Multi-next tag for increasing soluble expression of target protein, and use thereof

Abstract

The present invention relates to a multi-NEXT tag for increasing the soluble expression of a target protein, and use thereof. The fusion tag in which NEXT tag sequences are repeatedly linked, according to the present invention, is small, thereby having the excellent effect of increasing the soluble expression level of a target protein without affecting the function of the target protein, and thus the fusion tag of the present invention can be used as a fundamental component of a vector system for the expression of recombinant proteins of pharmaceutical, industrial, and research uses and the like.

Description

Multiple NEXT tags and their uses for increasing soluble expression of target proteins

[0001] The present invention relates to multiple NEXT tags and their uses for increasing the soluble expression of a target protein. This invention was carried out with the support of the Individual Basic Research Program (2021R1F1A1057310), the Group Research Support Program (2021R1A5A8029490), and the Biomedical Technology Development Program (00235511) through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT.

[0002] As genetic recombination technology has developed, many useful target proteins are being produced using animal cells, eukaryotes such as yeast, and prokaryotes such as Escherichia coli, and the produced recombinant proteins are widely used in biotechnology industries such as pharmaceuticals.

[0003] In particular, Escherichia coli is widely used as a host cell for producing target proteins in genetic recombination technology because its cell growth rate is rapid and its genes are well-studied compared to other organisms. However, when using E. coli as a host cell, the protein to be produced is often degraded by proteases within E. coli, resulting in low yields. This tendency is known to be particularly severe when expressing small-sized polypeptides with a molecular weight of 10 kDa or less. If a recombinant protein is overexpressed in E. coli, it can accumulate in the cytoplasm in the form of insoluble aggregates. To make such a protein active, a denaturant such as high concentrations of urea or guanidine hydrochloride must be used to dissolve the aggregates and release them into their primary structure. The reagents used above must then be removed to allow the released protein to refold accurately. However, the refolding conditions are different for each protein, and it takes a lot of time and money to find efficient refolding conditions, and in many cases, refolding itself is impossible.

[0004] The most efficient way to produce recombinant proteins is to overexpress them in detectable quantities while maintaining high solubility. To increase recombinant protein expression efficiency, various engineering approaches have been attempted at the vector, host, and open reading frame (ORF) levels. Vectors consist of transcription, translation, and replication factors, each of which has multiple variants. Recently, novel regulatory factors have been discovered in addition to these classic elements, leading to diverse combinatorial approaches to increase expression efficiency. In this process, vectors equipped with functional tags that aid protein folding or recovery can be used to increase protein solubility or facilitate purification. The use of tags is not only the most common and simplest approach, but also widely adopted due to its non-interfering nature and minimal impact on recombinant protein function.

[0005] Meanwhile, Korean Patent No. 2021-0034527 discloses 'a tag protein for increasing the water solubility and thermostability of a target protein and a fusion protein comprising the same' including an Oct-1 protein, and Korean Patent No. 2106773 discloses 'a fusion tag for increasing the water solubility and expression amount of a target protein and its use' including a PLX1DLGX2E domain present at the N-terminus of α-carbonic anhydrase derived from Hydrogenovibrio marinus, H. crunogenus or H. kuenenii, but there is no description of a multiple NEXT tag for increasing the water solubility expression of a target protein and its use.

[0006] The present invention was derived from the above-mentioned needs, and the inventors of the present invention have developed a single NEXT tag (NEXT) consisting of 53 amino acids derived from the N-terminus of α-carbonic anhydrase derived from Hydrogenovibrio marinus. ×1 ; Korean Patent No. 2106773) is double (NEXT ×2 ) or triple (NEXT ×3 ) were repeatedly connected to produce a 'multiple NEXT tag'. In addition, by transforming an E. coli strain with a recombinant vector including the 'multiple NEXT tag' coding sequence and the target protein coding sequence sequentially connected thereto, and expressing the recombinant protein, it was confirmed that the soluble expression amount of the recombinant protein obtained by transforming with the recombinant vector including the multiple NEXT tag coding sequence was significantly increased compared to the recombinant protein obtained by transforming with the recombinant vector including the single NEXT tag coding sequence, thereby completing the present invention.

[0007] To solve the above problem, the present invention provides a fusion tag comprising two or more repetitions of the amino acid sequence of sequence number 1.

[0008] Additionally, the present invention provides a polynucleotide encoding the fusion tag.

[0009] In addition, the present invention provides a recombinant vector characterized in that a polynucleotide encoding the fusion tag and a gene encoding a target protein are sequentially linked.

[0010] In addition, the present invention provides a host cell transformed with the recombinant vector.

[0011] In addition, the present invention provides a method for producing a target protein with increased soluble expression in a host cell, comprising the steps of transforming a host cell with the recombinant vector; and culturing the transformed host cell to express the target protein.

[0012] In addition, the present invention provides a composition for producing a target protein with increased water-soluble expression, which comprises, as an active ingredient, a recombinant vector in which a polynucleotide encoding the fusion tag and a gene encoding the target protein are sequentially linked.

[0013] The fusion tag in which the NEXT tag sequence according to the present invention is repeatedly connected is small in size and has an excellent effect of increasing the soluble expression amount of the target protein without affecting the function of the target protein. Therefore, the fusion tag of the present invention can be utilized as a basic component of a vector system for expressing recombinant proteins for pharmaceutical, industrial, and research purposes.

[0014] Figure 1 shows β-carbonic anhydrase (β-taCA) from Thermovibrio ammonificans, β-taCA with a single NEXT tag, NEXT ×2 or NEXT ×3 Tagged fusion protein (NEXT-β-taCA, NEXT ×2 -β-taCA or NEXT ×3 The Coomassie blue stained gel photo (a) confirming the expression level of -β-taCA, the InVision His-tag In-Gel stained gel photo (b), and the graph quantifying the bands of the In-Gel stained gel (c).

[0015] Figure 2 shows a single NEXT tag for tobacco etch virus protease (TEVP), TEVP, and NEXT ×2 or NEXT ×3 Fusion proteins with tags (NEXT-TEVP, NEXT ×2 -TEVP or NEXT ×3 -TEVP) expression level confirmed Coomassie blue stained gel photo (a), InVision His-tag In-Gel stained gel photo (b), and graph (c) quantifying the bands of the In-Gel stained gel.

[0016] Figure 3 shows a single NEXT tag, NEXT, for Firefly luciferase (Luc). ×2 or NEXT ×3 Fusion proteins with tags (NEXT-Luc, NEXT ×2 -Luc or NEXT ×3 -Luc) is a Coomassie blue stained gel photograph (a), an InVision His-tag In-Gel stained gel photograph (b), and a graph (c) quantifying the bands of the In-Gel stained gel.

[0017] In order to achieve the purpose of the present invention, the present invention provides a fusion tag comprising two or more repetitions of the amino acid sequence of sequence number 1.

[0018] In the present invention, the amino acid sequence of sequence number 1 is a single NEXT tag consisting of 53 amino acids derived from the N-terminus of α-carbonic anhydrase derived from Hydrogenovibrio marinus (see Korean Patent No. 2106773).

[0019] In the fusion tag of the present invention, the two or more repetitions may be any one of two to five repetitions, preferably two or three repetitions, but is not limited thereto.

[0020] In the fusion tag of the present invention, the amino acid sequence of the sequence number 1 is repeated twice (NEXT ×2 ) or 3 repetitions (NEXT ×3 ) The fusion tag may be composed of an amino acid sequence of sequence number 2 or 3, but is not limited thereto.

[0021] The scope of the fusion tag according to the present invention includes a tag having an amino acid sequence represented by SEQ ID NO: 2 or 3 and functional equivalents thereof. As used herein, the term "functional equivalent" refers to a tag that has at least 60%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence represented by SEQ ID NO: 2 or 3 as a result of addition, substitution, or deletion of amino acids, and exhibits substantially the same physiological activity as the tag represented by SEQ ID NO: 2 or 3. "Substantially the same physiological activity" refers to an activity that increases the soluble expression amount of a target protein.

[0022] In the fusion tag of the present invention, the fusion tag may additionally include a (GGGGS)2 linker sequence at the C-terminus, but is not limited thereto. The (GGGGS)2 linker may be composed of the amino acid sequence of SEQ ID NO: 13, and the polynucleotide encoding the (GGGGS)2 linker may include the base sequence of SEQ ID NO: 14, but is not limited thereto.

[0023] The present invention also provides a polynucleotide encoding a fusion tag comprising the amino acid sequence of SEQ ID NO: 2 or 3.

[0024] The polynucleotide of the present invention may be DNA or RNA encoding the fusion tag. The DNA may include cDNA, genomic DNA, or artificially synthesized DNA, and the DNA may be single-stranded or double-stranded.

[0025] Preferably, the polynucleotide of the present invention may include a base sequence represented by SEQ ID NO: 5 or 6. The base sequence of SEQ ID NO: 5 or 6 of the present invention is a polynucleotide encoding a fusion tag consisting of an amino acid sequence of SEQ ID NO: 2 or 3, respectively.

[0026] The present invention also provides a recombinant vector characterized in that a polynucleotide encoding a fusion tag consisting of the amino acid sequence of SEQ ID NO: 2 or 3 and a gene encoding a target protein are sequentially linked.

[0027] In the present invention, the fusion tag consisting of the amino acid sequence of sequence number 2 or 3 and the polynucleotide encoding the same are as described above.

[0028] The recombinant vector according to the present invention may be a polynucleotide encoding a fusion tag consisting of any one of the amino acid sequences of SEQ ID NO: 2 or 3, and a gene encoding a target protein, which are operably linked. As used herein, the term "operably linked" means that one nucleic acid fragment is combined with another nucleic acid fragment such that its function or expression is influenced by the other nucleic acid fragment. That is, the gene encoding the target protein may be linked so that its expression can be controlled by a promoter within the vector.

[0029] In this specification, the term "target protein" refers to any protein that a person skilled in the art wishes to mass-produce, and which can be expressed in a transformant by inserting a polynucleotide encoding the target protein into a recombinant expression vector.

[0030] In the recombinant vector of the present invention, the target protein may be a variety of proteins having biological activity selected from the group consisting of medical, research and industrial proteins, for example, enzymes, antigens, antibodies, cell receptors, structural proteins, serum and cell proteins, and may preferably be an enzyme protein, but is not limited thereto.

[0031] In the recombinant vector of the present invention, the target protein may additionally include a 6XHis sequence at the C-terminus, but is not limited thereto.

[0032] As used herein, the term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0033] In the present invention, the polynucleotide encoding the fusion tag and the gene sequence encoding the target protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid or vector can be used as long as it can replicate and stabilize in a host. Important characteristics of the expression vector include having an origin of replication, a promoter, a marker gene, and a translation control element.

[0034] An expression vector comprising a polynucleotide encoding the fusion tag of the present invention, a gene sequence encoding the target protein, and appropriate transcription / translation control signals can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to an appropriate promoter within the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

[0035] In the present invention, the multiple NEXT tag having the amino acid sequence of sequence number 1 repeated 2 or 3 times has a superior effect of increasing the soluble expression amount of the target protein compared to a single NEXT tag.

[0036] The present invention also provides a host cell transformed with the recombinant vector.

[0037] Any host cell known in the art can be used as a host cell capable of stably and continuously cloning and expressing the vector of the present invention in a prokaryotic cell, and examples thereof include Bacillus strains such as E. coliBL21, E. coliJM109, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, Bacillus subtilis, Bacillus thuringiensis, and enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

[0038] In addition, when transforming the vector of the present invention into a eukaryotic cell, yeast (e.g., Saccharomyce cerevisiae; Pichia pastoris; Kluyveromyces lactis; Kluyveromyces marxianus; Yarrowia lipolytica; Hansenula polymorpha, etc.) and insect cells (e.g., Spodoptera frugiperda Sf9, Sf21, High Five) may be used as host cells. TM ), animal cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK cell lines), and plant cells can be used.

[0039] The host cell transformed with the recombinant vector according to one embodiment of the present invention may be, but is not limited to, E. coli, preferably E. coliBL21(DE3).

[0040] The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl2 method, the Hanahan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580), and the electroporation method, if the host cell is a prokaryotic cell. In addition, if the host cell is a eukaryotic cell, the vector can be injected into the host cell by the microinjection method, the calcium phosphate precipitation method, the electroporation method, the liposome-mediated transfection method, the DEAE-dextran treatment method, and the gene bombardment method.

[0041] The present invention also provides:

[0042] A step of transforming a host cell with the above recombinant vector; and

[0043] A method for producing a target protein with increased soluble expression in a host cell is provided, comprising a step of culturing the transformed host cell to express the target protein.

[0044] In the method for producing the target protein of the present invention, the transformed host cell can be cultured in a medium suitable for producing the target protein using known techniques. Suitable culture media can be commercially available or prepared according to the ingredients and composition ratios described in publications such as the catalog of the American Type Culture Collection, but are not limited thereto.

[0045] The method for producing a target protein of the present invention may further include a step of isolating and purifying the target protein from a host cell expressing the target protein. The separation method may be, but is not limited to, separation from the medium by conventional methods including, for example, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. Furthermore, the separated protein may be purified by various known methods including chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), dialysis, electrophoresis, differential solubilization (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction.

[0046] The present invention also provides a composition for producing a target protein with increased water-soluble expression, comprising as an active ingredient a recombinant vector in which a polynucleotide encoding a fusion tag consisting of the amino acid sequence of SEQ ID NO: 2 or 3 and a gene encoding the target protein are sequentially linked.

[0047] The composition of the present invention comprises, as an active ingredient, a polynucleotide encoding a fusion tag capable of increasing the soluble expression amount of a target protein to be fused, thereby enabling production of a target protein with increased soluble expression amount.

[0048]

[0049] Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0050]

[0051] Materials and Methods

[0052] 1. Strains and culture conditions

[0053] For the production of genetic recombinant plasmid vectors, E. coli TOP10 strain was used, and for protein expression, E. coli BL21 (DE3) strain was used. E. coli was cultured in LB (Luria-Bertani) medium at 37°C and 180 rpm, and 50 ㎍ / ㎖ ampicillin was added during culture as needed.

[0054]

[0055] 2. Creating an expression vector

[0056] NEXT, which is a single NEXT tag sequence consisting of 53 amino acids derived from the N-terminus of α-carbonic anhydrase from Hydrogenovibrio marinus, repeated twice. ×2 To produce a tag, the NEXT tag coding sequence was PCR amplified using the primer sets of SEQ ID NOs. 7 and 10 in Table 1 using the previously constructed pET-NEXT-taCA vector (see Korean Patent No. 2106773) as a template, and this was ligated to the NEXT tag coding sequence amplified using the primer sets of SEQ ID NOs. 8 and 9 in Table 1 using the BamHI-BglⅡ restriction enzyme ligation method.

[0057] Additionally, the sequence of a single NEXT tag is repeated three times and linked to the NEXT ×3To produce the tags, the NEXT tag coding sequences were amplified using primer sets of SEQ ID NOs: 7 and 10, 9 and 10, and 8 and 9 in Table 1, respectively, and these were ligated using the BamHI-BglⅡ restriction enzyme ligation method. The multiple NEXT tags, like the single NEXT tags, have NdeI and NcoI restriction enzyme sequences at both ends.

[0058] The multiple NEXT tags of the present invention can add a restriction enzyme site sequence when inserted into a recombinant vector, and a (GGGGS)2 linker sequence can be added to the C-terminus of the tag. The sequences of the single NEXT tag and the multiple NEXT tag with the restriction enzyme site sequence and (GGGGS)2 linker sequence added as described above are shown in Table 2 below. In addition, all expressed proteins have a His6 tag sequence at the C-terminus.

[0059] Primer sequence information for cloning Name Sequence (5'-3') (SEQ ID NO) NEXT-tag F:CATATGGCTGTTCAACATAGCAATGCCCC (7) R:CCATGGAGCCTCCAC (8) NEXT-tag-tandem repeat F:AGATCTGCTGTTCAACATAGCAATGC (9) R:GGATCCCACAACGGGTTTTGGTTTAG (10) TEVPF:CCATGGGAGAAAGCTTGTTTAAGGGAC (11) R:CTCGAGTTGCGAGTACA (12)

[0060] Underline: Restriction enzyme location.

[0061] Sequence information of single NEXT tag and multiple NEXT tags NEXTProtein sequence MAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGGGGSGGGGSMGene sequence CATATGGCTGTTCAACATAGCAATGCCCCATTGATTGACTTGGGCGCGGAAATGAAAAAACAGCACAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGGCTCAAGGTAAGGCACCTGCCGCGGAAGCCAAAAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGNEXT ×2 Protein sequence MAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGSAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGGGGSGGGGSMgene SequenceCATATGGCTGTTCAACATAGCAATGCCCCATTGATTGACTTGGGCGCGGAAATGAAAAAACAGCACAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGGCTCAAGGTAAGGCACCTGCCGCGGAAGCCAAAAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGATCTGCTGTTCAACAT AGCAATGCCCCATTGATTGACTTGGGCGCGGAAATGAAAAAACAGCACAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGGCTCAAGGTAAGGCACCTGCCGCGGAAGCCAAAAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGNEXT ×3Protein sequenceMAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGSAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGSAVQHSNAPLIDLGAEMKKQHKEAAPEGAAPAQGKAPAAEAKKEEAPKPKPVVGGGGSGGGGSMgene SequenceCATATGGCTTGTTCAACATAGCAATGCCCCATTGATTGACTTGGGCGCGGAAATGAAAAAACAGCACAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGGCTCAAGGTAAGGCACCTGCCGCGGAAGCCAA AAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGATCTGCTGTTCAACATAGCAATGCCCCATTGATTGACTTGGGGCGCGGAAATGAAAAAACAGCACAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGG CTCAAGGTAAGGCACCTGCCGCGGAAGCCAAAAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGATCTGCTGTTCAACATAGCAATGCCCCATTGATTGACTTGGGCGCGGAAATGAAAAAACAGCA CAAGGAGGCAGCTCCCGAAGGCGCTGCGCCGGCTCAAGGTAAGGCACCTGCCGCGGAAGCCAAAAAAGAAGAAGCACCTAAACCAAAACCCGTTGTGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGG

[0062] Underline: Restriction enzyme location.

[0063] Italics: (GGGGS)2 linker sequence.

[0064] Bold and underlined: Connection site of multiple NEXT tags (BamHⅡ-BglⅡ).

[0065]

[0066] Next, for the expression of β-carbonic anhydrase (β-taCA) derived from Thermovibrio ammonificans, which is one of the target proteins, the previously constructed pET-βtaCA vector (see Patent Application No. 2022-0041638) was used. In order to construct an expression vector of β-taCA linked to a single NEXT tag and multiple NEXT tags, the PVY tag derived from the amorphous sequence present at the N-terminus of PVY (Potato Virus Y) coat protein was removed from the previously constructed pET-PVY-βtaCA (Patent Application No. 2023-0051136) using the NdeI and NcoI restriction enzyme sequences, and then a single NEXT tag or multiple NEXT tags were inserted at the same restriction enzyme sequence position. Through this, pET-NEXT-βtaCA, pET-NEXT ×2 -βtaCA and pET-NEXT ×3 -βtaCA was constructed.

[0067] In addition, for the expression of Firefly luciferase (Luc), the luciferase coding gene, which was previously synthesized and inserted into the pUC vector, was introduced into the pET-22b(+) vector using the NdeI and XhoI restriction enzyme sequences to construct pET-luciferase. For the expression of luciferase linked to a single NEXT tag, the previously constructed pET-NEXT-luciferase (refer to Korean Patent Registration No. 2106773) was used. For the expression of luciferase linked to multiple NEXT tags, the NEXT tag was removed from pET-NEXT-luciferase using the NdeI and NcoI restriction enzyme sequences, and then multiple NEXT tags were inserted into the same restriction enzyme sequence positions to construct pET-NEXT. ×2 -luciferase and pET-NEXT ×3 -luciferase was constructed.

[0068] In addition, for the expression of tobacco etch virus protease (TEVP), the TEVP gene, which was previously synthesized and inserted into the pUC vector, was introduced into the pET-22b(+) vector using the NdeI and XhoI restriction enzyme sequences to construct pET-TEVP. For the expression of TEVP linked to a single NEXT tag or multiple NEXT tags, the TEVP gene was amplified using the primer sets of SEQ ID NOs. 11 and 12 in Table 1, and this was treated with NcoI and XhoI restriction enzymes to generate pET-NEXT-luciferase and pET-NEXT, which were treated with the same restriction enzymes. ×2 -luciferase, pET-NEXT ×3 -Inserted into luciferase, pET-NEXT-TEVP, pET-NEXT ×2 -TEVP, pET-NEXT ×3 -TEVP was constructed. All expressed proteins used in the present invention have a His6 tag sequence at the C-terminus.

[0069]

[0070] 3. Protein expression and cell fractionation

[0071] The expression vector was introduced into the E. coli BL21 (DE3) strain. The recombinant strain was cultured in LB medium supplemented with 50 μg / ml ampicillin at 37°C and 180 rpm. OD 600When the value reached 0.6–0.8, 1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) was added, and the cells were cultured for an additional 12 hours under the same conditions. After culture, the cells were harvested by centrifugation at 4,000 g for 10 minutes at 4°C and resuspended in lysis buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). The resuspended cells were disrupted by sonication, and the cell homogenate was centrifuged at 4°C and 10,000 g for 10 minutes. The supernatant was designated as the soluble fraction (S), and the precipitated pellet was resuspended in the same volume of lysis buffer and designated as the insoluble fraction (IS).

[0072]

[0073] 4. Protein expression analysis

[0074] Protein expression was analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins separated by SDS-PAGE were analyzed using Coomassie blue staining (Biorad) or InVision His-tag In-Gel staining (Invitrogen). The expression ratio of the soluble / insoluble fractions was quantified using densitometry using ImageJ on the In-Gel-stained gel.

[0075]

[0076] Example 1. Improving the water solubility of a target protein using multiple NEXT tags.

[0077] To confirm the effect of multiple NEXT tags on improving the soluble expression, three target proteins expressed insoluble in Escherichia coli were selected and tested. β-taCA, TEVP, and Luc derived from Thermovibrio ammonicans were selected as the target proteins. The target proteins were expressed alone or fused with single or multiple NEXT tags and expressed at 37°C, and the degree of soluble expression of the target proteins was analyzed based on the band intensity appearing on the gel.

[0078] First, when β-taCA with a molecular weight of 26.4 kDa was tested, the total expression amount was high when β-taCA was expressed alone, but it was mostly expressed insoluble and only 17.7% soluble expression was shown. When a single NEXT tag was fused to β-taCA, soluble expression was improved to 47.7%, but still showed insoluble expression of more than half. On the other hand, when β-taCA was fused with NEXT tag, ×2 or NEXT ×3 When the tags were fused, high solubility expression was observed at 91% and 94.4%, respectively (Fig. 1).

[0079] In addition, when tested for TEVP with a molecular weight of 28.7 kDa, the expression level was very low to the extent that no noticeable band could be found when TEVP was expressed alone, and when a single NEXT tag was fused to TEVP, the total expression level increased, but most of it was expressed insoluble, and the soluble expression was only 16.8%. On the other hand, when TEVP was fused with NEXT tag, ×2 or NEXT ×3 When the tags were fused, high solubility expression was observed at 84.7% and 87.6%, respectively (Fig. 2).

[0080] In addition, when Luc with a molecular weight of 60.6 kDa was tested, the total expression amount was high when Luc was expressed alone, but it was mostly expressed insoluble and only 7% soluble expression was shown. Even when a single NEXT tag was fused to Luc, the soluble expression did not increase significantly and remained at the level of 14.6%. On the other hand, when Luc was fused with a NEXT tag, ×2 or NEXT ×3 When the tags were fused, high solubility expression was observed at 89.7% and 92.6%, respectively (Fig. 3).

[0081] Through the above results, it was found that the multiple NEXT tags of the present invention can significantly improve the soluble expression of a target protein compared to a single NEXT tag, and can be effectively applied to proteins of a large size of 60 kDa or more.

Claims

1. A fusion tag consisting of two or more repetitions of the amino acid sequence of sequence number 1.

2. A fusion tag according to claim 1, characterized in that the two or more repetitions are any one of two to five repetitions.

3. A fusion tag according to claim 1, characterized in that the fusion tag consists of an amino acid sequence of sequence number 2 or 3.

4. A fusion tag characterized in that, in the first paragraph, the C-terminus of each fusion tag additionally includes a (GGGGS)2 linker sequence.

5. A polynucleotide encoding a fusion tag of any one of claims 1 to 4.

6. In the fifth paragraph, the polynucleotide is characterized in that it consists of a base sequence of sequence number 5 or 6.

7. A recombinant vector characterized in that a polynucleotide encoding a fusion tag consisting of an amino acid sequence of sequence number 2 or 3 and a gene encoding a target protein are sequentially linked.

8. A recombinant vector according to claim 7, characterized in that the target protein has a biological activity selected from the group consisting of enzymes, antigens, antibodies, cell receptors, structural proteins, serum, and cell proteins.

9. A recombinant vector according to claim 7, characterized in that the target protein additionally has a 6XHis sequence at the C-terminus.

10. A host cell transformed with a recombinant vector according to any one of claims 7 to 9.

11. A step of transforming a host cell with a recombinant vector of any one of claims 7 to 9; and A method for producing a target protein with increased soluble expression in a host cell, comprising: a step of culturing the transformed host cell to express the target protein.

12. A method for producing a target protein with increased soluble expression level in a host cell, characterized in that the host cell in claim 11 is E. coli.

13. A composition for producing a target protein with increased water-soluble expression, comprising, as an active ingredient, a recombinant vector in which a polynucleotide encoding a fusion tag consisting of any one of the amino acid sequences of SEQ ID NOs: 2 or 3 and a gene encoding the target protein are sequentially linked.

Images