Expression method for CSTN3 protein, recombinant expression vector, and recombinant HEK293f cell

Abstract

Disclosed is an expression method for CSTN3 protein, comprising: providing a humanized CSTN3 extracellular segment full-length gene as a target gene; linking the target gene to a mammalian cell secretory expression vector, so as to construct a recombinant expression vector containing the target gene; instantaneously transfecting a mammalian cell with the recombinant expression vector by means of mediation with a transfection reagent; and culturing the transfected mammalian cell. The method is characterized in that the recombinant CSTN3 protein can be obtained simply by collecting a cell supernatant and then performing affinity separation by means of a nickel column without the need of cell disruption. Also disclosed are a recombinant expression vector containing the humanized CSTN3 extracellular segment full-length gene and a recombinant HEK293F cell containing the mammalian cell secretory expression vector containing the humanized CSTN3 extracellular segment full-length gene. The present application achieves rapid, stable and efficient expression of the target protein CSTN3 and achieves a high level of protein folding expression and stable quality. In addition, the culture process only needs using a small amount of a serum-free culture medium, thereby achieving a low cost.

Description

A CSTN3 protein expression method, recombinant expression vector and recombinant HEK293F cells Technical Field

[0001] The present application relates to a method for expressing CSTN3 protein, and belongs to the field of biochemical technology. Background Art

[0002] Protein expression is an essential technical tool for research in areas such as antibody production, cell biology, molecular biology, structural biology, and immunology. Expressing large quantities of proteins and testing their functionality is the most direct way to study their function. Studying and elucidating protein structure is a crucial step in antibody production and drug target design. Analyzing the functions of key proteins in immunobiology plays a crucial role in understanding disease pathogenesis and developing targeted drugs.

[0003] The calsyntenin (CSTN) family of proteins is an evolutionarily conserved family of proteins that plays a crucial role in memory and learning. They participate in the cleavage of amyloid precursor protein (APP) to produce Aβ peptides, which regulate the development and progression of Alzheimer's disease. CSTN3 is a synaptic organizing protein essential for the development of neuronal synapses. Subcellular localization studies have shown that this protein is localized to the postsynaptic membrane, but it also plays a role in the differentiation of the presynaptic membrane. CSTN3 is cleaved by proteases in vivo, and its primary function is carried out by its extracellular domain. This extracellular domain consists of two cadherin domains, an LNS domain (Laminin, Neurexin, Sex hormone-binding globulin), and an α-helical / β-pleated sheet domain.

[0004] In the existing technology, CSTN3 protein is mainly obtained through prokaryotic expression or transient small-scale expression in 293T adherent cells. However, these methods have defects such as low expression, long time consumption, and relatively long time consumption for 293S stable transformation cells. In addition, there are reports on the use of insect expression systems to express human CSTN3 protein. This method involves transferring the expression component to a baculovirus shuttle vector propagated in Escherichia coli, and then transfecting the shuttle plasmid into insect cells to obtain progeny virus, collecting the recombinant progeny virus supernatant to infect insect cells, and then obtaining the expressed recombinant human CSTN3 protein. However, this method requires a large amount of screening, the operation is cumbersome, and it takes a long time. Technical issues

[0005] The first purpose of the present application is to provide a method for expressing CSTN3 protein, so as to overcome the problem that the expression of CSTN3 protein in the prior art is complicated and time-consuming. Technical Solutions

[0006] To achieve the aforementioned invention objectives, the technical solutions adopted in this application include:

[0007] A method for expressing CSTN3 protein is provided, characterized by comprising the following steps:

[0008] S1. Provide the full-length extracellular segment of human CSTN3 as the target gene;

[0009] S2. Connecting the target gene to a mammalian cell secretory expression vector to construct a recombinant expression vector containing the target gene;

[0010] S3, transiently transfecting the recombinant expression vector into mammalian cells through a transfection reagent, and continuing to culture the transfected mammalian cells in a culture medium;

[0011] S4. Isolate the culture medium obtained in step S3 to obtain recombinant CSTN3 protein.

[0012] Furthermore, the mammalian cell secretory expression vector includes one of the pSecTag2B vector, the pSecTag2A vector, and the pSecTag2C vector.

[0013] Furthermore, the mammalian cell secretory expression vector includes the pSecTag2B vector.

[0014] The pSecTag2B vector enables high-level, stable transient expression in mammalian hosts. The expressed protein is fused to the N-terminus with an Igκ chain leader sequence for protein secretion. The C-terminal sequence contains the c-myc epitope and six tandem histidine residues, making it suitable for detection and purification. Its Zeocin™ resistance gene allows for stable expression and screening in Escherichia coli and mammalian cells in the presence of the antibiotic Zeocin™.

[0015] Furthermore, mammalian cells include human embryonic kidney HEK293F suspension cells.

[0016] HEK293F suspension cells are permanent cell lines established from primary human embryos. They are kidney cells transformed with sheared human adenovirus type 5 DNA. The E1A adenovirus gene expressed in these cells participates in the transactivation of some viral promoters, resulting in very high protein levels produced by these cells.

[0017] Furthermore, the transfection reagent in step S3 includes polyethyleneimine and Lipofectamine 2000.

[0018] Polyethyleneimine (PEI) is a highly charged cationic polymer. Its positive charge readily adsorbs negatively charged nucleic acid molecules to form complexes that enter cells. It can be used as a transient transfection reagent with low cytotoxicity and high transfection efficiency, with high gene expression efficiency in HEK293 cells. Lipofectamine 2000 introduces exogenous DNA or RNA into cells through liposome-mediated transfection.

[0019] Furthermore, step S3 specifically includes: culturing mammalian cells in a culture medium, and mixing the recombinant expression vector of the target gene with a transfection reagent, and when the cell density OD value in the culture medium is 1.5-2.5, adding the obtained recombinant expression vector of the target gene and the transfection reagent mixture to the culture medium; continuing to culture to express the recombinant CSTN3 protein.

[0020] Furthermore, the culture medium used in step S3 includes SMM serum-free culture medium.

[0021] Furthermore, step S4 specifically includes: after completing the cell culture, collecting the supernatant of the culture medium, purifying it with Ni-NTA agarose beads and imidazole elution buffer, then concentrating it, and then separating and purifying the CSTN3 protein by gel filtration chromatography.

[0022] Furthermore, the imidazole elution buffer contains 10-35 mM Hepes 7.5 buffer, 100-350 mM sodium chloride, 0.5-3.5 mM dithiothreitol and 100-500 mM imidazole.

[0023] Furthermore, the chromatography eluent used in the gel filtration chromatography comprises 10-35 mM Hepes 7.5 buffer, 100-350 mM sodium chloride and 0.5-3.5 mM dithiothreitol.

[0024] The second objective of the present application is to provide a recombinant expression vector containing the full-length gene of the extracellular segment of human CSTN3.

[0025] Furthermore, the recombinant expression vector includes one of the mammalian cell secretory expression vectors pSecTag2B vector, pSecTag2A vector, and pSecTag2C vector.

[0026] A third objective of the present application is to provide recombinant HEK293F cells, obtained by transfecting HEK293F cells with a mammalian cell secretory expression vector containing a target gene; the target gene is a full-length human CSTN3 extracellular segment gene, and the mammalian cell secretory expression vector includes one of the pSecTag2B vector, the pSecTag2A vector, and the pSecTag2C vector. Beneficial effects

[0027] Compared with the existing technology, this application utilizes a mammalian cell secretory expression vector and a transfection reagent for transient transfection, and realizes the rapid, stable and efficient expression of recombinant CSTN3 protein based on the mammalian cell expression system, which can fully meet the needs of large-scale expression of immune proteins containing transmembrane domains in eukaryotic proteins. The protein expression yield is large and the quality is stable. The expressed protein is close to the natural protein. Only a small amount of serum-free culture medium is needed during the cell culture process, which is low in cost. In addition, by using an optimized selective purification method, high-purity and relatively high-uniformity recombinant CSTN3 protein can be quickly obtained, and the operation is simple. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG1 is a nucleic acid electrophoresis pattern of the amplified DNA fragment of the target protein in the embodiment of the present application.

[0029] FIG2 is a Superdex6 column gel filtration chromatography analysis graph of the target protein in the examples of the present application.

[0030] FIG3 is a Coomassie brilliant blue staining detection pattern of the SDS-PAGE analysis chromatography column elution peak sample in the embodiment of the present application. Modes for Carrying Out the Invention

[0031] The present application is further described below with reference to the embodiments, but is not limited thereto.

[0032] Unless otherwise specified, the experimental methods in the following examples were conventional methods or performed according to the kit instructions. Materials and reagents used in the following examples were commercially available unless otherwise specified. Primer synthesis and sequencing were performed by Shanghai Bioengineering Co., Ltd.

[0033] Example 1:

[0034] This example provides a method for expressing human CSTN3 protein using a mammalian expression system based on the secretion vector pSecTag2B. This example uses the pSecTag2B vector as the base vector and specifically selects the Bwi36I and NotI double restriction sites as the multiple cloning site for ligating the exogenous gene. The main steps include:

[0035] Cloning of S1 and CSTN3 protein genes (i.e., target genes)

[0036] The full-length extracellular segment of CSTN3 (NP_055533.2) (amino acids 20-847) was obtained from human cDNA by PCR. The upstream primer sequence was GCCGGCCAGGCGCGCGCGCCGTACGAACAAAGCCAACAAGCACAAG, and the downstream primer sequence was GTTTTTGTTCGGGCCCTCCTCGAGCGGCCGCGGCGCTGGGTATCATGGAGT.

[0037] 1W / V% (mass volume percentage) agarose gel electrophoresis detection is shown in Figure 1.

[0038] S2. Construction of pSecTag2B vector containing target gene

[0039] The double enzyme digestion system of NEB was used to perform double enzyme digestion on the PCR product obtained in step S1 and the pSecTag2B vector (purchased from Shanghai Borsen Company) at the same time. The double enzyme digestion sites were Bwi36I and NotI. o Then, the double-digested products were ligated with T4 ligase from NEB and the reaction was continued at 16 o The ligation was carried out at 47°C for 12 h, and the specific operation was carried out according to the operating instructions of the ligation kit. Finally, the ligation product was used to transform Escherichia coli DH5α competent cells for plasmid amplification.

[0040] S3. Construction and culture of recombinant HEK293F cells with high CSTN3 expression

[0041] 293F cells were transiently transfected with the pSecTag2B vector containing the target gene prepared in step 2) using polyethyleneimine (PEI) as the transformation reagent. Specifically, 293F cells were cultured in culture medium and the target gene DNA plasmid was mixed with PEI at a 1:1 mass ratio (100 μg:100 μl) at room temperature for 20 minutes. When the cell density in 100 ml of 293F cell culture medium reached an OD value of 1.5-2.5, the target gene DNA-PEI mixture was added to the 293F cell culture medium. The transfected cells were cultured in serum-free SMM medium for 5 days to obtain recombinant HEK293F cells expressing the recombinant CSTN3 protein (referred to as the target protein). Using this method, 5 mg of the target protein can be obtained from 200 ml of cells.

[0042] S4. Isolation and purification of target protein

[0043] After 5 days of culture in step 3), the recombinant HEK293F cells were cultured at 4 oThe supernatant was collected by centrifugation at 12,000 rpm under 4°C conditions and purified using Ni-NTA agarose beads. The protein was then eluted using imidazole elution buffer (containing 10-35 mM Hepes, 100-350 mM sodium chloride, 0.5-3.5 mM dithiothreitol, and 100-500 mM imidazole). The eluted protein was concentrated using a sample concentrator (GE Healthcare Vivaspin) and separated from contaminating proteins by gel filtration chromatography using a Superose 6 column. The target protein was then eluted using chromatography elution buffer (containing 10-35 mM Hepes 7.5 buffer, 100-350 mM sodium chloride, and 0.5-3.5 mM dithiothreitol). The target protein sample was analyzed. As shown in Figure 2, the protein eluted in a single peak.

[0044] The molecular weight of the recombinant CSTN3 protein was determined by SDS-PAGE, revealing an actual molecular weight of approximately 120 kDa. A search on the Uniprot website indicated a theoretical molecular weight of 104 kDa. It is speculated that the recombinant CSTN3 protein may have undergone glycosylation during expression in HEK293F cells, as shown in Figure 3.

[0045] The purity of the samples was tested by SDS-PAGE, and it was found that the total amount of the purified target protein was 5 mg and the purity reached 90%. At the same time, a microspectrophotometer (Thermo Scientific NanoDrop) was used to detect the absorbance of the sample at 280 nm to determine the protein concentration.

[0046] Although the present application has been described with reference to illustrative embodiments, it will be understood by those skilled in the art that various other changes, omissions, and / or additions may be made and that substantial equivalents may be substituted for elements of the described embodiments without departing from the spirit and scope of the present application. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the present application without departing from the scope of the present application. Therefore, it is not intended that the present application be limited to the particular embodiments disclosed for carrying out the present application, but rather that the present application will encompass all embodiments falling within the scope of the appended claims.

Claims

1. A method for expressing CSTN3 protein, characterized in that: The steps include: S1. Provide the full-length extracellular segment of human CSTN3 gene as the target gene; S2, connecting the target gene to a mammalian cell secretory expression vector, thereby constructing a recombinant expression vector containing the target gene; S3, transiently transfecting the recombinant expression vector into mammalian cells through the mediation of a transfection reagent, and continuing to culture the transfected mammalian cells in a culture medium; S4. Separate the culture medium obtained in step S3 to obtain recombinant CSTN3 protein.

2. The method for expressing CSTN3 protein according to claim 1, characterized in that: The mammalian cell secretory expression vector includes one of a pSecTag2B vector, a pSecTag2A vector, and a pSecTag2C vector.

3. The method for expressing CSTN3 protein according to claim 1, characterized in that: The mammalian cells include human embryonic kidney HEK293F suspension cells.

4. The method for expressing CSTN3 protein according to claim 1, characterized in that: The transfection reagent in step S3 includes polyethyleneimine and Lipofectamine 2000.

5. The method for expressing CSTN3 protein according to claim 1, characterized in that: Step S3 specifically includes: culturing mammalian cells in a culture medium, and mixing the recombinant expression vector of the target gene with a transfection reagent, and when the cell density OD value in the culture medium is 1.5-2.5, adding the obtained mixture of the recombinant expression vector of the target gene and the transfection reagent to the culture medium; continuing to culture to express the recombinant CSTN3 protein.

6. The method for expressing CSTN3 protein according to claim 5, characterized in that: The culture medium used included SMM serum-free medium.

7. The method for expressing CSTN3 protein according to claim 1, characterized in that: Step S4 specifically includes: after the cell culture is completed, the supernatant of the culture medium is collected, purified using Ni-NTA agarose beads and imidazole elution buffer, then concentrated, and then separated and purified by gel filtration chromatography.

8. A recombinant expression vector, characterized in that: The recombinant expression vector contains the full-length gene of the extracellular segment of human CSTN3.

9. The recombinant expression vector according to claim 8, characterized in that: The recombinant expression vector comprises one of the mammalian cell secretory expression vectors pSecTag2B, pSecTag2A and pSecTag2C.

10. A recombinant HEK293F cell, characterized in that: The cells are obtained by transfecting HEK293F cells with a mammalian cell secretory expression vector containing a target gene; the target gene is a full-length gene of the extracellular segment of human CSTN3; the mammalian cell secretory expression vector includes one of a pSecTag2B vector, a pSecTag2A vector, and a pSecTag2C vector.

Images