Regulated expression of card11-PIK3r3 fusion protein

Abstract

The present disclosure relates generally to compositions and methods for improving T cell therapy.

Description

REGULATED EXPRESSION OF CARD11-PIK3R3 FUSION PROTEIN CROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to U.S. Provisional Patent Application Serial No.63 / 588,118, filed on October 5, 2023. The contents of the above-referenced application is herein expressly incorporated by reference in its entirety, including any drawings. STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under OD025751 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD

[0003] The present disclosure relates generally to compositions and methods for improving adoptive T cell therapy. BACKGROUND

[0004] Chimeric antigen receptor (CAR)-T cell therapy is a promising immunotherapy approach that involves genetically engineering T cells to express CARs, which enable them to recognize and eliminate tumor cells. CAR-T cell therapy has shown remarkable success in treating hematologic malignancies, but its efficacy in solid tumors has been limited. Solid tumors present unique challenges for CAR-T cell therapy due to the hostile tumor microenvironment, which can inhibit CAR-T cells by promoting T cell exhaustion and apoptosis. In addition, solid tumors often express low or heterogenous levels of target antigens, which can limit CAR-T cell efficacy. Addressing these challenges is critical to developing effective CAR-T cell therapies for solid tumors, and incorporating new signaling domains is one promising approach to improving the functionality of CAR-T cells.

[0005] CARD11 is a scaffolding protein that plays a critical role in CBM signaling in T cells. The protein is composed of several domains that are important for its function. At the N- terminus, CARD11 contains a caspase activation and recruitment domain (CARD), which mediates protein-protein interactions with other CARD-containing proteins such as BCL10.Next, CARD11 contains a coiled-coil domain that mediates CARD11 oligomerization. CARD11 also contains an inhibitory domain, located after the coiled-coil domain, which serves to keep CARD11 in an inactive state under basal conditions. Next, CARD11 contains a membrane-associated guanylate kinase (MAGUK) domain that is important for protein-protein interactions with downstream signaling molecules. At the C-terminal end, CARD11 contains a PDZ-binding motif, which mediates interactions with PDZ domain-containing proteins. Together, these domains and phosphorylation sites allow CARD11 to function as a scaffold for the assembly of the CBM complex and the activation of downstream signaling pathways in T cells.

[0006] Our previous work has identified a novel fusion protein (CARD11-PIK3R3) that enhances CARD11-BCL10-MALT1 signaling to improve CAR-T cell function. CARD11- BCL10-MALT1 (CBM) signaling is a critical pathway in T cells that mediates the activation of NF-κB and AP-1 transcriptional activity. Upon TCR activation, CARD11 forms a complex with the scaffolding protein BCL10 and the protease MALT1, which activates downstream signaling cascades resulting in NF-κB and AP-1 activation. This signaling pathway is essential for T cell activation, proliferation, and differentiation. Alterations in the CBM pathway have been associated with lymphoma, immunodeficiency and autoimmune disorders.

[0007] CARD11-PIK3R3 expression significantly increased NF-kB and AP-1 signaling and IL-2 production downstream of CAR signaling. While constitutive expression of the CARD11- PIK3R3 fusion protein is determined to be safe and tolerable in pre-clinical in vivo models, there are potential benefits to receptor-controlled expression of this fusion protein for safety. For example, CARD11-PIK3R3 can be constitutively expressed in CAR T cells, however, it is important to knockout or disable the endogenous T cell receptor to avoid any unintended activation of CARD11-PIK3R3 in autoreactive / autoimmune prone T cells. Receptor control of CARD11-PIK3R3 could avoid the need for TCR knockout and increase the safety of T cell therapies that utilize the fusion protein.

[0008] These observations point to the need for further development of novel genetic circuits that control CBM signaling in order to enhance the therapeutic efficacy and prevent toxicities associated with constitutive expression of CARD11-PIK3R3.

[0009] Thus, there remains a need in the art for alternative solutions to address the significant unmet need for effective adoptive T cell therapies and for enhancing engineered T cell fitness.SUMMARY

[0010] This section provides a general summary of the disclosure and is not comprehensive of its full scope or all of its features.

[0011] The present disclosure generally relates to, inter alia, genetic circuits including chimeric antigen receptors with an upstream activation sequence (UAS) responsive to (e.g., promoted by) CARD11-PIK3R3 that selectively switch on CARD11-PIK3R3 activity in primary human T-cells in response to CAR receptor ligation. The genetic circuits of the disclosure are such that activation of the CAR by its target antigen (i.e. the antigen to which the CAR has specificity to) activates the T cell thereby leading to expression of the CARD11- PIK3R3 fusion protein under influence of a promoter.

[0012] Provided herein is a recombinant cell comprising a) a first nucleic acid encoding a chimeric receptor. The chimeric receptor includes, from N-terminus to C-terminus: (i) an extracellular ligand-binding domain having a binding affinity for a selected ligand; (ii) a linking polypeptide; (iii) a transmembrane domain (TMD) comprising one or more ligand-inducible proteolytic cleavage sites; and (iv) an intracellular domain (ICD) comprising, in any order: (A) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule and an activation domain, and (B) a transcriptional regulator, and wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at a ligand-inducible proteolytic cleavage site disposed between the ICD and the linking sequence, and wherein the chimeric receptor does not comprise a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor. The chimeric receptor also includes b) a second nucleic acid encoding a caspase recruitment domain family member 11 (CARD11) polypeptide comprising (i) a caspase recruitment domain (CARD) and (ii) one or more mutations, wherein the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator; wherein expression of the CARD11 polypeptide is modulated by the transcriptional regulator.

[0013] In some embodiments, the extracellular domain comprises an antigen-binding moiety capable of binding to a ligand on the surface of a cell. In some embodiments, the cell is a pathogenic cell. In some embodiments, the cell is a human cell. In some embodiments, the human cell is a tumor cell. In some embodiments, the human cell is a terminally differentiated cell.

[0014] Also provided herein is a recombinant cell comprising a) a first nucleic acid encoding a first polypeptide of a multi-chain chimeric receptor, wherein the first polypeptide comprises, from N-terminus to C-terminus: (i) an extracellular ligand-binding domain having a binding affinity for a selected ligand; (ii) a linking sequence; (iii) a first transmembrane domain (TMD) comprising a first modified interface and one or more ligand-inducible proteolytic cleavage sites; (iv) a first intracellular domain (ICD) comprising a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the one or more ligand-inducible proteolytic cleavage sites; b) a third nucleic acid encoding a second polypeptide of the multi-chain chimeric receptor, wherein the second polypeptide comprises, from N-terminus to C-terminus: (i) a second TMD comprising a second modified interface; and (ii) a second ICD comprising (A) at least one costimulatory domain derived from a signaling molecule, and (B) an activation domain, wherein the first and the second modified interfaces each comprises an amino acid residue having a charged side chain, wherein the amino acid residues in the first and the second modified interfaces have opposite charges, wherein the first polypeptide is coupled to the second polypeptide via the first modified interface and the second modified interface; wherein the multi-chain chimeric receptor does not comprise a LIN- 12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor; and c) a second nucleic acid encoding a caspase recruitment domain family member 11 (CARD11) polypeptide comprising (i) a caspase recruitment domain (CARD) and (ii) one or more mutations, wherein the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator; wherein expression of the CARD1 1 polypeptide is modulated by the transcriptional regulator.

[0015] In some embodiments, binding of the selected ligand to the extracellular ligandbinding domain induces proximal signaling cascades through the at least one costimulatory domain and / or the activation domain.

[0016] In some embodiments, binding of the selected ligand to the extracellular ligandbinding domain releases the transcriptional regulator from the chimeric polypeptide.

[0017] In some embodiments, the response element is comprised within the promoter.

[0018] In some embodiments, the extracellular domain comprises an antigen-binding moiety capable of binding to the selected ligand on the surface of a second cell.

[0019] In some embodiments, the second cell is a pathogenic cell. In some embodiments, the second cell is a human cell. In some embodiments, the human cell is a tumor cell. In some embodiments, the human cell is a terminally differentiated cell.

[0020] In some embodiments, the ligand comprises a protein or a carbohydrate.

[0021] In some embodiments, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD- L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), blue fluorescent protein (BFP) enhanced green fluorescent protein (EGFP), and signal regulatory protein α (SIRPα).

[0022] In some embodiments, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M,Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0023] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0024] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

[0025] In some embodiments, the ligand is selected from cell surface receptors, adhesion proteins, integrins, mucins, lectins, tumor-associated antigens, and tumor-specific antigens. In some embodiments, the ligand is a tumor-associated antigen or a tumor-specific antigen.

[0026] In some embodiments, the extracellular ligand-binding domain comprises the ligand- binding portion of a receptor.

[0027] In some embodiments, the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, a minibody, an F(ab')2 fragment, an F(ab)v fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), and a functional fragment thereof. In some embodiments, the antigen-binding moiety comprises an scFv.

[0028] In some embodiments, the antigen-binding moiety specifically binds to a tumor- associated antigen selected from the group consisting of ADGRE2, CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, Claudin 18.2, CLECL1, CS-1, DLL3 EGFR, EGFRvIII, EGFR806, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), HER2p95, IGLL1, IL-11Rα, KIT (CD117), KLK2, KLK3, LY6G6D, MUC1, MUC16, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, GUCY2C, STEAP1, STEAP2, and Axl. In some embodiments, the tumor-associated antigen is CD19, BCMA, CEA, HER2, MUC1, CD20, ALPPL2, SIRPα, or EGFR. In some embodiments, the tumor-associated antigen is CD19, or ALPPL2.

[0029] In some embodiments, the antigen-binding moiety specifically binds to a tumor- associated antigen selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag,cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0030] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, GCC, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0031] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

[0032] In some embodiments, the antigen-binding moiety specifically binds to a target antigen selected from the group consisting of BCMA, CD19, CD20, CD22, CD70, CD79A,CD79B, CD276 (B7H3), Claudin 6, Claudin 18.2, DLL3, GCC, GD2, GD3, GPC3, GPRC5D, LY6G6D, p53R175H, PRAME, and ROR1.

[0033] In some embodiments, the linking polypeptide comprises a hinge domain. In some embodiments, the hinge domain is capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding. In some embodiments, the hinge domain is derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof.

[0034] In some embodiments, the linking sequence is derived from the group selected from: a CD8α hinge domain or a functional variant thereof, a CD28 hinge domain or a functional variant thereof, OX40 hinge domain or a functional variant thereof, and an IgG4 hinge domain or a functional variant thereof.

[0035] In some embodiments, the linking sequence comprises a hinge domain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 19-23.

[0036] In some embodiments, the linking sequence is derived from a CD8^ hinge domain or a functional variant thereof.

[0037] In some embodiments, the linking sequence is derived from a CD28 hinge domain or a functional variant thereof.

[0038] In some embodiments, the linking sequence comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 8.

[0039] In some embodiments, the one or more ligand-inducible proteolytic cleavage sites comprises a ^ secretase cleavage site.

[0040] In some embodiments, the TMD comprises a polypeptide sequence having at least 80% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor and comprises a γ-secretase cleavage site.

[0041] In some embodiments, the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to SEQ ID NO: 5.

[0042] In some embodiments, the TMD comprises an amino acid substitution at amino acid position 18 and / or 19 of SEQ ID NO: 5.

[0043] In some embodiments, the TMD comprises an amino acid substitution corresponding to G18A and / or V19A of SEQ ID NO: 5.

[0044] In some embodiments, the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-195.

[0045] In some embodiments, the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-95, 99, 113, 132, 136, 147, and 157.

[0046] In some embodiments, the first and the second polypeptides of the multi-chain chimeric receptor are not covalently connected.

[0047] In some embodiments, the first modified interface comprises a positively charged residue, and wherein the second modified interface comprises a negatively charged residue, and wherein the first and the second polypeptides of the multi-chain chimeric receptor are coupled via the electrostatic force between the first and the second modified interfaces.

[0048] In some embodiments, (i) the first TMD comprises SEQ ID NO: 87 or functional variants thereof and the lysine or arginine residue is at position selected from positions 10 to 14 of SEQ ID NO: 87 or (ii) the first TMD comprises SEQ ID NO: 87 and the lysine or arginine is at position selected from positions 8 to 11 of SEQ ID NO: 87.

[0049] In some embodiments, the lysine or arginine residue is (i) at position 12 of SEQ ID NO: 87, or (ii) is at position 9 of SEQ ID NO: 87.

[0050] In some embodiments, the chimeric receptor further comprises a stop-transfer- sequence (STS) positioned between the TMD and the ICD.

[0051] In some embodiments, the stop-transfer-sequence comprises a sequence having at least 70% sequence identity to a STS sequence from APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNEl, KCNE2, CHL1, LRP1, LRP2, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DOT, VASN, FLT1, CDH5, PKHD1, NECTINl, KL, IL6R, EFNBl, CD44, CLSTN1, LRP8, PCDHGC3, NRGl, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notchl, Notch2, Notch3, and Notch4.

[0052] In some embodiments, the signaling molecule comprises a class 1 or a class 3 human membrane protein.

[0053] In some embodiments, the signaling molecule is selected from the group consisting of CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BTN3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, EDAR, XEDAR, RELT, DR6, TROY, NGFR, CD22, SIGLEC-3, SIGLEC-5, SIGLEC-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Allergin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC.

[0054] In some embodiments, the signaling molecule is selected from the list consisting of OX40, ICOS, 4-1BB, CTLA4, CD28, CD30, CD2, CD27, and CD226.

[0055] In some embodiments, the activation domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs).

[0056] In some embodiments, the one or more ITAMs are derived from CD3ζ, CD3σ, CD3γ, and / or CD3ɛ.

[0057] In some embodiments, the one or more ITAMs have at least about 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to a CD3ζ ITAM.

[0058] In some embodiments, the transcriptional regulator comprises a transcriptional activator or a transcriptional repressor.

[0059] In some embodiments, the transcriptional regulator further comprises a nuclear localization sequence (NLS) derived from a protein selected from the group consisting of Gal4, tetR, ZFHD1, and HAP1.

[0060] In some embodiments, the transcriptional regulator comprises a transactivation domain derived from a protein selected from the group consisting of VP64, VP65, KRAB, and VP16.

[0061] In some embodiments, the recombinant cell comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOS: 88-89.

[0062] In some embodiments, the one or mutations in the CARD11 polypeptide is a point mutation, a gene fusion, a substitution, a gain-of-function mutation, a stop-gain mutation, an insertion mutation, a deletion mutation, a duplication mutation or a translocation.

[0063] In some embodiments, the CARD11 polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 47 and comprising a substitution at an amino acid position selected from the group consisting of 361, 615, 634, 655, and 357 of SEQ ID NO: 47.

[0064] In some embodiments, the substitution comprises Y361C, S615F, E634K, D357N, S655C, or combinations thereof.

[0065] In some embodiments, the mutation is a fusion between a CARD11 polypeptide and a phosphoinositide-3-kinase regulatory subunit 3 (PIK3R3) polypeptide. In some embodiments, the fusion comprises a CARD domain and a coiled coil domain. In some embodiments, the coiled coil domain is a truncated coiled coil domain. In some embodiments, the fusion protein further comprises an inhibitory domain. In some embodiments, the fusion protein further comprises an SH2 domain from PIK3R3.

[0066] In some embodiments, the CARD11 polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 48-55 and 57-65.

[0067] In some embodiments, the polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 90-91.

[0068] In some embodiments, the promoter is selected from the group consisting of an MND promoter, an EF1a promoter, a sEF1a promoter, a gamma retroviral LTR promoter, a CD4 promoter, a CD8a promoter, a CD8b promoter, a TCRalpha promoter, a TCRbeta promoter, a CD3γ promoter, a CD3δ promoter, a CD3ε promoter, a CD3ζ promoter, a minimal TATA promoter, a pGK, actin promoter, a CD25 promoter, an IL2 promoter, an IL7 promoter, an IL15 promoter, a KLRG-1 promoter, a HLA-DR promoter, a CD38 promoter, a CD69 promoter, a Ki-67 promoter, a CD11a promoter, a CD58 promoter, a CD99 promoter, a CD62L promoter, a CD103 promoter, a CCR4 promoter, a CCR5 promoter, a CCR6 promoter, a CCR9 promoter, a CCR10 promoter, a CXCR3 promoter, a CXCR4 promoter, a CLA promoter, a Granzyme A promoter, a Granzyme B promoter, a Perforin promoter, a CD57 promoter, a CD161 promoter,an IL-18Ra promoter, a CD69 promoter, a GzmB promoter, a T-bet promoter, an IFNgamma promoter, an IL4 promoter, a GATA3 promoter, an IL1 promoter, an IL5 promoter, an IL6 promoter, an IL13 promoter, an IL10 promoter, an IL17A promoter, an IL6 promoter, an IL21 promoter, an IL23R promoter, a FoxP3 promoter, a CTLA4 promoter, a CD25 promoter, a CD45RO promoter, a CCR7 promoter, a CD28 promoter, a CD95 promoter, a CD28 promoter, a CD27 promoter, a CD127 promoter, a CD122 promoter, a CD132 promoter, a c-Kit promoter, a nuclear factor of activated T cells (NFAT) promoter, a programmed death 1 (PD-1) promoter, a T cell immunoglobulin mucin-3 (TIM-3) promoter, a cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, a lymphocyte-activation protein 3 (LAG-3) promoter, a tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) promoter, a B- and T-lymphocyte attenuator (BTLA) promoter, a CD25 promoter, a CD69 promoter, a Fas ligand (FasL) promoter, a TIGIT promoter, a TGF-beta promoter, a T-bet promoter, an Eomes promoter, a CD45RA promoter, a 2B4 promoter, a Type I interferon (IFN) alpha, a Type I IFN beta promoter, an IFN gamma promoter, an IRF3 promoter, an IRF7 promoter, a NFkB promoter, an AP-1 promoter, a TNF-alpha promoter, a CD130 promoter, a NR4A1 promoter, a NR4A2, a NR4A3 promoter, and any combination thereof.

[0069] In some embodiments, the promoter is selected from the group consisting of a TCRalpha promoter, a TCRbeta promoter, a gamma retroviral LTR promoter, an IL2 promoter, a nuclear factor of activated T cells (NFAT) promoter, an NR4A1 promoter, an MND promoter, an EF1a promoter, and a sEF1a promoter.

[0070] In some embodiments, the recombinant cell has reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR).

[0071] In some embodiments, the recombinant cell does not have reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR).

[0072] In some embodiments, cell surface expression level of an endogenous T cell receptor (TCR) of the recombinant cell is at least 50% of, or substantially the same as, that of a control cell without the nucleic acids.

[0073] In some embodiments, binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least200-fold, at least 500-fold, or at least 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand.

[0074] In some embodiments, binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide by 1-fold to 2-fold, 2-fold to 3-fold, 3-fold to 5-fold, 5-fold to 10-fold, 10-fold to at least 20-fold, 20-fold to 50-fold, 50- fold to 100-fold, 100-fold to 200-fold, 200-fold to 500-fold, or 500-fold to 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand.

[0075] In some embodiments, baseline expression of the CARD11 polypeptide in the absence of the selected ligand is no more than 10%, no more than 5%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.1%, no more than 0.05%, no more than 0.01%, no more than 0.005%, or no more than 0.001%, compared to the maximal expression level of the CARD11 polypeptide in the present of the selected ligand.

[0076] In some embodiments, the recombinant cell has no leaky expression of the CARD11 polypeptide in the absence of the selected ligand.

[0077] In some embodiments, the likelihood of an individual experiencing an adverse event when administered the recombinant cell is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%, compared to a cell that constitutively expresses the CARD11 polypeptide.

[0078] In some embodiments, the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder, splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, graft-vs-host disease (GVHD), potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma.

[0079] In some embodiments, the adverse event is an acute adverse event.

[0080] In some embodiments, the adverse event GVHD.

[0081] In some embodiments, the recombinant cell is a eukaryotic cell.

[0082] In some embodiments, the recombinant cell is selected from the group of consisting of a T cell, a CD4+ T cell, a CD8+ T cell, a regulatory T cell (Treg), a gamma delta T cell (γδT),an invariant natural killer T (iNKT) cell, a mucosal associated invariant T (MAIT) cell, a macrophage, a monocyte, a natural killer (NK) cell, a tumor infiltrating lymphocyte (TIL), a cytotoxic T cell, a T helper cell, a memory T cell, a central memory T (TCM) cell, a stem memory T (TSCM) cell, a stem-cell-like memory T cell (or stem-like memory T cells), an effector memory T (TEM) cell, a TEMRA (CD45RA+) cell, an effector T cell, a Th1 cell, a Th2 cell, a Th9 cell, a Th17 cell, a Th22 cell, a Tfh (follicular helper) cell, a natural killer T (NKT) cell, a transitional memory T (TTM) cell, a terminal effector T (TTE) cell, a naïve T (TN) cell, a hematopoietic stem cell, and a progenitor cell of the lymphoid lineage.

[0083] In some embodiments, the recombinant cell is selected from the group consisting of a T cell, a macrophage, a monocyte, and a natural killer (NK) cell.

[0084] In some embodiments, the recombinant cell is a T cell.

[0085] In some embodiments, the T cell is selected from the group consisting of a regulatory T cell (Treg), a gamma delta T cell, a CD8+ T cell, an invariant iNKT cell, a MAIT cell, a CAR T cell, a tumor-infiltrating lymphocyte, and an engineered T cell comprising a transcriptional receptor.

[0086] In some embodiments, the recombinant cell is an autologous cell.

[0087] In some embodiments, the recombinant cell is an allogeneic cell.

[0088] In some embodiments, the recombinant cell is a primary cell.

[0089] In some embodiments, the recombinant cell is derived from a stem cell.

[0090] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is an immune cell, a neuron, an epithelial cell, and endothelial cell, or a stem cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or other T cell.

[0091] In some embodiments, activating the recombinant cell results in the secretion of IL-2 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2- fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IL-2 secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the CARD11 polypeptide.

[0092] In some embodiments, activating the recombinant cell results in the surface expression of ICOS by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, atleast 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, or at least 100-fold higher than the ICOS surface expression level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the CARD11 polypeptide.

[0093] In some embodiments, the transcriptional regulator comprises (i) a DNA-binding domain and (ii) an effector domain.

[0094] In some embodiments, the DNA-binding domain is derived from a human hepatocyte nuclear factor 1 homeobox A (HNF1α) protein, a human hepatocyte nuclear factor 1 homeobox B (HNF1β) protein, a human paired box protein (Pax-6) protein, a human paired box protein (Pax-1) protein, a human paired box protein (Pax-2) protein, a human paired box protein (Pax- 3) protein, a human paired box protein (Pax-4), or a human paired box protein (Pax-7); preferably, the DNA-binding domain is derived from a human HNF1α protein or a human Pax6 protein.

[0095] In some embodiments, the DNA-binding domain is derived from a human hepatocyte nuclear factor 1 homeobox A (HNF1α) protein.

[0096] In some embodiments, the HNF 1a DNA-binding domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 243, or wherein the Pax6 DNA-binding domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 244.

[0097] In some embodiments, the effector domain is selected from the group consisting of a transcriptional activation domain, a transcriptional repressor domain, and an epigenetic effector domain.

[0098] In some embodiments, the transcriptional activation domain is derived from human nuclear factor NFKB p65 subunit (p65); optionally, wherein the p65 effector domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 245-246.

[0099] In some embodiments, the response element comprises at least 2, 3, or 4 copies of a DNA sequence that binds to the transcriptional regulator; optionally wherein the DNA sequence comprises GTTAAT (SEQ ID NO: 200).

[0100] In some embodiments, the promoter is a minimal promoter; optionally wherein the minimal promoter is a pybTATA minimal promoter, a cytomegalovirus(CMV) minimal promoter, a herpes simplex virus thymidine kinase (HSV-tk) minimal promoter, a simian virus 40 (SV40) minimal promoter, a human β-actin minimal promoter, a human EF2 minimal promoter, an adenovirus E1B minimal promoter, or a heat shock protein 70 (HSP70) minimal promoter.

[0101] Also provided herein is a pharmaceutical composition comprising a pharmaceutically acceptable carrier, and the recombinant cell according to the present disclosure.

[0102] Also provided herein is a system for modulating an activity of a cell, inhibiting a target cancer cell, or treating a health condition in an individual in need thereof, the system comprising one or more of the following: a recombinant cell according to any one of claims 1- 49; and a pharmaceutical composition according to the present disclosure.

[0103] Also provided herein is a method for modulating an activity of a cell, the method comprising: a) providing a recombinant cell according to the present disclosure; and b) contacting the recombinant cell with a selected ligand, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of a ligand-inducible proteolytic cleavage site and releases the transcriptional regulator, wherein the released transcriptional regulator modulates expression of the CARD11 polypeptide. In some embodiments, the contacting is carried out in vivo, ex vivo, or in vitro. In some embodiments, the activity of the cell to be modulated is selected from the group consisting of: expression of a selected gene, proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, secretion of a molecule, cellular adhesion, and cytolytic activity.

[0104] Also provided herein is a method for the treatment of a health condition in an individual in need thereof, the method comprising administering to the individual a first therapy comprising an effective number of the recombinant cell according to the present disclosure, wherein the recombinant cell treats the health condition in the individual. In some embodiments, the method further includes administering to the individual a second therapy.In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and toxin therapy.

[0105] In some embodiments, the health condition is cancer.

[0106] In some embodiments, the health condition is an autoimmune disease.

[0107] In some embodiments, the likelihood of an adverse event is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, atleast 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%, compared to a method using recombinant cells that constitutively express the CARD11 polypeptide.

[0108] In some embodiments, the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder, splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, graft-vs-host disease (GVHD), potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma.

[0109] In some embodiments, the adverse event is an acute adverse event.

[0110] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative embodiments and features described herein, further aspects, embodiments, objects and features of the disclosure will become fully apparent from the drawings and the detailed description and the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] FIG.1 shows that Hybrid SynNotch CARs drive T cell activation and custom gene regulation.

[0112] FIGs.2A-2B show expression of hybrid SynNotch CAR to CARD11-PIK3R3 circuits in human primary T cells.

[0113] FIGs.3A-3C show hybrid SynNotch CARs can activate T cells and drive CARD11- PIK3R3 expression plus phenotypic changes in response to antigen.

[0114] FIGs.4A-4D show hybrid SynNotch CAR T cells that induce expression of CARD11- PIK3R3 have potent activity in xenograft tumors.

[0115] FIGs.5A-5D show hybrid SynNotch CAR T cells that induce expression of CARD11- PIK3R3 have potent activity in syngeneic tumors.

[0116] FIGs.6A-6E show Hybrid-R controlling CARD11-PIK3R3 enhances anti-tumor immunity and improves cell therapy safety. FIG.6A shows a Hybrid-R to CARD11-PIK3R3 mechanism schematic. FIG.6B shows Hybrid-R circuit regulated CARD11-PIK3R3 invokes the same functional changes as constitutive CARD11-PIK3R3 in human T cells. PurifiedHybrid-R T cells cocultured with CD19+ K562 were assessed for CARD11-PIK3R3 phenotypic changes after 48 hours in culture. The expression of the CARD11-PIK3R3 payload increases the concentration of IL-2 in the culture medium and the surface ICOS expression in both CAR + CARD11-PIK3R3 and Hybrid-R to CARD11-PIK3R3 T cells. IL-2 ELISA was performed with two different human T cell donors. FIG.6C shows Hybrid-R Inducible CARD11-PIK3R3 circuit improves cytotoxic capacity of primary human T cells in vitro. IncuCyte live cell imaging quantitation of Hybrid-R to CARD11-PIK3R3 targeting CD19+ A549 lung tumor cell line is shown. FIG.6D shows Hybrid-R controlled expression of CARD11-PIK3R3 maintains enhanced tumor control in solid tumor model. Animals receiving 4.0x106T cells, expressing CARD11-PIK3R37 days post tumor injection control and maintain control of M28 tumors overtime as measured by tumor volume. Tumor volume was calculated using the following formulae: (length × width2) / 2. FIG.6E shows Hybrid-R controlled expression of CARD11- PIK3R3 minimizes animal weight change and improves survival compared CAR + CARD11- PIK3R3 animals. Percent animal weight change was plotted overtime. Animals treated with Hybrid-R to CARD11-PIK3R3 T cells show no weight loss, indicating mitigation of CARD11- PIK3R3 related toxicity.2 / 6 animals receiving CAR + CARD11-PIK3R3 T cells succumb to weight loss. Survival data was plotted using Log-Rank Mantel-Cox test.

[0117] FIGs.7A-7D show Hybrid-R regulated CARD11-PIK3R3 maintains mouse T cell therapy potency and improves safety in immunocompetent mice. FIG.7A shows Hybrid-R to CARD11-PIK3R3 mechanism schematic. FIG.7B shows Hybrid-R regulated CARD11- PIK3R3 invokes the same functional changes as constitutive CARD11-PIK3R3 in mouse T cells. Hybrid-R mouse T cells cocultured with CD19+ K562 were assessed for CARD11- PIK3R3 phenotypic changes after 96 hours in culture. The expression of the CARD11-PIK3R3 fusion protein increases the concentration of IL-2 in the culture medium. FIG.7C shows Hybrid-R to CARD11-PIK3R3 T cells maintain B16 tumor control in syngeneic mice. Animals receiving 4x106receptor positive T cells expressing CARD11-PIK3R311 days post tumor injection control CD19+ B16 melanoma tumor growth overtime as measured by tumor volume. Tumor volume was calculated using the following formulae: (length × width2) / 2. FIG.7D shows Hybrid-R controlled expression of CARD11-PIK3R3 enhances B16 tumor bearing animal survival compared CAR + CARD11-PIK3R3 treated animals. Animals receiving Hybrid-R T cells regulating expression of CARD11-PIK3R3 payload show improved survival indicating aprevention of payload associated toxicity. Survival was data plotted using Log-Rank Mantel- Cox test.

[0118] FIGs.8A-8C shows humanized Hybrid-R to CARD11-PIK3R3 displays optimal payload specific phenotypes in primary human T cells. FIG.8A shows humanized Hybrid-R to CARD11-PIK3R3 mechanism schematic. FIG.8B shows humanized Hybrid-R circuit regulated CARD11-PIK3R3 invokes the same functional changes as constitutive CARD11-PIK3R3 in CAR T cells. Purified hHybrid-R T cells cocultured with CD19+ K562 were assessed for CARD11-PIK3R3 phenotypic changes after 72 hours in culture. The addition of the CARD11- PIK3R3 fusion protein increases the concentration of IL-2 in the culture medium and the surface ICOS expression in both CAR + CARD11-PIK3R3 and hHybrid-R to CARD11- PIK3R3 T cells. FIG.8C shows humanized Hybrid-R Inducible CARD11-PIK3R3 circuit improves cytotoxic capacity of primary human T cells in vitro. IncuCyte live cell imaging quantitation of hHybrid-R to CARD11-PIK3R3 targeting CD19+ A549 lung tumor is shown.

[0119] In the following detailed description, reference is made to the Figures, which form a part hereof. In the Figures, similar symbols generally identify similar components, unless context dictates otherwise. The illustrative alternatives described in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used and other changes may be made without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly contemplated and make part of this application. DETAILED DESCRIPTION OF THE DISCLOSURE

[0120] In general, the present disclosure relates, inter alia, to compositions and methods for improving adoptive T cell therapy. The inventors have discovered ways to improve the therapeutic efficacy and reduce the toxicity of T cells expressing a CARD11-PIK3R3 fusion protein by controlling expression of the CARD11-PIK3R3 fusion via a genetic circuit involving a chimeric CAR receptor.

[0121] The present disclosure provides genetic circuits and recombinant cells comprising nucleic acid constructs encoding a chimeric receptor and a CARD11-PIK3R3 fusion thatselectively switch expression of the CARD11-PIK3R3 construct in primary human T-cells in response to CAR receptor ligation.

[0122] The genetic circuits of the disclosure are engineered such that when the chimeric receptor binds antigen, cleavage of the transcription factor occurs, which translocates to the nucleus and induces transcription of CARD11-PIK3R3. When expressed, CARD11-PIK3R3 is then activated by the CAR signaling behavior of the chimeric receptor.

[0123] The constructs of the disclosure can be engineered and delivered efficiently into T cells via a single lentiviral vector or by a dual vector system. The disclosure also provides vectors and recombinant cells including the constructs of the disclosure, methods useful for inducing an immune response in a subject, methods for preventing and / or treating various health conditions, as well as methods for delivering a bioactive molecule by a T cell.

[0124] In particular, some embodiments of the disclosure provides exemplary genetic circuits involving a first nucleic acid encoding a chimeric receptor (referred to herein as “hybrid SynNotch CARs” or “hybrid receptors”) that incorporates (i) costimulatory domains and stimulatory domains of a CAR, for example, the cytoplasmic tail of the CD3zeta chain, and (ii) a transcriptional regulator. This can be combined with a second nucleic acid encoding a CARD11 polypeptide operably linked to a promoter. The architecture of the cytoplasmic tail of these receptors (costimulatory domain, CD3zeta, transcription factor) can be configured in multiple ways. As described in greater detail below, the present disclosure also identifies additional receptor architectures (e.g., “hinge notch”, “Fn Notch”) that can be combined with the second nucleic acid construct (i.e., nucleic acid encoding CARD11) described herein to induce proximal T-cell receptor costimulatory signals and regulation of a CARD11-PIK3R3 fusion in primary human T cells. The genetic circuits provided herein can induce T cell activation and expression of CARD11-PIK3R3 resulting in greater IL-2 secretion than a constitutively expressed CARD11-PIK3R3.

[0125] Further, the present disclosure demonstrates that, upon engagement with antigen, the Hybrid SynNotch CARs provided herein induce expression of CARD11-PIK3R3 and this activity is effective in controlling and clearing tumor burden in both xenograft and syngeneic tumor models.

[0126] Although various features of the disclosures may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination.Conversely, although the disclosures may be described herein in the context of separate embodiments for clarity, the disclosures may also be implemented in a single embodiment. Any published patent applications and any other published references, documents, manuscripts, and scientific literature cited herein are incorporated herein by reference for any purpose. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0127] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols generally identify similar components, unless context dictates otherwise. The illustrative alternatives described in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used and other changes may be made without departing from the spirit or scope of the subject matter presented here. It will be readily understood that the aspects, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are explicitly contemplated and make part of this application. DEFINITIONS

[0128] Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0129] The singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B.”

[0130] The terms “administration” and “administering”, as used herein, refer to the delivery of a bioactive composition or formulation by an administration route including, but not limited to, oral, intravenous, intra-arterial, intramuscular, intraperitoneal, subcutaneous, intramuscular,and topical administration, or combinations thereof. The term includes, but is not limited to, administering by a medical professional and self-administering.

[0131] The term “heterologous” refers to a polypeptide sequence or domain which is not native to a flanking sequence, e.g., wherein the heterologous sequence is not found in nature coupled to the polypeptide sequences occurring at one or both ends.

[0132] The term “derived from” as used herein in reference to a protein or polypeptide refers to an origin or source, and may include naturally occurring, recombinant, unpurified or purified polypeptide that is obtained from, is obtained based on a source or original protein or polypeptide. As such, a protein or polypeptide derived from an original protein or polypeptide may include the original protein or polypeptide, in part or in whole, and may be a fragment or variant of the original protein or polypeptide. In some instance, the polypeptide sequence or domain that is derived from a source or origin can be genetically or chemically modified.

[0133] The terms “host cell” and “recombinant cell” are used interchangeably herein. It is understood that such terms, as well as “cell”, “cell culture”, “cell line”, refer not only to the particular subject cell or cell line but also to the progeny or potential progeny of such a cell or cell line, without regard to the number of transfers. It should be understood that not all progeny are exactly identical to the parental cell. This is because certain modifications may occur in succeeding generations due to either mutation (e.g., deliberate or inadvertent mutations) or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein, so long as the progeny retain the same functionality as that of the originally cell or cell line.

[0134] The term “operably linked”,” as used herein, denotes a physical or functional linkage between two or more elements, e.g., polypeptide sequences or polynucleotide sequences, which permits them to operate in their intended fashion.

[0135] The term “percent identity,” as used herein in the context of two or more nucleic acids or proteins, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or bymanual alignment and visual inspection. See, e.g., the NCBI web site at ncbi.nlm.nih.gov / BLAST. Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. Sequence identity can be calculated over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res.12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990). Sequence identity can be measured using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis.53705), with the default parameters thereof.

[0136] As used herein, and unless otherwise specified, a “therapeutically effective amount” of an agent is an amount sufficient to provide a therapeutic benefit in the treatment or management of a health condition, such as a disease (e.g., a cancer), or to delay or minimize one or more symptoms associated with the cancer. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapeutic agents, which provides a therapeutic benefit in the treatment or management of the cancer. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the cancer, or enhances therapeutic efficacy of another therapeutic agent. An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). The exact amount of a composition including a “therapeutically effective amount” will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols.1-3, 2010); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (2016); Pickar, Dosage Calculations (2012); and Remington: The Science and Practice of Pharmacy, 22nd Edition, 2012, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0137] As used herein, a “subject” or an “individual” includes animals, such as human (e.g., human individuals) and non-human animals. In some embodiments, a “subject” or “individual” is an individual under the care of a physician. Thus, the subject can be a human individual or an individual who has, is at risk of having, or is suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease. The subject can also be an individual who is diagnosed with a risk of the condition of interest at the time of diagnosis or later. The term “non-human animals” includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, and nonmammals, such as non-human primates, e.g., sheep, dogs, cows, chickens, amphibians, reptiles, and the like.

[0138] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0139] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0140] As will be understood by one having ordinary skill in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to rangeswhich can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0141] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and “consisting essentially of” aspects and embodiments. As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, “consisting essentially of” does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term “comprising”, particularly in a description of components of a composition or in a description of steps of a method, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or step.

[0142] Headings, e.g., (a), (b), (i) etc., are presented merely for ease of reading the specification and claims. The use of headings in the specification or claims does not require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented.

[0143] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub- combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub­ combination was individually and explicitly disclosed herein. Notch Receptors

[0144] Notch receptors are large transmembrane proteins that normally communicate signals upon binding to surface-bound ligands expressed on adjacent cells. Notch signals rely on cell- to-cell communication, e.g., communication between two contacting cells, in which one contacting cell is a “receiver” cell and the other contacting cell is a “sender” cell. Notch receptors expressed in a receiver cell recognize their ligands (the delta / serrate / lag, or “DSL” family of proteins) expressed on a sending cell. The engagement of notch and delta on these contacting cells leads to a two-step proteolysis of the notch receptor, which ultimately causes the release of the intracellular portion of the receptor (“ICD”) from the membrane into the cytoplasm. Notch has a matrix metalloprotease cleavage site (denoted “S2”), which, when the receptor is not activated is protected from cleavage by the Notch negative regulatory region (“NRR”). The NRR consists of three LIN-12-Notch repeat (“LNR”) modules and a heterodimerization domain (“HD”). It is believed that this proteolysis is regulated by the force exerted by the sending cell: the DSL ligand pulls on the Notch receptor, which changes the conformation of the NRR and exposes the metalloprotease site. This is cleaved by a constitutively active protease (such as ADAM10), which releases the extracellular binding portion and negative regulatory region of the receptor. Release of the ligand binding portion of the receptor in turn exposes another cleavage site (denoted “S3”), which is cleaved by γ- secretase within the cell membrane: this cleavage releases the nuclear homing ICD from the cell membrane. W.R. Gordon et al., Dev Cell (2015) 33:729-36. This released domain alters receiver cell behavior by regulating transcription. Evolutionary divergence of vertebrates and invertebrates was accompanied by at least two rounds of gene duplication in the Notch lineage: flies possess a single Notch gene, worms two (GLP-1 and LIN-12), and mammals four (NOTCH1-4). Transduction of Notch signals relies on three key events: (i) ligand recognition; (ii) conformational exposure of the ligand-dependent cleavage site; and (iii) assembly of nuclear transcriptional activation complexes.

[0145] Canonical Notch signals are transduced by a process called regulated intramembrane proteolysis. Notch receptors are normally maintained in a resting, proteolytically resistant conformation on the cell surface, but ligand binding initiates a proteolytic cascade that releases the intracellular domain (ICD) of the receptor from the membrane. The critical, regulated cleavage step is effected by ADAM metalloproteases and occurs at a site called S2 immediately external to the plasma membrane. This truncated receptor, dubbed NEXT (for Notchextracellular truncation), remains membrane-tethered until it is processed at site S3 by γ- secretase, a multiprotein enzyme complex.

[0146] After γ-secretase cleavage, the ICD ultimately enters the nucleus, where it nucleates assembly of a transcriptional activation complex that contains a DNA-binding transcription factor, and a transcriptional coactivator of the Mastermind family. This complex then engages one or more additional coactivator proteins such as p300 to recruit the basal transcription machinery and activate the expression of downstream target genes.

[0147] Notch receptors have a modular domain organization. The ectodomains of Notch receptors consist of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding. O-linked glycosylation of these EGF repeats, including modification by O-fucose, Fringe, and Rumi glycosyltransferases, also modulates the activity of Notch receptors in response to different ligand subtypes in flies and mammals.

[0148] The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors, and are widely reported to participate in preventing premature receptor activation. The heterodimerization (HD) domain of Notch1 is divided by furin cleavage, so that its N-terminal part terminates the extracellular subunit, and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD), which includes a transcriptional regulator. CARD11-BCL10-MALT Signalsome

[0149] Formation of a CARD11-BCL10-MALT (CBM) signaling complex is a key event in T- and B cell receptor-induced gene expression. After exposure to distinct immune triggers, these molecules form self-organizing filaments with MALT1 protease activity to regulate canonical nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways and the degradation of mRNA-binding proteins, which provides two layers of control of inflammatory gene expression. Deregulation of CARD11, BCL10 or MALT1 expression or CBM signaling have been associated with cancer, immunodeficiency, and autoimmunity (J. Ruland, L. Hartjes, CARD-BCL-10-MALT1 signalling in protective and pathological immunity. Nat Rev Immunol 19, 118-134 (2019).

[0150] In normal T cells, T cell receptor (TCR) signaling activates PKCθ, which in turn promotes the assembly of the CARD11-BCL10-MALT1 (CBM) signalosome. The CBMcomplex subsequently has three major outputs: NF-κB transcriptional activity, AP-1 transcriptional activity and MALT1 proteolytic activity. The assembly of the CARD11-BCL10- MALT1 signalosome complex is an essential step in regulating NF-κB in lymphoid immune cells.

[0151] An inhibitory domain present in CARD11 may allow for intramolecular autoinhibition which can prevent CARD11 binding to BCL10 in the absence of upstream signals. Upon phosphorylation of the inhibitory domain in normal T cells, CARD11 autoinhibition can be relieved and the CARD11 protein can oligomerize and promote prion-like assembly of the CBM complex with recruitment of BCL10-MALT1 filaments, which then can allow for CBM complex signaling.

[0152] Genes involved in CBM signaling include but are not limited to caspase recruitment domain family member 11 (CARD11), capping protein regulator and myosin 1 linker 2 (CARMIL2), mucosa-associated lymphoid tissue lymphoma translocation protein 1 (MALT1), B-cell lymphoma 10 (BCL10). CARD11 can be involved in both the innate and adaptive immune systems. CARD11 is implicated in the activation of NF-kB by the TCR complex.

[0153] Previous work has identified a novel fusion protein (CARD11-PIK3R3) that enhances CARD11-BCL10-MALT1 signaling to improve CAR-T cell function. CARD11-BCL10- MALT1 (CBM) signaling is a critical pathway in T cells that mediates the activation of NF-κB and AP-1 transcriptional activity. Upon TCR activation, CARD11 forms a complex with the scaffolding protein BCL10 and the protease MALT1, which activates downstream signaling cascades resulting in NF-κB and AP-1 activation. This signaling pathway is essential for T cell activation, proliferation, and differentiation. Alterations in the CBM pathway have been associated with lymphoma, immunodeficiency and autoimmune disorders. COMPOSITIONS OF THE DISCLOSURE First and Second Nucleic Acids

[0154] The present disclosure provides genetic circuits including a first and second nucleic acid. In some embodiments, the first nucleic acid construct encodes a chimeric receptor. In some embodiments, the chimeric receptor includes, from N-terminus to C-terminus, an extracellular ligand-binding domain having a binding affinity for a ligand (e.g., a ligand selected from those disclosed herein); a linking polypeptide; a transmembrane domain (TMD)comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain (ICD) comprising, in any order: (i) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule and an activation domain, and (ii) a transcriptional regulator inducible proteolytic cleavage sites; and an intracellular domain (ICD) comprising, in any order: (i) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule and an activation domain, and (ii) a transcriptional regulator, and wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at a ligand-inducible proteolytic cleavage site disposed between the ICD and the linking polypeptide, wherein binding of the selected ligand to the extracellular ligand-binding domain induces proximal signaling cascades through the intracellular SD, and wherein the chimeric receptor does not comprise a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor. In some embodiments, the chimeric receptor of the disclosure completely lacks the NRR of a Notch receptor. In some embodiments, the chimeric receptor of the disclosure comprises neither a LNR nor a HD of a Notch receptor

[0155] In some embodiments, the second nucleic acid encodes a caspase recruitment domain family member 11 (CARD11) polypeptide comprising comprising (i) a caspase recruitment domain (CARD) and (ii) one or more mutations, wherein the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator, wherein expression of the CARD11 polypeptide is modulated by the transcriptional regulator expressed by the first nucleic acid.

[0156] In some embodiments, the second nucleic acid encodes a polypeptide (e.g., a caspase recruitment domain family member 11 (CARD11) containing polypeptide) that is operably linked to a promoter, wherein expression of the protein of interest is modulated by the chimeric receptor transcriptional regulator. Any suitable promoter can be used in connection with the present disclosure. In some embodiments, the promoter comprises a yeast GAL4 promoter. In some embodiments, the second nucleic acid encoding the protein of interest is incorporated into the same nucleic acid molecule that encodes the chimeric receptor of the disclosure. In some embodiments, the second nucleic acid encoding the protein of interest is incorporated into a second expression vector that is separate from the nucleic acid molecule encoding the chimeric receptor of the disclosure.

[0157] In some embodiments of the of the disclosure, the first nucleic acid and the second nucleic acid are adjacent to one another on a single nucleic acid molecule. In some embodiments, the first nucleic acid and the second nucleic acid of the disclosure can be delivered to a cell via a single vector system.

[0158] In some embodiments of the disclosure, the first nucleic acid and the second nucleic acid construct are not adjacent and are on separate nucleic acid molecules. In some embodiments, the first nucleic acid and the second nucleic acid of the disclosure can be delivered via a dual vector system.

[0159] The nucleic acids of the disclosure can be used as T cell activity reporters in vitro and in vivo assays. The nucleic acids of the disclosure can be part of genetic circuits that are designed to work with CAR-T cell receptors to enhance T cell therapies in hematological malignancies such as, for example, multiple myeloma and solid tumors. The constructs can, for instance, effect pairing T cell activation with the production of a therapeutic payload (e.g., a CARD11 polypeptide) so as to drive cell fate down different lineages therefore optimizing T cell function after an encounter with an antigen. For example, as shown in FIG.3, a first nucleic acid may include a hybrid SynNotch CAR- that upon engaging a target antigen - can activate the T cell and trigger expression of CARD11-PIK3R3 thereby resulting in enhanced IL-2 production.

[0160] Nucleic acid molecules of the present disclosure can be of any length, including for example, between about 1.5 Kb and about 50 Kb, between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, for example between about 15 Kb to 30 Kb, between about 20 Kb and about 50 Kb, between about 20 Kb and about 40 Kb, about 5 Kb and about 25 Kb, or about 30 Kb and about 50 Kb.

[0161] In some embodiments, the nucleotide sequence is incorporated into an expression cassette or an expression vector. It will be understood that an expression cassette generally includes a construct of genetic material that contains coding sequences and enough regulatory information to direct proper transcription and / or translation of the coding sequences in a recipient cell, in vivo and / or ex vivo. Generally, the expression cassette may be inserted into a vector for targeting to a desired host cell and / or into an individual. As such, in some embodiments, an expression cassette of the disclosure include a coding sequence for thechimeric receptor as disclosed herein, which is operably linked to expression control elements, such as a promoter, and optionally, any or a combination of other nucleic acid sequences that affect the transcription or translation of the coding sequence.

[0162] In some embodiments, the nucleotide sequence is incorporated into an expression vector. It will be understood by one skilled in the art that the term “vector” generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and that may be used for the purpose of transformation, e.g., the introduction of heterologous DNA into a host cell. As such, in some embodiments, the vector can be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. In some embodiments, the expression vector can be an integrating vector.

[0163] In some embodiments, the expression vector can be a viral vector. As will be appreciated by one of skill in the art, the term “viral vector” is widely used to refer either to a nucleic acid molecule (e.g., a transfer plasmid) that includes virus-derived nucleic acid elements that generally facilitate transfer of the nucleic acid molecule or integration into the genome of a cell or to a viral particle that mediates nucleic acid transfer. Viral particles will generally include various viral components and sometimes also host cell components in addition to nucleic acid(s). The term viral vector may refer either to a virus or viral particle capable of transferring a nucleic acid into a cell or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. The term “retroviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The term “lentiviral vector” refers to a viral vector or plasmid containing structural and functional genetic elements, or portions thereof, including LTRs that are primarily derived from a lentivirus, which is a genus of retrovirus.

[0164] In some embodiments, provided herein are nucleic acid molecules encoding a polypeptide with an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein. In some embodiments, provided herein are nucleic acid molecules encoding a polypeptide with an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 88-89. In some embodiments, the nucleic acid molecules encode apolypeptide with an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 90-91.

[0165] The nucleic acid sequences of the disclosure can be optimized for expression in the host cell of interest. For example, the G-C content of the sequence can be adjusted to average levels for a given cellular host, as calculated by reference to known genes expressed in the host cell. Methods for codon usage optimization are known in the art. Codon usages within the coding sequence of the chimeric receptor disclosed herein can be optimized to enhance expression in the host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a particular host cell.

[0166] Some embodiments disclosed herein relate to vectors or expression cassettes including a recombinant nucleic acid molecule encoding the chimeric receptors disclosed herein. The expression cassette generally contains coding sequences and sufficient regulatory information to direct proper transcription and / or translation of the coding sequences in a recipient cell, in vivo and / or ex vivo. The expression cassette may be inserted into a vector for targeting to a desired host cell and / or into an individual. An expression cassette can be inserted into a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, as a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule, derived from any source, capable of genomic integration or autonomous replication, including a nucleic acid molecule where one or more nucleic acid sequences has been linked in a functionally operative manner, i.e., operably linked.

[0167] Also provided herein are vectors, plasmids, or viruses containing one or more of the nucleic acid molecules encoding any chimeric receptor or multi-chain receptor disclosed herein. The nucleic acid molecules can be contained within a vector that is capable of directing their expression in, for example, a cell that has been transformed / transduced with the vector. Suitable vectors for use in eukaryotic and prokaryotic cells are known in the art and are commercially available, or readily prepared by a skilled artisan. See for example, Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, F. M. (1987). Current Protocols in MolecularBiology. New York, NY: Wiley (including supplements through 2014); Bollag, D. M. et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, M. G. et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K. B., Ferré, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, E. A. (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, S. L. et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, S. C. (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference).

[0168] DNA vectors can be introduced into eukaryotic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals, such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock, and infection.

[0169] Viral vectors that can be used in the disclosure include, for example, retrovirus vectors, adenovirus vectors, and adeno-associated virus vectors, lentivirus vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, N.Y.). For example, a chimeric receptor as disclosed herein can be produced in a eukaryotic host, such as a mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, VA). In selecting an expression system, care should be taken to ensure that the components are compatible with one another. Artisans or ordinary skill are able to make such a determination. Furthermore, if guidance is required in selecting an expression system, skilled artisans may consult P. Jones, “Vectors: Cloning Applications”, John Wiley and Sons, New York, N.Y., 2009).

[0170] The nucleic acid molecules provided can contain naturally occurring sequences, or sequences that differ from those that occur naturally, but, due to the degeneracy of the genetic code, encode the same polypeptide, e.g., antibody. These nucleic acid molecules can consist of RNA or DNA (for example, genomic DNA, cDNA, or synthetic DNA, such as that produced by phosphoramidite-based synthesis), or combinations or modifications of the nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules can be double-stranded or single-stranded (e.g., either a sense or an antisense strand).

[0171] The nucleic acid molecules are not limited to sequences that encode polypeptides; some or all of the non-coding sequences that lie upstream or downstream from a coding sequence (e.g., the coding sequence of a chimeric receptor) can also be included. Those of ordinary skill in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can, for example, be generated by treatment of genomic DNA with restriction endonucleases, or by performance of the polymerase chain reaction (PCR). In the event the nucleic acid molecule is a ribonucleic acid (RNA), molecules can be produced, for example, by in vitro transcription. First Nucleic Acid Hybrid Receptors

[0172] In one aspect, the first nucleic acid encodes a chimeric receptor comprising from N- terminus to C-terminus an extracellular binding domain (ECD) having a binding affinity for a selected ligand; a linking sequence; a transmembrane domain (TMD) having at least about 80% sequence identity to the transmembrane domain of a Type 1 transmembrane receptor and comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain (ICD) comprising, in any order: (i) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule and an activation domain, and (ii) a transcriptional regulator. In some embodiments, the binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at a ligand-inducible proteolytic cleavage site disposed between the intracellular domain and the linking polypeptide. Further, the binding of the selected ligand to the extracellular ligand-binding domain can also induce proximal signaling cascades through the intracellular SD. In some embodiments, the proximal signaling cascades refer to fast time-scale signaling. For instance, the signaling cascades can be inducedin seconds to minutes. Alternatively, the signaling cascades can last for seconds to minutes. In some embodiments, such proximal signaling cascades are induced through T-cell receptor costimulatory signals. In addition, in some embodiments, the chimeric receptor provided herein does not comprise a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor. In some embodiments, the chimeric receptor of the disclosure comprises neither a LNR nor a HD of a Notch receptor. In some embodiments, the chimeric receptor of the disclosure completely lacks the NRR of a Notch receptor. In some embodiments, the linking polypeptide is capable of promoting oligomer formation of the chimeric receptor via intermolecular disulfide bonding. Extracellular domains (ECD) and ligands

[0173] In some embodiments, the ECD of the chimeric receptors disclosed herein has a binding affinity for one or more target ligands. The target ligand can be expressed on the surface of a cell, or is otherwise anchored, immobilized, or restrained so that it can exert a mechanical force on the chimeric receptor. The cell can be a pathogenic cell or a human cell. In some embodiments, the human cell can be a tumor cell. In some embodiments, the human cell can be a terminally differentiated cell. As such, without being bound to any particular theory, binding of the ECD of a chimeric receptor provided herein to a cell-surface ligand does not necessarily remove the target ligand from the target cell surface, but instead enacts a mechanical pulling force on the chimeric receptor. For example, an otherwise soluble ligand may be targeted if it is bound to a surface, or to a molecule in the extracellular matrix. In some embodiments, the target ligand is a cell-surface ligand. Non-limiting examples of suitable ligand types include cell surface receptors; adhesion proteins; carbohydrates, lipids, glycolipids, lipoproteins, and lipopolysaccharides that are surface-bound; integrins; mucins; and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0174] In some embodiments, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261,CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0175] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0176] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

[0177] In some embodiments, the ligand is a cluster of differentiation (CD) marker. In some embodiments, the CD marker is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD- L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, and MAGE.

[0178] In some embodiments, the extracellular domain includes the ligand-binding portion of a receptor. In some embodiments, the extracellular domain includes an antigen-binding moiety that binds to one or more target antigens. In some embodiments, the antigen-binding moiety includes one or more antigen-binding determinants of an antibody or a functional antigen- binding fragment thereof. One skilled in the art upon reading the present disclosure will readily understand that the term “functional fragment thereof” or “functional variant thereof” refers to a molecule having quantitative and / or qualitative biological activity in common with the wild- type molecule from which the fragment or variant was derived. For example, a functional fragment or a functional variant of an antibody is one which retains essentially the same ability to bind to the same epitope as the antibody from which the functional fragment or functional variant was derived. For instance, an antibody capable of binding to an epitope of a cell surface receptor may be truncated at the N-terminus and / or C-terminus, and the retention of its epitope binding activity assessed using assays known to those of skill in the art. In some embodiments, the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, an F(ab’)2 fragment, an F(ab) fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding moiety includes an scFv.

[0179] The antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified to provide desired and / or improved properties such as,e.g., binding affinity. Generally, the binding affinity of an antigen-binding moiety, e.g., an antibody, for a target antigen (e.g., CD19 antigen) can be calculated by the Scatchard method described by Frankel et al., Mol. Immunol, 16:101-06, 1979. In some embodiments, binding affinity is measured by an antigen / antibody dissociation rate. In some embodiments, binding affinity is measured by a competition radioimmunoassay. In some embodiments, binding affinity is measured by ELISA. In some embodiments, antibody affinity is measured by flow cytometry. An antibody that “selectively binds” an antigen (such as CD19) is an antigen- binding moiety that does not significantly bind other antigens but binds the antigen with high affinity, e.g., with an equilibrium constant (KD) of 100 nM or less, such as 60 nM or less, for example, 30 nM or less, such as, 15 nM or less, or 10 nM or less, or 5 nM or less, or 1 nM or less, or 500 pM or less, or 400 pM or less, or 300 pM or less, or 200 pM or less, or 100 pM or less.

[0180] A skilled artisan can select an ECD based on the desired localization or function of a cell that is genetically modified to express a chimeric receptor or hybrid SynNotch CAR of the present disclosure. For example, a chimeric receptor or hybrid SynNotch CAR with an ECD including an antibody specific for a HER2 antigen can target cells to HER2-expressing breast cancer cells. In some embodiments, the ECD of the disclosed hybrid SynNotch CARs is capable of binding a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA). A skill artisan will understand that TAAs include a molecule, such as e.g., protein, present on tumor cells and on normal cells, or on many normal cells, but at much lower concentration than on tumor cells. In contrast, TSAs generally include a molecule, such as e.g., protein which is present on tumor cells but absent from normal cells.

[0181] In some cases, the antigen-binding moiety is specific for an epitope present in an antigen that is expressed by a tumor cell, i.e., a tumor-associated antigen. The tumor-associated antigen can be an antigen associated with, e.g., a breast cancer cell, a B cell lymphoma, a pancreatic cancer, a Hodgkin lymphoma cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma, a lung cancer cell, a non-Hodgkin B-cell lymphoma (B-NHL) cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma cell, a melanoma cell, a chronic lymphocytic leukemia cell, an acute lymphocytic leukemia cell, a myelogenous leukemia cell, a neuroblastoma cell, a glioma, a glioblastoma, a colorectal cancer cell, etc. It will also be understood that a tumor-associated antigen may also be expressed by a non-cancerous cell. Insome embodiments, the antigen-binding domain is specific for an epitope present in a tissue- specific antigen. In some embodiments, the antigen-binding domain is specific for an epitope present in a disease-associated antigen.

[0182] Non-limiting examples of suitable target antigens include CD19, B7H3 (CD276), BCMA (CD269), alkaline phosphatase, placental-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal regulatory protein α (SIRPα), CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, DLL3. Claudin 18.2, GCC, LY6g6D, CLDN6, KLK2, KLK3, EGFR806, HER2p95, ADGRE2, MUC16, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD 117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, GUCY2C, STEAP1, STEAP2, and Axl.

[0183] In some embodiments, the target antigen is selected from CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma- associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 ( a subunit of the heterodimeric IL-2 receptor), CD3, CD4, CD5, IFN-α, IFN-γ,IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, scleroscin, SOST, TGFβ1, TNF-α, VEGF-A, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, Kappa light chain, Lamba light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and isovariants thereof, TEM-8, sperm protein 17 (Sp17), mesothelin.

[0184] Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (six-transmembrane epithelial antigen of the prostate 1), an abnormal ras protein, an abnormal p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7H3), or IL-13Rα. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen- binding moiety of the ECD is specific for a reporter protein, such as BFP, GFP, and eGFP. Non- limiting examples of such antigen binding moiety include a LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding moiety of the ECD includes an anti-BCMA fully-humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein α (SIRPα).

[0185] Additional antigens suitable for targeting by the chimeric receptors disclosed herein include, but are not limited to GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1.

[0186] Additional antigens suitable for targeting by the chimeric receptors disclosed herein include, but are not limited to, those associated with an inflammatory disease such as, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (a subunit of the heteromeric of IL-2 receptor), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, scleroscin, SOST, TGFβ1, TNF-α, and VEGF-A.

[0187] Further antigens suitable for targeting by the chimeric receptors disclosed herein include, but are not limited to the pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, Kappa light chain, Lamba light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and isovariants thereof, TEM-8, sperm protein 17 (Sp17), mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (six-transmembrane epithelial antigen of the prostate 1), an abnormal ras protein, an abnormal p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is GPC2, CD19, Her2 / neu, CD276 (B7H3), IL-13Rα1, or IL-13Rα2. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen-binding moiety of the ECD is specific for a reporter protein, such as GFP and eGFP. Non-limiting examples of such antigen binding moiety include a LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding moiety of the ECD includes an anti-BCMA fully-humanized VH domain (FHVH).

[0188] In some embodiments, antigens suitable for targeting by the chimeric receptors disclosed herein include ligands derived from a pathogen. For example, the antigen can be HER2 produced by HER2-positive breast cancer cells. In some embodiments, the antigen can be CD19 that is expressed on B-cell leukemia. In some embodiments, the antigen can be EGFR that is expressed on glioblastoma multiform (GBM) but much less expressed so on healthy CNStissue. In some embodiments, the antigen can be CEA that is associated with cancer in adults, for example colon cancer.

[0189] In some embodiments, the antigen-binding moiety of the ECD is specific for a cell surface target, where non-limiting examples of cell surface targets include CD19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD11α, and α-integrin. In some embodiments, the chimeric receptors disclosed herein include an extracellular domain having an antigen-binding moiety that binds CD19, CEA, HER2, MUC1, CD20, ALPPL2, BCMA, or EGFR. In some embodiments, the chimeric receptors provided herein include an extracellular domain including an antigen-binding moiety that binds CD19. In some embodiments, the chimeric receptors provided herein include an extracellular domain including an antigen-binding moiety that binds ALPPL2. In some embodiments, the chimeric receptors provided herein include an extracellular domain including an antigen-binding moiety that binds BCMA. In some embodiments, the chimeric receptors provided herein include an extracellular domain including an antigen- binding moiety that binds Her2. In some embodiments, the chimeric receptors and hybrid SynNotch CARs disclosed herein include an extracellular domain including an antigen-binding moiety that binds CD19, ALPPL2, BCMA, or Her2.

[0190] In some embodiments, the antigen-binding moiety specifically binds to a tumor- associated antigen selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117),IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0191] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, GCC, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0192] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

[0193] In some embodiments, the antigen-binding moiety specifically binds to a target antigen selected from the group consisting of BCMA, CD19, CD20, CD22, CD70, CD79A, CD79B, CD276 (B7H3), Claudin 6, Claudin 18.2, DLL3, GCC, GD2, GD3, GPC3, GPRC5D, LY6G6D, p53R175H, PRAME, and ROR1.

[0194] In some embodiments, the extracellular domain includes an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to a sequence set forth in SEQ ID NOS: 1-4. In some embodiments, the extracellular domain includes an amino acid sequence having at least 90% sequence identity to a sequence set forth in SEQ ID NOS: 1-4. In some embodiments, the extracellular domain includes an amino acid sequence having at least 95% sequence identity to a sequence set forth in SEQ ID NOS: 1-4. In some embodiments, the extracellular domain includes an amino acid sequence having 100% sequence identity to a sequence set forth in SEQ ID NOS: 1-4. In some embodiments, the extracellular domain includes an amino acid sequence set forth in SEQ ID NOS: 1-4, wherein one, two, three, four, or five of the amino acid residues in any one of the SEQ ID NOS: 1-4 is / are substituted by a different amino acid residue.Linking polypeptide sequence

[0195] As described above, the chimeric receptors of the disclosure include a linking polypeptide sequence or linking sequence disposed between the extracellular binding domain (ECD) and the transmembrane domain (TMD).

[0196] In some embodiments, the chimeric receptors of the disclosure can be “SynNotch” receptors which comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (e.g., including the NRR), a TMD, and an ICD. In some embodiments, the chimeric receptors of the disclosure can be “Fn Notch” receptors which comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats (“Fn”), a TMD, and an ICD. In some embodiments, the chimeric receptors of the disclosure can be “Mini Notch” receptors which comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD but lacking the NRR (which consists of the LIN-12-Notch repeat (LNR) modules and the heterodimerization domain (HD)), a TMD, and an ICD. In some embodiments, the chimeric receptors of the disclosure can be “Minimal Linker Notch” receptors which comprise a heterologous extracellular ligand binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (for example, without limitation, having a synthetic(GGS)n polypeptide sequence), a TMD, and an ICD. In some embodiments, the chimeric receptors of the disclosure can be “Hinge Notch” receptors which comprise a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with a synthetic receptor and / or an existing host receptor), a TMD, and an ICD.

[0197] In the Mini Notch receptors, the linking polypeptide is derived from a Notch JMD sequence after deletion of the NRR and HD domain. The Notch JMD sequence may be the sequence from Notch1, Notch2, Notch3, or Notch4, and can be derived from a non-human homolog, such as those from Drosophila, Gallus, Danio, and the like. Four to 50 amino acid residues of the remaining Notch sequence (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more, amino acid residues) can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide, such as the signal transduction level when ligand induced or in the absence of ligand.

[0198] In the Minimal Linker Notch receptors, the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence, including the Notch JMD sequence from Notch1, Notch2, Notch3, or Notch4, or a non-human homolog thereof. Four to 50 amino acid residues (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more, amino acid residues) can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure. The Minimal Linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or sites for other types of post-translational modification. In some embodiments, the Minimal Linker linker does not comprise a protease cleavage site or a glysosylation site.

[0199] In some embodiments, the linking polypeptide has substantial sequence identity with a Notch receptor JMD but lacks the NRR (which consists of the LIN-12-Notch repeat (LNR) modules and the heterodimerization domain), a TMD, and an ICD. Stated differently, in some embodiments, in the receptors of the present disclosure, the linking polypeptide replaces the negative regulatory region (NRR) and heterodimerization (HD) domain of the native Notch.Three to 50 amino acid residues (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence can be optimized to vary the orientation and / or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric receptor of the disclosure. All of these sequences can be used as a linking polypeptide for the chimeric receptors of the present disclosure.

[0200] In some embodiments, the linking polypeptide sequence includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a sequence set forth in SEQ ID NO: 8. In some embodiments, the linking polypeptide sequence includes an amino acid sequence having at least 90% sequence identity to a sequence set forth in SEQ ID NO: 8. In some embodiments, the linking polypeptide sequence includes an amino acid sequence having at least 95% sequence identity to a sequence set forth in SEQ ID NO: 8. In some embodiments, the linking polypeptide sequence includes an amino acid sequence having at least 99% sequence identity to a sequence set forth in SEQ ID NO: 8. In some embodiments, the linking polypeptide sequence includes an amino acid sequence identical to a sequence set forth in SEQ ID NO: 8. In some embodiments, the linking polypeptide sequence includes an amino acid sequence set forth in SEQ ID NO: 8, wherein one, two, three, four, or five of the amino acid residues in any one of the SEQ ID NO: 8 is / are substituted by a different amino acid residue.

[0201] In the Hinge Notch receptors, hinge linkers of the disclosure can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomer formation of the chimeric polypeptides via intermolecular disulfide bonding. In these instances, within the chimeric Notch receptors disclosed herein, the hinge domain generally includes a flexible polypeptide connector region disposed between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and TMD and also provides sites for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain includes motifs that promote dimer formation of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain includes motifs that promote timer formation of the chimeric polypeptides disclosed herein (e.g., a hinge domain derived from 0X40). Hinge polypeptide sequences suitable for the compositions and methods of the disclosure can be naturally-occurring hinge polypeptide sequences (e.g., those from naturally-occurring immunoglobulins) or can be engineered, designed, or modified so as to provide desired and / or improved properties, e.g., modulating transcription. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgGl hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs. Additional information in this regard can be found in, for example, a recent review by G. Vidarsson et al., Frontiers Immunol (2014) 5:520 (doi: 10.3389 / fimmu.2014.00520), which is hereby incorporated by reference in its entirety.

[0202] Hinge polypeptide sequences can also be derived from a CD8α hinge domain, a CD28 hinge domain, a CD 152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an 0X40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD8a hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an 0X40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0203] The Hinge linker can include about 5 to about 60 amino acids from or overlapping with the selected hinge domain, for example at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 12, at least about 15, at least about17, at least about 20, at least about 22, at least about 24, at least about 26, at least about 28, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, or , at least about 60 amino acids. In embodiments of the invention, the Hinge linker has no more than about 60 amino acids, less than about 55, less than about 50, less than about 45, less than about 40, less than about 35, less than about 32, less than about 30, less than about 29, less than about 28, less than about 27, less than about 26, less than about 25, less than about 24, less than about 23, less than about 22, less than about 21, less than about 20, less than about18, less than about 16, less than about 14, less than about 12, or less than about 10 amino acids.

[0204] In the Fn Notch receptors, the Fn Notch linking polypeptide is derived from the Robol JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeats and the TMD. The Fn Notch linking polypeptide does not contain a Notch negative regulatory region (NRR), or the Notch HD domain. The Fn linking polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises a Fn linking polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeats and the TMD can be from about 2 to about 30 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more, amino acid residues). In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 naturally-occurring amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence but having no more than one proline. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, where the amino acids are selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn linking polypeptide sequence can be varied to alter the orientation and / or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.

[0205] In some embodiments, the linker polypeptide sequence includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 9-27 in the Sequence Listing. In some embodiments, the linker polypeptide sequence includes an amino acid sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 9-27. In some embodiments, the linker polypeptide sequence includes an amino acid sequence having at least 95% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 9-27. In some embodiments, the linker polypeptide sequence includes an amino acid sequence having at least 100% sequence identity to a sequence selected from the group consisting of SEQ IDNOs: 9-27. In some embodiments, the linker polypeptide sequence includes an amino acid sequence having a sequence selected from the group consisting of SEQ ID NOs: 9-27, wherein one, two, three, four, or five of the amino acid residues in any one of the SEQ ID NOs: 9-27 is / are substituted by a different amino acid residue.

[0206] In some embodiments, the linker polypeptide sequence comprises a hinge domain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 19- 23. Transmembrane domains (TMD)

[0207] As described above, the chimeric receptors of the disclosure include a TMD comprising one or more ligand-inducible proteolytic cleavage sites.

[0208] Examples of proteolytic cleavage sites in a Notch receptor (e.g., S2 or S3) are as described above. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, a metalloproteinase cleavage site for a MMP selected from collagenase-1, -2, and -3 (MMP-1, - 8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). For example, the cleavage sequence of MMP-9 is Pro-X-X-Hy (wherein, X represents an arbitrary residue; Hy, a hydrophobic residue such as Leu, Ile, Val, Phe, Trp, Tyr, Val, Met, and Pro), e.g., Pro-X-X-Hy- (Ser / Thr), e.g., Pro-Leu / Gln-Gly-Met-Thr-Ser or Pro-Leu / Gln-Gly-Met-Thr. Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, e.g., a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences of uPA and tPA include sequences comprising Val-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser, where the protease cleaves between the glutamine and the serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys, where cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg. Additional suitable linkers comprising protease cleavagesites include sequences cleavable by the following proteases: a PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), a thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase l (MMP-l), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator(tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium activated neutral protease). Proteases that are not native to the host cell in which the receptor is expressed (for example, TEV) can be used as a further regulatory mechanism, in which activation of the receptor is reduced until the protease is expressed or otherwise provided. Additionally, a protease may be tumor-associated or disease-associated (expressed to a significantly higher degree than in normal tissue), and serve as an independent regulatory mechanism. For example, some matrix metalloproteases are highly expressed in certain cancer types.

[0209] Generally, the TMD suitable for the chimeric receptors disclosed herein can be any transmembrane domain of a Type 1 transmembrane receptor including at least one γ-secretase cleavage site. Detailed description of the structure and function of the γ-secretase complex as well as its substrate proteins, including amyloid precursor protein (APP) and Notch, can, for example, be found in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non- limiting suitable TMDs from Type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, wherein the TMD includes at least one γ-secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of the chimeric receptors of the disclosure is a TMD derivedfrom the TMD of a member of the calsyntenin family, such as, alcadein alpha and alcadein gamma. In some embodiments, the TMD of the chimeric receptors of the disclosure is a TMD known for Notch receptors. In some embodiments, the TMD of the chimeric receptors of the disclosure is a TMD derived from a different Notch receptor. For example, in a Mini Notch based on human Notch1, the Notch1 TMD can be substituted with a Notch2 TMD, Notch3 TMD, Notch4 TMD, or a Notch TMD from a non-human animal such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus. In some embodiments, the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-195. In some embodiments, the TMD comprises a polypeptide sequence having at most 1, 2, or 3, mutations compared to any one of SEQ ID NOS: 94-195. In some embodiments, the TMD comprises a polypeptide sequence having at most 1 mutation compared to any one of SEQ ID NOS: 94-195. In some embodiments, the mutation(s) are substitution(s). In some embodiments, the TMD comprises a polypeptide sequence of any one of SEQ ID NOS: 94-195. In some embodiments, the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-95, 99, 113, 132, 136, 147, and 157.

[0210] In some embodiments, the amino acid substitution(s) within the TMD includes one or more substitutions within a “GV” motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. For example, one, two, three, four, five, or more of the amino acid residues of the sequence FMYVAAAAFVLLFFVGCGVLL (SEQ ID NO: 5) may be substituted by a different amino acid residue. In some embodiments, the amino acid residue at position 18 and / or 19 of the “GV” motif within SEQ ID NO: 5 is substituted by a different amino acid residue. In some embodiments, the glycine residue at position 18 of SEQ ID NO: 5 is substituted by a different amino acid residue. In some embodiments, the valine residue at position 19 of SEQ ID NO: 5 is substituted by a different amino acid residue. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 5 with a mutation at the position corresponding to position 18 of SEQ ID NO: 5, such as G18A mutations. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 5 with a mutation at the position corresponding to position 19 of SEQ ID NO: 5, such as V19A mutations. The TMD can be derived from but longer or shorter than SEQ ID NO: 5. Forinstance, the TMD can be one, two, three, four, or more amino acids longer or shorter than SEQ ID NO: 5. In some embodiments, the TMD includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO: 5. Stop-transfer sequence (STS)

[0211] In some embodiments, the chimeric receptors of the disclosure include an STS which comprises a highly-charged, hydrophilic domain located C-terminally to the TMD. In some embodiments, the STS is linked to the TMD and the ICD in the following order, from N- terminus to C-terminus, TMD-STS-ICD (e.g., the STS is located between the TMD and the ICD). Without being bound to any particular theory, this highly-charged domain disposed between the TMD and the ICD prevents the ICD from entering the plasma membrane. In some embodiments, a single-chain peptide comprising about 1 to about 40 amino acid residues (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues) in which most of the residues have charged side chains under physiological conditions can be used as a STS. In short STS embodiments (e.g., less than about 6 amino acids), about 5 or 6 of the amino acids will have charged side chains. In some embodiments, the STS includes about 1 to 15, about 5 to 20, about 8 to 25, about 10 to 30, about 12 to 35, about 14 to 40, about 5 to 40, about 10 to 35, about 15 to 30, about 20 to 25, about 20 to 40, about 10 to 30, about 4 to 20, or about 5 to 25 amino acid residues. In some embodiments, the STS includes about 4 to 10, about 5 to 12, about 6 to 14, about 7 to 18, about 8 to 20, about 9 to 22, about 10 to 24, or about 11 to 26 amino acid residues. In some embodiments, the STS includes about 4 to 10 residues, such as, 4, 5, 6, 7, 8, 9, or 10 amino acid residues.

[0212] In some embodiments, the STS includes a sequence having at least about 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to the STS domain of a Type 1 receptor. In some embodiments, the STS includes an amino acid sequence having at least 90% sequence identity to the STS domain of a Type 1 receptor. In some embodiments, the STS includes a sequence having at least 70% sequence identity, such as, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a STS sequence from APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2,KCNEl, KCNE2, CHL1, LRP1, LRP2, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DOT, VASN, FLT1, CDH5, PKHD1, NECTINl, KL, IL6R, EFNBl, CD44, CLSTN1, LRP8, PCDHGC3, NRGl, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notchl, Notch2, Notch3, and Notch4. In some embodiments, the STS includes a sequence comprising only Lys (K) or Arg (R) in the first 4 residues. In some embodiments, the STS includes one, two, three, four, five, or more basic residues. In some embodiments, the STS includes five, four, three, two, one, or zero aromatic residues or residues with hydrophobic and / or bulky side chains.

[0213] In some embodiments, the STS includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to SKRKRKH (SEQ ID NO: 6). In some embodiments, the STS includes an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 6. The STS can be derived from but longer or shorter than SEQ ID NO: 6. For instance, the STS can be one, two, three, four, or more amino acids longer or shorter than SEQ ID NO:6. In some embodiments, the STS includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO:6. In some embodiments, the STS includes an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 6. In some embodiments, the STS includes an amino acid sequence having at least 100% sequence identity to SEQ ID NO: 6. In some embodiments, the STS includes the amino acid sequence of SEQ ID NO: 6, wherein one, two, three, four, or five of the amino acid residues in SEQ ID NO: 6 is / are substituted by a different amino acid residue. Intracellular Domain (ICD)

[0214] The chimeric receptors of the disclosure includes an intracellular domain (ICD) comprising, in any order: (i) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule and an activation domain, and (ii) a transcriptional regulator. In other words, the ICD of the chimeric receptors of the disclosure can have at least three distinct domains. The three distinct domains can be arranged in specific orders, and can be operably linked to one another via one or more linkers. In some embodiments, the three distinct domains are linked via (GS)n linkers. The n can be any numberselected from 1 to 100. For example, the n can be 2, 3, 4, 5, 6, 7, 8, 9, or 10. In other embodiments, the n can be 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. An exemplary GS linker can have 4 GS repeats and the sequence of GSGSGSGS (SEQ ID NO: 7). One skilled in the art would know how to modify the linker to suit specific uses.

[0215] In some embodiments, the intracellular domain of the chimeric receptors of the disclosure further comprises an intracellular signaling domain. As used herein, an intracellular domain can be a polypeptide chain with binding motifs or phosphorylation sites. When a receptor is bound and activated, the intracellular signaling domains transmit external signals through these phosphorylation or binding events, inducing an intracellular signaling cascade, ultimately causing changes in cell metabolism, gene expression, etc. The intracellular signaling domain can have at least two distinct domains: at least one costimulatory domain and an activation domain.

[0216] In some embodiments, the costimulatory domain comprises a sequence that is derived from a signaling molecule. The signaling molecule can be a protein selected from a class 1 or a class 3 human membrane protein. In some embodiments, the signaling molecule is selected from CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BTN3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, EDAR, XEDAR, RELT, DR6, TROY, NGFR, CD22, SIGLEC-3, SIGLEC-5, SIGLEC-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Allergin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC, and derivatives, mutants, variants, fragments and combinations thereof. In other embodiments, the signaling molecule is selected from the list consisting of OX40, ICOS, 4-1BB, CTLA4, CD28, CD30, CD2, CD27, and CD226, and derivatives, mutants, variants, fragments and combinations thereof. In some embodiments, the signaling molecule is selected from the group consisting of 4-1BB, BAFF-R, BCMA, BTLA, CD2, CD200R, CD244, CD28, CD300a, CD300f, CD40, CD7, CD72, CD96, CRACC, CRTAM, CTLA4, CXADR, DC-SIGN, GITR, HAVCR2, ICOS, ILT2, ILT3, ILT4, KIR2DL1, KIR3DL1, KLRG1, LAG3, LAIR1, NKG2D, NKR-P1A, NTB-A, PD1, Siglec-3, TACI, TIGIT, TLT-1, and TNR8 (CD30), and derivatives,mutants, variants, fragments and combinations thereof. In other embodiments, the signaling molecule is CD28 or 4-1BB. In one exemplary embodiment, the costimulatory domain comprises a sequence that is derived from CD28. In another exemplary embodiment, the costimulatory domain comprises a sequence that is derived from 4-1BB. In another embodiment, the costimulatory domain comprises one of the CD28 signaling motifs appended to the C terminus of a trunc41BB costimulatory domain.

[0217] In some embodiments, the activation domain includes one or more conserved amino acid motifs that serve as substrates for phosphorylation such as, for example, immunoreceptor tyrosine-based activation motifs (ITAMs). In some embodiments, the activation domain includes at least 1, at least 2, at least 3, at least 4, or at least 5 specific tyrosine-based motifs selected from ITAM motifs, an ITIM motifs, or related intracellular motifs that serve as a substrate for phosphorylation. In some embodiments of the disclosure, the activation domain of the intracellular signaling domain includes at least 1, at least 2, at least 3, at least 4, or at least 5 ITAMs. Generally, any activation domain including an ITAM can be suitably used for the construction of the chimeric receptors as described herein. An ITAM generally includes a conserved protein motif that is often present in the tail portion of signaling molecules expressed in many immune cells. The motif may include two repeats of the amino acid sequence YxxL / I separated by 6-8 amino acids, wherein each x is independently any amino acid, producing the conserved motif YxxL / Ix(6-8)YxxL / I. ITAMs within signaling molecules are important for signal transduction within the cell, which is mediated at least in part by phosphorylation of tyrosine residues in the ITAM following activation of the signaling molecule. ITAMs may also function as docking sites for other proteins involved in signaling pathways

[0218] In some embodiments, the activation domain is derived from CD3ζ, CD3σ, CD3 / , and CD3ɛ. For instance, in some embodiments, the ITAMs are derived from CD3ζ, CD3σ, CD3 / , and CD3ɛ. In one exemplary embodiment, the ITAM is derived from CD3ζ. In certain embodiments, the ITAM comprises a sequence that is at least about 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical to a CD3ζ ITAM. In some embodiments, the activation domain comprises at least 1, at least 2, at least 3, at least 4, or at least 5 ITAMs independently selected from the ITAMs derived from CD3ζ, FcRγ, and combinations thereof. In some embodiments, the activation domain comprises a CD3ζ ITAM.

[0219] In some embodiments, the intracellular domain of the chimeric receptors of the disclosure further comprises a transcriptional regulator. The transcriptional regulator is a biochemical element that acts to activate or repress the transcription of a promoter-driven DNA sequence. Transcriptional regulators suitable for the compositions and methods of the disclosure can be naturally-occurring transcriptional regulators or can be engineered, designed, or modified so as to provide desired and / or improved properties, e.g., modulating transcription. Any one of the transcriptional regulators can include a human or humanized sequence. In some embodiments, the transcriptional regulator directly regulates expression of one or more genes involved in differentiation of the cell. In some embodiments, the transcriptional regulator indirectly modulates expression of one or more genes involved in differentiation of the cell by modulating the expression of a second transcription factor which in turn modulates expression of one or more genes involved in differentiation of the cell. It will be understood by a skilled artisan that a transcriptional regulator can be a transcriptional activator or a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional activator.

[0220] In some embodiments, the transcriptional regulator includes a DNA-binding domain and an effector domain. As described in further detail below, exemplary effector domains suitable for the receptors of the disclosure include, but are not limited to, transcriptional activating domains, transcriptional repressor domains, epigenetic effector domains, and DNA modifying enzymes.

[0221] In some embodiments, the DNA-binding domain used in the transcriptional regulator is derived from human transcription factors. For example, transcription factors from which DNA-binding domains can be obtained include human homeodomain-containing polypeptides, such as, for example, Oct-3 / 4, Cdx-2, Gbx2, Gshl, HesXl, HoxAI O, HoxAl, and HoxBl. Additional human homeodomain- containing polypeptides from which suitable DBDs can be obtained include Irx2, Isl1, Meisl, Meox2, Nanog, Nkx2.2, Onecut, Otxl, Oxt2, Pax5, Pax6, Pdxl, Tcfl, Tcf2, and Zfhxl.

[0222] In some embodiments, DNA-binding domains used in the transcriptional regulator disclosed herein are derived from human zinc finger domain-containing polypeptides, such as, for example, Klf-4, Atbfl, Esrrb, Gcnf, Jarid2, Jmjdl a, Jmjd2c, Klf-3, Klf-5, Mel-18, Myst3, and Nad. Additional human zinc finger domain-containing polypeptides from which suitableDBDs can be obtained include REST, Rex-1, Rybp, Sal14, SalM, Tif1, YY1, Zeb2, Zfp281, Zfp57, Zic3, Coup-Tf1, Coup-Tf2, Bmi1, Rnf2, Mta11 Piasl, Pias2, Pias3, and Piasy.

[0223] In some embodiments, DNA-binding domains incorporated into the transcriptional regulator of the receptors disclosed herein are derived from human HMG-box domain containing polypeptides, such as, for example, Sox-2, Sox-6, Sox-9, Sox-10, Sox-15, Lef1, Tcf- 7, Tcf711. Human bHLH domain-containing proteins from which suitable DNA-binding domains can be obtained include, but are not limited to c- Myc, L-Myc, N-Myc, Hand1,, Mad1, Mad3, Mad4, Mxil, Myf5, Neurog2, Ngn3, Olig2, Tcf3, and f4. Non-limiting examples of forkhead / winged helix domain polypeptides from which suitable DNA-binding domains can be obtained include Foxd and Foxd3.

[0224] In some embodiments, DNA-binding domains incorporated into the transcriptional regulator of the receptors disclosed herein are derived from (i) HTH domain containing polypeptides, such as BAF155 and the like; (ii) leucine zipper domain containing polypeptides such as, for example, C / EBRb and mafa; (iii) T-box domain containing polypeptides such as, for example, Eomes and Tbx-3 ; (vi) RFX domain containing polypeptides such as Rfx4 and the like; and (v) STAT domain containing polypeptides such as Stat3 and the like.

[0225] In some embodiments, DNA-binding domains incorporated into the transcriptional regulator of the receptors disclosed herein can be derived from a human hepatocyte nuclear factor 1 homeobox A (HNF 1 a) protein, a human hepatocyte nuclear factor 1 homeobox B (HNF1β) protein, a human paired box protein (Pax-6), a human paired box protein (Pax-1) protein, a human paired box protein (Pax-2) protein, a human paired box protein (Pax-3) protein, a human paired box protein (Pax-4), or a human paired box protein (Pax-7).

[0226] In some embodiments, the DNA-binding domain is derived from a human hepatocyte nuclear factor 1 homeobox A (HNF 1a) protein. In some embodiments, the HNF 1α DNA- binding domain includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 243,

[0227] In some embodiments, the DNA-binding domain is derived from a human paired box protein, Pax6. In some embodiments, the Pax6 DNA-binding domain includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 244.

[0228] As outlined above, the transcriptional regulator of the receptors disclosed herein includes a second domain through which the transcriptional effector exerts its effect (effector domain). In some embodiments, the transcriptional regulator directly regulates differentiation of the cell. It will be understood by one having ordinary skill in the art that a transcriptional effector can be a transcriptional activator or a transcriptional repressor.

[0229] Exemplary effector domains suitable for the receptors of the disclosure include, but are not limited to, transcriptional activating domains, transcriptional repressor domains, epigenetic effector domains, and DNA modifying enzymes. In some embodiments, the transcriptional regulator is a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional activator. In some embodiments, the transcriptional regulator directly regulates differentiation of the cell. In some embodiments, the transcriptional regulator indirectly modulates (e.g., regulates) differentiation of the cell by modulating the expression of a second transcription factor.

[0230] Accordingly, in some embodiments, the effector domain of the transcriptional regulator includes a transcription-activating domain. Non-limiting examples of transcription- activating domains suitable for use in the compositions and methods disclosed herein include a p65 activation domain of NFKB; and a histone acetyltransferase core domain of the human El A- associated protein p300 (p300 HAT core activation domain). In some embodiments, the effector domain of the transcriptional effector includes a p65 activation domain of NFKB. In some embodiments, the p65 effector domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 245-246.

[0231] In some embodiments, the effector domain of the transcriptional regulator includes a human or humanized transcription repressor domain. Non-limiting examples of transcription repressor domains suitable for use in the compositions and methods disclosed herein include a Kruppel associated box repression domain (KRAB); a Repressor Element Silencing Transcription Factor repression domain (REST); a WRPW motif of the hairy-related basic helix- loop-helix repressor proteins repression domain (WRPW); a DNA (cytosine-5)- methyltransferase 3B repression domain (DNMT3B); and an HP1 alpha chromoshadow repression domain. In some embodiments, the transcription repressor domain includes a KRAB repressor domain.

[0232] In some embodiments, the effector domain of the transcriptional regulator includes a human or humanized epigenetic effector domain. Examples of epigenetic effector domain suitable for use in the compositions and methods disclosed herein include, but are not limited to, DNA methyltransferases DNMT (DNMT1, DNMT3), HAT1, GCN5, PCAF, MLL, SET, DOT1, SUV39H, G9a, KAT2A / B, EZH1 / 2, TET1 / 2, SIRT family protein effector domains, histone deacetylases, LSD1, and KDM family protein effector domains.

[0233] Effectors domains suitable for the compositions and methods of the disclosure can be naturally-occurring transcriptional effectors or can be engineered, designed, or modified so as to provide desired and / or improved properties, e.g., modulating transcription a eukaryotic cell. In some embodiments, the effector domain is derived from an animal protein. In some embodiments, the effector domain is derived from a mammalian protein. In some embodiments, the effector domain is derived from non-human primate protein. In some embodiments, the effector domain is derived from a human protein.

[0234] In some embodiments, the DBD of the transcriptional effector is N-terminally linked to its effector domain.

[0235] In some embodiments, the transcriptional regulator can further include a nuclear localization signal. In some embodiments, the transcriptional regulator comprises a nuclear localization sequence derived from Gal4, tetR, ZFHD1, or HAP1.

[0236] In other embodiments, the transcriptional regulator comprises a transcriptional regulator sequence derived from VP64, VP65, KRAB, or VP16. In certain embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4- VP64. In some embodiments, the ICD includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to one or more of SEQ ID NOs: 29-46. In some embodiments, the ICD includes an amino acid sequence having at least 90% sequence identity to one or more of SEQ ID NOs: 29-46. In some embodiments, the ICD includes an amino acid sequence having at least 95% sequence identity to one or more of SEQ ID NOs: 29-46. In some embodiments, the ICD includes an amino acid sequence having at least 100% sequence identity to one or more of SEQ ID NOs: 29-46. In some embodiments, the ICD includes an amino acid sequence of one or more of SEQ ID NOs: 29-46, wherein one, two, three, four, or five of theamino acid residues in one or more of SEQ ID NOs: 29-46 is / are substituted by a different amino acid residue.Additional Domains

[0237] In some embodiments, the chimeric receptors provided herein can further include an additional region or domain. For example, in some embodiments, the extracellular domains located N-terminally to the TMD can include a membrane localization signal such as a CD8A signal. In other embodiments, the chimeric receptors can include a detectable label, such as a myc tag or His tag, and the like. In additional embodiments, the chimeric receptors provided herein can also include a tumor-specific cleavage site, or a disease-specific cleavage site. In further embodiments, the chimeric receptors provided herein can include a combination of these additional regions.

[0238] In some embodiments, the chimeric receptor of the disclosure includes an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein. In some embodiments, provided herein are chimeric receptors including an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 88-89.Second Nucleic AcidsCARD11-PIK3R3 Fusion

[0239] In one aspect, the second nucleic acid encodes a caspase recruitment domain family member 11 (CARD11) polypeptide comprising one or more mutations that is operably linked to a promoter. In some embodiments, the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator. In some embodiments, the response element is comprised within the promoter. The response elements of the disclosure can be from various species. In some embodiments, the response elements are from mouse. In some embodiments, the response elements are from rat. In some embodiments, the response elements are from human.

[0240] The term “response element” can refer to a nucleic acid sequence or a DNA sequence within a gene promoter or enhancer that can bind specific transcription factors that regulate gene transcription. The transcription factors can be gene repressors or activators.

[0241] In some embodiments, expression of the CARD11 polypeptide is modulated by the transcriptional regulator of the first nucleic acid encoding the chimeric receptor.

[0242] In some embodiments of the second nucleic constructs of the disclosure, the polypeptides can include more than one mutation. For example, one or two or three or four or five or more mutations. In some embodiments, the mutations are a combination of different types of mutations. The different types of mutations can be point mutations, gene fusions, substitutions, gain-of-function mutations, stop-gain mutations, insertion mutations, deletion mutations, duplication mutations or translocations.

[0243] In some embodiments, the second nucleic acid constructs of the disclosure encode a polypeptide a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:47 and comprising a substitution at an amino acid position 361, 615, 634, 655, 357 or combinations thereof. In some embodiments, the substitution is Y361C, S615F, E634K, S655C and / or D357N. In some embodiments the second nucleic acid constructs of the disclosure encode a polypeptide a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 47 and comprising at least one, two or more substitutions at an amino acid position 361, 615, 634, 655, 357. In some embodiments, the second nucleic acid constructs encode a polypeptide having E634K and S655C mutations. In some embodiments, the second nucleic acid construct encodes a substitution selected from the group consisting of: Y361C, S615F, E634K, D357N, S655C, and any combination thereof.

[0244] In some embodiments, the second nucleic acid constructs of the disclosure encode a polypeptide a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 28 and comprising a substitution at an amino acid position 361, 615, 634, 655, 357 or combinations thereof. In some embodiments, the substitution is Y361C, S615F, E634K, S655C and / or D357N. In some embodiments the second nucleic acid constructs of the disclosure encode a polypeptide a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 28 and comprising at least one, two or more substitutions at an amino acid position 361, 615, 634, 655, 357. In some embodiments, thesecond nucleic acid constructs encode a polypeptide having E634K and S655C mutations. In some embodiments, the second nucleic acid construct encodes a substitution selected from the group consisting of: Y361C, S615F, E634K, D357N, S655C, and any combination thereof.

[0245] In some embodiments, the mutation is a fusion between a CARD11 polypeptide and a phosphoinositide-3-kinase regulatory subunit 3 (PIK3R3) polypeptide or any truncations thereof. In some embodiments, the second nucleic acid constructs include a CARD11-PIK3R3 fusion polypeptide or truncations thereof including an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 48-55, or SEQ ID NO:57-65. In some embodiments, the truncations are encoded by a nucleic acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to 66-81, or SEQ ID NO: 56.

[0246] In some embodiments, the CARD11-PIK3R3 fusion polypeptide includes a CARD domain, a coiled-coil domain, and an SH2 domain from PIK3R3.

[0247] In some embodiments of the second nucleic acid constructs of the disclosure, includes a CARD11-PIK3R3 fusion polypeptide encoded by a nucleic acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 67-81, or SEQ ID NO: 56.

[0248] In some embodiments of the second nucleic acid constructs of the disclosure, the polypeptide includes a first polypeptide encoding a partial CARD11 polypeptide and a second polypeptide encoding a partial PIK3R3 polypeptide. In some embodiments, the first polypeptide includes an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 82. In 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 83.

[0249] In some embodiments, the second nucleic acid constructs of the disclosure includes a promoter. The promoter can be any promoter. The promoter can be a T cell promoter, or aninducible promoter. The promoter can be active in a subset of T cells. In some embodiments, the promoter comprises a yeast GAL4 promoter.

[0250] In some embodiments, the promoter can be a constitutive promoter. Examples of constitutive promoters include but are not limited to CD4 promoter, CD8a promoter, CD8b promoter, TCRa promoter, TCRb promoter, CD3d promoter, CD3g promoter, CD3e promoter, or a CD3z promoter. In some embodiments, the promoter is a minimal TATA promoter, a pGK, actin promoter, CD25 promoter, IL2 promoter, IL7 promoter, IL15 promoter, KLRG-1 promoter, HLA-DR promoter, CD38 promoter, CD69 promoter, Ki-67 promoter, CD11a promoter, CD58 promoter, CD99 promoter, CD62L promoter, CD103 promoter, CCR4 promoter, CCR5 promoter, CCR6 promoter, CCR9 promoter, CCR10 promoter, CXCR3 promoter, CXCR4 promoter, CLA promoter, Granzyme A promoter, Granzyme B promoter, Perforin promoter, CD57 promoter, CD161 promoter, IL-18Ra promoter,CD69 promoter, GzmB promoter, T-bet promoter, IFNgamma promoter, TIM3 promoter, IL4 promoter, GATA3 promoter, IL1 promoter, IL5 promoter, IL6 promoter, IL13 promoter, IL10 promoter, IL17A promoter, IL6 promoter, IL21 promoter, IL23R promoter, FoxP3 promoter, CTLA4 promoter, CD25 promoter, PD1 promoter, CD45RO promoter, CCR7 promoter, CD28 promoter, CD95 promoter, CD28 promoter, CD27 promoter, CD127 promoter, PD-1 promoter, CD122 promoter, CD132 promoter, c-Kit promoter, nuclear factor of activated T cells (NFAT) promoter, programmed death 1 (PD-1) promoter, T cell immunoglobulin mucin-3 (TIM-3) promoter, cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, lymphocyte-activation protein 3 (LAG-3) promoter, tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) promoter, B- and T-lymphocyte attenuator (BTLA) promoter, CD25 promoter, CD69 promoter, Fas ligand (FasL) promoter, TIGIT promoter, TGF-beta promoter, T-bet promoter, Eomes promoter, GATA3 promoter, CD45RA promoter, 2B4 promoter, Type I interferon (IFN) alpha, Type I IFN beta promoter, IFN gamma promoter, IRF3 promoter, IRF7 promoter, NF-κB promoter, AP-1 promoter, TNF-alpha promoter, and CD130 promoter, NR4A1 promoter, NR4A2, or NR4A3 promoter.

[0251] In some embodiments, the promoter is selected from the group consisting of an MND promoter, an EF1a promoter, a sEF1a promoter, a gamma retroviral LTR promoter, a CD4 promoter, a CD8a promoter, a CD8b promoter, a TCRalpha promoter, a TCRbeta promoter, a CD3γ promoter, a CD3δ promoter, a CD3ε promoter, a CD3ζ promoter, a minimal TATApromoter, a pGK, actin promoter, a CD25 promoter, an IL2 promoter, an IL7 promoter, an IL15 promoter, a KLRG-1 promoter, a HLA-DR promoter, a CD38 promoter, a CD69 promoter, a Ki-67 promoter, a CD11a promoter, a CD58 promoter, a CD99 promoter, a CD62L promoter, a CD103 promoter, a CCR4 promoter, a CCR5 promoter, a CCR6 promoter, a CCR9 promoter, a CCR10 promoter, a CXCR3 promoter, a CXCR4 promoter, a CLA promoter, a Granzyme A promoter, a Granzyme B promoter, a Perforin promoter, a CD57 promoter, a CD161 promoter, an IL-18Ra promoter, a CD69 promoter, a GzmB promoter, a T-bet promoter, an IFNgamma promoter, an IL4 promoter, a GATA3 promoter, an IL1 promoter, an IL5 promoter, an IL6 promoter, an IL13 promoter, an IL10 promoter, an IL17A promoter, an IL6 promoter, an IL21 promoter, an IL23R promoter, a FoxP3 promoter, a CTLA4 promoter, a CD25 promoter, a CD45RO promoter, a CCR7 promoter, a CD28 promoter, a CD95 promoter, a CD28 promoter, a CD27 promoter, a CD127 promoter, a CD122 promoter, a CD132 promoter, a c-Kit promoter, a nuclear factor of activated T cells (NFAT) promoter, a programmed death 1 (PD-1) promoter, a T cell immunoglobulin mucin-3 (TIM-3) promoter, a cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, a lymphocyte-activation protein 3 (LAG-3) promoter, a tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) promoter, a B- and T-lymphocyte attenuator (BTLA) promoter, a CD25 promoter, a CD69 promoter, a Fas ligand (FasL) promoter, a TIGIT promoter, a TGF-beta promoter, a T-bet promoter, an Eomes promoter, a CD45RA promoter, a 2B4 promoter, a Type I interferon (IFN) alpha, a Type I IFN beta promoter, an IFN gamma promoter, an IRF3 promoter, an IRF7 promoter, a NFkB promoter, an AP-1 promoter, a TNF-alpha promoter, a CD130 promoter, a NR4A1 promoter, a NR4A2, a NR4A3 promoter, and any combination thereof.

[0252] In some embodiments, the promoter is selected from the group consisting of a TCRalpha promoter, a TCRbeta promoter, a gamma retroviral LTR promoter, an IL2 promoter, a nuclear factor of activated T cells (NFAT) promoter, an NR4A1 promoter, an MND promoter, an EF1a promoter, and a sEF1a promoter. Other First Nucleic Acids

[0253] As described below, the present disclosure also contemplates additional receptor architectures that can be encoded by the first nucleic acid described herein. Multi-Chain Receptors

[0254] In some embodiments, the first nucleic acid can be a nucleic acid encoding multi-chain chimeric polypeptides having two distinct polypeptides (chains) such that a transcriptional regulator is located on the first polypeptide close to the membrane and a signaling domain is located on the second polypeptide. The first polypeptide and the second polypeptide can associate to allow, in a ligand dependent manner, the simultaneous modulation of signaling (e.g., T-cell signaling) from one chain and the release of the transcriptional regulator, upon binding of a select ligand to one of the polypeptides.

[0255] In some embodiments, the first and the second polypeptides of the multi-chain chimeric receptor are not covalently connected.

[0256] Particularly, the disclosure relates to multi-chain chimeric polypeptides with distinct polypeptide chains that can associate post-translationally via residues located within the TMD of the first and second polypeptide. Ligand binding to the extracellular ligand binding domain (ECD) of the first polypeptide, can activate cell signaling and cleavage release of a transcriptional regulator from the first polypeptide. The cleaved transcriptional regulator can function, therefore, free of any other fused signaling domain and vice versa.

[0257] In some embodiments, the multi-chain chimeric polypeptides presented herein can have the following unique architecture in which the first polypeptide may include (i) an extracellular ligand-binding domain having a binding affinity (specificity) for a selected ligand, (ii) a first TMD with a first modified interface and (iii) a first intracellular domain with a transcriptional regulator. The second polypeptide may include (i) a second TMD having a second interface and (ii) a second intracellular domain with a signaling domain. The first and the second polypeptide can associate via charged residues within the first modified interface and the second interface. In some embodiments, the first modified interface comprises a positively charged residue, and wherein the second modified interface comprises a negatively charged residue, and wherein the first and the second polypeptides of the multi-chain chimeric receptor are coupled via the electrostatic force between the first and the second modified interfaces.Binding of the select ligand to the extracellular ligand-binding domain can simultaneously induce activity of the signaling domain and release of the transcriptional regulator.

[0258] The design of the multi -chain polypeptides of the disclosure can improve the functionality of previously described multi-chain chimeric receptors. By incorporating signaling domains in the multi-chain format of the disclosure, a skilled in the art can effectively couple auxiliary functions to a transcriptional response and have both activated at the same time and in response to the same antigen. Auxiliary functions can include, for example, destroying cells (through the use of immunoreceptor tyrosine-based activation motif (ITAM) domains on the signaling chain) or promoting survival signaling through the use of costimulatory domains (such as 41BB, CD28 costimulatory domains, etc).

[0259] In some embodiments of the multi-chain chimeric polypeptide of the disclosure, the first modified interface comprises a positively charged residue, the second interface comprises a negatively charged residue, and the first polypeptide is coupled to the second polypeptide via the electrostatic force between the first and the second modified interfaces.

[0260] In a further aspect, provided herein are multi-chain chimeric polypeptides that can enable simultaneous transcriptional regulation and cellular activation (e.g., T cell activation), upon binding of a selected ligand to the extracellular-ligand binding domain of the first polypeptide of the multi -chain chimeric polypeptides of the disclosure.

[0261] In some embodiments, the multi-chain chimeric polypeptides of the disclosure can be immunoreceptors. In some embodiments, the immunoreceptors are chimeric antigen receptors (CARS).First Polypeptides

[0262] The multi-chain polypeptides of the disclosure include a first chimeric polypeptide having an extracellular ligand-binding domain (moiety) with a binding affinity for a selected ligand, a first TMD having a first modified interface, a first intracellular domain and one or more transcriptional regulators.

[0263] In some embodiments, the first polypeptides of the disclosure include in order from the N-terminus to the C -terminus (i) the extracellular ligand-binding domain, (ii) the first TMD, and (iii) the first ICD.

[0264] In some embodiments, the first polypeptides of the disclosure include an amino acid sequence that is has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 84 or SEQ ID NO: 85 or functional variants thereof.Extracellular Ligand-Binding Domains (ECD)

[0265] In some embodiments, the extracellular domains (ECDs) of the first polypeptide of the multi-chain chimeric polypeptides disclosed herein have a binding affinity for one or more target ligands. The target ligand can be expressed on a cell surface, or otherwise be anchored, immobilized, or restrained so that it can exert a mechanical force on the chimeric receptor. As such, without being bound to any particular theory, binding of the ECD of the first polypeptide of the multi-chain chimeric polypeptides provided herein to a cell-surface ligand does not necessarily remove the target ligand from the target cell surface, but instead enacts a mechanical pulling force on the chimeric receptor. For example, an otherwise soluble ligand may be targeted if it is bound to a surface, or to a molecule in the extracellular matrix.

[0266] In some embodiments, the target ligand is a cell-surface ligand. Non-limiting examples of suitable ligand types include cell surface receptors; adhesion proteins; carbohydrates, lipids, glycolipids, lipoproteins, and lipopolysaccharides that are surface-bound; integrins, mucins; and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligands include tumor associated antigens or tumor-specific antigens. In some embodiments, the ligand is a cluster of differentiation ligand (CD) and includes but is not limited to CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD- L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), or signal regulatory protein a (SIRPα).

[0267] In some embodiments, the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261,CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0268] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0269] In some embodiments, the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

[0270] In some embodiments, the extracellular domains of the first polypeptide of the multi- chain chimeric polypeptides of the disclosure includes an antigen-binding moiety. In some embodiments, the antigen-binding moiety can bind to a ligand on the surface of a cell. In some embodiments, the antigen-binding moiety can bind one or more targets. In some embodiments, the antigen-binding moiety includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof. One skilled in the art upon reading the present disclosure will readily understand that the term "functional fragment thereof" or "functional variant thereof" refers to a molecule having quantitative and / or qualitative biological activity in common with the wild-type molecule from which the fragment or variant was derived. For example, a functional fragment or a functional variant of an antibody is one which retains essentially the same ability to bind to the same epitope as the antibody from which the functional fragment or functional variant was derived. For instance, an antibody that can bind to an epitope of a cell surface receptor may be truncated at the N-terminus and / or C-terminus, and the retention of its epitope binding activity assessed using assays known to those of skill in the art. The antigen-binding moiety can be, but is not limited to, an antibody, a nanobody, a diabody, a triabody, a minibody, an F(ab′)2 fragment, an F(ab) fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), and any functional fragment thereof.

[0271] The antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified to provide desired and / or improved properties such as, e.g., binding affinity. Generally, the binding affinity of an antigen-binding moiety, e.g., an antibody, for a target antigen (e.g., CD19 antigen) can be calculated by the Scatchard method described by Frankel et al., Mol. Immunol, 16:101-06, 1979. In some embodiments, binding affinity is measured by an antigen / antibody dissociation rate. In some embodiments, binding affinity is measured by a competition radioimmunoassay. In some embodiments, binding affinity is measured by ELISA. In some embodiments, antibody affinity is measured by flow cytometry.

[0272] An antibody that "selectively binds" an antigen (such as CD19) is an antigen-binding moiety that does not significantly bind other antigens but binds the antigen with high affinity,e.g., with an equilibrium constant (KD) of 100 nM or less, such as 60 nM or less, for example, 30 nM or less, such as, 15 nM or less, or 10 nM or less, or 5 nM or less, or 1 nM or less, or 500 pM or less, or 400 pM or less, or 300 pM or less, or 200 pM or less, or 100 pM or less.

[0273] A skilled artisan can select an ECD based on the desired localization or function of a cell that is genetically modified to express a multi-chain chimeric polypeptide or a first polypeptide of the present disclosure. For example, a first polypeptide with an ECD including an antibody specific for a HER2 antigen can target cells to HER2-expressing breast cancer cells. In some embodiments, the ECD of the disclosed first polypeptide is capable of binding a tumor- associated antigen (TAA) or a tumor-specific antigen (TSA). A skill artisan will understand that TAAs include a molecule, such as e.g., protein, present on tumor cells and on normal cells, or on many normal cells, but at much lower concentration than on tumor cells. In contrast, TSAs generally include a molecule, such as e.g., protein which is present on tumor cells but absent from normal cell.

[0274] In some cases, the antigen-binding moiety is specific for an epitope present in an antigen that is expressed by a tumor cell, i.e., a tumor-associated antigen. The tumor-associated antigen can be an antigen associated with, e.g., a breast cancer cell, a B cell lymphoma, a pancreatic cancer, a Hodgkin lymphoma cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma, a lung cancer cell, a non-Hodgkin B-cell lymphoma (B-NHL) cell, an ovarian cancer cell, a prostate cancer cell, a mesothelioma cell, a melanoma cell, a chronic lymphocytic leukemia cell, an acute lymphocytic leukemia cell, a neuroblastoma cell, a glioma, a glioblastoma, a colorectal cancer cell, etc. It will also be understood that a tumor-associated antigen may also be expressed by a non-cancerous cell. In some embodiments, the antigen- binding domain is specific for an epitope present in a tissue-specific antigen. In some embodiments, the antigen-binding domain is specific for an epitope present in a disease- associated antigen.

[0275] Non-limiting examples of suitable target antigens include CD19, B7H3 (CD276), BCMA (CD269), alkaline phosphatase, placental-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal regulatory protein .alpha. (SIRPα), CD123, CD171, CD179.alpha., CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2(ERBB2 / neu), IGLL1, IL-11R.alpha., KIT (CD 117), MUC1, NCAM, PAP, PDGFR-.beta., PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

[0276] In some embodiments, the target antigen is selected from CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179.alpha., CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-.beta., PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13R.alpha.1, IL-13R.alpha.2, .alpha.- fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (a subunit of the heterodimeric IL-2 receptor), CD3, CD4, CD5, IFN-.alpha., IFN-.gamma., IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin .alpha.4, integrin .alpha.4.beta.7, LFA-1 (CD11.alpha.), myostatin, OX-40, scleroscin, SOST, TGF.beta.1, TNF-.alpha., VEGF-A, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, Kappa light chain, Lamba light chain, CD16 / Fc.gamma.RIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and isovariants thereof, TEM-8, sperm protein 17 (Sp17), mesothelin.

[0277] Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptorgamma alternate reading frame protein), Trp-p8, STEAP1 (six-transmembrane epithelial antigen of the prostate 1), an abnormal ras protein, an abnormal p53 protein, integrin (33 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7H3), or IL-13R.alpha.. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen- binding moiety of the ECD is specific for a reporter protein, such as GFP and eGFP. Non- limiting examples of such antigen-binding moiety include a LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding moiety of the ECD includes an anti-BCMA fully- humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein.alpha. (SIRP.alpha.).

[0278] Additional antigens suitable for targeting by the first chimeric polypeptide and the multi-chain CARs disclosed herein include, but are not limited to GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13R.alpha.1, IL-13R.alpha.2, .alpha.- fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron- specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1.

[0279] Additional antigens suitable for targeting by the polypeptides disclosed herein include, but are not limited to, those associated with an inflammatory disease such as, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (a subunit of the heteromeric of IL-2 receptor), CD3, CD4, CD5, IFN-.alpha., IFN-.gamma., IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin .alpha.4, integrin .alpha.4.beta.7, LFA-1 (CD11.alpha.), myostatin, OX-40, scleroscin, SOST, TGF.beta.1, TNF-.alpha., and VEGF-A.

[0280] Further antigens suitable for targeting by the first chimeric polypeptides and the multi- chain CARs disclosed herein include, but are not limited to the pyruvate kinase isoenzyme typeM2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, Kappa light chain, Lamba light chain, CD16 / Fc.gamma.RIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and isovariants thereof, TEM-8, sperm protein 17 (Sp17), mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (six-transmembrane epithelial antigen of the prostate 1), an abnormal ras protein, an abnormal p53 protein, integrin .beta.3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is GPC2, CD19, Her2 / neu, CD276 (B7H3), IL-13R.alpha.1, or IL-13R.alpha.2. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen-binding moiety of the ECD is specific for a reporter protein, such as GFP and eGFP. Non-limiting examples of such antigen-binding moiety include a LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding moiety of the ECD includes an anti-BCMA fully-humanized VH domain (FHVH).

[0281] In some embodiments, the antigen can be HER2 produced by HER2-positive breast cancer cells. In some embodiments, the antigen can be CD19 that is expressed on B-cell leukemia. In some embodiments, the antigen can be EGFR that is expressed on glioblastoma multiform (GBM) but much less expressed so on healthy CNS tissue. In some embodiments, the antigen can be CEA that is associated with cancer in adults, for example colon cancer.

[0282] In some embodiments, the antigen-binding moiety of the ECD is specific for a cell surface target, where non-limiting examples of cell surface targets include CD19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD11 α, and α -integrin. In some embodiments, the chimeric first polypeptides and the multi-chain CARs disclosed herein include an extracellular domain having an antigen-binding moiety that binds CD19, CEA, HER2, MUC1, CD20, ALPPL2, BCMA, or EGFR. In some embodiments, the multi-chain CARs provided herein include an extracellular domain including an antigen-binding moiety that binds CD19. In some embodiments, the chimeric first polypeptides provided herein include an extracellular domain including an antigen-binding moiety that binds ALPPL2. In some embodiments, the chimeric first polypeptides provided herein include an extracellular domain including an antigen-bindingmoiety that binds BCMA. In some embodiments, the chimeric first polypeptides include an extracellular domain including an antigen-binding moiety that binds Her2.

[0283] In some embodiments, the antigen-binding moiety specifically binds to a tumor- associated antigen selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2,CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

[0284] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, GCC, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.

[0285] In some embodiments, the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1. In some embodiments, the antigen-binding moiety specifically binds to a target antigen selected from the group consisting of BCMA, CD19, CD20, CD22, CD70, CD79A, CD79B, CD276 (B7H3), Claudin 6, Claudin 18.2, DLL3, GCC, GD2, GD3, GPC3, GPRC5D, LY6G6D, p53R175H, PRAME, and ROR1.

[0286] In some embodiments, antigens suitable for targeting by the chimeric first polypeptides disclosed herein include ligands derived from a pathogen. Linking Sequences between ECD and First Transmembrane domain (TMD)

[0287] The multi-chain chimeric polypeptides and receptors of the disclosure can include a linking sequence disposed between the ECD and the TMD. The linking sequence can be a natural or a synthetic polypeptide. The linking sequence can be a flexible connector that provides structural flexibility and spacing to flanking polypeptide regions. The linking sequence can be a hinge domain inserted N-terminally to the TMD. In some embodiments, the hinge domain is a CD8 hinge domain. In some embodiments, the CD8 hinge domain is a truncated CD8α hinge domain. In some embodiments, the truncated CD8α is encoded by an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 86. In some embodiments, the truncated CD8α comprises an amino acidsequence comprising SEQ ID NO: 86. In some embodiments, the truncated CD8α is encoded by SEQ ID NO: 86.Hinge polypeptide sequences suitable for the compositions and methods of the disclosure can be naturally-occurring hinge polypeptide sequences (e.g., those from naturally- occurring immunoglobulins). Alternatively, a hinge polypeptide sequence can be a synthetic sequence that corresponds to a naturally-occurring hinge polypeptide sequence, or can be an entirely synthetic hinge sequence, or can be engineered, designed, or modified to provide desired and / or improved properties, e.g., modulating transcription. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs. Additional information in this regard can be found in, for example, a recent review by Vidarsson G. et al., Frontiers Immunol. Oct.20, 2014, which is hereby incorporated by reference in its entirety.

[0288] Accordingly, in some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG1 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG2 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG3 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgA hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgD hinge domain or a functional variant thereof.

[0289] Additional hinge polypeptide sequences suitable for the compositions and methods disclosed herein include, but are not limited to, hinge polypeptide sequences derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an Fcγ RIIIα hinge domain, and functional variants thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD8.alpha hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD28hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an 0X40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0290] In principle, there are no particular limitations to the length and / or amino acid composition of the hinge domain other than it confers flexibility. However, one skilled in the art will readily appreciate that the length and amino acid composition of the hinge polypeptide sequence can be optimized to vary the orientation and / or proximity of the ECD and the TMD relative to one another, as well as of the first polypeptide and second polypeptide to one another, to achieve a desired activity of the chimeric multi-chain polypeptides of the disclosure. In some embodiments, any arbitrary single-chain peptide including about one to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a hinge domain. In some embodiments, the hinge domain includes about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the hinge domain includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, about 50 to 70 amino acid residues. In some embodiments, the hinge domain includes about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the hinge domain includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues. In some embodiments, the hinge domain includes a sequence having at least 80% sequence identity, such as, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO: 86.First Transmembrane Domains

[0291] The multi-chain chimeric polypeptides of the present disclosure include a transmembrane domain located in the first polypeptide (e.g., first TMD). In some embodiments of the first polypeptide of the disclosure, the first TMD is fully synthetic. In some embodiments the first TMD includes a contiguous stretch of valine residues. In some embodiments, the contiguous stretch of valine residues includes 5 to 25 valine residues. In some embodiments, the first TMD includes a contiguous stretch of 5 to 25 valine residues. In some embodiments, thefirst TMD includes a contiguous stretch of 5, or 6, or 7, or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 consecutive valine residues.

[0292] In some embodiments, the first TMD includes a positively charged residue. In some embodiments, the positively charged residue is lysine or arginine. In some embodiments, the positively charged residue is within the contiguous stretch of valine residues. In some embodiments, the positively charged residue is located after the first valine residue from the N- terminus. In some embodiments, the positively charged residue is located after the second or third or fourth or fifth or sixth or seventh or eighth or ninth or tenth or eleventh or twelfth or thirteenth or fourteenth or fifteenth or sixteenth or seventeenth or eighteenth or nineteenth or twentieth or twenty first or twenty second or twenty third valine residue from the N-terminus. In some embodiments, the lysine or arginine residue replaces the sixth or seventh or eighth or ninth or tenth or eleventh or twelfth valine residue from the N-terminus. In some embodiments, the TMD of the first polypeptide includes a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 87. In some embodiments, the TMD is SEQ ID NO: 87. In some embodiments, the lysine or arginine residue is residue number 8 or residue number 9 or residue number 10 or residue number 11 of SEQ ID NO:87 or at a position corresponding to residue number 8 or residue number 9 or residue number 10 or residue number 11 of SEQ ID NO: 87. In some embodiments, the lysine or arginine residue is (i) at position 12 of SEQ ID NO: 87, or (ii) is at position 9 of SEQ ID NO: 87.

[0293] The first TMD of the multi-chain chimeric polypeptides of the disclosure can include a TMD from a Notch receptor. In some embodiments, the TMD includes the Notch 1 receptor. In some embodiments, the Notch 1 receptor is a human Notch 1 receptor.

[0294] The first TMD can include one or more ligand-inducible proteolytic cleavage sites. Examples of ligand-inducible proteolytic cleavage sites in a Notch receptor (e.g., S2 or S3) are described in US Patent No. 11,202,801, incorporated herein by reference in its entirety. In some embodiments, the ligand-inducible proteolytic cleavage site is cleavable by gamma secretase, a multiprotein enzyme complex.

[0295] The first polypeptide of the multi-chain chimeric polypeptides of the disclosure can include a stop-transfer-sequence (STS). The STS can be located C-terminally to the TMD. The STS can include a highly-charged domain. In some embodiments, the STS is a Notch 2 JMD.

[0296] In principle, there are no particular limitations to the length and / or amino acid composition of the STS. Any arbitrary single-chain peptide that includes about 4 to about 40 amino acid residues (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc. amino acid residues) can be used as a STS. In some embodiments, the STS includes about 4 to 15, about 6 to 20, about 8 to 25, about 10 to 30, about 12 to 35, about 14 to 40, about 5 to 40, about 10 to 35, about 15 to 30, about 20 to 25, about 20 to 40, about 10 to 30, about 4 to 20, or about 5 to 25 amino acid residues. In some embodiments, the STS includes about 4 to 10, about 5 to 12, about 6 to 14, about 7 to 18, about 8 to 20, about 9 to 22, about 10 to 24, or about 11 to 26 amino acid residues. In some embodiments, the STS includes about 4 to 10 residues, such as, 4, 5, 6, 7, 8, 9, or 10 amino acid residues.

[0297] In some embodiments, the STS is a polybasic domain. In some embodiments, the polybasic domain includes Notch -1 or Notch-2. In some embodiments, the polybasic domain comprises an amino acid sequence where the majority (i.e., at least 55%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%,) of the residues are lysine and / or arginine and / or histidine and / or any combination thereof.

[0298] The STS can include a sequence having at least 70% sequence identity, such as, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to a JMD sequence from Notch1, Notch2, Notch3, Notch4, CLSTN1, CLSTN2, CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, CDH5, NRG2, PTPRK, BTC, EPHA3, EPHA4, IL1R2, or PTPRM. In some embodiments, the STS includes a sequence having only Lys (K) or Arg (R) in the first 4 residues. In some embodiments, the STS includes one, two, three, four, five, or more basic residues. In some embodiments, the STS includes five, four, three, two, one, or zero aromatic residues or residues with hydrophobic and / or bulky side chains. First Intracellular Domains and Transcriptional Regulators

[0299] The first polypeptides of the multi-chain chimeric polypeptides of the disclosure can include a transcriptional regulator. The transcriptional regulator of the disclosure can be a polypeptide element that acts to activate or inhibit the transcription of a promoter-driven DNA sequence. Transcriptional regulators suitable for the compositions and methods of the disclosurecan be naturally-occurring transcriptional regulators or can be engineered, designed, or modified so as to provide desired and / or improved properties, e.g., modulating transcription. As discussed above, the engineered receptors of the present disclosure are advantageous in that they can provide the ability to trigger a custom transcriptional program in engineered cells. In some embodiments, transcriptional regulator of the disclosure is a custom transcriptional regulator that drives transcription off a specific sequence that only appears once in the engineered cell.

[0300] In some embodiments, the transcriptional regulator directly regulates differentiation of the cell. In some embodiments, the transcriptional regulator indirectly modulates (e.g., regulates) differentiation of the cell by modulating the expression of a second transcription factor. It will be understood by one having ordinary skill in the art that a transcriptional regulator can be a transcriptional activator or a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional repressor. In some embodiments, the transcriptional regulator is a transcriptional activator. In some embodiments, the transcriptional regulator can further include a nuclear localization signal. In some embodiments, the transcriptional regulator is from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4- KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. In some embodiments, the transcriptional regulator is a humanized transcriptional regulator as described above for Hybrid receptors.

[0301] Various embodiments of the first polypeptides of the disclosure can include the following non-limiting examples of components. The first polypeptide can include an extracellular domain, a TMD, an intracellular domain and other sequences from known receptors such as, for example, the triggering receptor expressed on myeloid cells 2 (TREM 2). TREM2 can undergo proteolytic cleavage between amino acids H157 and S158 by members of the disintegrin and metalloproteinase (ADAM) family. This cleavage results in the release of a soluble TREM2 ectodomain (sTREM2) into extracellular fluids, and generation of a membrane tethered C-terminal fragment (CTF). The TREM2 CTF represents a substrate for intramembrane proteolysis by γ-secretase. In some embodiments of the disclosure, the first polypeptide can include TREM2 TMD without its cytoplasmic domain. In some embodiments, the first polypeptide can includes a TREM2 extracellular domain, and a TMD with a Notch 1 γ-secretase cleavage site and / or a Notch-2 JMD.

[0302] The first polypeptide of the multi-chain chimeric polypeptides of the disclosure can include a first modified interface via which the first polypeptide associates with the second polypeptide. The first modified interface can be from a Notch 1 TMD. The first modified interface can have a positively charged residue via which the first polypeptide associates with the second polypeptide of the multiple-chimeric polypeptides of the disclosure. The positively charged residue can be a lysine or arginine. Other components

[0303] In some embodiments of the disclosure, the first polypeptide can further include one or more of the following: an autoproteolytic peptide sequence or a nuclear localization signal.

[0304] In some embodiments, the autoproteolytic peptide sequence is from a porcine teschovirus-12A (P2A), a foot-and-mouth disease virus (FMDV) 2A (F2A), an Equine Rhinitis A Virus (ERAV) 2A (E2A), a Thosea asigna virus 2A (T2A), a cytoplasmic polyhedrosis virus 2A (BmCPV2A), a Flacherie Virus 2A (BmIFV2A), or a combination thereof.

[0305] The first polypeptide can further include a proteolytic cleavage site. In some embodiments, the proteolytic cleavage site is cleavable by gamma secretase. In some embodiments, the proteolytic cleavage site is ligand-inducible proteolytic cleavage site. The proteolytic cleavage site can be disposed between the CARD11 polyeptide and the hinge domain. The proteolytic cleavage site can be ligand-inducible wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site. Second Polypeptides

[0306] The multi-chain chimeric polypeptides of the disclosure include a second polypeptide having (i) a second TMD with a second interface, and (ii) a second intracellular domain in order from N-terminus to C-terminus of the second polypeptide.

[0307] In some embodiments, the first polypeptides of the disclosure include an amino acid sequence that is has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 92 or SEQ ID NO:93 or functional variants thereof. Second Transmembrane Domains

[0308] The second polypeptides of the multi-chain chimeric polypeptides of the disclosure can include a second TMD having a second interface. The second TMD can include any domain that is capable of associating with the first polypeptide of the multi-chain chimeric polypeptidesof the disclosure via a charged residue in the TMD and that has a signaling domain that can be activated upon binding of a target ligand to the extracellular ligand-binding domain of the first polypeptide. The second interface is the region in the second polypeptide can include a negatively charged residue via which it associates with a positively charged residue in the TMD of the first polypeptide of the disclosure. In some embodiments, the negatively charged residue can be arginine or lysine.

[0309] In some embodiments, the second polypeptide includes a DAP12 TMD. In some embodiments, the second polypeptide includes a DAP12 domain as well as a DAP12 intracellular signaling domain (i.e. cytoplasmic domain) as explained in more details below. Second Intracellular Domain

[0310] The second polypeptide of the multi-chain chimeric polypeptides of the disclosure include an intracellular domain. The intracellular domain can be responsible for propagation of downstream signaling upon ligand binding by the first polypeptide chain. In some embodiments, the intracellular domain is from DAP12 (DNAZ activation protein of 12 kDa, TYROBP). The DAP 12 intracellular domain, also known as the cytoplasmic domain of DAP12, includes an immunoreceptor tyrosine-based activation motif (ITAM), which gets phosphorylated upon ligand-binding to TREM2, and thereon regulate several intracellular signaling pathways that control cell proliferation and differentiation, survival, phagocytosis, cytoskeletal remodeling, calcium mobilization and / or cytokine production. In some embodiments, the signaling domain can be a CD3 zeta, TCR zeta, FcR γ, FcR β, CD3 γ, CD3 Δ, CD3 ε, CD5, CD22, CD79a, CD79b, CD278 (ICOS), Fcε RI, DAP10, DAP12, or CD66d, signaling domain. Mini-Notch Receptors

[0311] In some embodiments, the first nucleic acid can be a nucleic acid encoding a mini- Notch receptor as described in U.S. Patent Application Publication No.2021 / 0246186A1, which is hereby incorporated by reference in its entirety. Such receptors comprise from N- terminus to C-terminus: (a) an extracellular ligand-binding domain having a binding affinity for a selected ligand; (b) a linking sequence; (c) a transmembrane domain including one or more ligand-inducible proteolytic cleavage sites; and (d) an intracellular domain including a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcriptional regulator and the linking sequence, and wherein the chimeric polypeptide does not include a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor.Hinge Notch Receptors

[0312] In some embodiments, the first nucleic acid can be a nucleic acid encoding a Hinge Notch receptor as described in U.S. Patent No. 11,202,801 which is hereby incorporated by reference in its entirety. Such receptors include, from N-terminus to C-terminus: (a) an extracellular ligand-binding domain having a binding affinity for a selected ligand; (b) a hinge domain capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding; (c) a transmembrane domain including one or more ligandinducible proteolytic cleavage sites; and (d) an intracellular domain including a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at a ligand-inducible proteolytic cleavage site disposed between the transcriptional regulator and the hinge domain, and wherein the chimeric polypeptide does not include a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor.Robo Notch Receptors

[0313] In some embodiments, the first nucleic acid can be a nucleic acid encoding a Robo Notch receptor as described in U.S. Patent Application Publication No. 2022 / 0348628 which is hereby incorporated by reference in its entirety. Such receptors include, from N-terminus to C- terminus: (a) an extracellular ligand binding domain (ECD) having a binding affinity for a selected ligand; (b) a portion of a ROBO juxtamembrane domain (JMD) including an Fn repeat; (c) a transmembrane domain (TMD) including one or more ligand-inducible proteolytic cleavage sites; and (d) an intracellular domain (ICD) including a transcription regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcription regulator and the linking polypeptide. In some embodiments, the chimeric polypeptide does not include a LIN-12-Notchrepeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor. In an embodiment, the chimeric receptor does not include a Notch NRR. Recombinant Cells

[0314] The first and second nucleic acids of the present disclosure can be introduced into a host cell, such as, for example, a human T lymphocyte, to produce a recombinant or engineered cell containing the nucleic acid molecule. Accordingly, some embodiments of the disclosure relate to methods for making a recombinant or engineered cell, including (a) providing a cell capable of protein expression and (b) contacting the provided cell with a recombinant nucleic acid of the disclosure.

[0315] In some embodiments, the first nucleic acid and second nucleic acid can be delivered with two different vectors. In some embodiments, the first nucleic acid and second nucleic acid can be delivered in one single vector.

[0316] Introduction of the nucleic acid molecules of the disclosure into cells can be achieved by methods known to those skilled in the art such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.

[0317] Accordingly, in some embodiments, the nucleic acid molecules can be delivered by viral or non-viral delivery vehicles known in the art. For example, the nucleic acid molecule can be stably integrated in the host genome, or can be episomally replicating, or present in the recombinant host cell as a mini-circle expression vector for transient expression. Accordingly, in some embodiments, the nucleic acid molecule is maintained and replicated in the recombinant host cell as an episomal unit. In some embodiments, the nucleic acid molecule is stably integrated into the genome of the recombinant cell. Stable integration can be achieved using classical random genomic recombination techniques or with more precise techniques such as guide RNA-directed CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing with NgAgo (Natronobacterium gregoryi Argonaute), or TALENs genome editing (transcription activator-like effector nucleases). In some embodiments, the nucleic acidmolecule is present in the recombinant host cell as a mini-circle expression vector for transient expression.

[0318] The nucleic acid molecules can be encapsulated in a viral capsid or a lipid nanoparticle, or can be delivered by viral or non-viral delivery means and methods known in the art, such as electroporation. For example, introduction of nucleic acids into cells may be achieved by viral transduction. In a non-limiting example, adeno-associated virus (AAV) is engineered to deliver nucleic acids to target cells via viral transduction. Several AAV serotypes have been described, and all of the known serotypes can infect cells from multiple diverse tissue types. AAV is capable of transducing a wide range of species and tissues in vivo with no evidence of toxicity, and it generates relatively mild innate and adaptive immune responses.

[0319] Lentiviral-derived vector systems are also useful for nucleic acid delivery and gene therapy via viral transduction. Lentiviral vectors offer several attractive properties as genedelivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) the capability of infecting both dividing and non-dividing cells; (iii) broad tissue tropisms, including important gene- and cell-therapy-target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (vi) a potentially safer integration site profile; and (vii) a relatively easy system for vector manipulation and production.

[0320] In some embodiments, host cells can be genetically engineered (e.g., transduced or transformed or transfected) with, for example, a vector construct of the present application that can be, for example, a viral vector or a vector for homologous recombination that includes nucleic acid sequences homologous to a portion of the genome of the host cell, or can be an expression vector for the expression of the polypeptides of interest. Host cells can be either untransformed cells or cells that have already been transfected with at least one nucleic acid molecule.

[0321] In some embodiments, the recombinant cell has reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR) compared to a control cell. In some embodiments, expression of one of the endogenous TCR proteins is knocked-down or knocked- out (e.g., in the TRAC, TRBC1, or TRBC2 gene locus). In some embodiments, the recombinant cell with reduced or eliminated cell surface expression of an endogenous TCR elicits feweradverse events or adverse events with reduced severity (e.g., when administered to an individual) compared to a control cell.

[0322] In some embodiments, the recombinant cell does not have reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR) compared to a control cell (i.e., the cell surface expression of the endogenous TCR is unmodified). In some embodiments, cell surface expression level of an endogenous T cell receptor (TCR) of the recombinant cell is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of that of a control cell without the nucleic acids. In some embodiments, cell surface expression level of an endogenous T cell receptor (TCR) of the recombinant cell is between 50% and 200%, 70% and 150%, 80% and 120%, or 90% and 110%, of that of a control cell without the nucleic acids. In some embodiments, the cell surface expression level of an endogenous T cell receptor (TCR) of the recombinant cell is substantially the same to that of a control cell without the nucleic acids. In some embodiments, the recombinant cell that does not have reduced or eliminated cell surface expression of an endogenous TCR elicits fewer adverse events or adverse events with reduced severity (e.g., when administered to an individual) compared to a control cell.

[0323] In some embodiments, the recombinant cell has low or no baseline expression (e.g., background expression or expression in the absence of the selected ligand) of the CARD11 polypeptide. In some embodiments, expression of the CARD11 polypeptide is significantly increased in the recombinant cell once the selected ligand engages the receptor. In some embodiments, expression of the CARD11 polypeptide is significantly increased in the recombinant cell once the recombinant cell is in contact with the selected ligand. In some embodiments, the selected ligand is expressed on the surface of a second cell (e.g., a target cell).

[0324] In some embodiments, the baseline expression of the CARD11 polypeptide in the absence of the selected ligand in the recombinant cell is no more than 10%, no more than 5%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.1%, no more than 0.05%, no more than 0.01%, no more than 0.005%, or no more than 0.001%, compared to the maximal expression level of the CARD11 polypeptide in the presence of the selected ligand. In some embodiments, initially, the expression level of the CARD11 polypeptide increases as the concentration of the ligand increases, however, the expression level reaches a plateau (i.e., the maximal expression level) as the ligand concentration increases over a certain concentration. A skilled person can determine the maximal expression level of aprotein in response to a ligand using known techniques (e.g., Western blotting or flow cytometry).

[0325] In some embodiments, binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide in the recombinant cell by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, at least 500-fold, or at least 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand. In some embodiments, binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide in the recombinant cell by 1-fold to 2-fold, 2-fold to 3-fold, 3-fold to 5-fold, 5-fold to 10-fold, 10-fold to at least 20-fold, 20-fold to 50- fold, 50-fold to 100-fold, 100-fold to 200-fold, 200-fold to 500-fold, or 500-fold to 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand. In some embodiments, the selected ligand is expressed on the surface of a second cell (e.g., a target cell).

[0326] In some embodiments, the recombinant cell contacting the selected ligand increases the expression of the CARD11 polypeptide in the recombinant cell by at least 2-fold, at least 3- fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, at least 500-fold, or at least 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand. In some embodiments, the recombinant cell contacting the selected ligand increases the expression of the CARD11 polypeptide in the recombinant cell by 1-fold to 2-fold, 2-fold to 3-fold, 3-fold to 5-fold, 5-fold to 10-fold, 10-fold to at least 20-fold, 20-fold to 50-fold, 50-fold to 100-fold, 100-fold to 200- fold, 200-fold to 500-fold, or 500-fold to 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand. In some embodiments, the selected ligand is expressed on the surface of a second cell (e.g., a target cell).

[0327] In some embodiments, the recombinant cell is a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the mammalian cellis an immune cell, a neuron, an epithelial cell, and endothelial cell, or a stem cell. In some embodiments, the cell is derived from a stem cell. In some embodiments, the recombinant cell is an immune system cell, e.g., a lymphocyte (e.g., a T cell or NK cell), or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (TH), a cytotoxic T cell (TCTL), or other T cell. In some embodiments, the cell is selected from the group of consisting of a T cell, a CD4+ T cell, a CD8+ T cell, a regulatory T cell (Treg), a gamma delta T cell (γδT), an invariant natural killer T (iNKT) cell, a mucosal associated invariant T (MAIT) cell, a macrophage, a monocyte, a natural killer (NK) cell, a tumor infiltrating lymphocyte (TIL), a cytotoxic T cell, a T helper cell, a memory T cell, a central memory T (TCM) cell, a stem memory T (TSCM) cell, a stem-cell-like memory T cell (or stem- like memory T cells), an effector memory T (TEM) cell, a TEMRA (CD45RA+) cell, an effector T cell, a Th1 cell, a Th2 cell, a Th9 cell, a Th17 cell, a Th22 cell, a Tfh (follicular helper) cell, a natural killer T (NKT) cell, a transitional memory T (TTM) cell, a terminal effector T (TTE) cell, a naïve T (TN) cell, a hematopoietic stem cell, and a progenitor cell of the lymphoid lineage. In some embodiments, the cell is selected from the group consisting of a T cell, a macrophage, a monocyte, and a natural killer (NK) cell.

[0328] In some embodiments, the immune system cell is a T lymphocyte.

[0329] In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments of the cell, the cell is a lymphocyte. In some embodiments, the cell is T cell. In some embodiments, the T cell is selected from the group consisting of a regulatory T cell (Treg), a gamma delta T cell, a CD8+ T cell, an invariant iNKT cell, a MAIT cell, a CAR T cell, a tumor-infiltrating lymphocyte, and an engineered T cell comprising a transcriptional receptor. In some embodiments, the cell is a precursor T cell or a T regulatory (Treg) cell. In some embodiments, the cell is a CD34+, CD8+, or a CD4+ cell. In some embodiments, the cell is a CD8+ T cytotoxic lymphocyte cell selected from the group consisting of naïve CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells. In some embodiments of the cell, the cell is a CD4+ T helper lymphocyte cell selected from the group consisting of naïve CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells. In some embodiments, the cell is an autologous cell. In some embodiments, the cell is an allogeneic cell. In someembodiments, the cell is a primary cell. In some embodiments, the cell can be obtained by leukapheresis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient.

[0330] In another aspect, provided herein are cell cultures including at least one recombinant cell as disclosed herein, and a culture medium. Generally, the culture medium can be any suitable culture medium for culturing the cells described herein. Techniques for transforming a wide variety of the above-mentioned host cells and species are known in the art and described in the technical and scientific literature. Accordingly, cell cultures including at least one recombinant cell as disclosed herein are also within the scope of this application. Methods and systems suitable for generating and maintaining cell cultures are known in the art. Pharmaceutical Compositions

[0331] In some embodiments, the recombinant cells of the disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions generally include the nucleic acids, and / or recombinant cells, and a pharmaceutically acceptable excipient, e.g., carrier.

[0332] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™. (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants, e.g., sodium dodecyl sulfate. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be generally to include isotonicagents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0333] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.Methods of the Disclosure

[0334] Administration of any one of the therapeutic compositions described herein, e.g., nucleic acids, recombinant cells, and pharmaceutical compositions, can be used to treat patients for relevant health conditions or diseases, such as cancers and chronic infections. In some embodiments, the nucleic acids, recombinant cells, and pharmaceutical compositions described herein can be incorporated into therapeutic agents for use in methods of treating an individual who has, who is suspected of having, or who may be at high risk for developing one or more autoimmune disorders or diseases associated with checkpoint inhibition. Exemplary autoimmune disorders and diseases can include, without limitation, celiac disease, type 1 diabetes, Graves’ disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus erythematosus.

[0335] Accordingly, in one aspect, some embodiments of the disclosure relate to methods for inhibiting an activity of a target cell in an individual, the methods include administering to the individual a first therapy including one or more of nucleic acids, recombinant cells, and pharmaceutical compositions as disclosed herein, wherein the first therapy inhibits the target cell. For example, the target cell may be inhibited if its proliferation is reduced, if its pathologic or pathogenic behavior is reduced, if it is destroyed or killed, etc. Inhibition includes a reduction of the measured pathologic or pathogenic behavior of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. In some embodiments, the methods include administering to the individual an effective number ofthe recombinant cells disclosed herein, wherein the recombinant cells inhibit an activity of the target cells in the individual. Generally, the target cells of the disclosed methods can be any cell type in an individual and can be, for example an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B-cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a liver cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T-cell lymphoma cell, a renal cancer cell, a sarcoma cell, a stomach cancer cell, a carcinoma cell, a mesothelioma cell, or a sarcoma cell. In some embodiments, the target cell is a pathogenic cell.

[0336] In another aspect, some embodiments of the disclosure relate to methods for the treatment of a health condition (e.g., disease) in an individual in need thereof, the methods include administering to the individual a first therapy including one or more of the recombinant cells r as disclosed herein, and / or pharmaceutical compositions as disclosed herein, wherein the first therapy treats the health condition in the individual. In some embodiments, the methods include administering to the individual a first therapy including an effective number of the recombinant cells as disclosed herein, wherein the recombinant cells treat the health condition.

[0337] In another aspect, some embodiments of the disclosure relate to methods for assisting in the treatment of a health condition (e.g., disease) in an individual in need thereof, the methods including administering to the individual a first therapy including one or more of recombinant cells, and pharmaceutical compositions as disclosed herein, and a second therapy, wherein the first and second therapies together treat the disease in the individual. In some embodiments, the methods include administering to the individual a first therapy including an effective number of the recombinant cells as disclosed herein, wherein the recombinant cells treat the health condition.

[0338] One challenge for improving engineered immune cell therapies is to ensure their safety while enhancing potency. Severe and sometimes life-threatening adverse events may be associated with engineered immune cell therapies.

[0339] In some embodiments, the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder,splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, graft-vs-host disease (GVHD), potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma. In some embodiments, the adverse event is an acute adverse event. Non-limiting examples of acute adverse events include CRS, ICANS, HLH, on- target off-tumor toxicity, and tumor lysis syndrome.

[0340] In some embodiments, the methods of the disclosure comprise monitoring the individual for at least one symptom of the adverse event, optionally wherein the monitoring comprises one or more of:Clinical laboratory tests of ferritin, C-reactive protein (CRP), creatinine, alanine transaminase (ALT), aspartate transaminase (AST), fibrinogen, lactose dehydrogenase (LDH), absolute or relative white blood cell count, and / or absolute or relative T cell count;Imaging, wherein the imaging is PET, CT, MRI, and / or x-ray;Clinical assessment of body temperature, blood pressure, blood oxygenation, heart rate, cognitive status, and / or organ function; andStandardized assessment used for detecting or monitoring one or more adverse events. In some embodiments, the standardized assessment comprises the Immune Effector Cell- Associated Encephalopathy (ICE) assessment, the Cornell Assessment, and / or the Pediatric Delirium (CAPD) assessment.

[0341] In some embodiments, recombinant cells with controlled expression of the CARD11 polypeptide modulated by the transcriptional regulator, which is released upon ligand-binding, elicits no adverse events or are less likely to cause an adverse event (e.g., when administered to an individual). In some embodiments, the method of the disclosure reduces the likelihood of the adverse event by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%, compared to a control method using control recombinant cells that constitutively express the CARD11 polypeptide. In some embodiments, the adverse event is an acute adverse event. In some embodiments, the adverse event comprises graft-vs-host disease (GVHD).

[0342] Expression of the endogenous TCR in recombinant immune cells typically increases the likelihood of adverse events (e.g., GVHD) when administered to an individual, and onestrategy to reduce the occurrence of adverse events is to knock-out or knock-down the expression of the endogenous TCR. However, the controlled expression (i.e., regulated expression after ligand-binding) of the CARD11 polypeptide and the reduced likelihood of adverse events for the recombinant cells of the disclosure, expression of the endogenous TCR in such recombinant cells may no longer have a significant contribution to the occurrence of adverse events (e.g., when administered to an individual). Accordingly, in some embodiments, the genes encoding the endogenous TCR remain intact in the recombinant cells of the disclosure. In some embodiments, the recombinant cells of the disclosure have wildtype level (i.e., unmodified) cell surface expression of the endogenous TCR.Administration of recombinant cells to an individual

[0343] In some embodiments, the methods of the disclosure involve administering an effective amount of the recombinants cells of the disclosure to an individual in need of such treatment. This administering step can be accomplished using any method of implantation delivery in the art. For example, the recombinant cells of the disclosure can be infused directly in the individual’s bloodstream or otherwise administered to the individual.

[0344] In some embodiments, the methods disclosed herein include administering, which term is used interchangeably with the terms “introducing,” implanting,” and “transplanting,” recombinant cells into an individual, by a method or route that results in at least partial localization of the introduced cells at a desired site such that a desired effect(s) is / are produced. The recombinant cells or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the individual where at least a portion of the administered cells or components of the cells remain viable. The period of viability of the cells after administration to an individual can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the lifetime of the individual, i.e., long-term engraftment.

[0345] When provided prophylactically, the recombinant cells described herein can be administered to an individual in advance of any symptom of a disease or condition to be treated. Accordingly, in some embodiments the prophylactic administration of a recombinant cell population prevents the occurrence of symptoms of the disease or condition.

[0346] When provided therapeutically in some embodiments, recombinant cells are provided at (or after) the onset of a symptom or indication of a disease or condition, e.g., upon the onset of disease or condition.

[0347] For use in the various embodiments described herein, an effective amount of recombinant cells as disclosed herein, can be at least 102cells, at least 5 × 102cells, at least 103cells, at least 5 × 103cells, at least 104cells, at least 5 × 104cells, at least 105cells, at least 2 × 105cells, at least 3 × 105cells, at least 4 × 105cells, at least 5 × 105cells, at least 6 × 105cells, at least 7 × 105cells, at least 8 × 105cells, at least 9 × 105cells, at least 1 × 106cells, at least 2 × 106cells, at least 3 × 106cells, at least 4 × 106cells, at least 5 × 106cells, at least 6 × 106cells, at least 7 × 106cells, at least 8 × 106cells, at least 9 × 106cells, or multiples thereof. The recombinant cells can be derived from one or more donors or can be obtained from an autologous source. In some embodiments, the recombinant cells are expanded in culture prior to administration to an individual in need thereof.

[0348] In some embodiments, the delivery of a recombinant cell composition (e.g., a composition including a plurality of recombinant cells according to any of the cells described herein) into an individual by a method or route results in at least partial localization of the cell composition at a desired site. A composition including recombinant cells can be administered by any appropriate route that results in effective treatment in the individual, e.g., administration results in delivery to a desired location in the individual where at least a portion of the composition delivered, e.g., at least 1 × 104cells, is delivered to the desired site for a period of time. Modes of administration include injection, infusion, instillation. “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For the delivery of cells, delivery by injection or infusion is a preferred mode of administration.

[0349] In some embodiments, the recombinant cells are administered systemically, e.g., via infusion or injection. For example, a population of recombinant cells are administered other than directly into a target site, tissue, or organ, such that it enters, the individual’s circulatory system and, thus, is subject to metabolism and other similar biological processes.

[0350] The efficacy of a treatment including any of the compositions provided herein for the treatment of a disease or condition can be determined by a skilled clinician. However, one skilled in the art will appreciate that a treatment is considered effective if any one or all of the signs or symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of an individual to worsen as assessed by decreased hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.

[0351] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition that is sufficient to promote a particular beneficial effect when administered to an individual, such as one who has, is suspected of having, or is at risk for a disease. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.

[0352] In some embodiments of the disclosed methods, the individual is a mammal. In some embodiments, the mammal is a human. In some embodiments, the individual has or is suspected of having a disease associated with inhibition of cell signaling mediated by a cell surface ligand or antigen. The diseases suitable for being treated by the compositions and methods of the disclosure include, but are not limited to, cancers, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is a cancer or a chronic infection.

[0353] Methods for CAR design, delivery and expression in T cells, and the manufacturing of clinical-grade CAR-T cell populations are known in the art. See, for example, Lee et al., Clin Cancer Res (2012) 18(10):2780-90, hereby incorporated by reference in its entirety. For example, the engineered CARs may be introduced into T cells using retroviruses, whichefficiently and stably integrate a nucleic acid sequence encoding the chimeric antigen receptor into the target cell genome.

[0354] Other methods known in the art include, but are not limited to, lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR / Cas systems (e.g., type I, type II, or type III systems using a suitable Cas protein such Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12a (Cpf1), Cas13a (C2c2), Cas13b, Cas13d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), CasX, CasY, Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, etc.).

[0355] In some embodiments, a recombinant adeno-associated virus (AAV) vector can be used for delivery. Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (e.g., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes can be from any AAV serotype for which recombinant virus can be derived, and can be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO 01 / 83692.

[0356] The CAR-T cells, once they have been expanded ex vivo in response to, for example, an autoimmune disease antigen, can be reinfused into the subject in a therapeutically effective amount.

[0357] The precise amount of CAR T cells to be administered can be determined by a physician with consideration of individual differences in age, weight, extent of disease and condition of the subject.

[0358] Administration of T cell therapies may be defined by number of total cells per infusion or number of cells per kilogram of body weight, especially for pediatric subjects (e.g., patients). As T cells replicate and expand after transfer, the administered cell dose may not resemble thefinal steady-state number of cells. In some embodiments, a pharmaceutical composition including the CAR T cells of the present disclosure may be administered at a dosage of 104to 1010total cells. In another embodiment, a pharmaceutical composition including the CAR T cells of the present disclosure may be administered at a dosage of 103to 108cells / kg body weight, including all integer values within those ranges.

[0359] Compositions including the CAR T cells of the present disclosure may also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are known in the art (see, for example, Rosenberg et al., New Engl J Med, (1988) 319:1676). The optimal dosage and treatment regimen for a particular subject can be determined by one skilled in the art by monitoring the subject for signs of disease and adjusting the treatment accordingly.

[0360] In some embodiments, administration of any of the compositions embodied herein, for the treatment of, for example, an autoimmune or inflammatory disease, can be combined with other cell-based therapies, for example, stem cells, antigen presenting cells, pancreatic islets etc.

[0361] The composition of the present disclosure may be prepared in a manner known in the art and in a manner suitable for parenteral administration to mammals, particularly humans, including a therapeutically effective amount of the composition alone, with one or more pharmaceutically acceptable carriers or diluents.

[0362] The term “pharmaceutically acceptable carrier” as used herein means any suitable carriers, diluents or excipients. These include all aqueous and non-aqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers and solutes, which render the composition isotonic with the blood of the intended recipient; aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents, dispersion media, antifungal and antibacterial agents, isotonic and absorption agents and the like. It will be understood that compositions of the present disclosure may also include other supplementary physiologically active agents.

[0363] The carrier must be pharmaceutically “acceptable” in the sense of being compatible with the other ingredients of the composition and not injurious to the subject. Compositions include those suitable for parenteral administration, including subcutaneous, intramuscular, intravenous and intradermal administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any method well known in the art of pharmacy. Suchmethods include preparing the carrier for association with the CAR-T cells. In general, the compositions are prepared by uniformly and intimately bringing into association any active ingredients with liquid carriers.

[0364] In some embodiments, the composition is suitable for parenteral administration. In another embodiment, the composition is suitable for intravenous administration.

[0365] Compositions suitable for parenteral administration include aqueous and nonaqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers, bactericides and solutes, which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Additional Therapies

[0366] As discussed above, any one of the compositions as disclosed herein, e.g., the chimeric receptors, recombinant nucleic acids, recombinant cells, cell cultures, and pharmaceutical compositions described herein can be administered to a subject in need thereof as a single therapy (e.g., monotherapy). In addition or alternatively, in some embodiments of the disclosure, the chimeric receptors, recombinant nucleic acids, recombinant cells, cell cultures, and pharmaceutical compositions described herein can be administered to the subject in combination with one or more additional therapies, e.g., at least one, two, three, four, or five additional therapies. Suitable therapies to be administered in combination with the compositions of the disclosure include, but are not limited to chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, targeted therapy, and surgery. Other suitable therapies include therapeutic agents such as chemotherapeutics, anti-cancer agents, and anti-cancer therapies.

[0367] Administration “in combination with” one or more additional therapies includes simultaneous (concurrent) and consecutive administration in any order. In some embodiments, the one or more additional therapies is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery. The term chemotherapy as used herein encompasses anti-cancer agents. Various classes of anti-cancer agents can be suitably used for the methods disclosed herein. Non-limiting examples of anti- cancer agents include: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxin, antibodies (e.g., monoclonal or polyclonal), tyrosinekinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone treatments, soluble receptors and other antineoplastics.

[0368] The present disclosure also contemplates the combination of the composition of the disclosure with other drugs and / or in addition to other treatment regimens or modalities such as surgery. When the composition of the present disclosure is used in combination with known therapeutic agents the combination may be administered either in sequence (either continuously or broken up by periods of no treatment) or concurrently or as an admixture. In the case of, for example, autoimmune diseases, treatment includes administering to the subject the compositions embodied herein, e.g. autologous T cells transduced or contacted with a CAR embodied herein and one or more anti-inflammatory agents and / or therapeutic agents. The anti- inflammatory agents include one or more antibodies which specifically bind to pro- inflammatory cytokines, e.g., pro-inflammatory cytokines such as IL-1, TNF, IL-6, GM-CSF, and IFN-γ. In some embodiments, the antibodies are anti-TNFα, anti-IL-6 or combinations thereof. In some embodiments, one or more agents, other than antibodies can be administered which decrease pro-inflammatory cytokines, e.g. non-steroidal anti-inflammatory drugs (NSAIDs). Any combination of antibodies and one or more agents can be administered which decrease pro-inflammatory cytokines.

[0369] Treatment in combination is also contemplated to encompass the treatment with either the composition of the disclosure followed by a known treatment, or treatment with a known agent followed by treatment with the composition of the disclosure, for example, as maintenance therapy. For example, in the treatment of autoimmune diseases, excessive and prolonged activation of immune cells, such as T and B lymphocytes, and overexpression of the master pro-inflammatory cytokine tumor necrosis factor alpha (TNF), together with other mediators such as interleukin-6 (IL-6), interleukin-1 (IL-1), and interferon gamma (IFN-γ), play a central role in the pathogenesis of autoimmune inflammatory responses in rheumatoid arthritis (RA), inflammatory bowel disease (IBD), Crohn’s disease (CD), and ankylosing spondylitis (AS).

[0370] Non-steroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, disease-modifying anti-rheumatic drugs (DMARDs) are traditionally used in the treatment of autoimmune inflammatory diseases. NSAIDs and glucocorticoids are effective in the alleviation of pain and inhibition of inflammation, while DMARDs have the capacity of reducing tissue and organdamage caused by inflammatory responses. More recently, treatment for RA and other autoimmune diseases has been revolutionized with the discovery that TNF is critically important in the development of the diseases. Anti-TNF biologies (such as infliximab, adalimumab, etanercept, golimumab, and certolizumab pepol) have markedly improved the outcome of the management of autoimmune inflammatory diseases.

[0371] Non-steroidal anti-inflammatory drugs have the analgesic, antipyretic, and antiinflammatory effect, frequently used for the treatment of conditions like arthritis and headaches. NSAIDs relieve pain through blocking cyclooxygenase (COX) enzymes. COX promotes the production of prostaglandins, a mediator which causes inflammation and pain. Although NSAIDs have different chemical structures, all of them have the similar therapeutic effect, e.g., inhibition of autoimmune inflammatory responses. In general, NSAIDs can be divided into two broad categories: traditional non-selective NSAIDs and selective cyclooxygenase-2 (COX-2) inhibitors (For a review, see, P. Li et al., Front Pharmacol (2017) 8:460).

[0372] In addition to anti-TNF agents, the biologies targeting other proinflammatory cytokines or immune competent molecules have also been extensively studied and actively developed. For example, abatacept, a fully humanized fusion protein of extracellular domain of CTLA-4 and Fc fraction of IgGl, has been approved for the RA patients with inadequate response to anti-TNF therapy. The major immunological mechanism of abatacept is selective inhibition of co-stimulation pathway (CD80 and CD86) and activation of T cells. Tocilizumab, a humanized anti-IL-6 receptor monoclonal antibody was approved for RA patients intolerant to DMARDs and / or anti-TNF biologies. This therapeutic mAb blocks the transmembrane signaling of IL-6 through binding with soluble and membrane forms of IL-6 receptor.Biological drugs targeting IL-1 (anakinra), Thl immune responses (IL-12 / IL-23, ustekinumab), Thl7 immune responses (IL-17, secukinumab) and CD20 (rituximab) have also been approved for the treatment of autoimmune diseases (For a review see, P. Li et al., Front Pharmacol (2017) 8:460).

[0373] Accordingly, in some embodiments, the methods of the disclosure include administration of a composition disclosed herein to a subject individually as a single therapy (e.g., monotherapy). In some embodiments, a composition of the disclosure is administered to a subject as a first therapy in combination with a second therapy. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy,immunotherapy, hormonal therapy, toxin therapy, and surgery. In some embodiments, the first therapy and the second therapy are administered concomitantly. In some embodiments, the first therapy is administered at the same time as the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation. Methods for modulating an activity of a cell

[0374] In another aspect, provided herein are various methods for modulating an activity of a cell. The methods include the steps of: (a) providing an effective amount of any of the recombinant cells provided herein, and (b) contacting it with a selected ligand, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of a ligand- inducible proteolytic cleavage site and releases the intracellular domain comprising the transcriptional regulator, wherein the transcriptional regulator modulates expression of the second nucleic acid and an activity of the recombinant cell. One skilled in the art upon reading the present disclosure will appreciate that the disclosed methods can be carried out in vivo, ex vivo, or in vitro.

[0375] Non-limiting exemplary cellular activities that can be modulated using the methods provide herein include, but are not limited to, gene expression, proliferation, apoptosis, non- apoptotic death, differentiation, dedifferentiation, migration, secretion of a gene product, cellular adhesion, and cytolytic activity.

[0376] In some embodiments, the second nucleic acid encoding the CARD11 polypeptide modulates T cell signaling through NFAT, NF-κB and / or AP-1 pathways and / or cytokine production. Methods for Simultaneously Inducing T Cell Signaling and Gene Regulation

[0377] The present disclosure also provides methods for simultaneously inducing T cell signaling and gene regulation in a T cell including (a) providing a T cell including the first and second nucleic acids of the disclosure and (b) exposing the T cell to the selected ligand, wherein binding of a selected ligand to the extracellular ligand-binding domain simultaneously inducesintracellular signaling and release of the transcription regulator to induce expression of the CARD11 polypeptide.

[0378] Also provided herein are methods for simultaneously inducing T cell signaling and gene regulation in a T cell, the method including (a) providing a vector the first and second nucleic acids of the disclosure of the disclosure and (b) transducing a T cell with the vector, wherein binding of a selected ligand to the extracellular ligand-binding domain simultaneously induces intracellular signaling and release of the transcription regulator to induce expression of the CARD11 polypeptide.

[0379] In some embodiments, the induced intracellular signaling of the T cell modulates expression of a selected gene involved in proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, secretion of a molecule, cellular adhesion, and / or a cytolytic activity. In some embodiments, the CARD11 polypeptide modulates IL-2 expression in the T cell. Systems and Kits

[0380] Also provided herein are systems and kits including the recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided and described herein as well as written instructions for making and using the same. For example, provided herein, in some embodiments, are systems and / or kits that include one or more of: a chimeric receptor and / or CARD11 polypeptide as described herein, a recombinant nucleic acids as described herein, a recombinant cell as described herein, or a pharmaceutical composition as described herein. In some embodiments, the systems and / or kits of the disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer one any of the provided chimeric receptor and / or CARD11 polypeptide, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual. In some embodiments, a kit can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with the other kit components for a desired purpose, e.g., for modulating an activity of a cell, inhibiting a target cancer cell, or treating a health condition (e.g., disease) in an individual in need thereof.

[0381] Any of the above-described systems and kits can further include one or more additional reagents, where such additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negativecontrol polypeptides, positive control polypeptides, reagents for in vitro production of the chimeric receptor polypeptides.

[0382] In some embodiments, the components of a system or kit can be in separate containers. In some other embodiments, the components of a system or kit can be combined in a single container.

[0383] In some embodiments, a system or kit can further include instructions for using the components of the kit to practice the methods. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kits as a package insert, or in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD- ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g, via the internet), can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0384] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0385] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of information sources, including scientific journal articles, patent documents, and textbooks, are referred to herein; this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0386] The discussion of the general methods given herein is intended for illustrative purposes only. Other alternative methods and alternatives will be apparent to those of skill in the art upon review of this disclosure, and are to be included within the spirit and purview of this application.

[0387] Throughout this specification, various patents, patent applications and other types of publications (e.g., journal articles, electronic database entries, etc.) are referenced. The disclosure of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entirety for all purpose.

[0388] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of information sources, including scientific journal articles, patent documents, and textbooks, are referred to herein; this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0389] The discussion of the general methods given herein is intended for illustrative purposes only. Other alternative methods and alternatives will be apparent to those of skill in the art upon review of this disclosure, and are to be included within the spirit and purview of this application. EXAMPLES

[0390] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature cited above.

[0391] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims. EXAMPLE 1 Materials and Methods

[0392] This Example describes the materials and methods used in Examples 2-5.

[0393] Primary Human T cell Isolation and Culture. Primary CD3+ T cells were isolated from anonymous donor blood after apheresis by negative selection (STEMCELL Technologies #15062 & 15063). Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board. T cells were cryopreserved in RPMI- 1640 (UCSF cell culture core) with 20% human AB serum (Valley Biomedical Inc., #HP1022)and 10% DMSO. After thawing, T cells were cultured in human T cell medium consisting of X- VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L- Cysteine (Sigma-Aldrich #A9165) supplemented with 30 units / mL IL-2 (NCI BRB Preclinical Repository) for all experiments.

[0394] Lentiviral Transduction of Human T cells. Pantropic VSV-G pseudotyped lentivirus was produced via transfection of Lenti-X 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus TransIT-Lenti (Mirus #MIR 6606). Primary T cells were thawed the same day, and after 24 hours in culture, were stimulated with Human T-Activator CD3 / CD28 Dynabeads (Life Technologies #11131D) at a 1:3 cell:bead ratio. At 48 hours, viral supernatant was harvested and the primary T cells were exposed to the virus for 24 hours. At day 5 post T cell stimulation, the Dynabeads were removed, T cells were sorted, and the T cells expanded until day 10-14 when they were rested and could be used in vitro or in vivo assays. T cells were sorted for assays with a Beckton Dickinson (BD) FACs ARIA II.

[0395] Retroviral Transduction of Mouse T cells. Retrovirus was produced via transfection of Lenti-X 293T cells (Clontech #11131D) with a pMSCV transgene expression vector and the Retroviral ecotropic packaging plasmid (Addgene #12371) using Fugene HD. B6 CD45.1 B6.SJL-Ptprca Pepcb / BoyJ mice were euthanized via CO2 asphyxiation and cervical dislocation, spleens were harvested. T cells were isolated from spleens using EasySep negative selection protocol (BioLegend #480031). Mouse Dynabeads (Gibco #11453D) were added to isolated T cells at a 1:1 cell:bead ratio.12-well non-TC treated plates were coated with 50µg / mL Retronectin (Takara #T100B) with a volume of 500µl / well and stored at 4oC overnight.24 hours later Retronectin plates were blocked with PBS+2%FBS for 1hr at room temperature. Blocking solution was removed and T cells were exposed to harvested virus and spinfected at 20-30ºC for 1hr, plates were then incubated overnight. The next day viral supernatant was removed, and T cells seeded in fresh media with IL-2.24hr later T cells were split and assessed for vector transduction efficiency via flow cytometry with a Becton Dickinson (BD) FACSymphony X-50.

[0396] Cancer Cell Lines. The cancer cell lines used were Nalm6 acute lymphoblastic leukemia (ATCC #CRL-3273) and B16-F10 murine melanoma. Nalm6 cells were lentivirally transduced to stably express human CD19. B16-F10 cells were retrovirally transduced to stablyexpress human CD19. CD19 levels were determined by staining the cells with α-CD19 APC (Biolegend #302212) or BV421 (Biolegend # 302234). All cell lines were sorted for expression of the transgenes.

[0397] Circuit Induction Assay. To assess circuit induction, primary human T cells were co- transduced with the Hybrid SynNotch CAR and a response element containing a UAS promoted CARD11-PIK3R3 with BFP or just BFP alone, transduced cells were then co-cultured with K562s, either with or without CD19, at a 1:1 ratio for 24 hours. Co-cultured cells were then centrifuged, washed twice with flow buffer (PBS + 2% FBS), and resuspended in flow buffer with diluted DRAQ7 to assess viability. Washed cells were immediately analyzed on a flow cytometer to assess expression of BFP.

[0398] In Vitro Activation Assay. To determine the activation, transduced cells were co- cultured with K562s, either with or without CD19 expression, at a 1:1 ratio for 24 hours. Co- cultured cells were then centrifuged, washed twice with flow buffer (PBS + 2% FBS), and stained in 50uL of a master mix of antibodies targeting surface activation markers CD25. Cells were washed twice after stain with flow buffer and resuspended in flow buffer with diluted DRAQ7 to assess viability. Stained cells were immediately analyzed on a flow cytometer to assess expression of activation markers.

[0399] In vitro Cytokine Secretion Assay. To assess cytokine secretion, transduced primary human T cells were co-cultured with K562s, either with or without CD19 expression, at a 1:1 ratio for 24 hours. Supernatant was collected from co-cultures, diluted and assessed for IL-2 concentration via ELISA Invitrogen).

[0400] In Vivo Nalm6 Study. NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) (UCSF LARC Breeding Core) mice were dosed with 0.5 x 106Luciferase expressing Nalm 6 cells via tail vein injection.4 days post tumor injection, Hybrid synNotch CAR or CAR transduced T cells were dosed to tumor bearing animals via retro-orbital injection (see figures details for the number of T cells dosed per experiment). Bioluminescence imaging was performed using an IVIS Spectrum In Vivo Imaging system at regular timepoints to assess tumor burden. Animals were dosed with 200uL of 15mg / mL Luciferin via IP injection, and allowed to ambulate for 12-20 minutes prior to capturing prone and supine images. Image capture time was adjusted based on bioluminescence intensity, and average radiance [p / s / cm² / sr] was used as a measurement oftumor burden. Throughout experiment animal drinking water was supplemented with Clavomox (Zoetis #55-101) to prevent bacterial infections.

[0401] In Vivo B16-F10 Study. C57BL / 6 CD45.2 mice were dosed with 0.1 x 106 CD19 expressing B16-F10 cells via subcutaneous injection.11 days post tumor injection, Hybrid synNotch CAR or CAR tranduced T cells were dosed to tumor bearing animals via retro-orbital injection (see figures details for the number of T cells dosed per experiment). Tumors were measured with calipers twice weekly, and tumor volume was calculated using the following formula: (length x width2) / 2. EXAMPLE 2 Expression of Hybrid SynNotch CAR to CARD11-PIK3R3 Circuits in Human Primary Human T cells

[0402] This Example describes design and expression of hybrid SynNotch CAR to CARD11- PIK3R3 payload circuits.

[0403] Hybrid SynNotch CAR to CARD11-PIK3R3 payload circuits were designed as shown in FIG.2A. Briefly, flag tagged CD19 targeted Hybrid SynNotch CAR that utilizes the optimized internal signaling domains of truncBB_CD3z_TF were designed. Exemplary sequences of these constructs are shown in Table 1 below.

[0404] This receptor is paired with response elements, containing a UAS promoter followed by CARD11-PIK3R3 or ΔID CARD11-PIK3R3 and BFP. BFP is used as a proxy for CARD11- PIK3R3 or ΔID CARD11-PIK3R3 protein expression during circuit induction. The response element constructs additionally contain a constitutively expressed GFP, used as a reporter to determine expression of the response element construct. Exemplary sequences of response element constructs are shown in Table 2 below.

[0405] The expression of these circuits was then analyzed in T cells. Briefly, primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads and transduced with two lentiviral constructs expressing either the Hybrid SynNotch CAR (truncBB_CD3z_TF) or response elements (UAS_CARD11-PIK3R3 or UAS_ΔID CARD11-PIK3R3). Primary T cells were sorted to purify the dual positive population (FIG.2B), expressing both the Hybrid SynNotch CAR (flag tag) and the response elements (GFP). EXAMPLE 3 Hybrid SynNotch CARs Can Activate T cells and Drive CARD11-PIK3R3 Expression Plus Phenotypic Changes in Response to Antigen

[0406] This experiment was done to determine if hybrid SynNotch CAR to CARD11-PIK3R3 Circuits can induce T cell activation, cytokine phenotypic changes, and drive expression of CARD11-PIK3R3 in response to antigen stimulation.

[0407] Experiments were performed using T cells as described in FIG.2B. The T cells were then co-cultured for 24 hours with CD19+ target cells and assessed via flow for activation (CD25 expression) and CARD11-PIK3R3 or ΔID CARD11-PIK3R3 protein expression (BFP). As shown in FIG.3B, Hybrid SynNotch CAR circuits induce activation (FIG.3B, left) and CARD11-PIK3R3 or ΔID CARD11-PIK3R3 protein expression (FIG.3B, right) as expected.

[0408] To examine cytokine phenotypic changes in response to antigen stimulation, T cells were prepared as described in FIG.2B. The T cells were then co-cultured for 24 hours with CD19+ target cells. Supernatant was collected and assessed via ELISA for IL-2 secretion. As shown in FIG.3C, T cells with Hybrid SynNotch CAR to CARD11-PIK3R3 or ΔID CARD11- PIK3R3 circuits secrete higher amounts of IL-2 in response to antigen stimulation as compared to a CD19 targeted second generation (41BB_CD3z) CAR T cell.EXAMPLE 4 Hybrid SynNotch CAR T cells that Induce Expression of CARD11-PIK3R3 Have Potent Activity in Xenograft Tumors

[0409] This experiment was done to test activity of the Hybrid SynNotch CAR to CARD11- PIK3R3 circuits in tumors.

[0410] NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were dosed intravenously with 0.5x106 Nalm6-Luc-GFP tumor cells. Bulk CD3+ T-cells were co-transduced with the anti-CD19 Hybrid SynNotch CAR (truncBB_CD3z_TF) and the CARD11-PIK3R3 response element as described in FIG.2B. Control groups include untransduced T cells, BBz CAR T cells, or T cells dual transduced with BBz CAR and constitutively expressed CARD11-PIK3R3.1 x106transduced CD3+ T cells were dosed to animals via retro-orbital injection 4 days post tumor injection. Animals were assessed twice weekly for tumor via IVIS imaging. This experimental timeline is shown in FIG.4A.

[0411] Tumor burden of each animal was measured via bioluminescence imaging of luciferase secreting tumor cells using IVIS. As shown in FIG.4B, animals receiving either BBz CAR with constitutive CARD11-PIK3R3 or Hybrid SynNotch CAR to CARD11-PIK3R3 Circuit T cells maintain control of Nalm6 tumors, while untransduced or BBz CAR only treated animals do not control tumor burden.

[0412] Percent weight change of treated animals was then determined. As shown in FIG.4C, animals receiving either BBz CAR with constitutive CARD11-PIK3R3 or Hybrid SynNotch CAR to CARD11-PIK3R3 Circuit T cells continue to gain weight, while untransduced or BBz CAR only treated animals lose weight as they succumb to their tumors. Thus, hybrid SynNotch CAR T cells that drive expression of CARD11-PIK3R3 payload minimizes animal weight loss.

[0413] Survival of treated animals was then analyzed. As shown in FIG.4D, animals receiving either BBz CAR with constitutive CARD11-PIK3R3 or Hybrid SynNotch CAR to CARD11-PIK3R3 Circuit T cells survive longer than untransduced control or BBz CAR only T cells. Thus, hybrid SynNotch CAR T cells that drive expression of CARD11-PIK3R3 payload improves animal survival. EXAMPLE 5Hybrid SynNotch CAR T cells that Induce Expression of CARD11-PIK3R3 Have Potent Activity in Syngeneic Tumors

[0414] This experiment was done to analyze activity of the Hybrid SynNotch CAR to CARD11-PIK3R3 circuits in tumors.

[0415] C57BL / 6 mice were dosed subcutaneously with 0.1x106 human CD19+ B16 melanoma tumor cells. Bulk CD3+ T-cells isolated from a C57BL / 6 donor mouse were co- transduced with the anti-CD19 Hybrid SynNotch CAR (truncBB_CD3z_TF) and the CARD11- PIK3R3 response element. Control groups include untransduced T cells, murinized BBz CAR T cells alone, or T cells dual transduced with murinized BBz CAR and constitutively expressed CARD11-PIK3R3.3 x106Receptor+ CD3+ T cells were dosed to animals via retro-orbital injection 12 days post tumor injection. Tumor volume was assessed 2x weekly using calipers. This experimental timeline is shown in FIG.5A.

[0416] Tumor volume of each animal was then measured via caliper measurements. As shown in FIG.5B, animals receiving either murinized BBz CAR with constitutive CARD11-PIK3R3 or Hybrid SynNotch CAR to CARD11-PIK3R3 Circuit T cells maintain control of B16tumors over time, while untransduced or murinized BBz CAR only treated animals do not control tumor burden. Thus, hybrid SynNotch CAR T cells that drive expression of CARD11-PIK3R3 payload maintains tumor control similarly to CAR with constitutive expression of CARD11- PIK3R3.

[0417] Percent weight change of treated animals was then determined. As shown in FIG.5C, animals receiving any treatment group continue to gain weight throughout the study. This suggests that hybrid SynNotch CAR T cells that drive expression of CARD11-PIK3R3 payload minimizes animal weight loss.

[0418] Finally, survival of treated animals was analyzed. As shown in FIG.5D, animals receiving either murinized BBz CAR with constitutive CARD11-PIK3R3 or Hybrid SynNotch CAR to CARD11-PIK3R3 Circuit T cells survive longer than untransduced control or murinized BBz CAR only T cells. This suggests that hybrid SynNotch CAR T cells that drive expression of CARD11-PIK3R3 payload improves animal survival. EXAMPLE6 Materials and Methods

[0419] This Example describes the materials and methods used in Examples 7-8.

[0420] Receptor Construction. Intracellular domains containing the appropriate costimulatory domain, CD3zeta domain, Gal4VP64 and GSlinkers were synthesized as gBlock gene fragments from Twist. Receptors were built by fusing the CD19 scFv or ALPPL2 scFv (M25FYIA) to the corresponding receptor scaffold and intracellular tail. All receptors contain an n-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP SEQ ID NO: 197) for membrane targeting and a flag-tag (DYKDDDDK SEQ ID NO: 198) for easy determination of surface expression with α-flag PE (Biolegend 637310). The receptors were cloned into a modified pHR’SIN:CSW vector containing a PGK promoter for all primary T cell experiments. Constitutive CARD11-PIK3R3 was cloned into the same pHR’SIN:CSW vector and was also fused to a T2A mCherry for easy determination of intracellular expression.

[0421] The pHR’SIN:CSW vector was also modified to make the response element plasmids. Five copies of the Gal4 DNA binding domain target sequence (GGAGCACTGTCCTCCGAACG SEQ ID NO: 199) or four copies of the HNF1α DNA binding domain target sequence (GTTAAT SEQ ID NO: 200) were cloned 5′ to a minimal pybTATA promoter. Also included in the response element plasmids is a PGK promoter that constitutively drives mCitrine expression to easily identify transduced T cells. For all inducible BFP and CARD11-PIK3R3 vectors, BFP or CARD11-PIK3R3 was cloned via a BamHI site in the multiple cloning site 3′ to the Gal4 response elements. All constructs were cloned via Infusion cloning (Clontech #ST0345).

[0422] Exemplary sequences of these constructs are shown in Table 3 below.

[0423] Primary Human T Cell Isolation and Culture. Primary CD3+ T cells were isolatedfrom anonymous donor blood after apheresis by negative selection (STEMCELL Technologies #15062 & 15063). Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board. T cells were cryopreserved in RPMI- 1640 (UCSF cell culture core) with 20% human AB serum (Valley Biomedical Inc., #HP1022) and 10% DMSO. After thawing, T cells were cultured in human T cell medium consisting of X- VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L- Cysteine (Sigma-Aldrich #A9165) supplemented with 30 units / mL IL-2 (Peprotech).

[0424] Mouse T cell Isolation Culture and Retroviral Transduction. CD8+ T cells were isolated from the spleens of CD45.1+or CD45.2+mice using a mouse pan CD3+T cell isolation kit (Biolegend, No.480031). T cells were then cultured with 100 units / mL recombinant human IL-2 (Peprotech), T cells were stimulated overnight with anti-CD3 and anti-CD28 Dynabeads beads (ThermoFisher #11453D). Retroviral supernatants were added to T cells in plates coated with RetroNectin (Takara #T100B), and spinduction was carried out for 1 hour at 2,000 r.p.m. at 30 °C. Following transduction, T cells were resuspended and cultured in fresh medium containing 100 units / mL IL-2 until adoptive transfer. Transduction efficiency was determined by flow cytometry before adoptive transfer.

[0425] Lentiviral Transduction of Human T cells. Pantropic VSV-G pseudotyped lentivirus was produced via transfection of Lenti-X 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus TransIT-Lenti (Mirus #MIR 6606). Primary T cells were thawed thesame day, and after 24 hours in culture, were stimulated with Human T-Activator CD3 / CD28 Dynabeads (Life Technologies #11131D) at a 1:3 cell:bead ratio. At 48 hours, viral supernatant was harvested, and the primary T cells were exposed to the virus for 24 hours. At day 5 post T cell stimulation, the Dynabeads were removed, T cells were sorted, and expanded until day 10- 14 when they were rested and could be used in vitro or in vivo assays. T cells were sorted for assays with a Beckton Dickinson (BD) FACs ARIA II.

[0426] Cancer Cell Lines. The cancer cell lines used were K562 myelogenous leukemia cells (ATCC #CCL-243), A549 lung epithelial carcinoma cells (ATCC #CCL-18), M28 epithelioid cells (originally obtained from Dr. Brenda Gerwin’s laboratory at the National Cancer Institute), and B16-F10 melanoma cells (ATCC No. CRL-6475). K562s and A549s were lentivirally transduced to stably express human CD19. B16-F10s were engineered to express human CD19. CD19 levels were determined by staining the cells with α-CD19 APC (Biolegend #302212) or BV421 (Biolegend # 302234).

[0427] In vitro primary T cell assays. For all in vitro co-culture assays, purified primary human T cells transduced with Hybrid-R and circuit vectors were seeded with target cells at a 1:1 effector:target ratio for 48 or 72 hours after which supernatants were isolated and frozen at - 80 ºC. Isolated mouse T cells transduced with Hybrid-R and circuit vectors were seeded with target cells at a 1:1 effector:target ratio for 96 hours after which supernatants were isolated and frozen at -80 ºC. All IL-2 ELISA experiments (ThermoFisher #BMS221INST, ThermoFisher #BMS601) were conducted in medium without exogenous IL-2. Once culture supernatants were harvested, the remaining cells were stained for flow cytometric analysis for surface protein expression.

[0428] Flow Cytometry. For all in vitro primary T cell assays, cells were washed with PBS 2% FBS twice, stained with surface staining markers (diluted 1:200) in the dark at room temperature for 20 minutes, washed twice and resuspended in PBS 2% FBS with DRAQ7 (diluted 1:1,000). Cells were then analyzed on a Becton Dickinson FACSymphony X-50 flow cytometer.

[0429] Incucyte Killing Assay. CD19+ A549 expressing nuclear mKate2 were seeded in a 96-well flat bottom plate.24 hours later purified engineered T cells were added at an expected effector:target ratio of 1:8. Plates were imaged every 4 hours using the IncuCyte S3 Live-CellAnalysis System (Essen Bioscience). Five images per well were collected at x10 magnification. All IncuCyte experiments were performed in human T cell medium without exogenous IL-2.

[0430] In Vivo M28 Study. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) (UCSF LARC Breeding Core) mice were dosed with 4 x 106ALPPL2 expressing M28 cells via flank subcutaneous injection.7 days post tumor injection, Hybrid-R or CAR transduced T cells were dosed to tumor bearing animals via retro-orbital injection (see figures details for the number of T cells dosed per experiment). Mice with similar-sized tumors were randomized to receive treatments of engineered T cells. Digital caliper measurements were performed at regular timepoints to assess tumor volume. Tumor volume was calculated using the following formula: (length × width2) / 2. Throughout experiment animal drinking water was supplemented with Clavomox (Zoetis #55- 101) to prevent bacterial infections.

[0431] In Vivo B16 Study. B6.SJL-Ptprca Pepcb / BoyJ mice aged 6–12 weeks were injected subcutaneously with 1 × 105CD19-B16 melanoma cells. Mice with similar-sized tumors were randomized to receive treatments of engineered T cells. A 100 μL volume of T cells was retro- orbitally injected on day 11 post tumor inoculation. All animals received a dose of 4 x 106receptor positive T cells (receptor positive frequency was assessed via flow cytometry on the day of injection). Digital caliper measurements were performed at regular timepoints to assess tumor volume. Tumor volume was calculated using the following formula: (length × width2) / 2. EXAMPLE 7 Hybrid-R Controlling CARD11-PIK3R3 Enhances Anti-Tumor Immunity, Maintains Mouse T Cell Therapy Potency, and Improves Cell Therapy Safety

[0432] Chimeric antigen receptor (CAR) T cell therapies have struggled to overcome many of the challenges faced when treating solid tumors. To improve CAR T cell performance and efficacy many groups have sought to overexpress enhancing or pro-inflammatory factors (Lynn, R.C., Weber, E.W., Sotillo, E. et al. c-Jun overexpression in CAR T cells induces exhaustion resistance. Nature 576, 293–300 (2019); Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024); Yeku, Oladapo O, and Renier J Brentjens. “Armored CAR T-cells: utilizing cytokines and pro- inflammatory ligands to enhance CAR T-cell anti-tumour efficacy.” Biochemical Society transactions vol.44,2 (2016): 412-8). These proteins like transcription factors or T cell receptor(TCR) signaling pathway members can greatly improve activating signal strength or limit T cell differentiation therefore enhancing therapy potency (Lynn, R.C., Weber, E.W., Sotillo, E. et al. c-Jun overexpression in CAR T cells induces exhaustion resistance. Nature 576, 293–300 (2019); Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). However, the permanent overexpression of some factors overtime, can drive T cell dysfunction and deleterious consequences (Yeku, Oladapo O, and Renier J Brentjens. “Armored CAR T-cells: utilizing cytokines and pro-inflammatory ligands to enhance CAR T-cell anti-tumour efficacy.” Biochemical Society transactions vol.44,2 (2016): 412-8; June, Carl H et al. “Is autoimmunity the Achilles' heel of cancer immunotherapy?” Nature medicine vol.23,5 (2017): 540-547). It is therefore critical to consider regulating the expression of these enhancing factors and restricting boosted cell therapy activity to the local tumor microenvironment only.

[0433] Recently, our group has described robust improvements in T cell therapy performance when the mutant fusion protein CARD11-PIK3R3 is expressed alongside a CAR or TCR (Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). A hit from an in vivo screen assessing the impacts of human T cell lymphoma mutations on T cell immunotherapy performance, the CARD11- PIK3R3 fusion protein significantly boosts IL-2 production in primary human and mouse T cells and increases overall efficacy in a variety of in vivo models (Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). However, this fusion protein, under constitutive promoter control, can incite alloreactive toxicities in T cells whose native TCR repertoire is left intact (Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). To take advantage of the CARD11-PIK3R3 protein’s benefits in the T cell immunotherapeutic setting we therefore sought to regulate its expression under Hybrid Receptors.

[0434] The Hybrid receptors (Hybrid-R) used in this study combine key architectural elements of CARs and transcriptional receptors like SyNthetic Intramembrane Proteolysis Receptors (SNIPRs). A non-limiting example of the Hybrid-R is shown in FIG.6A, which comprises a GAL4-VP64 transcriptional regulator domain. These compact multi-functional receptors have the potential to greatly improve T cell therapy performance and safety byinvoking short timescale T cell activating signals and regulating genetically encoded transcriptional circuits from a single input signal.

[0435] To evaluate the capacity of the Hybrid-R system for the regulated expression of CARD11-PIK3R3 primary human T cells were engineered with Hybrid-R and an inducible CARD11-PIK3R3 circuit. In vitro, co-cultured with antigen expressing target cells, it was found that the Hybrid-R to CARD11-PIK3R3 circuit increases IL-2 production from primary human and mouse T cells, only when antigen is present (FIG.6B, FIG.7B). Moreover, expression of the CARD11-PIK3R3 can improve cytotoxicity and increase ICOS surface expression in human T cells (Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). Indeed, Hybrid-R regulated CARD11-PIK3R3 fusion offers these enhancements in vitro (FIGs.6B-6C).

[0436] Previously, it has been shown that the CARD11-PIK3R3 fusion protein drives robust anti-tumor responses in solid tumor models (Garcia, J., Daniels, J., Lee, Y. et al. Naturally occurring T cell mutations enhance engineered T cell therapies. Nature 626, 626–634 (2024)). To stress test the Hybrid-R to CARD11-PIK3R3 circuit, NSG mice bearing solid (M28) tumors and syngeneic mice bearing solid (B16) tumors were treated. In all cases the Hybrid-R to CARD11-PIK3R3 circuit T cells were able to control tumor growth as potently or more potently than CAR + CARD11-PIK3R3 indicating high therapeutic potential for this receptor circuit pairing (FIG.6D, FIG.7C). Further, as animal body weight was monitored for the duration of the experiments, complete prevention of payload associated toxicities or weight loss was observed only in animals treated with Hybrid-R to CARD11-PIK3R3 T cells (FIG.6E), this greatly improved animal survival. (FIG.6E, FIG.7D) EXAMPLE 8 Humanized Hybrid-R Controlling CARD11-PIK3R3 Enhances Anti-Tumor Immunity, and Improves Cell Therapy Safety

[0437] The construction of the prototypical Hybrid-R system includes a GAL4-VP64 transcriptional activator domain derived from the yeast GAL4 protein (FIG.6A) (Zhu, Iowis et al. “Modular design of synthetic receptors for programmed gene regulation in cell therapies.” Cell vol.185,8 (2022): 1431-1443.e16). Adapting a yeast derived protein for use in primary human T cells could potentiate immunogenicity and is therefore not ideal for a clinicalcell therapy. To address this, we sought to update Hybrid-R with a human transcriptional activator domain. We chose HNF1α-p65, which has previously displayed orthogonal transcriptional regulation in primary human T cells (FIG.8A) (Zhu, Iowis et al. “Modular design of synthetic receptors for programmed gene regulation in cell therapies.” Cell vol.185,8 (2022): 1431-1443.e16). These humanized Hybrid-R (hHybrid-R) driving CARD11-PIK3R3 fusion display the same phenotypic changes as the original Hybrid-R when stimulated with antigen expressing target cells in vitro (FIGs.8A-8B). Moreover, hHybrid-R to CARD11- PIK3R3 circuits greatly improve T cell therapy control of A549 solid tumor cells in vitro (FIG. 8C).

[0438] While particular alternatives of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. There is no intention, therefore, of limitations to the exact abstract and disclosure herein presented. Informal Sequence Listing

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A recombinant cell comprising : a) a first nucleic acid encoding a chimeric receptor, the chimeric receptor comprising, from N-terminus to C-terminus:(i) an extracellular ligand-binding domain having a binding affinity for a selected ligand;(ii) a linking sequence;(iii) a transmembrane domain (TMD) comprising one or more ligandinducible proteolytic cleavage sites; and(iv) an intracellular domain (ICD) comprising, in any order:(A) an intracellular signaling domain (SD) comprising at least one costimulatory domain derived from a signaling molecule, and an activation domain, and(B) a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the one or more ligand-inducible proteolytic cleavage sites disposed between the ICD and the linking sequence, wherein the chimeric receptor does not comprise a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor; and b) a second nucleic acid encoding a caspase recruitment domain family member 11 (CARD11) polypeptide comprising (i) a caspase recruitment domain (CARD) and (ii) one or more mutations, wherein the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator; wherein expression of the CARD11 polypeptide is modulated by the transcriptional regulator.

2. A recombinant cell comprising: a) a first nucleic acid encoding a first polypeptide of a multi-chain chimeric receptor, wherein the first polypeptide comprises, from N-terminus to C-terminus:(i) an extracellular ligand-binding domain having a binding affinity for a selected ligand;(ii) a linking sequence;(iii) a first transmembrane domain (TMD) comprising a first modified interface and one or more ligand-inducible proteolytic cleavage sites;(iv) a first intracellular domain (ICD) comprising a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the one or more ligand-inducible proteolytic cleavage sites; b) a third nucleic acid encoding a second polypeptide of the multi-chain chimeric receptor, wherein the second polypeptide comprises, from N-terminus to C-terminus:(i) a second TMD comprising a second modified interface; and(ii) a second ICD comprising (A) at least one costimulatory domain derived from a signaling molecule, and (B) an activation domain, wherein the first and the second modified interfaces each comprises an amino acid residue having a charged side chain, wherein the amino acid residues in the first and the second modified interfaces have opposite charges, wherein the first polypeptide is coupled to the second polypeptide via the first modified interface and the second modified interface; wherein the multi-chain chimeric receptor does not comprise a LIN-12-Notch repeat (LNR) and / or a heterodimerization domain (HD) of a Notch receptor; and c) a second nucleic acid encoding a caspase recruitment domain family member 11 (CARD11) polypeptide comprising (i) a caspase recruitment domain (CARD) and (ii) one or more mutations, wherein the second nucleic acid is operably linked to a promoter and a response element that is capable of binding to the transcriptional regulator; wherein expression of the CARD11 polypeptide is modulated by the transcriptional regulator.

3. The recombinant cell of claim 1 or 2, wherein binding of the selected ligand to the extracellular ligand-binding domain induces proximal signaling cascades through the at least one costimulatory domain and / or the activation domain.

4. The recombinant cell of any one of claims 1-3, wherein binding of the selected ligand to the extracellular ligand-binding domain releases the transcriptional regulator from the chimeric polypeptide.

5. The recombinant cell of any one of claims 1-4, wherein the response element is comprised within the promoter.

6. The recombinant cell of any one of claims 1-5, wherein the extracellular domain comprises an antigen-binding moiety capable of binding to the selected ligand on the surface of a second cell.

7. The recombinant cell of claim 6, wherein the second cell is a pathogenic cell.

8. The recombinant cell of claim 7, wherein the second cell is a human cell.

9. The recombinant cell of claim 8, wherein the human cell is a tumor cell.

10. The recombinant cell of claim 9, wherein the human cell is a terminally differentiated cell.

11. The recombinant cell of any one of the preceding claims, wherein the ligand comprises a protein or a carbohydrate.

12. The recombinant cell of any one of the preceding claims, wherein the ligand is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1,CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY- TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof. 13.The recombinant cell of any one of the preceding claims, wherein the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL-13Rα, EGFRv3, EGFR806, GD2, or CA9.14.The recombinant cell of any one of the preceding claims, wherein the ligand comprises or consists of KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

15. The recombinant cell of any one of the preceding claims, wherein the ligand is selected from cell surface receptors, adhesion proteins, integrins, mucins, lectins, tumor-associated antigens, and tumor-specific antigens.

16. The recombinant cell of any one of the preceding claims, wherein the ligand is a tumor- associated antigen or a tumor-specific antigen.

17. The recombinant cell of any one of the preceding claims, wherein the extracellular ligand- binding domain comprises the ligand-binding portion of a receptor.

18. The recombinant cell of any one of claims 6-17, wherein the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, a minibody, an F(ab')2 fragment, an F(ab)v fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), and a functional fragment thereof.

19. The recombinant cell of claim 18, wherein the antigen-binding moiety comprises an scFv.

20. The recombinant cell of any one of claims 6-17, wherein the antigen-binding moiety specifically binds to a tumor-associated antigen selected from the group consisting of ADGRE2, CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, Claudin 18.2, CLECL1, CS-1, DLL3, EGFR, EGFRvIII, EGFR806, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), HER2p95, IGLL1, IL-11Rα, KIT (CD117), KLK2, KLK3, LY6G6D, MUC1, MUC16, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248,TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, GUCY2C, STEAP1, STEAP2, and Axl.

21. The recombinant cell of claim 20, wherein the tumor-associated antigen is CD19, BCMA, CEA, HER2, MUC1, CD20, ALPPL2, SIRPα, or EGFR.

22. The recombinant cell of claim 21, wherein the tumor-associated antigen is CD19, or ALPPL2.

23. The recombinant cell of any one of claims 16-19, wherein the antigen-binding moiety specifically binds to a tumor-associated antigen selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3δ, CD3ζ, CD3γ, CD3ε, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD28, CD30, CD33, CD34, CD38, CD40, CD44v6, CD45, CD46, CD47 CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD97, CD123, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD171, CD178, CD179, CD179a, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD213A2, CD246, CD252, CD253, CD261, CD262, CD272, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), CDH17, CEA, CLECL1, CLL-1, CLDN6, CLDN18.2, CS1, DLL3, LY6G6D, GCC, PRAME, EGFR, EGFRvIII, FGFR2, AFP, CA125, MUC-1, MAGE, ALPI, alkaline phosphatase placental-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), KLK2, KLK3, Mesothelin, IL13Ra2, signal regulatory protein α (SIRPα), TCRalpha, TCRbeta, TSHR, GD2, GD3, Tn Ag, cMET, Axl, ROR1, ROR2, GPC1, GPC2, GPC3, FLT3, TAG72, CEA, EPCAM, KIT (CD117), IL-13Ra2, IL-11Ra, PSCA, PRSS21, VEGFR2, LewisY, PDGFRβ, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, MUC16, NCAM, prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, STEAP1, STEAP2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, ROPN1, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-Al, legumain, HPV E6,E7, MAGE Al, ETV6-AML,sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, p53R175H, KRAS, mutant KRAS, KRAS G12D, prostein, surviving, telomerase, PCTA-1 / Galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin Bl, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2,LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, FCRL5, IGLL1, PSMA, TROP2, citrullinated vimentin, the extracellular portion of the APRIL protein, and any combinations thereof.

24. The recombinant cell of any one of claims 16-19, wherein the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin α5β1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, integrin α11β1, DLL3, CD2, SSTR2, TROP2, KLK2, KLK3, STEAP2, STEAP1, PSMA, PSCA, LY6G6D, IL-1α, CEA, C242 antigen, CanAg (MUC1 glycoform), CTAA16.88, UCY2C, IGF2BP3, p53R175H, NKG2D ligands, PRAME, MAGEA4, vimentin, HER2 / neu, CCR4, CCR5, ROPN1, ROR1, KK-LC-1, CA-125, folate receptor 1, folate receptor alpha, MUC1, MUC16, MSLN, CLDN6, WT1, ALPPL2, KRASG12D, KRASG12V, GCC, CDH17, CD70, MSLN, CLDN18.2, HPV E6 / E7, GPC3, IL- 13Rα, EGFRv3, EGFR806, GD2, or CA9.

25. The recombinant cell of any one of claims 16-19, wherein the tumor-associated antigen is KIR2D, NRP1, CD221, VEGFR, HGF, integrin a5b1, CD51, CD27, B7H3, NYESO1, EGFR, cMET, BRD4, EpCAM, SSX, Fibronectin EDB, or Integrin α11β1.

26. The recombinant cell of any one of claims 6-25, wherein the antigen-binding moiety specifically binds to a target antigen selected from the group consisting of BCMA, CD19, CD20, CD22, CD70, CD79A, CD79B, CD276 (B7H3), Claudin 6, Claudin 18.2, DLL3, GCC, GD2, GD3, GPC3, GPRC5D, LY6G6D, p53R175H, PRAME, and ROR1.

27. The recombinant cell of any one of the preceding claims, wherein the linking sequence comprises a hinge domain.

28. The recombinant cell of claim 27, wherein the hinge domain is capable of promoting oligomer formation of the chimeric polypeptide via intermolecular disulfide bonding.

29. The recombinant cell of claim 27, wherein the hinge domain is derived from a CD8α hinge domain, a CD28 hinge domain, a CDI 52 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgGl hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof.

30. The recombinant cell of any one of the preceding claims, wherein the linking sequence is derived from the group selected from: a CD8α hinge domain or a functional variant thereof, a CD28 hinge domain or a functional variant thereof, an 0X40 hinge domain or a functional variant thereof, and an IgG4 hinge domain or a functional variant thereof.

31. The recombinant cell of any one of the preceding claims, wherein the linking sequence comprises a hinge domain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 19-23.

32. The recombinant cell of any one of the preceding claims, wherein the linking sequence is derived from a CD8α hinge domain or a functional variant thereof.

33. The recombinant cell of any one of the preceding claims, wherein the linking sequence is derived from a CD28 hinge domain or a functional variant thereof.

34. The recombinant cell of any one of the preceding claims, wherein the linking sequence comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 8.

35. The recombinant cell of any one of the preceding claims, wherein the one or more ligandinducible proteolytic cleavage sites comprise a γ secretase cleavage site.

36. The recombinant cell of any one of the preceding claims, wherein the TMD comprises a polypeptide sequence having at least 80% sequence identity to a transmembrane domain from a Type 1 transmembrane receptor and comprises a γ-secretase cleavage site.

37. The recombinant cell of any one of the preceding claims, wherein the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to SEQ ID NO: 5.

38. The recombinant cell of claim 37, wherein the TMD comprises an amino acid substitution at amino acid position 18 and / or 19 of SEQ ID NO: 5.

39. The recombinant cell of claim 38, wherein the TMD comprises an amino acid substitution corresponding to G18A and / or V19A of SEQ ID NO: 5.

40. The recombinant cell of any one of the preceding claims, wherein the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-195.

41. The recombinant cell of any one of the preceding claims, wherein the TMD comprises a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100%, sequence identity to any one of SEQ ID NOS: 94-95, 99, 113, 132, 136, 147, and 157.

42. The recombinant cell of any one of claims 2-41, wherein the first and the second polypeptides of the multi-chain chimeric receptor are not covalently connected.

43. The recombinant cell of any one of claims 2-42, wherein the first modified interface comprises a positively charged residue, and wherein the second modified interface comprises a negatively charged residue, and wherein the first and the second polypeptides of the multi-chain chimeric receptor are coupled via the electrostatic force between the first and the second modified interfaces.

44. The recombinant cell of any one of claims 2-43, wherein (i) the first TMD comprises SEQ ID NO: 87 or functional variants thereof and the lysine or arginine residue is at position selected from positions 10 to 14 of SEQ ID NO: 87 or (ii) the first TMD comprises SEQ ID NO: 87 and the lysine or arginine is at position selected from positions 8 to 11 of SEQ ID NO:

87.

45. The recombinant cell of claim 44, wherein the lysine or arginine residue is (i) at position 12 of SEQ ID NO: 87, or (ii) is at position 9 of SEQ ID NO:

87.

46. The recombinant cell of any one of the preceding claims, wherein the chimeric receptor further comprises a stop-transfer-sequence (STS) positioned between the TMD and the ICD.

47. The recombinant cell of any one of the preceding claims, wherein the stop-transfer- sequence comprises a sequence having at least 70% sequence identity to a STS sequence from APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNEl, KCNE2, CHL1, LRP1, LRP2, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DOT, VASN, FLT1, CDH5, PKHD1, NECTINl, KL, IL6R, EFNBl, CD44, CLSTN1, LRP8, PCDHGC3, NRGl, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notchl, Notch2, Notch3, and Notch4.

48. The recombinant cell of any one of the preceding claims, wherein the signaling molecule comprises a class 1 or a class 3 human membrane protein.

49. The recombinant cell of any one of the preceding claims, wherein the signaling molecule is selected from the group consisting of CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BTN3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, EDAR, XEDAR, RELT, DR6, TROY, NGFR, CD22, SIGLEC-3, SIGLEC-5, SIGLEC-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Allergin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC.

50. The recombinant cell of any one of the preceding claims, wherein the signaling molecule is selected from the group consisting of OX40, ICOS, 4-1BB, CTLA4, CD28, CD30, CD2, CD27, and CD226.

51. The recombinant cell of any one of the preceding claims, wherein the activation domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs).

52. The recombinant cell of any one of the preceding claims, wherein the one or more ITAMs are derived from CD3ζ, CD3δ, CD3γ, and / or CD3ɛ.

53. The recombinant cell of any one of the preceding claims, wherein the one or more ITAMs have at least 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to a CD3ζ ITAM.

54. The recombinant cell of any one of the preceding claims, wherein the transcriptional regulator comprises a transcriptional activator or a transcriptional repressor.

55. The recombinant cell of any one of the preceding claims, wherein the transcriptional regulator further comprises a nuclear localization sequence (NLS) derived from a protein selected from the group consisting of Gal4, tetR, ZFHD1, and HAP1.

56. The recombinant cell of any one of the preceding claims, wherein the transcriptional regulator comprises a transactivation domain derived from a protein selected from the group consisting of VP64, VP65, KRAB, and VP16.

57. The recombinant cell of any one of the preceding claims, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOS: 88-89.

58. The recombinant cell of any one of the preceding claims, wherein the one or mutations in the CARD11 polypeptide is a point mutation, a gene fusion, a substitution, a gain-of-function mutation, a stop-gain mutation, an insertion mutation, a deletion mutation, a duplication mutation or a translocation.

59. The recombinant cell of any one of the preceding claims, wherein the CARD11 polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 47 and comprising a substitution at an amino acid position selected from the group consisting of 361, 615, 634, 655, and 357 of SEQ ID NO: 47.

60. The recombinant cell of claim 59, wherein the substitution comprises Y361C, S615F, E634K, D357N, S655C, or combinations thereof.

61. The recombinant cell of any one of the preceding claims, wherein the mutation is a fusion between a CARD 11 polypeptide and a phosphoinositide-3 -kinase regulatory subunit 3 (PIK3R3) polypeptide.

62. The recombinant cell of claim 61, wherein the fusion comprises a CARD domain and a coiled coil domain.

63. The recombinant cell of claim 62, wherein the coiled coil domain is a truncated coiled coil domain.

64. The recombinant cell of any one of the preceding claims, wherein the fusion protein further comprises an inhibitory domain.

65. The recombinant cell of any one of the preceding claims, wherein the fusion protein further comprises an Src Homology region 2 (SH2) domain from PIK3R3.

66. The recombinant cell of any one of the preceding claims, wherein the CARD11 polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 48-55 and 57-65.

67. The recombinant cell of any one of the preceding claims, wherein the polypeptide comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 90-91.

68. The recombinant cell of any one of the preceding claims, wherein the promoter is selected from the group consisting of an MND promoter, an EF1a promoter, a sEF1a promoter, a gamma retroviral LTR promoter, a CD4 promoter, a CD8a promoter, a CD8b promoter, a TCRalpha promoter, a TCRbeta promoter, a CD3γ promoter, a CD3δ promoter, a CD3ε promoter, a CD3ζ promoter, a minimal TATA promoter, a pGK, actin promoter, a CD25 promoter, an IL2 promoter, an IL7 promoter, an IL15 promoter, a KLRG-1 promoter, a HLA-DR promoter, a CD38 promoter, a CD69 promoter, a Ki-67 promoter, a CD11a promoter, a CD58 promoter, a CD99 promoter, a CD62L promoter, a CD103 promoter, a CCR4 promoter, a CCR5 promoter, a CCR6 promoter, a CCR9 promoter, a CCR10 promoter, a CXCR3 promoter, a CXCR4 promoter, a CLA promoter, a Granzyme A promoter, a Granzyme B promoter, a Perforin promoter, a CD57 promoter, a CD161 promoter, an IL-18Ra promoter, a CD69 promoter, a GzmB promoter, a T-bet promoter, an IFNgamma promoter, an IL4 promoter, a GATA3 promoter, an IL1 promoter, an IL5 promoter, an IL6 promoter, an IL13 promoter, an IL10 promoter, an IL17A promoter, an IL6 promoter, an IL21 promoter, an IL23R promoter, a FoxP3 promoter, a CTLA4 promoter, a CD25 promoter, a CD45RO promoter, a CCR7 promoter, a CD28 promoter, a CD95 promoter, a CD28 promoter, a CD27 promoter, a CD127 promoter, a CD122 promoter, a CD132 promoter, a c-Kit promoter, a nuclear factor of activated T cells (NFAT) promoter, a programmed death 1 (PD-1) promoter, a T cell immunoglobulin mucin-3 (TIM-3) promoter, a cytotoxic T lymphocyte antigen-4 (CTLA4) promoter, a lymphocyte- activation protein 3 (LAG-3) promoter, a tumor necrosis factor (TNF)-related apoptosis- inducing ligand (TRAIL) promoter, a B- and T-lymphocyte attenuator (BTLA) promoter, a CD25 promoter, a CD69 promoter, a Fas ligand (FasL) promoter, a TIGIT promoter, a TGF- beta promoter, a T-bet promoter, an Eomes promoter, a CD45RA promoter, a 2B4 promoter, aType I interferon (IFN) alpha, a Type I IFN beta promoter, an IFN gamma promoter, an IRF3 promoter, an IRF7 promoter, a NFkB promoter, an AP-1 promoter, a TNF-alpha promoter, a CD130 promoter, a NR4A1 promoter, a NR4A2, a NR4A3 promoter, and any combination thereof.

69. The recombinant cell of any one of the preceding claims, wherein the promoter is selected from the group consisting of a TCRalpha promoter, a TCRbeta promoter, a gamma retroviral LTR promoter, an IL2 promoter, a nuclear factor of activated T cells (NFAT) promoter, an NR4A1 promoter, an MND promoter, an EF1a promoter, and a sEF1a promoter 70. The recombinant cell of any one of the preceding claims, wherein the recombinant cell has reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR).

71. The recombinant cell of any one of claims 1-69, wherein the recombinant cell does not have reduced or eliminated cell surface expression of an endogenous T cell receptor (TCR).

72. The recombinant cell of any one of claims 1-69, wherein cell surface expression level of an endogenous T cell receptor (TCR) of the recombinant cell is at least 50% of, or substantially the same as, that of a control cell without the nucleic acids.

73. The recombinant cell of any one of the preceding claims, wherein binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 200-fold, at least 500-fold, or at least 1000- fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand.

74. The recombinant cell of any one of the preceding claims, wherein binding of the extracellular ligand-binding domain to the selected ligand increases the expression of the CARD11 polypeptide by 1-fold to 2-fold, 2-fold to 3-fold, 3-fold to 5-fold, 5-fold to 10-fold, 10-fold to at least 20-fold, 20-fold to 50-fold, 50-fold to 100-fold, 100-fold to 200-fold, 200-fold to 500-fold, or 500-fold to 1000-fold, compared to the baseline expression of the CARD11 polypeptide in the absence of the selected ligand.

75. The recombinant cell of any one of the preceding claims, wherein baseline expression of the CARD11 polypeptide in the absence of the selected ligand is no more than 10%, no more than 5%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.1%, no more than 0.05%, no more than 0.01%, no more than 0.005%, or no more than 0.001%, compared to the maximal expression level of the CARD11 polypeptide in the present of the selected ligand.

76. The recombinant cell of any one of the preceding claims, wherein the recombinant cell has no leaky expression of the CARD11 polypeptide in the absence of the selected ligand.

77. The recombinant cell of any one of the preceding claims, wherein the likelihood of an individual experiencing an adverse event when administered the recombinant cell is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%, compared to a cell that constitutively expresses the CARD11 polypeptide.

78. The recombinant cell of claim 77, wherein the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder, splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, graft-vs- host disease (GVHD), potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma.

79. The recombinant cell of claim 77 or claim 78, wherein the adverse event is an acute adverse event.

80. The recombinant cell of claim 77 or claim 78, wherein the adverse event GVHD.

81. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is a eukaryotic cell.

82. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is selected from the group of consisting of a T cell, a CD4+ T cell, a CD8+ T cell, a regulatory T cell (Treg), a gamma delta T cell (γδT), an invariant natural killer T (iNKT) cell, a mucosal associated invariant T (MAIT) cell, a macrophage, a monocyte, a natural killer (NK) cell, a tumor infiltrating lymphocyte (TIL), a cytotoxic T cell, a T helper cell, a memory T cell, a central memory T (TCM) cell, a stem memory T (TSCM) cell, a stem-cell-like memory T cell (or stem-like memory T cells), an effector memory T (TEM) cell, a TEMRA (CD45RA+) cell, an effector T cell, a Th1 cell, a Th2 cell, a Th9 cell, a Th17 cell, a Th22 cell, a Tfh (follicular helper) cell, a natural killer T (NKT) cell, a transitional memory T (TTM) cell, a terminal effector T (TTE) cell, a naïve T (TN) cell, a hematopoietic stem cell, and a progenitor cell of the lymphoid lineage.

83. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is selected from the group consisting of a T cell, a macrophage, a monocyte, and a natural killer (NK) cell.

84. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is a T cell.

85. The recombinant cell of any one of claim 84, wherein the T cell is selected from the group consisting of a regulatory T cell (Treg), a gamma delta T cell, a CD8+ T cell, an invariant iNKT cell, a MAIT cell, a CAR T cell, a tumor-infiltrating lymphocyte, and an engineered T cell comprising a transcriptional receptor.

86. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is an autologous cell.

87. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is an allogeneic cell.

88. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is a primary cell.

89. The recombinant cell of any one of the preceding claims, wherein the recombinant cell is derived from a stem cell.

90. The recombinant cell of any one of claims 81-89, wherein the recombinant cell is a mammalian cell.

91. The recombinant cell of claim 90, wherein the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell.

92. The recombinant cell of claim 91, wherein the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or other T cell.

93. The recombinant cell of any one of the preceding claims, wherein activating the recombinant cell results in the secretion of IL-2 by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, least 30-fold, or at least 100-fold higher than the IL-2 secretion level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the CARD11 polypeptide.

94. The recombinant cell of any one of the preceding claims, wherein activating the recombinant cell results in the surface expression of ICOS by the cell at a level that is at least 10%, at least 20%, at least 50%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, or at least 100-fold higher than the ICOS surface expression level of a control cell, optionally wherein the control cell is a wild type cell, an unmodified cell, or a cell lacking the CARD11 polypeptide.

95. The recombinant cell of any one of the preceding claims, wherein the transcriptional regulator comprises (i) a DNA-binding domain and (ii) an effector domain.

96. The recombinant cell of claim 95, wherein the DNA-binding domain is derived from a human hepatocyte nuclear factor 1 homeobox A (HNF1α) protein, a human hepatocyte nuclear factor 1 homeobox B (HNF1β) protein, a human paired box protein (Pax-6) protein, a human paired box protein (Pax-1) protein, a human paired box protein (Pax-2) protein, a human paired box protein (Pax-3) protein, a human paired box protein (Pax-4), or a human paired box protein (Pax-7); preferably, the DNA-binding domain is derived from a human HNF1α protein or a human Pax6 protein.

97. The recombinant cell of claim 96, wherein the DNA-binding domain is derived from a human hepatocyte nuclear factor 1 homeobox A (HNF1α) protein.

98. The recombinant cell of claim 96 or 97, wherein the HNF 1a DNA-binding domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 243, or wherein the Pax6 DNA-binding domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:

244.

99. The recombinant cell of any one of claims 95-98, wherein the effector domain is selected from the group consisting of a transcriptional activation domain, a transcriptional repressor domain, and an epigenetic effector domain.

100. The recombinant cell of claim 99, wherein the transcriptional activation domain is derived from human nuclear factor NFKB p65 subunit (p65); optionally, wherein the p65 effector domain comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOS: 245-246.

101. The recombinant cell of any one of the preceding claims, wherein the response element comprises at least 2, 3, or 4 copies of a DNA sequence that binds to the transcriptional regulator; optionally wherein the DNA sequence comprises GTTAAT.

102. The recombinant cell of any one of the preceding claims, wherein the promoter is a minimal promoter; optionally wherein the minimal promoter is a pybTATA minimal promoter, a cytomegalovirus (CMV) minimal promoter, a herpes simplex virus thymidine kinase (HSV- tk) minimal promoter, a simian virus 40 (SV40) minimal promoter, a human β-actin minimal promoter, a human EF2 minimal promoter, an adenovirus E1B minimal promoter, or a heat shock protein 70 (HSP70) minimal promoter.

103. A pharmaceutical composition comprising a pharmaceutically acceptable carrier, and the recombinant cell according to any one of claims 1-102.

104. A system for modulating an activity of a cell, inhibiting a target cancer cell, or treating a health condition in an individual in need thereof, the system comprising one or more of the following: a) a recombinant cell according to any one of claims 1-102; and b) a pharmaceutical composition according to claim 103.

105. A method for modulating an activity of a cell, the method comprising: a) providing a recombinant cell according to any one of claims 1-102; and b) contacting the recombinant cell with a selected ligand, wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of the one or more ligand-inducible proteolytic cleavage sites and releases the transcriptional regulator, wherein the released transcriptional regulator modulates expression of the CARD 11 polypeptide.

106. The method of claim 105, wherein the contacting is carried out in vivo, ex vivo, or in vitro.

107. The method of claim 105, wherein the activity of the cell to be modulated is selected from the group consisting of: expression of a selected gene, proliferation, apoptosis, non-apoptoticdeath, differentiation, dedifferentiation, migration, secretion of a molecule, cellular adhesion, and cytolytic activity.

108. A method for the treatment of a health condition in an individual in need thereof, the method comprising administering to the individual a first therapy comprising an effective number of the recombinant cell according to any one of claims 1-102, wherein the recombinant cell treats the health condition in the individual.

109. The method of claim 108, further comprising administering to the individual a second therapy.

110. The method of claim 109, wherein the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, and toxin therapy.

111. The method of any one of claims 108-110, wherein the health condition is cancer.

112. The method of any one of claims 108-110, wherein the health condition is an autoimmune disease.

113. The method of any one of claims 108-112, wherein the likelihood of an adverse event is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9%, compared to a method using recombinant cells that constitutively express the CARD11 polypeptide.

114. The method of claim 113, wherein the adverse event is cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome (ICANS), hemophagocytic lymphohistiocytosis (HLH), on-target off-tumor toxicity, tumor lysis syndrome, lymphoproliferative disorder, splenomegaly, lymphadenopathy, an abnormal ratio of engineered cells to other blood cells, acute toxicity, potency enhancement mediated cytotoxicity, graft-vs-host disease (GVHD), potency enhancement mediated GVHD, uncontrolled expansion of engineered cells, or engineered cell mediated lymphoma.

115. The method of claim 113 or 114, wherein the adverse event is an acute adverse event.

Images