 0,01 |

[0414] Table 5D: Dose-dependent inhibition of LPA RNA in primary human hepatocytes

Claims

CLAIMS1. An oligomeric agent comprising a modified oligonucleotide consisting of 13 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises i) at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs:3-41; or ii) at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs:294-355; and wherein the modified oligonucleotide comprises at least one modified sugar moiety or sugar surrogate and / or at least one modified intemucleoside linkage.

2. The oligomeric agent of claim 1, wherein the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee, wherein all except 0, 1, or 2 modifications are identical to the sugar motif; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss wherein all except 0, 1, or 2 intemucleoside linkage modifications are identical to the intemucleoside linkage motif.

3. The oligomeric agent of claim 1, wherein the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss.

4. The oligomeric agent of claim 1, wherein the modified oligonucleotide comprises a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; eeeeeddddddddddeeeee and sssssssssssssssssss; and kkkddddddddddkkk and sssssssssssssss.

5. The oligomeric agent of claim 4, wherein the modified oligonucleotide comprises a nucleobase sequence of any one of SEQ ID NO: 3 -41 and the modified oligonucleotide comprises a modified sugar motif and a modified intemucleoside linkage motif selected from: kdkdkddddddddddkdkdk and zzzzzssssssssszzzzz; kkkddddddddddddddkkk and zzzzzssssssssszzzzz; kddkddddddddddddkddk and zzzzzssssssssszzzzz; kkddkddddddddddkddkk and zzzzzssssssssszzzzz; and eeeeeddddddddddeeeee and sssssssssssssssssss.

6. An oligomeric agent comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises i) at least 16 contiguous nucleobases of and all except 0, 1, or 2 nucleobases are identical to the nucleobase sequence of any one of SEQ ID NOs:3-41; or ii) at least 13 contiguous nucleobases of, and all except 0, 1, or 2 nucleobases are identical to the nucleobase sequence of SEQ ID NOs:294-355; wherein the modified oligonucleotide comprises at least one modified sugar moiety or sugar surrogate and / or at least one modified intemucleoside linkage; andwherein each of the sequences of the modified oligonucleotide comprises a modified sugar motif independently selected from one of kdkdkddddddddddkdkdk, kkkddddddddddddddkkk, kddkddddddddddddkddk, kkddkddddddddddkddkk, and eeeeeddddddddddeeeee; and / or a modified intemucleoside linkage motif independently selected from zzzzzssssssssszzzzz, sssssssssssssssssss, and sssssssssssssss.

7. The oligomeric agent of any one of claims 1-6, wherein the sequence of the modified oligonucleotide comprises at least 15 or at least 16 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 232-293.

8. The oligomeric agent of any one of claims 1-6, wherein the sequence of the modified oligonucleotide comprises at least 18, at least 19, or at least 20 contiguous nucleobases of any one of the sequences of SEQ ID NOs: 42-231.

9. The oligomeric agent of any one of claims 1-6, wherein the sequence of the modified oligonucleotide comprises the sequence of any one of SEQ ID NOs: 42-293.

10. The oligomeric agent of any one of claims 1-6, wherein the sequence of the modified oligonucleotide consists of the sequence of any one of SEQ ID NOs: 42-293.

11. The oligomeric agent of any one of claims 1-10, wherein the agent comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

12. The oligomeric agent of claim 11, wherein the conjugate group comprises a celltargeting moiety.

13. The oligomeric agent of claim 12, wherein the conjugate group comprises a liver cell targeting moiety.

14. The oligomeric agent of claim 13, wherein the agent comprises a conjugate moiety that binds asialoglycoprotein receptor (ASGPR).

15. The oligomeric agent of claim 14, wherein the conjugate moiety is selected from a GalNAc moiety.

16. The oligomeric agent of claim 15, wherein the GalNAc conjugate moiety is selected from Table A.

17. The oligomeric agent of claim 15, wherein the conjugate group consists of a GalNAc ligand and a conjugate linker.

18. The oligomeric agent of claim 15, wherein the GalNAc ligand has the structure:

19. The oligomeric agent of claim 15, wherein the conjugate group has the structure:or a salt thereof, wherein the conjugate linker is covalently connected to an oligonucleotide.

20. The oligomeric agent of claim 15, wherein the conjugate group has the structure:or a salt thereof, wherein the conjugate linker is covalently connected to an oligonucleotide.

21. The oligomeric agent of any one of claims 11-20, wherein the conjugate group is conjugated directly to the modified oligonucleotide.

22. The oligomeric agent of claim 21, wherein the conjugate group is conjugated to the 5’ end or 3’ end of the modified oligonucleotide.

23. The oligomeric agent of claim 22, wherein the conjugate group is attached to the 5’- terminal nucleoside of the modified oligonucleotide.

24. The oligomeric agent of claim 22, wherein the conjugate group is attached to the 3’- terminal nucleoside of the modified oligonucleotide.

25. The oligomeric agent of claim 11, wherein the conjugate linker of the conjugate group consists of a single bond.

26. The oligomeric agent of claim 11, wherein the conjugate linker of the conjugate group is cleavable.

27. The oligomeric agent of claim 11, wherein the conjugate linker comprises 1 to 3 linker- nucleosides.

28. The oligomeric agent of claim 23, wherein the conjugate group having the structure:or a salt thereof, is attached to the 5 ’-terminal nucleoside of the modified oligonucleotide.

29. The oligomeric agent of claim 24, wherein the conjugate group having the structure:or a salt thereof, is attached to the 3 ’-terminal nucleoside of the modified oligonucleotide.

30. A population of oligomeric agented of any one of claims 1-29, wherein the population is enriched for and / or modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.

31. The population of claim 30, wherein the population is enriched for and / or modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) or (Rp) configuration.

32. A pharmaceutical composition comprising the oligomeric agent of any one of claims 1- 29, or the population of any one of claims 30-31, and a pharmaceutically acceptable diluent or carrier.

33. The pharmaceutical composition of claim 32, wherein the pharmaceutically acceptable diluent is water or phosphate-buffered saline.

34. The pharmaceutical composition of claim 32, wherein the pharmaceutical composition consists essentially of the oligomeric agent and water or phosphate-buffered saline.

35. A method of decreasing the amount of LPA RNA or Lipoprotein(a) protein in a cell, tissue, organ or subject, comprising contacting the cell, tissue, organ or subject with the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34.

36. The method of claim 35, wherein the cell is a liver cell.

37. A method comprising administering to a subject the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34; wherein the subject has or is at risk for developing cardiovascular disease (CVD) coronary artery disease (CAD), hypercholesterolemia, myocardial infarction (MI), peripheral arterial disease (PAD), calcific aortic valve disease (CAVD), aortic stenosis, atherosclerotic cardiovascular disease (ASCVD), atherosclerosis, dyslipidemia, thrombosis, or stroke.

38. A method of preventing or treating a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, and / or an inflammatory disease disorder or condition in a subject, comprising administering to a subject having, or at risk of having, a cardiovascular, metabolic, and / or inflammatory disease, disorder, or condition, an oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34; wherein the disease, disorder, condition or injury is hypertriglyceridemia, lipidemia (e.g., hyperlipidemia), dyslipidemia (e.g., atherogenic dyslipidemia, diabetic dyslipidemia, or mixed dyslipidemia), hyperlipoproteinemia, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve calcification, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, restenosis, renal artery stenosis, angina, cerebrovascular atherosclerosis, cerebrovascular disease, or venous thrombosis..

39. A method of decreasing the amount of LPA RNA and / or Lipoprotein(a) protein in the liver of a subject having or at risk of developing a disease, disorder or condition associated with elevated Lp(a), comprising administering to a subject having, or at risk of having, a disease, disorder or condition associated with lipoprotein(a) metabolism misregulation, an oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34; wherein the disease, disorder, condition or injury is a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, and / or an inflammatory disease disorder or condition.

40. The method of any one of claims 35-39, wherein the amount of LPA RNA and / or lipoprotein(a) protein in liver and / or plasma of the subject is decreased.

41. The method of any one of claims 35-39, wherein the disease, disorder or condition is hypertriglyceridemia or atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

42. The method of claim 41, wherein at least one symptom of a disease, disorder or condition associated with elevated lipoprotein(a) is episodes of abdominal pain, physical fatigue, difficulty thinking, diarrhea, recurrent acute pancreatitis, eruptive cutaneous xanthomata, and hepatosplenomegaly or a combination thereof.

43. The method of any one or claims 35-39, wherein the method prevents or protects against progression of atherosclerotic cardiovascular disease (ASCVD) or coronary artery disease (CAD).

44. The method of any one of claims 129-143, wherein administering of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 improves hypertriglyceridemia, hyperlipidemia, dyslipidemia hyperlipoproteinemia abdominal pain, physical fatigue, difficulty thinking, diarrhea, acute pancreatitis, eruptive xanthomas, lipemia retinalis, or hepatosplenomegaly, or a combination of two or more of the foregoing in the subject.

45. The method of any one of claims 35-39, wherein administering of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 is parenteral.

46. The method of any one of claims 35-39, wherein administering of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 is subcutaneous.

47. The method of any one of claims 35-39, wherein administering of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 is co-administering with a second agent.

48. The method of any one of claim 47, wherein administering of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 and the agent are administered concomitantly.

49. Use of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 for treating or preventing a disease, disorder or condition associated with lipoprotein metabolism misregulation or postponing a symptom of a disease, disorder or condition associated with elevated lipoprotein(a).

50. Use of the oligomeric agent of any one of claims 1-29, the population of any one of claims 30-31, or the pharmaceutical composition of any one of claims 32-34 in the manufacture of a medicament for treating or preventing a cardiovascular disease, disorder, condition, a metabolic disease, disorder, or condition, or an inflammatory disease disorder or condition.

Images