Nickase-retron template-based precision editing system and methods of use

Abstract

Disclosed herein relates to a chimeric gene editing system comprising a modified retron editing system for precise and efficient gene editing. Additionally, a chimeric gene editing system that comprises one or more components of a prime editing system (or a prime editor-like system) with one or more components of a retron editing system, is disclosed, providing an entirely new gene editing system with distinct properties, capabilities and advantages.

Description

RNG043-WO1 PCT Application NICKASE-RETRON TEMPLATE-BASED PRECISION EDITING SYSTEM AND METHODS OF USE SEQUENCE LISTING

[0001] This application contains a sequencing listing filed in electronic form in eXentsible Markup Language (XML) format entitled 60676WO_CRF_sequencelisting, created on September 30, 2024, and having a size of 36,013,000 bytes. The content of the sequence listing is incorporate herein in its entirety. This application incorporates by reference the Sequence Listings filed in U.S. Application No.18 / 087,673, International Application No. PCT / US2023 / 061038, filed January 20, 2023, and International Application No. PCT / US2023 / 072872, filed August 24, 2023, including without limitation each of the disclosed retron reverse transcriptases amino acid and nucleotide sequence described therein and each of the disclosed retron ncRNA nucleotide sequences. The contents of said Sequence Listings are incorporated herein in their entireties. TECHNICAL FIELD

[0002] The present disclosure generally relates to systems, methods and pharmaceutical compositions used for precise genome editing, including nucleic acid edits, insertions, replacements, and deletions at targeted and precise genome sites, wherein said systems, methods, and compositions are based on a chimeric editing system comprising one or more components of a prime editor and one or more components of a retron editor. BACKGROUND OF THE INVENTION

[0003] Gene editing tools encompass a diverse set of technologies that can make many types of genetic alterations in various contexts. These technologies have evolved over the last couple of decades to provide a range of user-programmable editing tools that include ZFN (zinc finger) nuclease editing systems, meganuclease editing systems, and TALENS (transcription activator-like effector nucleases). The past decade has seen an explosive growth in a new generation of gene editing systems based on components from bacterial immune pathways, including CRISPR (clustered regularly interspaced short palindromic repeats) and the associated CRISPR-associated proteins (e.g., CRISPR-Cas9), for example, as described in Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science, Vol.337 (6096), pp.816-821, meganuclease editors, for example, as described, Boissel et al., “megaTALs: a rare-cleaving nuclease architecture for therapeutic genome engineering,” Nucleic Acids Research 42: pp.2591-2601, and bacterial retron systems,RNG043-WO1 PCT Application for example, as described, in Schubert et al., “High-throughput functional variant screens via in vivo production of single-stranded DNA,” PNAS, April 27, 2021, Vol.118(18), pp.1-10.

[0004] CRISPR-Cas9 has been derivatized in numerous ways to expand upon its guide RNA- based programmable double-strand cutting activity to form systems ranging from finding alternative CRISPR Cas nuclease enzymes having different PAM requirements and cutting properties (e.g., Cas12a, Cas12f, Cas13a, and Cas13b) forto base editing, for example, as described in Komor et al., “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage,” Nature, May 19, 2016, 533 (7603); pp.420-424 [cytosine base editors or CBEs] and Gaudelli et al., “Programmable base editing of A-T to G-C in genomic DNA without DNA cleavage,” Nature, Vol.551, pp.464-471 [adenine base editors or ABEs]) to prime editing, for example, as described in Anzalone et al., “Search-and-replace genome editing without double-strand breaks or donor DNA,” Nature, Dec 2019, 576 (7789): pp.149-157, to twin prime editing, for example, as described in Anzalone et al., “Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing,” Nature Biotechnology, Dec 9, 2021, vol.40, pp.731-740, to epigenetic editing, for example, as described in Kungulovski and Jeltsch, “Epigenome Editing: State of the Art, Concepts, and Perspective,” Trends in Genetics, Vol.32, 206, pp.101-113, and to CRISPR-directed integrase editing, for example, as described in Yarnell et al., “Drag-and-drop genome insertion of large sequences without double-stranded DNA cleavage using CRISPR- directed integrases,” Nature Biotechnology, Nov 24, 2022, doi.org / 10.1038 / s41587-022- 01527-4.

[0005] Despite vast progress in the gene editing field over the last ten years through the development of a wide variety of gene editing tools based on CRISPR enzymes (e.g., base editors and prime editors) and other editing tools (e.g., retrons), new and improved editing systems that go beyond the capabilities of currently known editing systems are insatiably desired in the art. SUMMARY OF THE INVENTION

[0006] In one aspect, the present disclosure describes a chimeric gene editing system that comprises one or more components of site-specific gene editing system (e.g., a prime editing system or a prime editor-like system) with one or more components of a retron editing system, producing an entirely new gene editing system with distinct properties, capabilities and advantages. Fruther provided include modified retrons and retron-editing systems for improving the gene editing specificity and efficiency.RNG043-WO1 PCT Application

[0007] In certain embodiments, the chimeric gene editing system comprises (a) a nickase component, (b) a guide RNA that complexes with the nickase component and directs it to a target DNA sequence, (c) a polymerase component, (d) and a polymerase template sequence, wherein the polymerase template sequence is provided by a modified retron ncRNA comprising the polymerase template sequence (herein referred to as a “templated ncRNA” or “tncRNA”). In various embodiments, the tncRNA comprises an altered structural configuration relative to a wildtype retron ncRNA wherein the alterations include (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or portion thereof, or (iii) installation of a single-strand RNA sequence comprising the polymerase template in place of the deleted msd sequence. The chimeric gene editing system may also optionally comprise a retron reverse transcriptase (RT) to convert the templated ncRNA to a cognate msDNA, which is referred to herein as the “templated msDNA” or “tmsDNA”.

[0008] In certain other embodiments, the chimeric gene editing system comprises (a) a nickase component or a nucleic acid sequence encoding same (e.g., a mRNA), (b) a guide RNA that complexes with the nickase component and directs it to a target DNA sequence, (c) a polymerase component or a nucleic acid sequence encoding same (e.g., a mRNA), (d) and a polymerase template sequence, wherein the polymerase template sequence is provided by a modified retron ncRNA comprising the polymerase template sequence (herein referred to as a “templated ncRNA” or “tncRNA”). In various embodiments, the tncRNA comprises an altered structural configuration relative to a wildtype retron ncRNA wherein sthe alterations include (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or portion thereof, or (iii) installation of a single-strand RNA sequence comprising the polymerase template in place of the deleted msd sequence. The chimeric gene editing system may also optionally comprise a retron RT (or a nucleic acid sequence encoding a retron RT) to convert the templated ncRNA to a cognate msDNA, which is referred to herein as the “templated msDNA” or “tmsDNA”.

[0009] Referring to the figures, FIG.1 provides a schematic of a prime editor which includes (a) a reverse transcriptase component fused to a (b) CRISPR Cas9 nickase component, and which is complexed with (c) a prime editor guide RNA (pegRNA) (i.e., the PE:pegRNA complex). The pegRNA comprises a (i) primer binding site (PBS) and (ii) a template sequence. The mechanism of prime editing is described in the art. The PE:pegRNA complex binds to a target DNA at a site specified by the spacer sequence of the pegRNA. The Cas9 nickase then nicks one strand, generating a 3’-ended flap of endogenous DNA (“the 3’ flap”).RNG043-WO1 PCT Application The PBS, located on the pegRNA, binds to the 3’ flap and the edited RNA sequence is reverse transcribed from the 3’ flap against the template portion of the pegRNA by the reverse transcriptase of the PE:pegRNA complex. The reverse transcription product effectively extends from the endogenous 3’ flap to form a newly synthesized single strand of DNA (i.e., the RT product or edited strand). The edited strand displaces the endogenous strand sitting immediately downstream of the nick on the nicked strand, forming a 5’ flap of displaced endogenous DNA, which is removed by cell enzymes. The edited DNA is permanently installed onto both strands as a result of endogenous DNA repair enzymes and a round of DNA replication. This process can be enhanced by using an additional normal-length guide RNA that is programmed to install (by again complexing with the PE) a second nick into the unedited strand. This particular DNA lesion is recognized by the cells, compelling the cell to repair the unedited strand to match as the complement of the edited strand. This process leaves both strands in the edited configuration, thereby permanently installing the edit.

[0010] Referring to FIG.2, a retron editing system is depicted. Retrons encode and transcribe as a single RNA, which comprises a non-coding RNA (ncRNA) portion and a portion encoding a specialized reverse transcriptase (RT) (see Panel 1). The retron ncRNA (msr and msd) is the precursor of the hybrid molecule that eventually forms, and it initially folds into a typical RNA secondary structure that is recognized by the accompanying RT. As shown in Panel 2, the translated RT typically recognizes certain secondary structures in the ncRNA, and binds the RNA template downstream from the msd region. The RT initiates reverse transcription of the RNA towards its 5ʹ end, starting from the 2’-end of a conserved guanosine (G) residue found immediately after a double-stranded RNA structure (the a1 / a2 region) within the ncRNA. A portion of the ncRNA serves as a template for reverse transcription, and reverse transcription terminates before reaching the msr locus. During reverse transcription, cellular RNase H degrades the segment of the ncRNA that serves as template, but not other parts of the ncRNA. As shown in Panel 3, the result of the reverse transcription, the msDNA, remains covalently attached to the RNA template via the 2’-5ʹ phosphodiester bond, and base-pairs with the RNA template using the 3ʹ end of the msDNA.

[0011] As described at a high level in FIG.3, the present disclosure describes a chimeric gene editing system comprising one or more components of a prime editor system and one or more components of a retron editor. The resulting chimeric editing system is referred to herein as a “nickase / retron template precision editing system.”RNG043-WO1 PCT Application

[0012] The present disclosure contemplates a variety of configurations and interchangeable components that may constitute different embodiments envisioned for the nickase / retron template precision editing system described herein.

[0013] In various embodiments, the nickase / retron template precision editing system described herein may comprise: (1) a nickase or a nucleic acid sequence encoding a nickase (e.g., a mRNA encoding a nickase); (2) a guide RNA that complexes with the nickase and directs the nickase to a target DNA sequence; (3) a polymerase or a nucleic acid sequence encoding a polymerase (e.g., a mRNA encoding a polymerase); and (4) a polymerase template sequence for synthesis of an edit strand to be incorporated into a target site, wherein the polymerase template sequence is provided by a templated ncRNA.

[0014] In various embodiments, the tncRNA comprises an altered structural configuration relative to a wildtype retron ncRNA wherein the alterations include, but are not limited to, (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or a portion thereof, or / and (iii) installation of a single- strand RNA sequence comprising the polymerase template in place of the deleted msd sequence. The polymerase template may also comprise a primer binding site which anneals to an endogenous 3’ flap produced as a result of introducing a nick at the target site by the nickase. The annealing of the primer binding site to the endogenous 3’ flap creates a polymerization initiation site for synthesis of a new strand of single-stranded DNA (“the edited strand” or “the edited flap”) from the 3’ end of the endogenous flap and using the polymerase template as instructions. The edited strand displaces the endogenous strand sitting immediately downstream of the nick on the nicked strand, forming a 5’ flap of displaced endogenous DNA, which is removed by cell enzymes. The edited flap is permanently installed onto both strands as a result of endogenous DNA repair enzymes and DNA replication. This process can be enhanced by using an additional normal-length guide RNA that is programmed to install (by again complexing with the nickase) a second nick into the unedited strand. This particular DNA lesion is recognized by the cells, compelling the cell to repair the unedited strand to match as the complement of the edited strand. This process leaves both strands in the edited configuration, thereby permanently installing the edit.RNG043-WO1 PCT Application

[0015] The chimeric gene editing system shown in FIG.3 may also optionally comprise a retron RT (or a nucleic acid sequence encoding a retron RT) to convert the templated ncRNA to a cognate msDNA, which is referred to herein as the “templated msDNA” or “tmsDNA”.

[0016] In various embodiments of the nickase / retron template precision editing system described herein, the polymerase template may be provided directly by a templated ncRNA (e.g., as shown in FIG.6). In other embodiments, the polymerase template of the nickase / retron template precision editing system described herein may be provided by a templated ncRNA and a retron RT which converts the ncRNA to a templated msDNA, which then effectivley provides the templating function for the polymerase to synthesize and edited strand for incorporation. This embodiment is depicted in FIG.5.

[0017] In various embodiments, the nickase / retron template precision editing system described herein comprises a templated ncRNA and / or a templated msDNA, as illustrated in FIG.4. Referring to panel A, a non-folded wildtype ncRNA is depicted. The molecule comprises in the 5’ to 3’ direction an a1 region, an msr region, an msd region, and an a2 region. The ncRNA folds as represented by panel B, whereby the a1 / a2 regions comprises regions of reverse complementarity thereby forming a duplex. In addition, the msr region forms 1 or more stem loops, as well as in the msd region. Refer to FIG.2 for a detailed schematic on how the ncRNA is conventionally converted to an msRNA by a retron RT. By contrast, panels C and D are components of the nickase / retron template precision editing system described herein. Panel C illustrates an embodiment of a templated ncRNA. As depicted, the tncRNA comprises an altered structural configuration relative to a wildtype retron ncRNA (e.g., as shown in Panel B) wherein said alterations include, but are not limited to, (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or a portion thereof, and (iii) installation of a single-strand RNA sequence comprising the polymerase template ((i) or (ii)) in place of the deleted msd sequence. The polymerase template may also comprise a primer binding site ((i) or (ii)) which anneals to an endogenous 3’ flap produced as a result of introducing a nick at the target site by the nickase. Panel D depicts a structure of the templated msDNA, which is generated after the the single-stranded RNA sequence comprising the polymerase template is reversed transcribed.

[0018] FIG.5 depicts one embodiment of the nickase / retron template precision editing system described herein. In this embodiment, a templated ncRNA is converted to a templated msDNA by a retron RT. In parallel, a complex comprising a fusion protein comprising a nickase and a polymerase and a guide RNA binds to and cuts an unedited target DNA to introduce a nick in the DNA (“nicked DNA”). Next, the templated msDNA (comprising a polymerase templateRNG043-WO1 PCT Application with a PBS) associates with the nicked DNA by annealing the PBS to the endogenous 3’ flap immediately upstream of the nick on the nicked strand. The annealed PBS provides an initiation point for the polymerase (e.g., an DNA-dependent DNA polymerase) of the fusion protein to synthesize a new strand of DNA from the available 3’ end of the endogenous 3’ flap templated against the polymerase template. This results in an edited 3’ flap which displaces the 5’ endogenous flap formed downstream of the nick site and becomes incorporated into the DNA following cellular DNA repair and replication processes. In some embodiments, a second site nicking guide RNA may be provided to introduce a nick in the non-edited strand downstream of the original nick site. The second nick site induces the cell to replace the unedited strand to form a reverse complement against the 3’ edited flap, thereby introducing the edit into both strands. Replication ensures permanent incorporation of the edit into both strands.

[0019] FIG.6 depicts another embodiment of the nickase / retron template precision editing system described herein. In this embodiment, a templated ncRNA directly provides the polymerase template function (without the need to convert it to msDNA by a retron RT). In parallel, a complex comprising a fusion protein comprising a nickase and a polymerase and a guide RNA binds to and cuts an unedited target DNA to introduce a nick in the DNA (“nicked DNA”). Next, the templated ncRNA (comprising a polymerase template with a PBS) associates with the nicked DNA by annealing the PBS to the endogenous 3’ flap immediately upstream of the nick on the nicked strand. The annealed PBS provides an initiation point for the polymerase (e.g., a RNA-dependent DNA polymerase) of the fusion protein to synthesize a new strand of DNA from the available 3’ end of the endogenous 3’ flap templated against the polymerase template. This results in an edited 3’ flap which displaces the 5’ endogenous flap formed downstream of the nick site and becomes incorporated into the DNA following cellular DNA repair and replication processes. In some embodiments, a second site nicking guide RNA may be provided to introduce a nick in the non-edited strand downstream of the original nick site. The second nick site induces the cell to replace the unedited strand to form a reverse complement against the 3’ edited flap, thereby introducing the edit into both strands. Replication ensures permanent incorporation of the edit into both strands.

[0020] FIG.7A through FIG.7D provides a more detailed look at the mechanism of a nickase / retron template precision editing system described herein, which relies on use of an msDNA (i.e., corresponding to the general configuration of FIG.5). FIG.7A depicts the association of a complex comprising a fusion protein comprising a nickase and a polymerase complexed with a guide RNA. The black triangle represents a single nuclease catalyticRNG043-WO1 PCT Application activity. FIG.7B shows the binding of the guide RNA to a target site by annealing to a specific complementary sequence therein, which then results in the action of the nuclease thereby introducing a singular nick in the top strand (which will become the “edited strand”). In FIG.7C, the region immediately upstream of the nick forms a 3’ flap region, which anneals to an inbound templated msDNA in the PBS of the msDNA. In this embodiment, the PBS is at the 3’ end of the msDNA, and the template region is upstream of the PBS. Also, as this embodiment involves an msDNA, the polymerase template (comprising both the PBS and the template) is a single strand of DNA which is joined to the msDNA by a 2’ to 5’ connection with a guanosine. Given the template is DNA, the polymerase can be a DNA-dependent DNA polymerase. Next, as shown in FIG.7D in panel (1), the polymerase synthesizes a new strand of DNA from the 3’ end of the endogenous flap over and instructed by the template of the msDNA. Once the complex and msDNA dissasemble, the newly synthesized DNA strand displaces the endogenous DNA, forming a 5’ endogenous flap which is removed by host enzymes (panel (2)). Lastly, the edit is incorporated into both strands as shown in panel (3) as a result of celluar repair and replication processes that preferably edit the endogenous strand to match as the reverse complement of the first-edited strand.

[0021] In various embodiments, the nickase / retron template precision editing system described herein includes both a guide RNA (to guide the nickase to the target site) and a retron templated ncRNA. In some embodiments, the guide RNA and the ncRNA may be fused together, as shown for example in FIG.8A (PBS = primer binding site and RTT = reverse transcriptase template). In other embodiments, the guide RNA and the ncRNA can be delivered separately and do not need to be joined, as shown in FIG.8B. In still other embodiments, as illustrated in FIG.8C, the structure of the ncRNA may be further minimized by removing all or a portion of the a1 / a2 stem / loop. In that embodiment, the guide RNA may be fused to the ncRNA or unfused. Other configurations on delivering ncRNAs and guide RNAs are depicted in FIG.8E.

[0022] In various other embodiments, the ncRNA used herein may be comprise one or more stabilizing modifications, including stable nucleotide analogs, structures such as a 3’ hairpin, or circularized. Such embodiments are shown in FIG.8D.

[0023] In another embodiment, shown in FIG.9, the nickase / retron template precision editing system may be configured as a dual editing system to create a pair of complementary edited strands (as shown in panel (2), which are then recombined into the target DNA, as shown in panel (3). In this embodiment, as shown in panel (1), the system involves a first template ncRNA and a first nickase-polymerase-guide RNA complex (dotted gray circle) that nicks aRNG043-WO1 PCT Application first site and creates a first single-stranded DNA edited flap. In this case, since the ncRNA is used directly (i.e., without the msDNA), a retron RT is provided to convert the ncRNA to msDNA. In addition, since the ncRNA is all-RNA, the polymerase is an RNA-dependent DNA polymerase so that it may synthesize the edited DNA strands against an RNA template.

[0024] FIG.10A and FIG.10B depict yet another embodiment which is differs from the system of FIG.9 in that the ncRNAs each have a first and second PBS. As shown in panel (1), a first ncRNA comprising a polymerase template with flanking PBS sites (PBS1 and PBS2). Panel (2) depicts that as a first step the RT (e.g., retron RT) of a first fusion protein (the first fusion protein comprises a nickase (dotted black circle) and RT) synthesizes DNA against the first RTT from the 3’ of the endogenous 3’ flap, extending over the entire RTT and the PBS2 downstream of the RTT. The PBS2 is encoded into the resulting first edited DNA flap a counterpart PBS2’ DNA sequence, which anneals to a second 3’ endogenous flap formed at a second nick site as shown in Panel 3. DNA is again synthesized by a second editing fusion protein (e.g. by a DNA-dependent DNA polymerase, which in theory could be an engineered retron RT or another DNA-dependent DNA polymerase). The second synthesis uses the first synthesis product as a template. Similarly, in panel (4), the double stranded DNA duplex is then incorporated into the DNA thereby installing the edited strands.

[0025] In various embodiments, depicted in FIG.11, each of the components of the nickase / retron template precision editing system may comprises various modifications resulting from optimization, engineering, mutagenesis, substitution of orthologs, and other engineering processes to change, alter, or improve editing functions, stability, and processivity, and / or other characteristics.

[0026] In still other aspects, as depicted in FIG.12, the disclosure provides pharmaceutical compositions, such as lipid nanoparticles (LNPs) comprising an appropriate set of cargo elements that constitute the components of the nickase / retron template precision editing system. Any delivery system may be used to delivery the nickase / retron template precision editing systems as proteins, nucleic acids, or protein-nucleic acid complexes, etc. For example, the nickase / retron template precision editing system may be delivered in an all-RNA configuration comprising one or more mRNAs encoding a nickase, a polymerase, and an optionally a retron RT (i.e., where the polymerase template is an msDNA such that it is converted from a ncRNA), as well as function RNA components such as targeting guide RNAs, second nicking guide RNAs, and ncRNAs.

[0027] In another aspect, the present disclosure further provides nucleic acid molecules encoding the gene editing system components (e.g., a recombinant ncRNA and / or aRNG043-WO1 PCT Application recombinant retron RT). In still another aspect, the present disclosure provides genome editing systems comprising recombinant retron components (e.g., recombinant ncRNA and / or recombinant RT), programmable nickases, and guide RNAs. In a further aspect, the disclosure provides nucleic acid molecules encoding the described genome editing systems and said components thereof, as well as polypeptides making up the components of said genome editing systems. In yet another aspect, the disclosure provides vectors for transferring and / or expressing said genome editing systems, e.g., under in vitro, ex vivo, and in vivo conditions. In still another aspect, the disclosure provides cell-delivery compositions and methods, including compositions for passive and / or active transport to cells (e.g., plasmids), delivery by virus- based recombinant vectors (e.g., AAV and / or lentivirus vectors), delivery by non-virus-based systems (e.g., liposomes and LNPs), and delivery by virus-like particles. Depending on the delivery system employed, the genome editing systems described herein may be delivered in the form of DNA (e.g., plasmids or DNA-based virus vectors), RNA (e.g., ncRNA and mRNA delivered by LNPs), a mixture of DNA and RNA, protein (e.g., virus-like particles), and ribonucleoprotein (RNP) complexes. Any suitable combinations of approaches for delivering the components of the herein disclosed retron-based genome editing systems may be employed. In one embodiment, each of the components of the retron-based genome editing system is delivered by an all-RNA system, e.g., the delivery of one or more RNA molecules (e.g., mRNA and / or ncRNA) by one or more LNPs, wherein the one or more RNA molecules form the ncRNA and guide RNA (as needed) and / or are translated into the polypeptide components (e.g., the RT and a programmable nuclease). In yet another aspect, the disclosure provides methods for genome editing by introducing a retron-based genome editing system described herein into a cell (e.g., under in vitro, in vivo, or ex vivo conditions) comprising a target edit site, thereby resulting in an edit at the target edit. In other aspects, the disclosure provides formulations comprising any of the aforementioned components for delivery to cells and / or tissues, including in vitro, in vivo, and ex vivo delivery, recombinant cells and / or tissues modified by the recombinant retron-based genome modification systems and methods described herein, and methods of modifying cells by conducting genome editing and related DNA donor-dependent methods, such as recombineering, or cell recording, using the herein disclosed retron-based genome modification systems. The disclosure also provides methods of making the recombinant retrons, retron-based genome modification systems, vectors, compositions, and formulations described herein, as well as to pharmaceutical compositions and kits for modifying cells under in vitro, in vivo, and ex vivo conditions that comprise the herein disclosed genome editing and / or modification systems.RNG043-WO1 PCT Application

[0028] In an embodiment, this disclosure or the inventions herein provide a gene editing system comprising one or more delivery vehicles, wherein: the delivery vehicle(s) comprise RNA cargo; the RNA cargo comprises (a) at least one mRNA molecule encoding (i) a nucleic acid programmable nuclease (e.g., a nickase) and (ii) a polymerase (e.g., a DNA-dependent DNA polymerase, an RNA-dependent DNA polymerase, e.g., a retron reverse transcriptase), (b) an engineered templated retron ncRNA, and (c) guide RNA for the programmable nuclease; and each delivery vehicle contains (a)(i) and / or (a)(ii) and / or (b) and / or (c); whereby one delivery vehicle or more than one delivery vehicle delivers (a)(i), (a)(ii), (b), and (c).

[0029] In an embodiment, in the gene editing system, (a)(i) and (a)(ii) comprise a single mRNA molecule encoding the nucleic acid programmable nuclease and the polymerase (e.g, retron reverse transcriptase).

[0030] In an embodiment, in the gene editing system, (a)(i) and (a)(ii) are encoded and expressed as a fusion protein.

[0031] In an embodiment, in the gene editing system (a)(i) and (a)(ii) are encoded and expressed as a fusion protein and the fusion protein comprises the C-terminal end of the nucleic acid programmable nuclease fused to the N-terminal end of the polymerase (e.g. retron reverse transcriptase (nuclease:polymerase)); or the fusion protein comprises the N-terminal end of the nucleic acid programmable nuclease fused to the C-terminal end of the retron reverse transcriptase (polymerase:nuclease fusion).

[0032] In an embodiment, in the gene editing system, (a)(i) and (a)(ii) comprise a first mRNA molecule encoding the nucleic acid programmable nuclease and a second mRNA molecule encoding the polymerase (e.g., retron reverse transcriptase).

[0033] In an embodiment, in the gene editing system, (c) is separate from (a)(i), (a)(ii) and (b) or is provided in trans.

[0034] In an embodiment, in the gene editing system, (b) the engineered retron ncRNA, and (c) the guide RNA are fused or are provided in cis.

[0035] In an embodiment, in the gene editing system, (b) the engineered retron ncRNA, and (c) the guide RNA are fused or are provided in cis and the guide RNA is fused to the 5’ end of the retron ncRNA.

[0036] In an embodiment, in the gene editing system, (b) the engineered retron ncRNA, and (c) the guide RNA are fused or are provided in cis and the guide RNA is fused to the 3’ end of the retron ncRNA.

[0037] In an embodiment, in the gene editing system, (b) the engineered retron ncRNA, and (c) the guide RNA are fused or are provided in cis and the engineered ncRNA comprises a firstRNG043-WO1 PCT Application guide RNA fused to the 5’ end of the retron ncRNA, and a second guide RNA fused to the 3’ end of the retron ncRNA, and the first and second guide RNAs target different sequences. Thus, on a broader scale, in an embodiment, in the gene editing system, (c) guide RNA for the programmable nuclease, can comprise one or more guides that target the same or different target sequences. Such guide RNA(s) in an embodiment, can be single guide RNA(s) or sgRNA(s); for instance, when the nucleic acid programmable nuclease comprises a Cas9.

[0038] In an embodiment, in the gene editing system, the one or more delivery vehicles comprise a liposome or a lipid nanoparticle (LNP).

[0039] In an embodiment, in the gene editing system, (a) the at least one mRNA molecule encoding (i) the nucleic acid programmable nuclease and (ii) the polymerase (e.g., retron reverse transcriptase), and (b) the engineered retron ncRNA, are in the same delivery vehicle.

[0040] In an embodiment, in the gene editing system, (a) the at least one mRNA molecule encoding (i) the nucleic acid programmable nuclease and (ii) the polymerase (e.g., retron reverse transcriptase), and (b) the engineered retron ncRNA, are in separate delivery vehicles.

[0041] In an embodiment, in the gene editing system, the nucleic acid programmable nuclease and the polymerase (e.g., retron reverse transcriptase) are encoded on separate mRNA molecules and those separate mRNA molecules of (a)(i) and (a)(ii) are contained in the same delivery vehicle.

[0042] In an embodiment, in the gene editing system, the nucleic acid programmable nuclease and the polymerase (e.g., retron reverse transcriptase) are encoded on separate mRNA molecules and those separate mRNA molecules of (a)(i) and (a)(ii) are contained in different delivery vehicles.

[0043] In an embodiment, in the gene editing system, the engineered retron ncRNA includes a polymerase template comprising a PBS and a template sequence comprising an intended edit to be integrated at a target sequence in a cell, and wherein the polymerase template comprises one or more regions of homology to the endogenous sequence downstream of a nick site to facilitate integration of the edited strand. The editing systems can be used in an animal cell, or a mammalian cell (e.g., a primate, a non-human primate, or a domesticated mammal such as a cat or dog or horse) or a human cell; for instance to correct, address, treat, mitigate a genetic condition in the animal, mammal, domesticated mammal, cat, dog, horse or human. Such can be done in plant cells to introduce mutations that give rise to favorable phenotypic characteristics such as disease resistance or other favorable plant trait(s).RNG043-WO1 PCT Application

[0044] In an embodiment, in the gene editing system, the nucleic acid programmable nuclease comprises a Cas9 nuclease, a TnpB nuclease, or a Cas12a nuclease. Preferably, the nuclease is a nickase such that only one of the two strands in the target region is cut.

[0045] In various embodiments, the templated ncRNA may be derived from a baseline or wildtype ncRNA, such as any of those ncRNAs disclosed in Table B or a nucleotide sequence of Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 (each are incorporated herein by reference in their entireties, including their Sequence Listings), or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with a sequence from Table B of any of the aforementioned applications. The polymerase template can be heterologous to a cell. Alternatively, the polymerase template can be endogenous to the cell. For instance, the cell can contain a sequence that is typical for those in a population having a disease state and the donor polynucleotide can be a sequence that is typical for those in the population not having a non-disease state (e.g., the donor can be for a genetic correction or repair of a cell to modify the cell from having a mutation or modification that gives rise to a disease state to having a sequence typical of not having the disease state).

[0046] In an embodiment of the gene editing system, the gene editing system can comprise any combination(s) of the foregoing embodiments of the gene editing system.

[0047] In an embodiment, this disclosure or the inventions herein provide a cell, such as an isolated cell comprising the gene editing system disclosed herein, such as in any of the foregoing paragraphs. In an embodiment, the cell, e.g., isolated cell, can be a eukaryotic cell. In an embodiment, the eukaryotic cell can be a plant cell or an animal cell or a mammalian cell, e.g., an isolated plant cell or an isolated animal cell or an isolated mammalian cell. In an embodiment, the mammalian cell, e.g., an isolated mammalian cell, can be a human cell. In an embodiment, the cell can be a prokaryotic cell, e.g., a bacterial cell. In such an embodiment where the cell is a bacterial cell, the donor polynucleotide can code for antibiotic susceptibility; and thus, the present disclosure and any inventions disclosed herein can involve a means for addressing antibiotic resistant bacteria by rendering such bacteria susceptible to antibiotics (and a subject to whom the gene editing system is administered can also then receive antibiotics to which the bacteria are rendered susceptible by the gene editing system).

[0048] In an embodiment, this disclosure or the inventions herein provide a composition comprising: a) the gene editing system disclosed herein, such as in any of the foregoing paragraphs; and b)a pharmaceutically or veterinarily acceptable carrier. In an embodiment, in the composition the delivery vehicle can comprise a lipid nanoparticle comprising: a) one orRNG043-WO1 PCT Application more ionizable lipids; b) one or more structural lipids; c) one or more PEGylated lipids; and d) one or more phospholipids. In an embodiment, in the composition the one or more ionizable lipids comprises an ionizable lipid set forth in Table 2 of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038.

[0049] In an embodiment, this disclosure or the inventions herein provide uses of the gene editing system embodiments and / or the compositions disclosed herein, such as in any of the foregoing paragraphs; for instance, use in modifying a cell or genetically modifying a cell, e.g., a eukaryotic or a prokaryotic cell and / or an animal cell and / or a mammalian and / or a human cell and / or a bacterial cell and / or a plant cell, in vivo, in vitro or ex vivo (e.g., any cell discussed herein wherein the cell comprises an isolated cell). In an embodiment, this disclosure or the inventions herein provide uses of the gene editing system embodiments and / or the compositions disclosed herein, such as in any of the foregoing paragraphs; for instance, use in treating or addressing a genetic condition of a subject,

[0050] In an embodiment, this disclosure or the inventions herein provide methods of genetically modifying a cell comprising: contacting a gene editing system as herein discussed, such as in any of the foregoing paragraphs, or a composition as herein discussed, such as in any of the foregoing paragraphs (which comprises a gene editing system as herein discussed, such as in any of the foregoing paragraphs), advantageously a gene editing system that includes a sequence of interest encoding a donor polynucleotide comprising an intended edit to be integrated at a target sequence in a cell, said method comprising contacting the composition or the gene editing system with the cell, thereby delivering the RNA cargo to the cell, wherein: the nucleic acid programmable nuclease forms a complex with the guide RNA, wherein said guide RNA directs the complex to the target sequence; the nucleic acid programmable nuclease creates a double-stranded break in in the target sequence; the retron reverse transcriptase and engineered retron ncRNA create msDNA that comprises the donor polynucleotide; and the donor polynucleotide becomes integrated at the target sequence; whereby editing the cell is genetically modified. In an embodiment, the cell can be a eukaryotic or a prokaryotic cell or an animal cell or a mammalian cell or a human cell or a bacterial cell or a plant cell.

[0051] In another aspect, the present disclosure provides a non-coding RNA (ncRNA) variant comprising a reference retron ncRNA with one or more modifications, wherein the reference retron ncRNA comprises from 5’ to 3’ direction: a1 region, first branching guanosine, msr, msd, and a2 region, and the one or more modifications comprises (i) linkage of the a1 region and the a2 region, (ii) deletion of at least a portion of the msr; (iii) deletion of at least a portionRNG043-WO1 PCT Application of the msd, (iv) addition of a single-stranded RNA comprising a polymerase template, or (v) addition of an RNA motif.

[0052] In an embodiment, the one or more modifications comprise the linkage of the a1 region to the a2 region.

[0053] In an embodiment of any one of the preceding embodiments, the one or more modifications comprise the linkage of the a1 region and the a2 region, wherein the linkage of the a1 region and the a2 region is formed via a linker joining the 5’ end of the a1 region to the 3’ end of the a2 region. In an embodiment of any one of the preceding embodiments, the one or more modifications comprise the linkage of the a1 region and the a2 region, wherein the linkage of the a1 region and the a2 region is formed by directly joining the 5’ end of the a1 region to the 3’ end of the a2 region without a linker.

[0054] In an embodiment of any one of the preceding embodiments, the a1 region and the a2 region are partially or completely complementary to each other and the a1 region and the a2 region form a stem-loop structure after the linkage.

[0055] In an embodiment of any one of the preceding embodiments, the ncRNA variant further comprises a second branching guanosine.

[0056] In an embodiment of any one of the preceding embodiments, formation of the linkage of the a1 region and the a2 region circularizes the ncRNA variant.

[0057] In an embodiment of any one of the preceding embodiments, the one or more modifications further comprises a breakage between the msd and the a2 region, thereby generating the ncRNA variant comprising from 5’ to 3’ direction: the a2 region, the linkage between the a1 and the a2 region, the a1 region, the first branching guanosine, the msr, and the msd.

[0058] In an embodiment of any one of the preceding embodiments, the one or more modifications comprises the deletion of at least a portion of the msr. In an embodiment, the portion deleted from the msr comprises a spacer between two stem-loops in the msr or a portion of the spacer. In an embodiment, the portion deleted from the msr comprises a portion of the spacer, whereby the deletion preserves a remaining 1-15 base pairs between the two stem-loops in the msr, as compared to the reference retron ncRNA. In an embodiment, the deletion preserves a remaining 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 6 base pairs, 7 base pairs, 8 base pairs, 9 base pairs, 10 base pairs, 11 base pairs, 12 base pairs, 13 base pairs, 14 base pairs, or 15 base pairs between the two stem-loops in the msr, as compared to the reference retron ncRNA. In an embodiment, the portion deleted from the msr comprises the entirety of the spacer between two stem-loops in the msr, as compared to theRNG043-WO1 PCT Application reference retron ncRNA. In an embodiment, the portion deleted from the msr comprises a stem-loop in the msr or a portion thereof.

[0059] In an embodiment of any one of the preceding embodiments, the one or more modifications comprises the deletion of at least a portion of the msd. In an embodiment, the deleted portion of the msd comprises a spacer located between a stem-loop in the msd and the a2 region or a portion of the spacer. In an embodiment, the deleted portion in the msd comprises a portion of the spacer located between the stem-loop in the msd and the a2 region, whereby the deletion preserves a remaining 1-15 base pairs between the stem-loop in the msd and the a2 region, as compared to the reference retron ncRNA. In an embodiment, the deletion preserves a remaining 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 6 base pairs, 7 base pairs, 8 base pairs, 9 base pairs, 10 base pairs, 11 base pairs, 12 base pairs, 13 base pairs, 14 base pairs, or 15 base pairs between the stem-loop in the msd and the a2 region, as compared to the reference retron ncRNA. In an embodiment, the deleted portion in the msd comprises the entire spacer between the stem-loop in the msd and the a2 region. In an embodiment, the deleted portion in the msd further comprises the stem-loop in the msd, thereby the deletion comprises deletion of the entire spacer between the stem-loop in the msd and the a2 region and the stem-loop in the msd.

[0060] In an embodiment of any one of the preceding embodiments, the one or more modifications comprises the addition of the single-stranded RNA comprising the polymerase template. In an embodiment, the one or more modifications comprise the addition of the single-stranded RNA comprising the polymerase template and the deletion of at least a portion of msd, and the single-stranded RNA comprising the polymerase template is added to the deleted portion of the msd. In an embodiment, the single-stranded RNA comprising the polymerase template comprises a pair of homology arms specific to a target locus. In an embodiment, each of the homology arms comprises 5-200 nucleotides. In an embodiment, each of the homology arms comprises between 5 and 100 nucleotides, between 5 and 50 nucleotides, between 10 and 50 nucleotides, between 25 and 50 nucleotides, between 5 and 25 nucleotides, between 10 and 25 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 30 and 40 nucleotides, or between 40 to 50 nucleotides. In an embodiment, the single-stranded RNA comprising the polymerase template further comprises a donor sequence for integration into a target locus. In an embodiment, the donor sequence comprises 2-100 nucleotides, 2-50 nucleotides, 2-25 nucleotides, 5-25 nucleotides, 5-15 nucleotides, 5-10 nucleotides, 10-30 nucleotides, 10-20 nucleotides or 1-10 nucleotides.RNG043-WO1 PCT Application

[0061] In an embodiment of any one of the preceding embodiments, the one or more modifications comprises the addition of the RNA motif. In an embodiment, the RNA motif is a MS2 stem-loop or a 3’ tail of U7 small nuclear RNA (snRNA).

[0062] In an embodiment of any one of the preceding embodiments, the one or more modifications comprise: (a) a combination of (i) and (ii): the linkage of the a1 region and the a2 region and the deletion of at least a portion of the msr, (b) a combination of (i) and (iii): the linkage of the a1 region and the a2 region and the deletion of at least a portion of the msd, (c) a combination of (i) and (iv): the linkage of the a1 region and the a2 region and the addition of the single-stranded RNA comprising the polymerase template, (d) a combination of (i) and (v): the linkage of the a1 region and the a2 region and the addition of the RNA motif, (e) a combination of (ii) and (iii): the deletion of at least a portion of the msr and the deletion of at least a portion of the msd, (f) a combination of (ii) and (iv): the deletion of at least a portion of the msr and the addition of the single-stranded RNA comprising the polymerase template, (g) a combination of (ii) and (v): the deletion of at least a portion of the msr and the addition of the RNA motif at the 5’ end or 3’ end, or (h) a combination of (iv) and (v): the addition of the single-stranded RNA sequence comprising the polymerase template and the addition of the RNA motif at the 5’ end or 3’ end.

[0063] In an embodiment of any one of the preceding embodiments, the one or more modifications comprise: (a) a combination of (i), (ii), and (iii): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msr, and the deletion of at least a portion of the msd, (b) a combination of (i), (ii), and (iv): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msr, and the addition of the single-stranded RNA comprising the polymerase template, (c) a combination of (i), (iii), and (iv): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msd, and the addition of the single-stranded RNA sequence comprising the polymerase template, or (d) a combination of (ii), (iii), and (iv): the deletion of at least a portion of the msr, the deletion of at least a portion of the msd, and the addition of the RNA motif at the 5’ end or 3’ end.

[0064] In an embodiment of any one of the preceding embodiments, the one or more modifications comprise: (i) the linkage of the a1 region and the a2 region, (ii) the deletion of at least a portion of the msr, (iii) the deletion of at least a portion of the msd, (iv) the addition of the single-stranded RNA sequence comprising the polymerase template, and (v) the addition of the RNA motif at the 5’ end or 3’ end region.

[0065] In an embodiment of any one of the preceding embodiments, the one or more modifications further comprises substitution, insertion, or deletion of one or more nucleotides,RNG043-WO1 PCT Application or a combination thereof. In an embodiment, the substitution, insertion, or deletion is capable of modulating activity of a first polymerase or a second polymerase, production of a single stranded DNA from the ncRNA variant, or immunogenicity of the ncRNA variant.

[0066] In an embodiment of any one of the preceding embodiments, the reference retron ncRNA comprises a sequence of a naturally occurring retron or a portion thereof.

[0067] In an embodiment of any one of the preceding embodiments, the reference retron ncRNA comprises a sequence selected from SEQ ID NO: 3980-4178, 11231-11429, 4671- 4825, 11922-12075, 4980-5143, 12229-12392, 367-368, 427-441, 494-521, 526-527, 536, 626, 649, 660-668, 675, 679, 687-692, 695, 697, 703, 716, 721-722, 751-763, 767, 770-1411, 1456- 1462, 7624-7625, 7684-7698, 7751-7778, 7783-7784, 7793, 7883, 7906, 7917-7925, 7932, 7936, 7944-7949, 7952, 7954, 7960, 7973, 7978-7979, 8008-8020, 8024, 8027-8667, 8712- 8718, 1529-1569, 8784-8823, 6697-6701, 13943-13947, 4179-4670, 11430-11921, 4884-4909, 12134-12159, 6919-6972, 14163-14215, 2786-2866, 2887-2938, 10039-10119, 10140-10191, 4826-4863, 12076-12113, 4864-4875, 12114-12125, 6974-7002, 14217-14244, 2598-2600, 2759-2785, 9851-9853, 10012-10038, 2445-2582, 9699-9836, 1983-2158, 9237-9412, 1612- 1982, 8866-9236, 2601-2678, 9854-9931, 2679-2758, 9932-10011, 3442-3603, 10694-10855, 3604-3708, 10856-10959, 2939-3441, 3709-3979, 5177-5192, 10192-10693, 10960-111230, 12426-12441, 7003-7033, 14245-14275, 7054-7133, 14296-14374, 7034-7049, 14276-14291, 6835-6918, 14079-14162, 6823-6834, 14068-14078, 298-366, 369-373, 442-493, 522-525, 528-535, 537, 551-554, 557, 560-625, 672-674, 680-681, 684-686, 696, 698, 702, 723-742, 764-766, 1412-1453, 1463-1466, 1571-1577, 7555-7623, 2626-7630, 7699-7750, 7785-7792, 7794, 7808-7811, 7814, 7817-7882, 7929-7931, 7937-7938, 7941-7943, 7953, 7955, 7959, 7980-7999, 8021-8023, 8668-8706, 8708-8709, 8719-8722, 8825-8831, 374-426, 539-550, 555-556, 558-559, 671, 682-683, 743, 745-750, 7631-7683, 7796-7807, 7812-7813, 7815- 7816, 7928, 7939-7940, 800, 8002-8007, 5942-6665, 13189-13911, 1-297, 715, 1580-1603, 7258-7554, 7972, 8834-8857, 705-714, 7962-7971, 6681-6694, 13927-13940, 6788-6803, 14033-14048, 1469-1526, 5147-5151, 8725-8781, 12396-12400, 2159-2428, 9413-9682, 646- 648, 7903-7905, 2592-2595, 9846-9849, 676-678, 717-720, 7933-7935, 7974-7977, 538, 669, 704, 7795, 7926, 7961, 8710, 670, 699-701, 7927, 7956-7958, 4917-4979, 12167-12228, 4910- 4916, 12160-12166, 5195-5941, 12444-13188, 627-645, 650-659, 693-694, 744, 768-769, 1451, 1455, 1467-1468, 1527-1528, 1570, 1578, 1579, 1604-1611, 2429-2444, 2583-2591, 2596-2597, 2867-2886, 4876-4883, 5144-5146, 5152-5176, 5193-5194, 6666-6680, 6695- 6696, 6702-6787, 6804-6822, 6973, 7050-7053, 7134-7257, 7884-7902, 7907-7916, 7950- 7951, 8001, 8025-8026, 8707, 8711, 8723-8724, 8782-8783, 8824, 8832-8833, 8858-8865,RNG043-WO1 PCT Application 9683-9698, 9837-9845, 9850, 10120-10139, 12126-12133, 12393-12395, 12401-12425, 12442-12443, 13912-13926, 13941-13942, 13948-14032, 14049-14067, 14216, 14292-14295, 14375-14498, 16886-17078, 17478-17622, 17677-17756, 14831-14833, 14838, 14847, 14850- 15460, 17079-17477, 17660-17676, 19031-19080, 16414-16516, 17623-17659, 19081-19108, 16397-16413, 16195-16320, 15779-15925, 15476-15778, 16321-16366, 16367-16396, 16705- 16814, 16815-16885, 16517-16704, 18949-19030, 14657-14716, 14778-14824, 14834, 14835- 14836, 14839, 15461-15475, 14717-14777, 14841-14846, 18413-18936, 14499-14656, 18939, 15926-16178, 14837, 17757-18412, 14825-14830, 14840, 14848-14849, 16179-16194, 18937- 18938, and 18940-18948 (Table A or Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 or Table 31A of PCT Publication WO2024044723A1; SEQ ID NOs: 19543-19733 of the PCT).

[0068] In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to any one of Table A or Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 or Table 31A of PCT Publication WO2024044723A1 (SEQ ID NOs: 19543-19733 of the PCT).

[0069] In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises a sequence selected from RTX3_6342_msr_stem_var1 (SEQ ID NO: 19644), RTX3_6342_msr_stem_var20 (SEQ ID NO: 19663), RTX3_6342_msr_stem_var5 (SEQ ID NO: 19648), RTX3_6342_a1a2_var6 (SEQ ID NO: 19548), RTX3_6342_a1a2_var10 (SEQ ID NO: 19552), RTX3_6342_a1a2_var15 (SEQ ID NO: 19557), RTX3_6342_a1a2_var16 (SEQ ID NO: 19558), RTX3_6342_a1a2_var19 (SEQ ID NO: 19561), RTX3_6342_a1a2_var20 (SEQ ID NO: 19562), RTX3_6342_a1a2_var21 (SEQ ID NO: 19563), RTX3_6342_a1a2_var26 (SEQ ID NO: 19568), RTX3_6342_a1a2_var27 (SEQ ID NO: 19569), and RTX3_6342_a1a2_var32 (SEQ ID NO: 19574). In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises one or more modifications in RTX3_6342_msr_stem_var1 (SEQ ID NO: 19644), RTX3_6342_msr_stem_var20 (SEQ ID NO: 19663), RTX3_6342_msr_stem_var5 (SEQ ID NO: 19648), RTX3_6342_a1a2_var6 (SEQ ID NO: 19548), RTX3_6342_a1a2_var10 (SEQ ID NO: 19552),RNG043-WO1 PCT Application RTX3_6342_a1a2_var15 (SEQ ID NO: 19557), RTX3_6342_a1a2_var16 (SEQ ID NO: 19558), RTX3_6342_a1a2_var19 (SEQ ID NO: 19561), RTX3_6342_a1a2_var20 (SEQ ID NO: 19562), RTX3_6342_a1a2_var21 (SEQ ID NO: 19563), RTX3_6342_a1a2_var26 (SEQ ID NO: 19568), RTX3_6342_a1a2_var27 (SEQ ID NO: 19569), or RTX3_6342_a1a2_var32 (SEQ ID NO: 19574) compared to RTX3_6342_WT (SEQ ID NO: 19734).

[0070] In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises a sequence selected from msR Spacer Del-1 (SEQ ID NO: 19939), msD Spacer Del- 1 (SEQ ID NO: 19940), msD Spacer Del-2 (SEQ ID NO: 19941), and msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19942). In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises one or more modifications in msR Spacer Del-1 (SEQ ID NO: 19939), msD Spacer Del-1 (SEQ ID NO: 19940), msD Spacer Del-2 (SEQ ID NO: 19941), or msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19942) compared to WT R6342 ncRNA (SEQ ID NO: 19734).

[0071] In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises a sequence selected from Alt1 msR Spacer Del- (SEQ ID NO: 19947)1, Alt1 msD Spacer Del-1 (SEQ ID NO: 19948), Alt1 msD Spacer Del-2 (SEQ ID NO: 19949), Alt1 msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19950), Alt1 msR Spacer Del-2 / msD Del-3 (SEQ ID NO: 19951), Alt1 msR Spacer Del-2 / msD Del-3 MS2 (SEQ ID NO: 19952), and Alt1 msR Spacer Del-2 / msD Del-3 U7 (SEQ ID NO: 19953). In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises one or more modifications in Alt1 msR Spacer Del- (SEQ ID NO: 19947)1, Alt1 msD Spacer Del-1 (SEQ ID NO: 19948), Alt1 msD Spacer Del-2 (SEQ ID NO: 19949), Alt1 msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19950), Alt1 msR Spacer Del-2 / msD Del-3 (SEQ ID NO: 19951), Alt1 msR Spacer Del- 2 / msD Del-3 MS2 (SEQ ID NO: 19952), or Alt1 msR Spacer Del-2 / msD Del-3 U7 (SEQ ID NO: 19953) compared to WT R6342 ncRNA (SEQ ID NO: 19734).

[0072] In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises a sequence selected from msR spacer del_30HA (SEQ ID NO: 19955), msR spacer del_45HA (SEQ ID NO: 19956), WT PAM mt, (SEQ ID NO: 19957) Alt del1+del2 PAM mt (SEQ ID NO: 19958), or Alt del1+del2+U7 PAM mt (SEQ ID NO: 19959), and Alt del1+del2 25bp ins (SEQ ID NO: 19960). In an embodiment of any one of the preceding embodiments, the ncRNA variant comprises one or more modifications in msR spacer del_30HA (SEQ ID NO: 19955), msR spacer del_45HA (SEQ ID NO: 19956), WT PAM mt, (SEQ ID NO: 19957) Alt del1+del2 PAM mt (SEQ ID NO: 19958), or Alt del1+del2+U7 PAM mt (SEQ ID NO:RNG043-WO1 PCT Application 19959), or Alt del1+del225bp ins (SEQ ID NO: 19960)compared to WT R6342 ncRNA (SEQ ID NO: 19734).

[0073] In an embodiment of any one of the preceding embodiments, the one or more modifications further comprises addition of 2’O methyl or phosphorothioate bond at the 5’ or 3’ end of the ncRNA variant. In an embodiment, the one or more modifications further comprises the addition of the 2’O methyl or the phosphorothioate bond at both the 5’ and 3’ ends of the ncRNA variant.

[0074] In another aspect, the present disclosure provides a retron variant comprising the ncRNA variant of any one of the preceding embodiments and an RNA encoding a first polymerase, optionally downstream of the msd of the ncRNA variant.

[0075] In an embodiment, the first polymerase is a reverse transcriptase, optionally wherein the reverse transcriptase is originated from a naturally occurring retron or retron-like sequence.

[0076] In an embodiment of any one of the preceding embodiments, the first polymerase is a reverse transcriptase selected from: EcoI-RT, Efe1-RT, Mva1-RT, Cex1-RT, Eco8-RT, Vap1- RT, and Vro1-RT. In an embodiment, the reverse transcriptase is originated from a same naturally occurring retron as the reference retron ncRNA.

[0077] In another aspect, the present disclosure provides a chimeric gene editing composition comprising: (a) the ncRNA variant of any one of the preceding embodiments, or the retron variant of any one of the preceding embodiments, (b) a nuclease or a first mRNA encoding the nuclease, (c) a guide RNA (gRNA) associated with the nuclease, and (d) optionally, a second polymerase or a second mRNA encoding the second polymerase.

[0078] In an embodiment, the chimeric gene editing composition comprises the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a reverse transcriptase. In an embodiment, the chimeric gene editing composition comprises the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a DNA polymerase.

[0079] In an embodiment of any one of the preceding embodiments, the nuclease is a nickase. In an embodiment, the nickase comprises a Cas9 nuclease, a Cas9(D10A) nuclease, a TnpB nuclease, or a Cas12a nuclease.

[0080] In an embodiment of any one of the preceding embodiments, the ncRNA variant or the retron variant is linked to the gRNA directly or indirectly. In an embodiment, the ncRNA variant or the retron variant, the gRNA, and the first mRNA encoding the nuclease are linked directly or indirectly.RNG043-WO1 PCT Application

[0081] In an embodiment of any one of the preceding embodiments, the chimeric gene editing composition further comprises delivery vehicles. In an embodiment, the delivery vehicles encapsulate one or more components selected from: (a) the ncRNA variant or the retron variant, (b) the nuclease or the first mRNA encoding the nuclease, (c) the gRNA associated with the nuclease, and (d) optionally, the second polymerase or the second mRNA encoding the second polymerase. In an embodiment, the delivery vehicle is a lipid nanoparticle.

[0082] In another aspect, the present disclosure provides one or more polynucleotides comprising a coding sequence of the ncRNA variant of any one of the preceding embodiments or the retron variant of any one of the preceding embodiments.

[0083] In an embodiment, the one or more polynucleotides further comprise a coding sequence of a nuclease or a coding sequence of a gRNA.

[0084] In an embodiment, the one or more polynucleotides further comprise a coding sequence of a nuclease and a coding sequence of a gRNA.

[0085] In an embodiment of any one of the preceding embodiments, the one or more polynucleotides further comprise a coding sequence of the first polymerase.

[0086] In an embodiment of any one of the preceding embodiments, the one or more polynucleotides further comprise a coding sequence of a second polymerase.

[0087] In an embodiment of any one of the preceding embodiments, the one or more polynucleotides further comprise one or more promoters, wherein each of the one or more promoters is operably linked to (i) the coding sequence of the ncRNA variant or the retron variant, (ii) a coding sequence of a nuclease, (iii) a coding sequence of a gRNA, (iv) a coding sequence of the first polymerase, or (v) a coding sequence of a second polymerase.

[0088] In another aspect, the present disclosure provides a vector comprising the one or more polynucleotides of any one of the preceding embodiments.

[0089] In an embodiment, the vector is a plasmid or a viral vector, optionally wherein the viral vector is an AAV or lentiviral vector.

[0090] In another aspect, the present disclosure provides a method of editing a target DNA, the method comprising interacting the target DNA with the chimeric gene editing composition of any one of the preceding embodiments, the one or more polynucleotides of any one of the preceding embodiments, or the vector of any one of the preceding embodiments.

[0091] In an embodiment, the ncRNA variant in the chimeric gene editing composition, the one or more polynucleotides, or the vector comprises a pair of homology arms specific to a target locus and specific to the target DNA.RNG043-WO1 PCT Application

[0092] In an embodiment of any one of the preceding embodiments, the interacting step is performed in vivo or in vitro.

[0093] In another aspect, the present disclosure provides a chimeric gene editing composition comprising: (a) a non-coding RNA (ncRNA) comprising a single-stranded RNA comprising a polymerase template, (b) a nickase or a first mRNA encoding the nickase, (c) a guide RNA (gRNA) associated with the nickase, and (d) optionally, a second polymerase or a second mRNA encoding the second polymerase.

[0094] In an embodiment, the chimeric gene editing composition comprises the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a reverse transcriptase.

[0095] In an embodiment, the chimeric gene editing composition comprises the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a DNA polymerase.

[0096] In an embodiment of any one of the preceding embodiments, the nickase comprises a Cas9 nuclease, a Cas9(D10A) nuclease, a TnpB nuclease, or a Cas12a nuclease.

[0097] In ame embodiments of any one of the preceding embodiments, the ncRNA is linked to the gRNA directly or indirectly. In an embodiment, the ncRNA, the gRNA, and the first mRNA encoding the nickase are linked directly or indirectly. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0099] FIG.1 depicts a prime editing system.

[0100] FIG.2 depicts a retron editing system.

[0101] FIG.3 depicts the chimeric editing system disclosed herein, i.e., the nickase retron template precision editing system which comprises one or more prime editing components and one or more components of a retron editor.

[0102] FIG.4A-4D compares the structures of a wildtype ncRNA (A and B) with a templated ncRNA (C) and cognate templated msDNA (D) which are used in the gene editing system described herein.RNG043-WO1 PCT Application

[0103] FIG.5 illustrates the process of editing with a gene editing system described herein that utilizes a ncRNA and a retron RT to generate the msDNA to use as the polymerase template to edit the target DNA.

[0104] FIG.6 illustrates the process of editing with a gene editing system described herein that utilizes a ncRNA and a retron RT to use the ncRNA as the polymerase template to edit the target DNA.

[0105] FIG.7A-7D illustrates the mechanism of editing with the gene editing system described herein.

[0106] FIG.8A-8C illustrates various configurations envisioned for the guide RNA and ncRNA components of the gene editing systems described herein.

[0107] FIG.8D illustrates various modifications that may be introduced in the templated ncRNAs described herein.

[0108] FIG.8E illustrates various configurations envisioned for the guide RNA and ncRNA components of the gene editing systems described herein.

[0109] FIG.9 illustrates an dual-editor embodiment of the gene editing system described herein.

[0110] FIG.10A-10B illustrates an dual-editor embodiment of the gene editing system described herein.

[0111] FIG.11 is a schematic illustrating various modifications of the gene editing system described herein.

[0112] FIG.12 is a schematic of an LNP formulation comprising RNA cargo for delivery the gene editing system of the disclosure to a cell, tissue, or patient under in vitro, in vivo, or ex vivo conditions.

[0113] FIG.13 is a scatter plot from a pooled screen assay, where a1:a2 variants were identified that showed higher performance than WT retron R6342.

[0114] FIG.14 is a scatter plot showing various a1a2 variants identified in the pooled screen assay from FIG.13, graphed by ssDNA production versus melt temperature.

[0115] FIG.15 is a graph summarizing edit% as determined by Exact Inserts, Inserts w / indels, and inserts w / SNPs for WT R6342, a variant lacking an msr spacer and stem (Del1), a variant lacking a msd spacer (Del2) and a variant lacking both (Del1+Del2).

[0116] FIG.16 is a set of graphs and a graphic showing the effects of deletion of the msr stem on editing efficiency. Overall, deletion of the msR stem resulted in near complete loss of precise gene editing.RNG043-WO1 PCT Application

[0117] FIG.17 is a set of graphs and a graphic showing the effects of altering the a1a2 stem on editing efficiency. These results suggest that the a1:a2 stem structure, instead of sequence, is the important feature for the editing output for ncRNA.

[0118] FIG.18 is a set of graphs and a graphic showing the effects of deleting the msD and msR spacer on editing efficiency. Deleting msR spacer alone did not affect the gene editing outcome while msD deletion variants exhibited lower editing efficiency, partially due to the decrease in indel rate in these cell lines. When combined, deletion of both msR spacer and msD spacer resulted in robust editing outcome comparable to WT, suggesting that the ncRNA can be shortened at msD and msR spacer region without a compromise in its function.

[0119] FIG.19 is a set of graphs and a graphic showing the effects of a fused a1a2 ncRNA configuration on editing efficiency. A fused a1a2 design (ALT) with both long and short R6342 retron ncRNA (R6342L and R6342S, respectively) was generated. The alternative design with the fused a1a2 loop did not impact editing efficiency for R6342L ncRNA and slightly reduced the editing efficiency of R6342S ncRNA.

[0120] FIG.20 is a set of graphs and a graphic showing the effects of deletion of the msR and msD spacers with a fused a1a2 ncRNA configuration on editing efficiency. Deletion of the spacer sequences generally reduced editing efficiencyas compared to WT, but overall the modified constructs still demonstrated appreciable activity.

[0121] FIG.21 is a set of graphs and a graphic showing the effects of deletion of the msD stem loop in combination with the msD and msR spacers. ncRNA with an msD stem- loop deletion with a further shortening of the msD spacer and a complete removal of the msR spacer, with the fused a1a2 stem (Alt1 msR Spacer Del-2 / msD Del-3) only suffered a small negative effect on gene editing. Incorporation of a MS2 stem-loop at 3’ end of the ncRNA significantly reduced the editing efficiency of such ncRNA (Alt1 msR Spacer Del-2 / msD Del- 3 MS2), while the 3’ tail from a snRNA, U7, maintained similar editing efficiency (Alt1 msR Spacer Del-2 / msD Del-3 MS2). Together, this demonstrates high level of editing when deleting msD spacer and stem-loop elements, in addition to msR spacer elements.

[0122] FIG.22 is a set of graphs and a graphic showing that the U7 snRNA sequence strongly boosted ssDNA production in the short ncRNA. ssDNA production with short ncRNA with deletions of msD, and msR stem-loop was measured. It was found that such ncRNA variants result in a 6-fold reduction in ssDNA production. Incorporation of an MS2 stem-loop (Alt1 msR Spacer Del-2 / msD Del-3 MS2) boosted the ssDNA production while incorporation U7 sequence (Alt1 msR Spacer Del-2 / msD Del-3 U7) shows a higher enhancement of the ssDNA.RNG043-WO1 PCT Application

[0123] FIG.23 is a set of graphs showing that a minimization variant ncRNA with msr spacer deletion allowed up to 20% editing in human hematopoietic stem cells (HSCs) for M (ATG)>T (ACC) mutation installation in the UBA1 gene at 2.5 fold higher efficiency than WT version.

[0124] FIG.24 is a set of graphs showing ncRNA with msr / msd spacer deletion and alternative configuration (as presented in FIG.19) allowed up to 40% editing in human hematopoietic stem cells (HSC) for PAM mutation installation or 25 bp insertion in AAVS1 gene, at 2.5 fold higher efficiency than WT version. DEFINITIONS

[0125] All technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this the present disclosure belongs. The following references provide one of skill in the art with a general definition of many of the terms used in this disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed.1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Margham, The Harper Collins Dictionary of Biology (1991).

[0126] In some examples, general methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.

[0127] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.RNG043-WO1 PCT Application

[0128] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a ncRNA” includes a plurality of ncRNAs and reference to “the reverse transcriptase” includes reference to one or more RTs and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation. For example, claims may be drafted to exclude certain RT sequences.

[0129] It is appreciated that certain features of the present disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the present disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub- combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub combination was individually and explicitly disclosed herein. Biologically active

[0130] As used herein, the term “biologically active” refers to a characteristic of an agent (e.g., DNA, RNA, or protein) that has activity in a biological system (including in vitro and in vivo biological system), and particularly in a living organism, such as in a mammal, including human and non-human mammals. For instance, an agent when administered to an organism has a biological effect on that organism, is considered to be biologically active. Bulge

[0131] As used herein, the term “bulge” refers to a small region of unpaired base(s) that interrupts a “stem” of base-paired nucleotides. The bulge may comprise one or two single-stranded or unbase-paired nucleotides joined at both ends by base-paired nucleotides of the stem. The bulge can be symmetrical (viz., the two unbase-paired single-stranded regions have the same number of nucleotides), or asymmetrical (viz., the unbase-paired single stranded region(s) have different or unequal numbers of nucleotides), or there is only one unbase-paired nucleotide on one strand. A bulge can be described as A / B (such as a “2 / 2 bulge,” or a “1 / 0 bulge”) wherein A represents the number of unpaired nucleotides on the upstream strand of theRNG043-WO1 PCT Application stem, and B represents the number of unpaired nucleotides on the downstream strand of the stem. An upstream strand of a bulge is more 5ʹ to a downstream strand of the bulge in the primary nucleotide sequence. cDNA

[0132] As used hereing, the term “cDNA” refers to a strand of DNA copied from an RNA template, e.g., by a reverse transcriptase. Cognate

[0133] The term “cognate” refers to two biomolecules that normally interact or co-exist in nature. Complementary

[0134] As used herein, the terms “complementary” or “substantially complementary" are meant to refer to a nucleic acid (e.g., RNA, DNA) that comprises a sequence of nucleotides that enables it to non-covalently bind, i.e., form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA]. In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g., when a DNA target nucleic acid base pairs with a guide RNA, etc.): guanine (G) can also base pair with uracil (U). For example, G / U base-pairing is at least partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, in the context of this disclosure, a guanine (G) is considered complementary to both a uracil (U) and to an adenine (A). For example, when a G / U base-pair can be made at a given nucleotide position of a dsRNA duplex of a guide RNA molecule, the position is not considered to be non-complementary, but is instead considered to be complementary.

[0135] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a bulge, a loop structure or hairpin structure, etc.). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within theRNG043-WO1 PCT Application target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs, such as those described in Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman as described in Adv. Appl. Math., 1981, 2, 482-489, and the like. DNA-guided nuclease

[0136] As used herein, an “DNA-guided nuclease” is a type of “programmable nuclease,” and a specific type of “nucleic acid-guided nuclease.” An example of a DNA- guided nuclease is reported in Varshney et al., DNA-guided genome editing using structure- guided endonucleases, Genome Biology, 2016, 17(1), 187, which may be used in the context of the present disclosure and is incorporated herein by reference. As used herein, the term “DNA-guided nuclease” or “DNA-guided endonuclease” refers to a nuclease that associates covalently or non-covalently with a guide RNA thereby forming a complex between the guide RNA and the DNA-guided nuclease. The guide RNA comprises a spacer sequence which comprises a nucleotide sequence having complementarity with a strand of a target DNA sequence. Thus, the DNA-guided nuclease is indirectly guided or programmed to localize to a specific site in a DNA molecule through its association with the guide RNA, which directly binds or anneals to a strand of the target DNA through its complementarity region via Watson- Crick base-pairing. DNA regulatory sequences

[0137] As used herein, the terms “DNA regulatory sequences,” “control elements,” and “regulatory elements,” can be used interchangeably herein to refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a non-coding sequence (e.g., guide RNA) or a coding sequence and / or regulate translation of a mRNA into an encoded polypeptide.RNG043-WO1 PCT Application Donor nucleic acid

[0138] By a “donor nucleic acid” or “donor polynucleotide” or “donor DNA” or “HDR donor DNA” it is meant a single-stranded DNA to be inserted at a site cleaved by a programmable nuclease (e.g., a CRISPR / Cas effector protein; a TALEN; a ZFN; a meganuclease) (e.g., after dsDNA cleavage, after nicking a target DNA, after dual nicking a target DNA, and the like). The donor polynucleotide can contain sufficient homology to a genomic sequence at the target site, e.g.70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the target site, e.g., within about 200 bases or less of the target site, e.g., within about 190 bases or less of the target site, e.g., within about 180 bases or less of the target site, e.g., within about 170 bases or less of the target site, e.g., within about 160 bases or less of the target site, e.g., within about 150 bases or less of the target site, e.g., within about 140 bases or less of the target site, e.g., within about 130 bases or less of the target site, e.g., within about 120 bases or less of the target site, e.g., within about 110 bases or less of the target site, e.g., within about 100 bases or less of the target site, e.g., within about 90 bases or less of the target site, e.g., within about 80 bases or less of the target site, e.g., within about 70 bases or less of the target site, e.g., within about 60 bases or less of the target site, e.g., 50 bases or less of the target site, e.g., within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the target site, to support homology-directed repair between it and the genomic sequence to which it bears homology. Encodes

[0139] As used herein, a DNA sequence that “encodes” a particular RNA is a DNA nucleotide sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a “non-coding” RNA (ncRNA), a guide RNA, etc.). In the case of retrons, the retron DNA may encode the ncRNA loci (which includes the msr and msd regions) as well as a retron RT. Engineered retron

[0140] As used herein, the term “engineered retron” or equivalently, “recombinant retron” or “retron variant” refers to a retron that does not occur in nature. In one embodiment, engineered retrons can include wildtype or naturally-occurring retrons that are modified to contain at least one modification, including a single nucleotide substitution, insertion, or deletion, or a substitution, insertion, or deletion of more than one nucleotide, i.e., up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,RNG043-WO1 PCT Application 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or up to 100, or up to 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or up to 2000 nucleotides substituted, inserted, or deleted from a starting point retron (e.g., a wildtype retron). Where more than one nucleotide of a starting point retron (e.g., a wildtype retron) is substituted, deleted, or inserted, the nucleotides may be contiguous or non- contiguous. While an engineered retron as a whole is not naturally-occurring, it may include components such as nucleotide sequences that do occur in nature. For example, an engineered retron can have nucleotide sequences from different organisms (e.g., from different bacteria species), or from completely synthetic / artificial / recombinant nucleic acid sequences. Thus, an engineered retron can have a bacterial nucleotide sequence, a human nucleotide sequence, a viral nucleotide sequence, and / or a synthetic / artificial / recombinant nucleotide sequence, and / or combinations of such sequences. An example of modifications of the recombinant retrons disclosed herein include the insertion of a heterologous nucleic acid sequence in a retron, for example, inserted into the ncRNA locus, such as in the msr or the msd loci. Linking guide RNA molecules to the 5ʹ and / or 3ʹ ends (i.e., linking one at the 5ʹ end of a ncRNA and / or one at the 3ʹ end of a ncRNA) also represent another modification envisioned by the recombinant retrons disclosed herein. In such embodiments, the guide RNA molecules may also be categorized or referred to more generally as types of heterologous nucleic acid sequences used to modify starting point retrons. Exosomes

[0141] As used herein, the term “exosomes” refer to small membrane bound vesicles with an endocytic origin. Without wishing to be bound by theory, exosomes are generally released into an extracellular environment from host / progenitor cells post fusion of multivesicular bodies the cellular plasma membrane. As such, exosomes can include components of the progenitor membrane in addition to designed components (e.g. engineered retron). Exosome membranes are generally lamellar, composed of a bilayer of lipids, with an aqueous inter-nanoparticle space. Expression vector

[0142] As used herein, the term “expression vector” or “expression construct” refers to a vector that includes one or more expression control sequences, and an “expression control sequence” is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence. Suitable expression vectors include, without limitation, plasmids andRNG043-WO1 PCT Application viral vectors derived from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalovirus, retroviruses, vaccinia viruses, adenoviruses, and adeno- associated viruses. Numerous vectors and expression systems are commercially available, such as from Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen / Life Technologies (Carlsbad, CA). The present disclosure comprehends recombinant vectors that may include viral vectors, bacterial vectors, protozoan vectors, DNA vectors, or recombinants thereof. Guide RNA

[0143] The RNA molecule that binds to a programmable nuclease of a retron-based gene editing systems and which targets the nuclease to a specific location within the targeted polynucleotide sequence is referred to herein as the “guide RNA” or “guide RNA polynucleotide” (also referred to herein as a “guide RNA” or “gRNA” or “crRNA”). In certain embodiments (depending on the particular nuclease to which it interacts with), a guide RNA comprises two segments, a “DNA-targeting segment” and a “protein-binding segment.” By “segment” it is meant a segment / section / region of a molecule, e.g., a contiguous stretch of nucleotides in an RNA. As an illustrative, non-limiting example, a protein-binding segment of a guide RNA can comprise base pairs 5-20 of the RNA molecule that is 40 base pairs in length; and the DNA-targeting segment can comprise base pairs 21-40 of the RNA molecule that is 40 base pairs in length. The definition of “segment,” unless otherwise specifically defined in a particular context, is not limited to a specific number of total base pairs, is not limited to any particular number of base pairs from a given RNA molecule, is not limited to a particular number of separate molecules within a complex, and may include regions of RNA molecules that are of any total length and may or may not include regions with complementarity to other molecules.

[0144] The DNA-targeting segment (or “DNA-targeting sequence”) comprises a nucleotide sequence that is complementary to a specific sequence within a targeted polynucleotide sequence (the complementary strand of the targeted polynucleotide sequence) designated the “protospacer-like” sequence herein. The protein-binding segment (or “protein- binding sequence”) interacts with a site-directed modifying polypeptide. When the site- directed modifying polypeptide is a CRISPR nuclease, site-specific cleavage of the targeted polynucleotide sequence may occur at locations determined by both (i) base-pairing complementarity between the guide RNA and the targeted polynucleotide sequence; and (ii) a short motif (referred to as the protospacer adjacent motif (PAM)) in the targeted polynucleotide sequence.RNG043-WO1 PCT Application Heterologous nucleic acid sequence

[0145] As used herein, the term “heterologous nucleic acid” refers to a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (e.g., DNA or RNA) and, if expressed, can encode a heterologous polypeptide. Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector. In some embodiments, the heterologous sequence inserted into the wild-type retron regions does not naturally insert into such regions (e.g., the engineered retron with the inserted heterologous sequence is not naturally existing). For example, the heterologous sequence can be from the same species of bacteria in which the wild-type retron is normally found, so long as the heterologous sequence is not naturally inserted in the wild-type retron at the location in which the heterologous sequence is inserted. In certain embodiments, the heterologous sequence is a mammalian sequence (e.g., a human sequence), or a reverse complement thereof. Heterologous nucleic acid sequences introduced into retrons can including without limitation guide RNA sequences, HDR donor templates, protein-encoding genes, or non-coding functional RNA elements (e.g., stem-loops, hairpins, and bulges). Homology-directed repair

[0146] As used herein, “homology-directed repair (HDR)” refers to the specialized form DNA repair that takes place, for example, during repair of double-strand breaks in cells. This process requires nucleotide sequence homology, uses a “donor” molecule to template repair of a “target” molecule (i.e., the one that experienced the double-strand break), and leads to the transfer of genetic information from the donor to the target. Homology-directed repair may result in an alteration of the sequence of the target molecule (e.g., insertion, deletion, mutation), if the donor polynucleotide differs from the target molecule and part or all of the sequence of the donor polynucleotide is incorporated into the targeted polynucleotide sequence. Identical

[0147] As used herein, the term “identical” refers to two or more sequences or subsequences which are the same. In addition, the term “substantially identical,” as used herein, refers to two or more sequences which have a percentage of sequential units which are the same when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a comparison algorithm or by manualRNG043-WO1 PCT Application alignment and visual inspection. By way of example only, two or more sequences may be “substantially identical” if the sequential units are about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, or about 95% identical over a specified region. Such percentages to describe the “percent identity” of two or more sequences. The identity of a sequence can exist over a region that is at least about 75-100 sequential units in length, over a region that is about 50 sequential units in length, or, where not specified, across the entire sequence. This definition also refers to the complement of a test sequence.

[0148] Alternatively, substantially identical or similarity exists when a nucleic acid or fragment thereof hybridizes to another nucleic acid, to a strand of another nucleic acid, or to the complementary strand thereof, under stringent hybridization conditions. “Stringent hybridization conditions” and “stringent wash conditions” in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, solvents, the base composition of the hybridizing species, length of the complementary regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art. One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of hybridization. Lipid nanoparticle (LNP)

[0149] As used herein, the term “lipid nanoparticle” or LNP refers to a type of lipid particle delivery system formed of small solid or semi-solid particles possessing an exterior lipid layer with a hydrophilic exterior surface that is exposed to the non-LNP environment, an interior space which may aqueous (vesicle like) or non-aqueous (micelle like), and at least one hydrophobic inter-membrane space. LNP membranes may be lamellar or non-lamellar and may be comprised of 1, 2, 3, 4, 5 or more layers. In some embodiments, LNPs may comprise a nucleic acid (e.g. engineered retron) into their interior space, into the inter membrane space, onto their exterior surface, or any combination thereof. In some embodiments, an LNP of the present disclosure comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEG lipid), and a phospholipid. In alternative embodiments, an LNP comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEG lipid), and a zwitterionic amino acid lipid.

[0150] Further discuss of liposomes can be found, for example, in Tenchov et al., “Lipid Nanoparticles – From Liposomes to mRNA Vaccine Delivery, a Landscape of Diversity and Advancement,” ACS Nano, 2021, 15, pp.16982-17015 (the contents of which are incorporated by reference).RNG043-WO1 PCT Application Linker

[0151] As used herein, the term “linker” refers to a molecule linking or joining two other molecules or moieties. The linker can be an amino acid sequence in the case of a linker joining two fusion proteins. For example, an RNA-guided nuclease (e.g., Cas12a) can be fused to a retron reverse transcriptase by an amino acid linker sequence. The linker can also be a nucleotide sequence in the case of joining two nucleotide sequences together. For example, in the instant case, a ncRNA at its 5ʹ and / or 3ʹ ends may be linked by a nucleotide sequence linker to one or more guide RNAs. In other embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40- 45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150- 200 amino acids in length. Longer or shorter linkers are also contemplated. Liposomes

[0152] As used herein, the term “liposomes” refer to a type of lipid particle delivery system comprising small vesicles that contain at least one lipid membrane surrounding an aqueous inner-nanoparticle space that is generally not derived from a progenitor / host cell. Liposomes are a versatile carrier platform in that they are capable of transporting hydrophobic or hydrophilic molecules, including small molecules, proteins, and nucleic acids into cells. They were the earliest developed generation of nanoscale medicine delivery platform. Numerous liposomal drug formulations have been approved for human medicines, e.g., Doxil, a lipid nanoparticle formulation of the antitumor agent doxorubicin. In some examples, the liposomes can include those described in Tenchov et al., “Lipid Nanoparticles – From Liposomes to mRNA Vaccine Delivery, a Landscape of Diversity and Advancement,” ACS Nano, 2021, 15, pp.16982-17015 (the contents of which are incorporated by reference). Loop

[0153] As used herein, the term “loop” in a polynucleotide refers to a single stranded stretch of one or more nucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, wherein the most 5ʹ nucleotide and the most 3ʹ nucleotide of the loop are each linked to a base-paired nucleotide in a stem. Micelles

[0154] As used herein, the term “micelles” refer to small particles which do not have an aqueous intra-particle space. NanoparticleRNG043-WO1 PCT Application

[0155] As used herein, the term “nanoparticle” refers to any nanoscale particle typically ranging in size from about 1 nm to 1000 nm. Nuclear localization sequence (NLS)

[0156] As used herein, the term“nuclear localization sequence” or“NLS” refers to an amino acid sequence that promotes import of a protein (e.g., a RNA-guided nuclease) into the cell nucleus, for example, by nuclear transport. For example, NLS sequences are described in Plank et al., international PCT application, PCT / EP2000 / 011690, filed November 23, 2000, published as WO / 2001 / 038547 on May 31, 2001, the contents of which are incorporated herein by reference for its disclosure of exemplary nuclear localization sequences. Nucleic acid

[0157] As used herein, the term “nucleic acid” or “nucleic acid molecule” or “nucleic acid sequence” or “polynucleotide” generally refer to deoxyribonucleic or ribonucleic oligonucleotides in either single- or double-stranded form. The term may also encompass oligonucleotides containing known analogues of natural nucleotides. The term also may also encompass nucleic acid-like structures with synthetic backbones, such as, for example, in Eckstein, 1991; Baserga et al., 1992; Milligan, 1993; WO 97 / 03211; WO 96 / 39154; Mata, 1997; Strauss-Soukup, 1997; and Samstag, 1996. The term encompasses both ribonucleic acid (RNA) and DNA, including cDNA (including RT DNA), genomic DNA, synthetic, synthesized (e.g., chemically synthesized) DNA, and / or DNA (or RNA) containing nucleic acid analogs. The nucleotides Adenine (A), Thymine (T), Guanine (G) and Cytosine (C) also may (or may not) encompass nucleotide modifications, e.g., methylated and / or hydroxylated nucleotides, e.g., Cytosine (C) encompasses 5-methylcytosine and 5- hydroxymethylcytosine. Nucleic acid-guided nuclease

[0158] As used herein, the term “nucleic acid-guided nuclease” or “nucleic acid-guided endonuclease” refers to a nuclease that associates covalently or non-covalently with a guide nucleic acid (e.g., a guide RNA or a guide DNA) thereby forming a complex between the guide nucleic acid and the nucleic acid-guided nuclease. The guide nucleic acid comprises a spacer sequence which comprises a nucleotide sequence having complementarity with a strand of a target DNA sequence. Thus, the nucleic acid-guided nuclease is indirectly guided or programmed to localize to a specific site in a DNA molecule through its association with the guide nucleic acid, which directly binds or anneals to a strand of the target DNA through its complementarity region via Watson-Crick base-pairing. In some embodiments, the nucleic acid-guided nuclease will include a DNA-binding activity (e.g., as in the case for CRISPR Cas9). Most commonly, the nucleic acid-guided nuclease is programmed by associating with aRNG043-WO1 PCT Application guide RNA molecule and in such cases the nuclease may be called “RNA-guided nuclease.” When programmed by a guide DNA, the nuclease may be called a “DNA-guided nuclease.” Nucleic acid-guided, RNA-guided, or DNA-guided nucleases may also be referred to as “programmable nucleases,” which also include other classes of programmable nucleases which associate with specific DNA sequences through amino acid / nucleotide sequence recognition (e.g., zinc fingers nucleases (ZFN) and transcription activator like effector nucleases (TALEN)) rather than through guide RNAs. In addition, any nuclease contemplated herein may also be engineered to remove, inactivate, or otherwise eliminate one or more nuclease activities (e.g., by introducing a nuclease-inactiving mutation in the active site(s) of a nuclease). A nuclease that has been modified to remove, inactivate, or otherwise eliminate all nuclease activity may be referred to as a “dead” nuclease. A dead nuclease is not able to cut either strand of a double-stranded DNA molecule. A nuclease that has been modified to remove, inactivate, or otherwise eliminate at least one nuclease activity but which still retains at least one nuclease activity may be referred to as a “nickase” nuclease. A nickase nuclease cuts one strand of a double-stranded DNA molecule, but not both strands. For example, a CRISPR Cas9 naturally comprises two distinct nuclease activity domains, namely, the HNH domain and the RuvC domain. The HNH domain cuts the strand of DNA bound to the guide RNA and the RuvC domain cuts the protospacer strand. One can obtain a nickase Cas9 by inactivating either the HNH domain or the RuvC domain. One can obtain a dead Cas9 by inactivating both the HNH domain and the RuvC domain. Other RNA-guided nuclease may be similarly converted to nickases and / or dead nucleases by inactivating one or more of the existing nuclease domains. Operably linked

[0159] As used herein, the term “operably linked” or “under transcriptional control,” when used in conjunction with the description of a promoter, refers to the correct location and orientation in relation to a polynucleotide (e.g., a coding sequence) to control the initiation of transcription by RNA polymerase and expression of the coding sequence, such as one for the msr gene, msd gene, and / or the ret gene. Other transcriptional control regulatory elements (e.g., enhancer sequences, transcription factor binding sites) may also be operably linked to a gene if their location relative to a gene controls or regulates the expression of the gene. Programmable nuclease

[0160] As used herein, the term “programmable nuclease” is meant to refer to a polypeptide that has the property of selective localization to a specific desired nucleotide sequence target in a nucleic acid molecule (e.g., to a specific gene target) due to one or moreRNG043-WO1 PCT Application targeting functions. Such targeting functions can include one or more DNA-binding domains, such as zinc finger domains characteristic of many different types of DNA binding proteins or TALE domains characteristic of TALEN proteins. Such targeting function may also include the ability to associate and / or form a complex with a guide RNA, which then localizes to a specific site on the DNA which bears a sequence that is complementary to a portion of the guide RNA (i.e., the spacer of the guide RNA). In some embodiments, the programmable nuclease may be a single protein which comprises both a domain that binds directly (e.g., a ZF protein) or indirectly (e.g., an RNA-guided protein) to a target DNA site, as well as a nuclease domain. In other embodiments, the programmable nuclease may be a composite of two or more separate proteins or domains (from different proteins) which together provide the necessary functions of selective DNA binding and nuclease activity. For example, the programmable nuclease may comprise a (a) nuclease-inactive RNA-guided nuclease (which still is capable of binding a guide RNA, localizing to a target DNA, and binding to the target DNA, but not capable of cutting or nicking the strands) fused to a (b) nuclease protein or domain, such as a FokI nuclease. Promoter

[0161] As used herein, the term“promoter” is art-recognized and refers to a nucleic acid molecule with a sequence recognized by the cellular transcription machinery and which is able to initiate transcription of a downstream gene. A promoter can be constitutively active, meaning that the promoter is always active in a given cellular context, or conditionally active, meaning that the promoter is only active in the presence of a specific condition. For example, a conditional promoter may only be active in the presence of a specific protein that connects a protein associated with a regulatory element in the promoter to the basic transcriptional machinery, or only in the absence of an inhibitory molecule. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain “TATA” boxes and “CAT” boxes. Various promoters, including inducible promoters, may be used to drive expression by the various vectors of the present disclosure. Recombinant nucleic acid

[0162] A “recombinant nucleic acid” or “recombinant nucleotide” refers to a molecule that is constructed by joining nucleic acid molecules, which optionally may self-replicate in a live cell. RetronRNG043-WO1 PCT Application

[0163] As used herein, the term “retron” refers to a specific type of naturally-occuring and distinct DNA sequence found in the genome of many bacteria which typically encodes three distinct components, namely, (a) a non-coding RNA (“ncRNA”) (comprising continguous inverted sequences (msr and msd), (b) a reverse transcriptase (RT)-coding gene (ret), and (c) in many cases, a retron-associated gene of unknown function. Retrons are particularly defined by their unique ability to produce a satellite DNA known as msDNA (multicopy single-stranded DNA). The ncRNA (comprising the msr and msd elements) and the ret gene are transcribed as a single polycitronic RNA transcript which processed into the ncRNA transcript and a transcript encoding the ret gene. The ncRNA then becomes folded into a specific secondary structure. Once translated, the RT then binds the folded ncRNA and reverse transcribes the msd region to form a single strand of cDNA (the msDNA) that remains covalently attached to the RNA template via a 2’-5ʹ phophodiester bond and base-pairing between the 3ʹ ends of the msDNA and the RNA template. See FIG.2 which provides a schematic of the production of an msDNA from a naturally-occurring retron. Retron component

[0164] As used herein, the term “retron component” refers to a distinct element or feature of a retron, namely (a) a non-coding RNA (“ncRNA”) (comprising continguous inverted sequences (msr and msd), (b) a reverse transcriptase (RT)-coding gene (ret), and (c) in many cases, a retron-associated gene of unknown function. RNA-guided nuclease

[0165] As used herein, an “RNA-guided nuclease” is a type of “programmable nuclease,” and a specific type of “nucleic acid-guided nuclease.” As used herein, the term “RNA-guided nuclease” or “RNA-guided endonuclease” refers to a nuclease that associates covalently or non-covalently with a guide RNA thereby forming a complex between the guide RNA and the RNA-guided nuclease. The guide RNA comprises a spacer sequence which comprises a nucleotide sequence having complementarity with a strand of a target DNA sequence. Thus, the RNA-guided nuclease is indirectly guided or programmed to localize to a specific site in a DNA molecule through its association with the guide RNA, which directly binds or anneals to a strand of the target DNA through its complementarity region via Watson- Crick base-pairing. Sequence identity

[0166] As used herein, the term “sequence identity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percentRNG043-WO1 PCT Application identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). For example, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller as described in CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna CMP matrix. Methods commonly employed to determine percent identity between sequences can include, but are not limited to those disclosed in Carillo, H. and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences can include, but are not limited to, GCG program package as described in Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984), BLASTP, BLASTN, and FASTA as described in Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990).RNG043-WO1 PCT Application

[0167] It is noted that when this disclosure speaks to a polypeptide (including anywhere in this specification, including in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, and the Examples) having a percent identity with respect to another amino acid sequence (a reference amino acid sequence), such as a polypeptide at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to another amino acid sequence (a reference amino acid sequence), it is advantageous that in the polypeptide having a percent identity to the reference amino acid sequence conserved regions of the reference amino acid sequence (e.g., conserved when compared with other retron RTs, such as those identified herein) be preserved and / or that the polypeptide has at least one activity selected from reverse transcriptase; endonuclease activity; endoribonuclease activity, or RNA-guided DNase activity and / or that the polypeptide of which comprises: a. one or more α-helical recognition lobe (REC) and a nuclease lobe (NUC); b. a Wedge (WED), α-helical recognition lobe (REC), PAM-interacting (PI), RuvC nuclease, Bridge Helix (BH) and NUC domains; or c. one or more domains selected from RuvC, REC, WED, BH, PI and NUC domains and / or that the polypeptide recognizes or binds a guide RNA or ncRNA as the case may be. Likewise, when this disclosure speaks to a nucleic acid sequence or molecule having a percent identity with respect to a nucleic acid sequence having a percent identity with respect to another nucleic acid sequence or molecule (a reference nucleic acid sequence), such as a nucleic acid sequence at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to another nucleic acid sequence, it is advantageous that in the nucleic acid sequence that has a percent identity to the reference nucleic acid sequence that conserved regions of the reference nucleic acid sequence (e.g., conserved when compared with other retron ncRNAs, such as those identified herein) be preserved and / or that in the polypeptide that is expressed from the nucleic acid sequence that has a percent identity to the reference nucleic acid sequence that the polypeptide contain conserved region(s) (e.g., conserved when compared with other retron sequences, such as those identified herein) and / or that the polypeptide has at least one activity selected from reverse transcriptase; endonucleaseRNG043-WO1 PCT Application activity; endoribonuclease activity, or RNA-guided DNase activity and / or that the polypeptide of which comprises: a. one or more α-helical recognition lobe (REC) and a nuclease lobe (NUC); b. a Wedge (WED), α-helical recognition lobe (REC), PAM-interacting (PI), RuvC nuclease, Bridge Helix (BH) and NUC domains; or c. one or more domains selected from RuvC, REC, WED, BH, PI and NUC domains and / or that the polypeptide recognizes or binds a guide RNA. Subject

[0168] As used herein, the term“subject” refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode. In some embodiments, the subject is a research animal. In some embodiments, the subject is genetically engineered, e.g., a genetically engineered non-human subject. The subject may be of either sex and at any stage of development. The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein. Stem

[0169] As used herein, the term “stem” refers to two or more base pairs, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more base pairs, formed by inverted repeat sequences connected at a “tip,” where the more 5ʹ or “upstream” strand of the stem bends to allows the more 3ʹ or “downstream” strand to base-pair with the upstream strand. The number of base pairs in a stem is the “length” of the stem. The tip of the stem is typically at least 3 nucleotides, but can be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more nucleotides. Larger tips with more than 5 nucleotides are also referred to as a “loop.” An otherwise continuous stem may be interrupted by one or more bulges as defined herein. The number of unpaired nucleotides in the bulge(s) are not included in the length of the stem. The position of a bulge closest to the tip can be described by the number of base pairs between the bulge and the tip (e.g., the bulge is 4 bps from the tip). The position of the other bulges (if any) further away from the tip can be described by the number of base pairs in the stem between the bulge in question and the tip, excluding any unpaired bases of other bulges in between. Synthetic or artificial nucleic acid

[0170] A “synthetic or artificial nucleic acid” refers nucleic acids that are non-naturally occurring sequences. Such sequences do not originate from, or are not known to be present inRNG043-WO1 PCT Application any living organism (e.g., based on sequence search in existing sequence databases). Recombinant nucleic acids and synthetic nucleic acids also include those molecules that result from the replication of either of the foregoing. Engineered nucleic acid constructs of the present disclosure, such as the engineer ed retron described herein, may be encoded by a single molecule (e.g., encoded by or present on the same plasmid or other suitable vector) or by multiple different molecules (e.g., multiple independently-replicating vectors). Target site

[0171] As used herein, a “target site” as used herein is a polynucleotide (e.g., DNA such as genomic DNA) that includes a site or specific locus (“target site” or “target sequence”) targeted by a recombinant retron genome modification system disclosed herein. In the context of retron genome modification systems disclosed herein that comprise an RNA-guided nuclease, a target sequence is the sequence to which the guide sequence of a guide nucleic acid (e.g., guide RNA) will hybridize. For example, the target site (or target sequence) 5ʹ- GTCAATGGACC-3ʹ (SEQ ID NO:19933) within a target nucleic acid is targeted by (or is bound by, or hybridizes with, or is complementary to) the sequence 5ʹ-GGTCCATTGAC-3ʹ (SEQ ID NO:19934). Suitable hybridization conditions include physiological conditions normally present in a cell. For a double stranded target nucleic acid, the strand of the target nucleic acid that is complementary to and hybridizes with the guide RNA is referred to as the “complementary strand” or “target strand”; while the strand of the target nucleic acid that is complementary to the “target strand” (and is therefore not complementary to the guide RNA) is referred to as the “non-target strand” or “non-complementary strand.” Treatment

[0172] As used herein, the terms “treatment,” “treat,” and “treating,” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed and / or after a disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their recurrence. Upstream and downstreamRNG043-WO1 PCT Application

[0173] As used herein, the terms “upstream” and “downstream” are terms of relativity that define the linear position of at least two elements located in a nucleic acid molecule (whether single or double-stranded) that is orientated in a 5ʹ-to-3ʹ direction. A first element is said to be upstream of a second element in a nucleic acid molecule where the first element is positioned somewhere that is 5ʹ to the second element. Conversely, a first element is downstream of a second element in a nucleic acid molecule where the first element is positioned somewhere that is 3ʹ to the second element. Variant

[0174] As used herein the term “variant” should be taken to mean the exhibition of qualities that have a pattern that deviates from what occurs in nature, e.g., a variant retron RT is retron RT comprising one or more changes in amino acid residues as compared to a wild type retron RT amino acid sequence. The term“variant” encompasses homologous proteins having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99% percent identity with a reference sequence and having the same or substantially the same functional activity or activities as the reference sequence. The term also encompasses mutants, truncations, or domains of a reference sequence, and which display the same or substantially the same functional activity or activities as the reference sequence. Vector

[0175] As used herein, the term “vector” permits or facilitates the transfer of a polynucleotide from one environment to another. It is a replicon such as a plasmid, phage, or cosmid into which another DNA segment may be inserted so as to bring about the replication of the inserted segment (e.g., the subject engineered retron). Generally, a vector is capable of replication when associated with the proper control elements. The term “vector” may include cloning and expression vectors, as well as viral vectors and integrating vectors. Wild type

[0176] As used herein the term “wild type” is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene, protein, or characteristic as it occurs in nature as distinguished from mutant or variant forms. DETAILED DESCRIPTION

[0177] The present disclosure provides systems, methods and compositions used for precise genome editing, including installing nucleic acid insertions, replacements, and deletions at targeted and precise genome sites, wherein said systems, methods, and compositions are based on novel and / or modified retrons or components thereof, such as modified versions of the retron RTs of Table X of U.S. Application No.18 / 087,673, orRNG043-WO1 PCT Application International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, modified versions of the ncRNAs of Table A of U.S. Application No. 18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, and modified versions of the RTs of Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0178] In one aspect, the present disclosure provides a non-coding RNA variant (ncRNA variant) comprising a reference retron non-coding RNA (ncRNA) with one or more modifications. The reference retron ncRNA can comprise from 5’ to 3’ direction: a1 region, first branching guanosine, msr, msd, and a2 region, In some embodiments, the reference retron ncRNA further comprises second branching guanisine. In some embodiments, the one or more modifications comprises (i) linkage of the a1 region and the a2 region, (ii) deletion of at least a portion of the msr; (iii) deletion of at least a portion of the msd, (iv) addition of a single- stranded RNA comprising a polymerase template, or (v) addition of an RNA motif. The ncRNA variant can be incorporated into a recombinant or engineered retron and provide improved functionality and / or properties compared to the reference retron.

[0179] Accordingly, in one aspect, the present disclosure provides recombinant retrons comprising one or more genetic modifications which improves the functionality and / or properties of a retron. Such genetic modifications can include a mutation, insertion, deletion, inversion, replacement, substitution, or translocation of one or more contiguous or non- contiguous nucleobases in a nucleic acid molecule encoding a retron or a component of a retron, such as an ncRNA or a reverse transcriptase. In various aspects, the retron that becomes modifed with the one or more genetic modifications (i.e., the “pre-modified” or “unmodified” retron or retron component) is a naturally occurring retron or retron component (e.g., naturally occuring ncRNA of Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 or RT) with the ability to facilitate homology-dependent recombination (or HDR) in a cell, thereby resulting in a relative increase in the concentrations or amounts of msDNA comprising a DNA donor template. In particular embodiments, the recombinant retrons are based on and / or derived from a naturally-occurring retron, such as any retron- related sequence provided by Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 (the introduction of the one or more genetic modifications into a set of 7257 previously unknown retrons discovered through computational methods described herein (e.g., seeRNG043-WO1 PCT Application Examples). In other examples, the recombinant retrons can be based on introducing the one or more genetic modifications into previously available retron sequences, as described in “Mestre et al., Systematic Prediction of Genes Functionally Associated with Bacterial Retrons and Classification of The Encoded Tripartite Systems, Nucleic Acids Research, Volume 48, Issue 22, 16 December 2020, Pages 12632-12647” (incorporated herein by reference)) to achieve recombinant retrons with the enhanced ability to produce increased concentrations or amounts of msDNA comprising a DNA donor template.

[0180] In another aspect, the present disclosure further provides nucleic acid molecules encoding the recombinant retrons and / or recombinant retron components (e.g., a recombinant ncRNA and / or a recombinant retron RT). In still another aspect, the present disclosure provides genome editing systems comprising recombinant retron components (e.g., recombinant ncRNA and / or recombinant RT), programmable nucleases (e.g., RNA-guided nucleases, such as CRISPR-Cas proteins, ZFPs, and TALENS), and guide RNAs (in the case where RNA-guide nucleases are used in said genome editing systems). In a further aspect, the disclosure provides nucleic acid molecules encoding the described genome editing systems and said components thereof, as well as polypeptides making up the components of said genome editing systems. In yet another aspect, the disclosure provides vectors for transferring and / or expressing the genome editing systems, e.g., under in vitro, ex vivo, and in vivo conditions. In still another aspect, the disclosure provides cell-delivery compositions and methods, including compositions for passive and / or active transport to cells (e.g., plasmids), delivery by virus- based recombinant vectors (e.g., AAV and / or lentivirus vectors), delivery by non-virus-based systems (e.g., liposomes and LNPs), and delivery by virus-like particles. Depending on the delivery system employed, the retron-based genome editing systems described herein may be delivered in the form of DNA (e.g., plasmids or DNA-based virus vectors), RNA (e.g., ncRNA and mRNA delivered by LNPs), a mixture of DNA and RNA, protein (e.g., virus-like particles), and ribonucleoprotein (RNP) complexes. Any suitable combinations of approaches for delivering the components of the herein disclosed retron-based genome editing systems may be employed. In one embodiment, each of the components of the retron-based genome editing system is delivered by an all-RNA system, e.g., the delivery of one or more RNA molecules (e.g., mRNA and / or ncRNA) by one or more LNPs, wherein the one or more RNA molecules form the ncRNA and guide RNA (as needed) and / or are translated into the polypeptide components (e.g., the RT and a programmable nuclease). In yet another aspect, the disclosure provides methods for genome editing by introducing a retron-based genome editing system described herein into a cell (e.g., under in vitro, in vivo, or ex vivo conditions)RNG043-WO1 PCT Application comprising a target edit site, thereby resulting in an edit at the target edit. In other aspects, the disclosure provides formulations comprising any of the aforementioned components for delivery to cells and / or tissues, including in vitro, in vivo, and ex vivo delivery, recombinant cells and / or tissues modified by the recombinant retron-based genome modification systems and methods described herein, and methods of modifying cells by conducting genome editing and related DNA donor-dependent methods, such as recombineering, or cell recording, using the herein disclosed retron-based genome modification systems. The disclosure also provides methods of making the recombinant retrons, retron-based genome modification systems, vectors, compositions, and formulations described herein, as well as to pharmaceutical compositions and kits for modifying cells under in vitro, in vivo, and ex vivo conditions that comprise the herein disclosed genome editing and / or modification systems.

[0181] Described herein are engineered retrons comprising one or more heterologous nucleic acids. The one or more heterologous nucleic acids may be inserted, for example, at or within a location selected from: the msd locus, upstream of the msr locus, upstream of the msd locus, and downstream of the msd locus. In some embodiments, the engineered retrons have structural improvements over their naturally existing counterparts or wild-type retrons at least with respect to the encoded ncRNA and / or the reverse transcriptase (RT), such that the engineered retron or the encoded ncRNA thereof, when delivered to a host cell, such as a mammalian host cell, exhibits various functional improvements over its naturally existing / wild-type retron elements.

[0182] Exemplary, but non-limiting, functional improvements may include any one or more of the features described herein. For example, in some embodiments, the engineered retron may comprise a sequence modification (e.g., insertion, deletion, and / or substitution of one or more nucleotide(s)) in the msr locus and / or the msd locus that: i) modulates (e.g., enhances) reverse transcription, processivity, accuracy / fidelity, and / or production of the msDNA (e.g., in the mammalian cell); ii) modulates (e.g., reduces) immunogenicity of the ncRNA encoded by the engineered retron (e.g., encoded by the msr locus and / or the msd locus) in a host (e.g., a host comprising the mammalian cell); iii) comprises a nucleotide sequence that modulates (e.g., inhibits or antagonizes) a function of the msDNA; and / or iv) modulates (e.g., improves) efficiency of targeted genomic engineering.

[0183] Thus, in general, the engineered retron is an engineered nucleic acid construct comprising: a) a first polynucleotide encoding a non-coding RNA (ncRNA), the first polynucleotide comprising: i) an msr locus encoding the msr RNA portion of a multi-copyRNG043-WO1 PCT Application single-stranded DNA (msDNA); and ii) an msd locus encoding the msd RNA portion of the msDNA; and b) one or more heterologous nucleic acids inserted at or within a location selected from: the msd locus, upstream of the msr locus, upstream of the msd locus, and downstream of the msd locus.

[0184] The engineered nucleic acid construct (e.g., the engineered retron or retron variant) may further comprise a second polynucleotide encoding a reverse transcriptase (RT), or a portion thereof, wherein the encoded RT is capable of synthesizing a DNA copy of at least a portion of the msd locus encoding the msDNA.

[0185] In certain embodiments, the engineered retron of the present disclosure encodes a reverse transcriptase (RT) or a functional domain thereof, comprising: i) a polypeptide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polypeptide listed in Table A of U.S. Application No. 18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; and / or ii) a polypeptide listed in any one of Table C of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872. In some embodiments, the RT does not comprise a polypeptide listed in Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0186] In certain embodiments, the engineered retron of the present disclosure encodes a reverse transcriptase (RT) or a functional domain thereof, comprising: i) a polynucleotide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polynucleotide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, orRNG043-WO1 PCT Application International Application No. PCT / US2023 / 072872; and / or ii) a consensus polynucleotide sequence listed in Table C of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872. In some embodiments, the polynucleotide encoding the RT does not comprise a polynucleotide of Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0187] In certain embodiments, the engineered retron of the present disclosure encodes an ncRNA comprising: (I) an ncRNA listed in Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or an ncRNA having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to an ncRNA in Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0188] In certain embodiments, the engineered retron of the present disclosure encodes an ncRNA and a reverse transcriptase (RT) or a functional domain thereof, wherein the ncRNA and the RT or functional domain thereof are as described above.

[0189] Specifically, in such embodiment, the ncRNA may comprise: (I) an ncRNA listed in Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or an ncRNA having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to an ncRNA listed in Table B of U.S. Application No. 18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0190] Also in such embodiment, the reverse transcriptase (RT) or functional domain thereof comprises: (A) i) a polypeptide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at leastRNG043-WO1 PCT Application 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polypeptide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; and / or ii) a polypeptide listed in Table C of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; optionally, the RT does not comprise a polypeptide listed in Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; OR (B) i) a polynucleotide listed in Table A of U.S. Application No. 18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polynucleotide in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; and / or optionally, the polynucleotide encoding the RT does not comprise a polynucleotide in Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0191] In certain embodiments, the engineered nucleic acid construct comprises: 1) an msr locus (that encodes the msr RNA portion of an msDNA); 2) an msd locus encoding the msd RNA portion of the msDNA; 3) a sequence encoding a retron reverse transcriptase (RT), wherein the msd RNA is capable of being reverse transcribed to form the msDNA by the retron reverse transcriptase (RT); and, 4) a heterologous nucleic acid inserted at or within the msd locus, upstream of the msr locus, upstream or downstream of the msd locus; wherein the engineered nucleic acid construct is engineered based on and / or to resemble a secondary structure of a wild-type or consensus retron encoding a wild-type or consensus retron ncRNA encompassed by: a) any one of the sequences and / or structures as depicted in any one of SEQ ID NOs: of Table B and / or FIGs.2-27 of of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; or b) a variant of a), having: i) up to 1, 2, or 3 (e.g., up to 1) nucleotide changes per 10 red lettered-nucleotides; ii) up to 4, 5, or 6 (e.g., up to 1 or 2) nucleotide changes per 10 blackRNG043-WO1 PCT Application lettered-nucleotides; and / or iii) up to 7, 8, or 9 (e.g., up to 3 or 4) nucleotide changes per 10 grey lettered-nucleotides; and / or optionally further comprising: i) 7, 8, 9, or 10 (e.g., 9 or 10) nucleotides present per 10 red-circled nucleotides; ii) 6, 7, 8, 9, or 10 (e.g., 8, 9 or 10) nucleotides present per 10 black-circled nucleotides; iii) 4, 5, 6, 7, 8, 9, or 10 (e.g., 6, 7, 8, 9 or 10) nucleotides present per 10 grey-circled nucleotides; and / or iv) 2, 3, 4, 5, 6, 7, 8, 9, or 10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides present per 10 white-circled nucleotides; wherein the ncRNA does not comprise an ncRNA associated with the sequences of Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0192] The engineered nucleic acid construct (e.g., the engineered retron) may comprise one or more sequence modifications (e.g., an insertion, deletion, and / or substitution of one or more nucleotide(s)) in the msr locus and / or the msd locus that: a) modulates (e.g., enhances) reverse transcription, processivity, accuracy / fidelity, and / or production of the msDNA (e.g., in the mammalian cell); b) modulates (e.g., reduces) immunogenicity of ncRNA encoded by the engineered retron (e.g., the msr locus and / or the msd locus) in a host (e.g., a host comprising the mammalian cell); c) modulates (e.g., inhibits, either permanently or transiently) a function of the msDNA; and / or d) modulates (e.g., improves) efficiency of targeted genome editing / engineering.

[0193] In some embodiments, the engineered nucleic acid construct (e.g., the engineered retron) is engineered based on and / or to resemble a secondary structure of a wild- type or consensus retron encoding a wild-type or consensus retron ncRNA encompassed by: a) the sequence of any one of Table B ncRNA sequences and / or the structure depicted in any one of FIGs.2-27 of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; or b) a variant of a), having: i) up to 1, 2, or 3 (e.g., up to 1) nucleotide changes per 10 red lettered- nucleotides; ii) up to 4, 5, or 6 (e.g., up to 1 or 2) nucleotide changes per 10 black lettered- nucleotides; and / or iii) up to 7, 8, or 9 (e.g., up to 3 or 4) nucleotide changes per 10 grey lettered-nucleotides; and / or optionally further comprising: i) 7, 8, 9, or 10 (e.g., 9 or 10) nucleotides present per 10 red-circled nucleotides; ii) 6, 7, 8, 9, or 10 (e.g., 8, 9 or 10) nucleotides present per 10 black-circled nucleotides; iii) 4, 5, 6, 7, 8, 9, or 10 (e.g., 6, 7, 8, 9 or 10) nucleotides present per 10 grey-circled nucleotides; and / or iv) 2, 3, 4, 5, 6, 7, 8, 9, or 10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides present per 10 white-circled nucleotides.

[0194] Another aspect of the disclosure provides a vector system comprising a vector comprising the engineered retron described herein.RNG043-WO1 PCT Application

[0195] Another aspect of the disclosure provides an isolated host cell comprising the engineered retron described herein, or the vector system described herein.

[0196] Another aspect of the disclosure provides a pharmaceutical composition comprising the engineered retron described herein, or the vector system described herein.

[0197] Another aspect of the disclosure provides a delivery vehicle comprising the engineered retron described herein or the ncRNA encoded by the engineered retron described herein, the vector or vector system described herein, the host cell described herein, or the pharmaceutical composition described herein.

[0198] Another aspect of the disclosure provides a kit comprising the engineered retron described herein or the ncRNA encoded by the engineered retron described herein, and optionally instructions for genetically modifying a cell using the engineered retron described herein or the ncRNA encoded by the engineered retron described herein.

[0199] Another aspect of the disclosure provides a method of modifying a target DNA sequence in a host cell (e.g., a mammalian cell), the method comprising introducing into the host cell (e.g., the mammalian cell) the engineered retron of the present disclosure, the ncRNA encoded by the engineered retron of the present disclosure, or the vector / vector system described herein, to allow the production of the msDNA in the host cell (e.g., mammalian cell), wherein at least a part of the heterologous nucleic acid in the msDNA is integrated into the genome of the host (e.g., mammalian) cell at the target DNA sequence. Optionally, the target sequence is recognized by a suitable nuclease, such as a CRISPR / Cas effector enzyme, a ZFN, a TALEN, a meganuclease, TnpB, IscB, or a restriction endonuclease (RE), and a double- stranded break (DSB) is created by the nuclease to facilitate / promote the insertion of the part of the heterologous nucleic acid into the target sequence. Further optionally, the target sequence modified / inserted by the part of the heterologous nucleic acid can no longer be recognized by the nuclease to re-create a DSB.

[0200] Another aspect of the disclosure provides a use of the engineered retron in the various methods described herein.

[0201] Another aspect of the disclosure provides a genome editing system comprising: a) nuclease capable of acting at a target site on a genome (e.g. human genome), such as a CRISPR / Cas effector enzyme, a ZFN, a TALEN, a meganuclease, TnpB, IscB, or a restriction endonuclease (RE); and b) an engineered retron described herein, or an ncRNA encoded thereby, or a vector or a vector system comprising or encoding the same. Optionally, the nuclease may be linked to one or more element(s) of the engineered retron or the encoded ncRNA. For example, in one embodiment, the nuclease may be linked (e.g., fused orRNG043-WO1 PCT Application conjugated) to the reverse transcriptase of the engineered retron described herein. In another embodiment, the nuclease may engage / bind to form a complex with a nucleic acid guide sequence (such as a single-guided RNA of a Cas enzyme), wherein the guide sequence is linked to the ncRNA and / or msDNA of the engineered retron described herein.

[0202] Another aspect of the disclosure provides an enhanced genome editing system, comprising the genome editing system of the disclosure connected to a biomolecule that modulates host DNA repair, in order to, for example, modulate (e.g., enhance) the incorporation of the heterologous nucleic acid sequence into a genome (e.g., human genome).

[0203] With the general aspect of the disclosure described herein, specific aspects and embodiments of the disclosure are further described in the sections below. It should be understood that any one embodiment of the disclosure, including those described only in the examples or the claims, or only in one section herein below, can be combined with any one or more additional embodiments of the present disclosure, unless such combination is expressly disclaimed or are improper. A. Chimeric gene editing composition

[0204] The present disclosure describes a chimeric gene editing system that combines one or more site-specific gene editing components (e.g., prime editing or CRISPR / Cas9) with one or more components of a retron editing system, including a retron RT and a modified retron ncRNA. The chimeric gene editing composition comprises (a) an ncRNA, optionally comprising a polymerase template sequence and a first polymerase, (b) a nuclease or a first mRNA encoding the nuclease, (c) a guide RNA (gRNA) associated with the nuclease, and (d) optionally, a second polymerase or a second mRNA encoding the second polymerase.

[0205] In some embodiments, the chimeric gene editing composition comprises (a) a nickase component, (b) a guide RNA that complexes with the nickase component and directs it to a target DNA sequence, (c) a polymerase component, and (d) a polymerase template sequence, wherein the polymerase template sequence is provided by a modified retron ncRNA comprising the polymerase template sequence (herein referred to as a “templated ncRNA” or “tncRNA”). In various embodiments, the chimeric gene editing composition comprises an ncRNA variant having an altered structural configuration relative to a reference retron ncRNA (e.g., wildtype retron ncRNA) wherein the alterations include (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or portion thereof, (iii) a deletion of the wildtype msr region or portion thereof,iii) installation of a single-strand RNA sequence comprising the polymerase template e.g., in place of the deleted msd sequence, and / or iv) addition of an RNA motif. The chimeric gene editingRNG043-WO1 PCT Application system may also optionally comprise a retron RT to convert the templated ncRNA to a cognate msDNA, which is referred to herein as the “templated msDNA” or “tmsDNA”.

[0206] The gene editing systems described herein may also include any templated ncRNA that is derived from any ncRNA known in the art, including any of those described in Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 (each are incorporated herein by reference in their entireties, including their Sequence Listings), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with a sequence from Table B of any of the aforementioned applications.

[0207] Retrons were originally discovered in 1984 in Myxococcus xanthus bacterium when a short, multi-copy single-stranded DNA (msDNA) that is abundantly present in the bacterial cell was identified. Since then, a number of naturally existing retrons have been found in many prokaryotes such as bacteria.

[0208] Retrons encode and transcribe as a single RNA, which comprises a non-coding RNA (ncRNA) portion and a portion encoding a specialized reverse transcriptase (RT). The retron ncRNA (msr and msd) is the precursor of the hybrid molecule that eventually forms, and it initially folds into a typical RNA secondary structure that is recognized by the accompanying RT. The translated RT typically recognizes certain secondary structures in the ncRNA, and binds the RNA template downstream from the msd region. The RT initiates reverse transcription of the RNA towards its 5ʹ end, starting from the 2’-end of a conserved guanosine (G) residue found immediately after a double-stranded RNA structure (the a1 / a2 region) within the ncRNA. A portion of the ncRNA serves as a template for reverse transcription, and reverse transcription terminates before reaching the msr locus. During reverse transcription, cellular RNase H degrades the segment of the ncRNA that serves as template, but not other parts of the ncRNA. The result of the reverse transcription, the msDNA, remains covalently attached to the RNA template via the 2’-5ʹ phosphodiester bond, and base-pairs with the RNA template using the 3ʹ end of the msDNA. See FIG.2 for a general or typical organization of the retron coding sequence, including the RT encoding sequence and the msr and msd loci, as well as the synthesis of the msDNA by reverse transcription of the initial ncRNA transcript.

[0209] The templated retron ncRNAs may be constructed by modifying a starting point retron DNA sequence encoding a ncRNA (the msr / msd region) (such as any of those of aforementioned Table B). A starting point retron DNA sequence encoding an ncRNA (a reference retron ncRNA) may be modified in any number of ways and can including one modification or more than one modification.RNG043-WO1 PCT Application

[0210] Retron ncRNA sequences may be further modified to contain at least one nucleotide modification, including a single nucleotide substitution, insertion, or deletion, or a substitution, insertion, or deletion of more than one nucleotide, i.e., up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or up to 100, or up to 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or up to 2000 nucleotides substituted, inserted, or deleted from a starting point retron (e.g., a wildtype retron). Where more than one nucleotide of a starting point retron (e.g., a wildtype retron) is substituted, deleted, or inserted, the nucleotides may be contiguous or non-contiguous. While an engineered retron as a whole is not naturally-occurring, it may include components such as nucleotide sequences that do occur in nature. For example, an engineered retron can have nucleotide sequences from different organisms (e.g., from different bacteria species), or from completely synthetic / artificial / recombinant nucleic acid sequences. Thus, an engineered retron can have a bacterial nucleotide sequence, a human nucleotide sequence, a viral nucleotide sequence, and / or a synthetic / artificial / recombinant nucleotide sequence, and / or combinations of such sequences. An example of modifications of the recombinant retrons disclosed herein include the insertion of a heterologous nucleic acid sequence in a retron, for example, inserted into the ncRNA locus, such as in the msr or the msd loci. Linking guide RNA molecules to the 5ʹ and / or 3ʹ ends (i.e., linking one at the 5ʹ end of a ncRNA and / or one at the 3ʹ end of a ncRNA) also represents another modification contemplated by the recombinant retrons disclosed herein. In such embodiments, the guide RNA molecules may also be categorized or referred to more generally as types of heterologous nucleic acid sequences used to modify starting point retrons. Examples of such modifications are depicted in FIG.8A-8E.

[0211] In addition to the DNA encoding the ncRNA, the DNA encoding the RT may also be modified to obtain a recombinant RT. For example, the RT-encoding DNA may modified to contain at least one nucleotide modification, including a single nucleotide substitution, insertion, or deletion, or a substitution, insertion, or deletion of more than one nucleotide, i.e., up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,RNG043-WO1 PCT Application 99, or up to 100, or up to 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or up to 2000 nucleotides substituted, inserted, or deleted from a starting point retron (e.g., a wildtype retron) within the RT gene.

[0212] Such modifications to the DNA encoding ncRNA and / or RT may modulate the function of the ncRNA and / or RT in various ways, including i) modulating (e.g., enhancing) reverse transcription, processivity, accuracy / fidelity, and / or production of the msDNA (e.g., in the mammalian cell); ii) modulating (e.g., reducing) immunogenicity of ncRNA (msr locus and msd locus) encoded by the engineered retron in a host (e.g., a host comprising the mammalian cell); iii) modulating (e.g., inhibits, either permanently or transiently) a function of the msDNA; and / or iv) modulating (e.g., improving) efficiency of targeted genome editing / engineering.

[0213] In one embodiment, the present disclosure provides recombinant retrons having the general structure of: a) an msr locus; b) an msd locus encoding the msd RNA portion of the msDNA; c) a sequence encoding a retron reverse transcriptase (RT) (optionally in trans to the ncRNA), wherein the msd RNA is capable of being reverse transcribed (e.g., in a host cell such as a mammalian cell) to form an msDNA by the retron reverse transcriptase (RT); and / or d) a polymerase template nucleic acid capable of being transcribed. In some embodiments, the retrons have a general structure comprising from 5’ to 3’ direction: a1 region, first branching guanosine, msr, msd, and a2 region.

[0214] The engineered retrons of the present disclosure are optionally structurally further modified to include one or more heterologous nucleic acids. The engineered retron may be further modified to provide various functional improvements, such as (without limitation), to enhance the production of msDNA in a cell (e.g., a mammalian cell, including a human cell).

[0215] In certain embodiments, the engineered retron of the present disclosure encodes a reverse transcriptase (RT) or a functional domain thereof, comprising: i) a polypeptide listed in aforementioned Table A, or ii) a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polypeptide listed in aforementioned Table A.

[0216] In certain embodiments, the engineered retron of the present disclosure encodes a reverse transcriptase (RT) or a functional domain thereof, comprising: i) a polynucleotideRNG043-WO1 PCT Application listed in aforementioned Table A, or a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polynucleotide of Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 and / or ii) a consensus polynucleotide sequence listed in aforementioned Table A.

[0217] In certain embodiments, the templated ncRNA is derived from a ncRNA comprising: (I) an ncRNA listed in aforementioned Table B, or (II) an ncRNA having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to an ncRNA of aforementioned Table B.

[0218] Engineered ncRNAs of the present disclosure can diverge in size from ncRNAs on which they are based and the proportion of the the ncRNA retained in the engineered ncRNA can vary. In certain embodiments the retained amount of the ncRNA is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or from 50% to 80%, or from 60% to 85%, of from 70% to 90%, or from 80% to 95%, or from 85% to 98%, or from 90% to 99%, or all of the ncRNA.

[0219] In certain embodiments, the engineered retron of the present disclosure encodes an ncRNA and a reverse transcriptase (RT) or a functional domain thereof, wherein the ncRNA and the RT or functional domain thereof are as described above.

[0220] In some examples, the engineered retrons are engineered based on clades defined on retron / retron RTs, in which the retrons are associated with a tripartite system composed of the ncRNA, the RT and an additional protein or RT-fused domain with diverse enzymatic functions, such as, for example, as described in “Mestre et al., Systematic Prediction of Genes Functionally Associated with Bacterial Retrons and Classification of The Encoded Tripartite Systems, Nucleic Acids Research, Volume 48, Issue 22, 16 December 2020, Pages 12632-12647” (incorporated herein by reference). While the clades are based primarily upon naturally occurring ncRNA and retron / retron RT, and an additional protein or RT-fused domain, the clades, for the purpose of serving as the templates for the subject engineeredRNG043-WO1 PCT Application retrons, are not limited to naturally occurring sequences. Rather, the clades can also encompass non-naturally occurring ncRNA and RT, including, without limitation, recombinant, modified or altered, chimeric, hybrid, synthetic, artificial, etc.

[0221] Thus, according to the instant disclosure, retrons may be considered phylogenetically related based on a Neighbor-Joining algorithm of at least 75% (of at least 1000 replicates) and a Poisson correction distance measurement of no more than 0.05, based on alignment of the retron RT. Alternatively or in addition, retrons may be considered phylogenetically related when / if the same RT, or closely related RT, can recognize the secondary structures of the ncRNA of the retrons and reserve transcribe the retrons to produce msDNA.

[0222] In certain embodiments, sequence alignments between different retron sequences (e.g., ncRNA and / or RT (protein and / or nucleic acid) sequences) or secondary structure generations are based on software known to one of ordinary skill in the art.

[0223] The retron ncRNA sequences including msr and msd sequences within the same clade may be highly conserved at certain positions, while being less conserved at other positions.

[0224] Unless specifically indicated otherwise, the a1 and a2 regions are both single- stranded and substantially reverse complementary to each other, forming a stem with optional interruption by a symmetric or asymmetric bulge, with optional one or more 5ʹ and / or 3ʹ overhang / unpaired nucleotide(s), wherein the a1 region generally ends before (e.g., ends immediately 5ʹ to) the conserved branching guanosine (G) providing the 2’-OH for reverse transcription priming.

[0225] In some embodiments, the sequence change comprises a mutated, reduced, or eliminated bulge in the a1 / a2 stem region, including sequence change(s) in one (i.e., a1 or a2) strand, or both a1 and a2 strands.

[0226] For example, in some embodiments, the sequence change comprises deleting nucleotides from a1, a2, or both a1 and a2, such that the size of the bulge is reduced, or a symmetrical bulge becomes asymmetrical or vice versa, or a bulge is eliminated.

[0227] In some embodiments, the sequence change comprises replacing / substituting nucleotides in a1, a2, or both a1 and a2, such that previously unpaired bases in the bulge become base-paired.

[0228] In some embodiments, the sequence change comprises replacing an unpaired purine base with one or more unpaired pyrimidine base(s).RNG043-WO1 PCT Application

[0229] In some embodiments, the sequence change comprises replacing an unpaired pyrimidine base with one or more unpaired purine base(s).

[0230] In some embodiments, the sequence change comprises replacing one unpaired purine base (e.g., A or G) with another unpaired purine base (e.g., G or A, respectively).

[0231] In some embodiments, the sequence change comprises replacing one unpaired pyrimidine base (e.g., T / U or C) with another unpaired pyrimidine base (e.g., C or T / U, respectively).

[0232] In some embodiments, the sequence change comprises an extension or shortening of a1, a2, or both a1 and a2.

[0233] For example, the length of a1 can be shortened by deleting 5ʹ overhang, deleting any upstream bulge nucleotides, deleting bases involved in base-pairing. Likewise, the length of a1 can be extended by adding 5ʹ overhang, adding any upstream bulge nucleotides, adding bases involved in base-pairing.

[0234] In some embodiments, the length of a2 can be shortened by deleting 5ʹ overhang, deleting any downstream bulge nucleotides, deleting bases involved in base-pairing. Likewise, the length of a2 can be extended by adding 5ʹ overhang, adding any downstream bulge nucleotides, adding bases involved in base-pairing. Retron and ncRNA variants

[0235] The ncRNA variants provided herein comprise one or more modifications compared to a reference retron ncRNA. The one or more modifications can comprise (i) linkage of the a1 region and the a2 region, (ii) deletion of at least a portion of the msr; (iii) deletion of at least a portion of the msd, (iv) addition of a single-stranded RNA comprising a polymerase template, and / or (v) addition of an RNA motif.

[0236] In some embodiments, the ncRNAs disclosed herein may be modified by introducing additional RNA motifs into the ncRNAs, e.g., at the 5ʹ and 3ʹ termini of the ncRNAs, or even at positions therein between (e.g., in the msr or msd regions) to improve transcriptional production and / or stability and / or function (e.g., RT-DNA production). Such structures may include, but are not limited to RNA hairpins, RNA step-loops, RNA quadruplexes, cap structures, and poly(A) tails, or ribozyme functions and the like. Also, ncRNAs could also be modified to include one or more nuclear localization sequences.

[0237] Additional RNA motifs could also improve RT processivity of the ncRNA or enhance ncRNA activity by enhancing RT binding. Addition of dimerization motifs - such as kissing loops or a GNRA tetraloop / tetraloop receptor pair - at the 5ʹ and 3ʹ termini of the ncRNA could also result in effective circularization of the ncRNA, improving stability.RNG043-WO1 PCT Application Additionally, it is envisioned that addition of these motifs could enable the physical separation of ncRNA components, e.g., separation of the msr and msd regions. Short 5ʹ extensions or 3’ extensions to the ncRNA that form a small toehold hairpin at either or both ends of the ncRNA could also compete favorably against the annealing of intracomplementary regions along the length of the ncRNA. Finally, kissing loops could also be used to recruit other RNAs or proteins to the genomic site and enable swapping of RT activity from one RNA to the other.

[0238] ncRNAs could be further improved via directed evolution, in an analogous fashion to how protein function can be improved. Directed evolution could enhance ncRNA recognition by RT and / or reduce off-site targeting and / or indels and / or improve precise editing efficiency.

[0239] The present disclosure contemplates any such ways to further improve the stability and / or functionality of the ncRNAs disclosed here.

[0240] In some embodiments, the RNAs (including the guide RNAs and the ncRNAs) used in the compositions of the disclosure have undergone a chemical or biological modification to render them more stable. Exemplary modifications to an RNA include the depletion of a base (e.g., by deletion or by the substitution of one nucleotide for another) or modification of a base, for example, the chemical modification of a base. The phrase "chemical modifications" as used herein, includes modifications which introduce chemistries which differ from those seen in naturally occurring RNA, for example, covalent modifications such as the introduction of modified nucleotides, (e.g., nucleotide analogs, or the inclusion of pendant groups which are not naturally found in such mRNA molecules).

[0241] Other suitable polynucleotide modifications that may be incorporated into the RNAs used in the compositions of the disclosure include, but are not limited to, 4'- thio- modified bases: 4'-thio-adenosine, 4'-thio-guanosine, 4'-thio-cytidine, 4'-thio-uridine, 4'- thio- 5-methyl-cytidine, 4'-thio-pseudouridine, and 4'-thio-2-thiouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2- thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1- carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl- pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1- methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-RNG043-WO1 PCT Application cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2- thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio- 1- methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl- pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7- deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6- thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine, and combinations thereof. The term modification also includes, for example, the incorporation of non-nucleotide linkages or modified nucleotides into the mRNA sequences of the present disclosure (e.g., modifications to one or both of the 3' and 5' ends of an mRNA molecule encoding a functional protein or enzyme). Such modifications include the addition of bases to an mRNA sequence (e.g., the inclusion of a poly A tail or a longer poly A tail), the alteration of the 3' UTR or the 5' UTR, complexing the mRNA with an agent (e.g., a protein or a complementary nucleic acid molecule), and inclusion of elements which change the structure of an RNA molecule (e.g., which form secondary structures).

[0242] In some embodiments, RNAs (e.g., ncRNAs) include a 5' cap structure. A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5'5'5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G. Naturally occurring cap structures comprise a 7- methyl guanosine that is linked via a triphosphate bridge to the 5'-end of the first transcribedRNG043-WO1 PCT Application nucleotide, resulting in a dinucleotide cap of m7G(5')ppp(5')N, where N is any nucleoside. In vivo, the cap is added enzymatically; the cap is added in the nucleus and is catalyzed by the enzyme guanylyl transferase. The addition of the cap to the 5' terminal end of RNA occurs immediately after initiation of transcription. The terminal nucleoside is typically a guanosine, and is in the reverse orientation to all the other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0243] Additional cap analogs include, but are not limited to, a chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analog (e.g., m2,7GpppG), trimethylated cap analog (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or anti reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m72'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives), for example, as described in Jemielity, J. et al., "Novel 'anti-reverse' cap analogs with superior translational properties", RNA, 9: 1108- 1122 (2003).

[0244] Typically, the presence of a "tail" serves to protect the RNA (e.g., ncRNA) from exonuclease degradation. A poly A or poly U tail is thought to stabilize natural messengers and synthetic sense RNA. Therefore, in certain embodiments a long poly A or poly U tail can be added to an RNA molecule thus rendering the RNA more stable. Poly A or poly U tails can be added using a variety of art-recognized techniques. For example, long poly A tails can be added to synthetic or in vitro transcribed RNA using poly A polymerase as described in Yokoe, et al. Nature Biotechnology.1996; 14: 1252-1256. A transcription vector can also encode long poly A tails. In addition, poly A tails can be added by transcription directly from PCR products. In some examples, poly A may also be ligated to the 3' end of a sense RNA with RNA ligase, such as, for example, as described in Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0245] Typically, the length of a poly A or poly U tail can be at least about 10, 50, 100, 200, 300, 400 at least 500 nucleotides. In some embodiments, a poly-A tail on the 3' terminus of mRNA typically includes about 10 to 300 adenosine nucleotides (e.g., about 10 to 200 adenosine nucleotides, about 10 to 150 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 20 to 70 adenosine nucleotides, or about 20 to 60 adenosine nucleotides). In some embodiments, mRNAs include a 3' poly(C) tail structure. A suitable poly-C tail on the 3' terminus of mRNA typically include about 10 to 200 cytosine nucleotides (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). TheRNG043-WO1 PCT Application poly-C tail may be added to the poly-A or poly U tail or may substitute the poly-A or poly U tail.

[0246] RNAs according to the present disclosure (e.g., ncRNAs) may be synthesized according to any of a variety of known methods. For example, RNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary according to the specific application. An improved method of IVT of a ncRNA is disclosed in Example 5 herein.

[0247] In a particular embodiment (as exemplified in Example 6 herein), the ncRNAs can comprise an MS2 modification, a specific RNA hairpin structure recognized in nature by a certain MS2-binding protein. This domain can help to stabilize the ncRNA and improve the editing efficiency. The disclosure contemplates other similar modifications. In some examples, other such MS2-like domains can include, for example, the ones descirbed in Johansson et al.,“RNA recognition by the MS2 phage coat protein,” Sem Virol., 1997, Vol.8(3): 176-185; Delebecque et al.,“Organization of intracellular reactions with rationally designed RNA assemblies,” Science, 2011, Vol.333: 470-474; Mali et al.,“Cas9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol., 2013, Vol.31: 833- 838; and Zalatan et al.,“Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds,” Cell, 2015, Vol.160: 339-350, each of which are incorporated herein by reference in their entireties. In some examples, other systems include the PP7 hairpin, which specifically recruits the PCP protein, and the “com” hairpin, which specifically recruits the Com protein, for example, as described in Zalatan et al. The nucleotide sequence of the MS2 hairpin (or equivalently referred to as the“MS2 aptamer”) is: GCCAACATGAGGATCACCCATGTCTGCAGGGCC (SEQ ID NO:19935). Polymerase

[0248] In various embodiments, the chimeric gene editing composition includes one or more polymerases, which can be an retron RT. The retron RT in such embodiments would handle converting a template ncRNA to a cognate templated msDNA, as well as being the RNA-dependent DNA polymerase functioning on the target DNA at the nick site (see Figures for details mechanism of action).RNG043-WO1 PCT Application

[0249] The retron RTs that may be used with the gene editing system described herein may be any retron RT described in the art, including any of those described in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 (each are incorporated herein by reference in their entireties, including their Sequence Listings), or a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity with a sequence from Table A of any of the aforementioned applications.

[0250] Reverse transcriptases (RTs, also known as RNA-directed DNA polymerases) are enzymes present in all three domains of life, which are DNA polymerase using RNA as a template. Reverse transcriptases of the present disclosure are used to reverse transcribe template msd RNA into single-stranded msDNA.

[0251] The reverse transcriptase or a functional domain thereof that may be used in the instant disclosure includes prokaryotic and eukaryotic RT, provided that the RT functions within the host to generate a donor polynucleotide sequence from the RNA template (e.g., an RNA template from the retron transcript ncRNA).

[0252] In certain embodiments, suitable RT sequences (including amino acid sequences and the encoding polynucleotide sequences) are provided in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0253] In certain embodiments, the nucleotide sequence of a native or wild-type RT is modified, for example, using known codon optimization techniques, so that expression within the desired host is optimized.

[0254] In certain embodiments, the RT domain of a reverse transcriptase is used in the present disclosure, so long as it is compatible with the engineered retron of the present disclosure. The domain may include only the RNA-dependent DNA polymerase activity. In certain embodiments, the RT domain is non-mutagenic, i.e., does not cause mutation in the donor polynucleotide (e.g., during the reverse transcriptase process). In certain embodiments, the RT domain may be non-retron RT in origin, e.g., a viral RT or a human endogenous RTs. In certain embodiments, the RT domain is retron RT or diversity-generating retroelements (DGRs) RT. In certain embodiments, the RT may be less mutagenic than a counterpart wildtype RT. In certain embodiments, the RT is not mutagenic.

[0255] In some embodiments, a reverse transcriptase is encoded by a retron ret gene, which may accompany the cognate msr and msd loci and specifically recognize the secondary structure of the cognate ncRNA transcript.RNG043-WO1 PCT Application

[0256] In some embodiments, the RT may be obtained from prokaryotic or eukaryotic cells. Most reverse transcriptases (80%) can be phylogenetically clustered into three major lineages: group II introns, diversity-generating retroelements (DGRs), and retrons. Other clades of RTs include abortive infection (Abi) RTs, CRISPR-Cas-associated RTs, Group II- like (G2L), the unknown groups (UG), and rvt elements.

[0257] In some embodiments, the RT gene is a cognate RT, a retron RT from a species within the same species or clade of the cognate RT, or a retron RT not within the same clade of the cognate RT such as an unrelated RT or an engineered RT. In some examples, the non- retron related RT are RTs from group II introns, diversity-generating retroelements (DGRs), abortive infection (Abi) RTs, CRISPR-Cas-associated RTs, Group II-like (G2L), the unknown groups (UG), and rvt elements, for example, as described in Mestre et al., Nucleic Acids Research, Volume 48, Issue 22, 16 December 2020, Pages 12632-12647; and Mestere et al., UG / Abi: “A Highly Diverse Family of Prokaryotic Reverse Transcriptases Associated With Defense Functions,” doi.org / 10.1101 / 2021.12.02.470933 (incorporated herein by reference).

[0258] In some embodiments, the RT are from clades related to retron / retron-like sequences. In some embodiments, the RT are selected from RTs provided in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872. In some embodiments, the RT is not an RT associated with the sequences identified in Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0259] In prokaryotic retron systems, the RT gene is typically located downstream from the ncRNA (msr and msd) locus. In the engineered retron, the RT position can differ from the natural or wild type retrons. In some embodiments, the RT gene can be provided in cis, such as either upstream or downstream of the msr locus or the msd locus. In certain embodiments, the RT gene is provided in trans, such as provided separately in a vector of the vector system described herein, wherein the ncRNA coding msr and msd sequences are provided in a different vector of the vector system described herein.

[0260] In some embodiments, the RT is modified (e.g., insertion, deletion, and / or substitution of one or more nucleotide(s)) or codon optimized to enhance activity or processivity.

[0261] In certain embodiments, a cryptic stop signal is removed from the RT thereby allowing generation of longer ssDNAs.RNG043-WO1 PCT Application

[0262] In certain embodiments, the RT is from a retron which encodes msDNA, such as, for example, RTs described in US 6,017,737; US5,849,563; US5,780,269; US5,436,141; US5,405,775; US5,320,958; CA2,075,515; all of which are incorporated by reference herein in their entireties.

[0263] In some embodiments, the engineered retron further comprises a polynucleotide (e.g., a DNA molecule) encoding a reverse transcriptase (RT) or a portion thereof. In some embodiments, the encoded RT or portion thereof is capable of synthesizing a DNA copy of at least a portion of the msd locus encoding the msDNA.

[0264] In some embodiments, the polynucleotide (e.g., a DNA molecule) encoding the RT comprises a polynucleotide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polynucleotide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0265] In some embodiments, the polynucleotide encoding the RT encodes a polypeptide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872, or a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polypeptide listed in Table A of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872; and / or a polypeptide of Table C of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.

[0266] In some embodiments, the polynucleotide encoding the RT does not comprise a polynucleotide listed in Table X of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872.RNG043-WO1 PCT Application

[0267] Once translated, the RT binds the ncRNA template downstream from the msd locus, forming an RT-RNA complex, and initiating reverse transcription of the RNA towards its 5ʹ end. Accordingly, in certain aspects the disclosure relates to an engineered nucleic acid- enzyme construct comprising: a. a non-coding RNA (ncRNA) comprising: i) an msr locus encoding the msr RNA portion of a multi-copy single-stranded DNA (msDNA); and ii) an msd locus encoding the msd RNA portion of the msDNA; b. a heterologous nucleic acid inserted at or within a location selected from: the msd locus, upstream of the msr locus, upstream of the msd locus, and downstream of the msd locus; and c. a reverse transcriptase (RT), or a domain thereof comprising: i) a polypeptide listed in the abovementioned Table A, or a polypeptide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to a polypeptide listed in the abovementioned Table A; and / or ii) a polypeptide listed in the abovementioned Table C. In some embodiments, the RT does not comprise a polypeptide listed in the abovementioned Table X.

[0268] In certain aspects, the disclosure relates to an engineered nucleic acid-enzyme construct comprising: a) a non-coding RNA (ncRNA) comprising: i) an msr locus encoding the msr RNA portion of a multi-copy single-stranded DNA (msDNA); and ii) an msd locus encoding the msd RNA portion of the msDNA, b) a heterologous nucleic acid inserted at or within a location selected from: the msd locus; upstream of the msr locus; upstream of the msd locus; and downstream of the msd locus; and c) a reverse transcriptase (RT), or a portion thereof, wherein the RT is capable of synthesizing a DNA copy of at least a portion of the msd locus encoding the msDNA, and wherein the ncRNA and / or the RT is any one of the present disclosure described herein.

[0269] In certain aspects, the disclosure relates to an engineered nucleic acid-enzyme construct comprising: a) a non-coding RNA (ncRNA) comprising: i) an msr locus encoding the msr RNA portion of a multi-copy single-stranded DNA (msDNA); and ii) an msd locus encoding the msd RNA portion of the msDNA; b) a heterologous nucleic acid inserted at or within a location selected from: the msd locus, upstream of the msr locus, upstream of the msd locus, and downstream of the msd locus; and c) a reverse transcriptase (RT) or a domain thereof: wherein the RT comprises: i) an RT listed in the abovementioned Table A, or an RT having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at leastRNG043-WO1 PCT Application 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to an RT listed in the abovementioned Table A; and / or ii) a consensus sequence listed in the abovementioned Table C; and wherein, the RT does not comprise a sequence from the abovementioned Table X.

[0270] In some embodiments of the nucleic-acid enzyme constructs described herein, the ncRNA comprises: i) an ncRNA listed in the abovementioned Table B, or ii) an ncRNA having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to an ncRNA listed in the abovementioned Table B; and / or optionally wherein the ncRNA is not an ncRNA from the retons of the abovementioned Table X.

[0271] In some embodiments, the RT is linked to components such as RNA-guided and non-RNA guided nucleases. The linked maybe via a peptide bond or a short linker peptide in a fusion protein. Suitable linker peptides include flexible linkers such as those comprising G or S repeats, such as G4S (SEQ ID NO: 19511) repeat units or GS repeat units, with 1-20 repeats (SEQ ID NO: 19936), e.g., 1, 2, 3, 4, 5, 6, 7, or 8 repeats.

[0272] In certain embodiments, the RT is chemically linked or conjugated to the RNA- guided and non-RNA guided nucleases via non-peptide bonds. Such protein conjugates may be delivered directly to a host cell, either together with the nucleic acid component of the engineered retron described herein, or separately.

[0273] In some embodiments, the RT is linked to a DNA-repair modulating biomolecule (e.g., NHEJ peptide inhibitors). Nuclease

[0274] The chimeric gene editing composition disclosed herein comprises a nuclease. In some embodiments, the nuclease is a double-stranded endonuclease or a nickase.

[0275] In certain embodiments, the chimeric gene editing system comprises (a) a nickase component, (b) a guide RNA that complexes with the nickase component and directs it to a target DNA sequence, (c) a polymerase component, and / or (d) and a polymerase template sequence, wherein the polymerase template sequence is provided by a modified retron ncRNA comprising the polymerase template sequence (herein referred to as a “templated ncRNA” orRNG043-WO1 PCT Application “tncRNA”). In various embodiments, the tncRNA comprises an altered structural configuration relative to a wildtype retron ncRNA wherein the alterations include (i) a linker joining the 5’ end of the ncRNA a1 region to the 3’ end of the ncRNA a2 region, (ii) a deletion of the wildtype msd region or portion thereof, and / or (iii) installation of a single-strand RNA sequence comprising the polymerase template in place of the deleted msd sequence. The chimeric gene editing system may also optionally comprise a retron RT to convert the templated ncRNA to a cognate msDNA, which is referred to herein as the “templated msDNA” or “tmsDNA”.

[0276] The nickase component of the chimeric editing system described herein may be any programmable CRISPR nickase, including nickases based on CRISPR system Class 1, Type I, II, or III Cas nucleases; Class 2, Type II nuclease (such as Cas9); a Class 2, Type V nuclease (such as Cpfl), or a Class 2, Type VI nuclease (such as C2c2). Examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966, and homologs or modified versions thereof.

[0277] In some embodiments, a Class 1, type II CRISPR system Cas9 endonuclease is used. Cas9 nucleases from any species, or biologically active fragments, variants, analogs, or derivatives thereof that retain Cas9 endonuclease activity (i.e., catalyze site-directed cleavage of DNA to generate double-strand breaks) may be used to perform genome modification as described herein. The Cas9 need not be physically derived from an organism but may be synthetically or recombinantly produced. In some examples, Cas9 sequences from a number of bacterial species are well known in the art and listed in the National Center for Biotechnology Information (NCBI) database, for example, NCBI entries for Cas9 from: Streptococcus pyogenes (WP 002989955, WP_038434062, WP_011528583); Campylobacter jejuni (WP_022552435, YP 002344900), Campylobacter coli (WP 060786116); Campylobacter fetus (WP 059434633); Corynebacterium ulcerans (NC_015683, NC_017317); Corynebacterium diphtheria (NC_016782, NC_016786); Enterococcus faecalis (WP 033919308); Spiroplasma syrphidicola (NC 021284); Prevotella intermedia (NC 017861); Spiroplasma taiwanense (NC 021846); Streptococcus iniae (NC 021314); Belliella baltica (NC 018010); Psychroflexus torquisl (NC O 18721); Streptococcus thermophilus (YP 820832), Streptococcus mutans (WP 061046374, WP 024786433); Listeria innocua (NP 472073); Listeria monocytogenes (WPRNG043-WO1 PCT Application 061665472); Legionella pneumophila (WP 062726656); Staphylococcus aureus (WP_001573634); Francisella tularensis (WP_032729892, WP_014548420), Enterococcus faecalis (WP 033919308); Lactobacillus rhamnosus (WP 048482595, WP_032965177); and Neisseria meningitidis (WP_061704949, YP_002342100); all of which sequences (as entered by the date of filing of this application) are herein incorporated by reference in their entireties. Any of these sequences or a variant thereof comprising a sequence having at least about 70- 100% sequence identity thereto, including any percent identity within this range, such as 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, can be used for genome editing, as described herein and in some examples, as described in Fonfara et al. (2014) Nucleic Acids Res. 42(4):2577-90; Kapitonov et al. (2015) J. Bacterid.198(5): 797-807, Shmakov et al. (2015) Mol. Cell.60(3):385- 397, and Chylinski et al. (2014) Nucleic Acids Res.42(10):6091-6105).

[0278] In another embodiment, the CRISPR nuclease from Prevotella and Francisella 1 (Cpfl, or Cas12a) is used. Cpfl is another class II CRISPR / Cas system RNA-guided nuclease with similarities to Cas9 and may be used analogously. Unlike Cas9, Cpfl does not require a tracrRNA and only depends on a crRNA in its guide RNA, which provides the advantage that shorter guide RNAs can be used with Cpfl for targeting than Cas9. Cpfl is capable of cleaving either DNA or RNA. The PAM sites recognized by Cpfl have the sequences 5ʹ-YTN-3ʹ (where “Y” is a pyrimidine and “N” is any nucleobase) or 5ʹ-TTN-3ʹ, in contrast to the G-rich PAM site recognized by Cas9. Cpfl cleavage of DNA produces double-stranded breaks with a sticky-ends having a 4 or 5 nucleotide overhang. In some examples, additional information on examples of Cpfl is disclosed in Ledford et al. (2015) Nature.526 (7571):17-17, Zetsche et al. (2015) Cell.163 (3):759-771, Murovec et al. (2017) Plant Biotechnol. J.15(8):917-926, Zhang et al. (2017) Front. Plant Sci.8:177, Fernandes et al. (2016) Postepy Biochem.62(3):315-326; herein incorporated by reference.

[0279] C2c1 (Cas12b) is another class II CRISPR / Cas system RNA-guided nuclease that may be used. C2cl, similarly to Cas9, depends on both a crRNA and tracrRNA for guidance to target sites, such as, for example, those disclosed in Shmakov et al. (2015) Mol Cell.60(3):385-397, Zhang et al. (2017) Front Plant Sci.8:177; herein incorporated by reference.

[0280] In one aspect, a nucleic acid sequence-programmable DNA binding domain can be associated with or complexed with at least one guide nucleic acid (e.g., guide RNA or a pegRNA), which localizes the DNA binding domain to a DNA sequence that comprises a DNA strand (i.e., a target strand) that is complementary to the guide nucleic acid, or a portionRNG043-WO1 PCT Application thereof (e.g., the spacer of a guide RNA which anneals to the protospacer of the DNA target). In other words, the guide nucleic-acid “programs” the DNA binding domain (e.g., Cas9 or equivalent) to localize and bind to complementary sequence of the protospacer in the DNA.

[0281] Any suitable nucleic acid sequence-programmable DNA binding domain may be used in the prime editors described herein. In various embodiments, the nucleic acid sequence-programmable DNA binding domain may be any Class 2 CRISPR-Cas system, including any type II, type V, or type VI CRISPR-Cas enzyme. Given the rapid development of CRISPR-Cas as a tool for genome editing, there have been constant developments in the nomenclature used to describe and / or identify CRISPR-Cas enzymes, such as Cas9 and Cas9 orthologs. In some examples, CRISPR-Cas nomenclature is discussed in Makarova et al., “Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?,” The CRISPR Journal, Vol.1. No.5, 2018, the entire contents of which are incorporated herein by reference.

[0282] Without being bound by theory, the mechanism of action of certain CRISPR Cas enzymes contemplated herein includes the step of forming an R-loop whereby the Cas protein induces the unwinding of a double-strand DNA target, thereby separating the strands in the region bound by the Cas protein. The guide RNA spacer then hybridizes to the “target strand” at a region that is complementary to the protospacer sequence of the DNA. In some embodiments, the Cas protein may include one or more nuclease activities, which then cut the DNA leaving various types of lesions. For example, the Cas protein may comprises a nuclease activity that cuts the non-target strand at a first location, and / or cuts the target strand at a second location. Depending on the nuclease activity, the target DNA can be cut to form a “double-stranded break” whereby both strands are cut. In other embodiments, the target DNA can be cut at only a single site, i.e., the DNA is “nicked” on one strand. Exemplary Cas proteins with different nuclease activities include “Cas9 nickase” (“nCas9”) and a deactivated Cas9 having no nuclease activities (“dead Cas9” or “dCas9”).

[0283] The below description of various Cas proteins which can be used in connection with the presently disclosed LNP-delivered gene editing systems is not meant to be limiting in any way. The gene editing systems may comprise the canonical SpCas9, or any ortholog Cas9 protein, or any variant Cas9 protein—including any naturally occurring variant, mutant, or otherwise engineered version of Cas9—that is known or which can be made or evolved through a directed evolutionary or otherwise mutagenic process. In various embodiments, the Cas9 or Cas9 variants have a nickase activity, i.e., only cleave one strand of the target DNA sequence. In other embodiments, the Cas9 or Cas9 variants have inactive nucleases, i.e., are “dead” Cas9 proteins. Other variant Cas9 proteins that may be used are those having a smallerRNG043-WO1 PCT Application molecular weight than the canonical SpCas9 (e.g., for easier delivery) or having modified or rearranged primary amino acid structure.

[0284] The gene editing systems described herein may also comprise Cas9 equivalents, including Cas12a (Cpf1) and Cas12b1 proteins. The Cas proteins usable herein (e.g., SpCas9, Cas9 variant, or Cas9 equivalents) may also contain various modifications that alter / enhance their PAM specificities. The present disclosure contemplates any Cas9, Cas9 variant, or Cas9 equivalent which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% sequence identity to a reference Cas9 sequence, such as a reference SpCas9 canonical sequence of Streptococcus pyogenes M1 (Accession No. Q99ZW2) (SEQ ID NO: 2027): MDKKYSIGLD IGTNSVGWAV ITDEYKVPSK KFKVLGNTDR HSIKKNLIGA LLFDSGETAE ATRLKRTARR RYTRRKNRIC YLQEIFSNEM AKVDDSFFHR LEESFLVEED KKHERHPIFG NIVDEVAYHE KYPTIYHLRK KLVDSTDKAD LRLIYLALAH MIKFRGHFLI EGDLNPDNSD VDKLFIQLVQ TYNQLFEENP INASGVDAKA ILSARLSKSR RLENLIAQLP GEKKNGLFGN LIALSLGLTP NFKSNFDLAE DAKLQLSKDT YDDDLDNLLA QIGDQYADLF LAAKNLSDAI LLSDILRVNT EITKAPLSAS MIKRYDEHHQ DLTLLKALVR QQLPEKYKEI FFDQSKNGYA GYIDGGASQE EFYKFIKPIL EKMDGTEELL VKLNREDLLR KQRTFDNGSI PHQIHLGELH AILRRQEDFY PFLKDNREKI EKILTFRIPY YVGPLARGNS RFAWMTRKSE ETITPWNFEE VVDKGASAQS FIERMTNFDK NLPNEKVLPK HSLLYEYFTV YNELTKVKYV TEGMRKPAFL SGEQKKAIVD LLFKTNRKVT VKQLKEDYFK KIECFDSVEI SGVEDRFNAS LGTYHDLLKI IKDKDFLDNE ENEDILEDIV LTLTLFEDRE MIEERLKTYA HLFDDKVMKQ LKRRRYTGWG RLSRKLINGI RDKQSGKTIL DFLKSDGFAN RNFMQLIHDD SLTFKEDIQK AQVSGQGDSL HEHIANLAGS PAIKKGILQT VKVVDELVKV MGRHKPENIV IEMARENQTT QKGQKNSRER MKRIEEGIKE LGSQILKEHP VENTQLQNEK LYLYYLQNGR DMYVDQELDI NRLSDYDVDH IVPQSFLKDD SIDNKVLTRS DKNRGKSDNV PSEEVVKKMK NYWRQLLNAK LITQRKFDNL TKAERGGLSE LDKAGFIKRQ LVETRQITKH VAQILDSRMN TKYDENDKLI REVKVITLKS KLVSDFRKDF QFYKVREINN YHHAHDAYLN AVVGTALIKK YPKLESEFVY GDYKVYDVRK MIAKSEQEIG KATAKYFFYS NIMNFFKTEI TLANGEIRKR PLIETNGETG EIVWDKGRDF ATVRKVLSMP QVNIVKKTEVRNG043-WO1 PCT Application QTGGFSKESI LPKRNSDKLI ARKKDWDPKK YGGFDSPTVA YSVLVVAKVE KGKSKKLKSV KELLGITIME RSSFEKNPID FLEAKGYKEV KKDLIIKLPK YSLFELENGR KRMLASAGEL QKGNELALPS KYVNFLYLAS HYEKLKGSPE DNEQKQLFVE QHKHYLDEII EQISEFSKRV ILADANLDKV LSAYNKHRDK PIREQAENII HLFTLTNLGA PAAFKYFDTT IDRKRYTSTK EVLDATLIHQ SITGLYETRI DLSQLGGD

[0285] The Cas proteins contemplated herein embrace CRISPR Cas 9 proteins, as well as Cas9 equivalents, variants (e.g., Cas9 nickase (nCas9) or nuclease inactive Cas9 (dCas9)) homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or recombinant), and may include a Cas9 equivalent from any Class 2 CRISPR system (e.g., type II, V, VI), including Cas12a (Cpf1), Cas12e (CasX), Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), C2c4, C2c8, C2c5, C2c10, C2c9 Cas13a (C2c2), Cas13d, Cas13c (C2c7), Cas13b (C2c6), and Cas13b. In some examples, further Cas-equivalents are described in Makarova et al., “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector,” Science 2016; 353(6299) and Makarova et al., “Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?,” The CRISPR Journal, Vol.1. No.5, 2018, the contents of which are incorporated herein by reference.

[0286] The terms “Cas9” or “Cas9 nuclease” or “Cas9 moiety” or “Cas9 domain” embrace any naturally occurring Cas9 from any organism, any naturally-occurring Cas9 equivalent or functional fragment thereof, any Cas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a Cas9, naturally-occurring or engineered. The term Cas9 is not meant to be particularly limiting and may be referred to as a “Cas9 or equivalent.” Exemplary Cas9 proteins are further described in the art and are incorporated herein by reference. As noted herein, Cas9 nuclease sequences and structures are well known to those of skill in the art. In some examples, the Cas9 nuclease sequences and structures can be those described in “Complete genome sequence of an M1 strain of Streptococcus pyogenes.” Ferretti et al., J.J., McShan W.M., Ajdic D.J., Savic D.J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A.N., Kenton S., Lai H.S., Lin S.P., Qian Y., Jia H.G., Najar F.Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S.W., Roe B.A., McLaughlin R.E., Proc. Natl. Acad. Sci. U.S.A.98:4658-4663(2001); “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C.M., Gonzales K., Chao Y., Pirzada Z.A., Eckert M.R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K.,RNG043-WO1 PCT Application Fonfara I., Hauer M., Doudna J.A., Charpentier E.Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference).

[0287] In certain embodiments, a polynucleotide programmable nucleotide binding domain of a nucleobase editor itself comprises one or more domains. In one embodiment, a polynucleotide programmable nucleotide binding domain comprises one or more nuclease domains. In some embodiments, the nuclease domain of a polynucleotide programmable nucleotide binding domain comprises an endonuclease or an exonuclease. In some embodiments, the endonuclease cleaves a single strand of a double-stranded nucleobase. In some embodiments, the endonuclease cleaves both strands of a double-stranded nucleobase molecule. In some embodiments, the polynucleotide programmable nucleotide binding domain is a deoxyribonuclease. In some embodiments, the polynucleotide programmable nucleotide binding domain is a ribonuclease.

[0288] In some embodiments, the nuclease domain of a polynucleotide programmable nucleotide binding domain can cut zero, one, or two strands of a target polynucleotide. In some embodiments, the polynucleotide programmable nucleotide binding domain comprises a nickase domain. Herein the term “nickase” refers to a polynucleotide programmable nucleotide binding domain comprising a nuclease domain that is capable of cleaving only one strand of the two strands in a duplexed nucleobase molecule (e.g., DNA). In some embodiments, the nickase is derived from a fully catalytically active (e.g., natural) form of a polynucleotide programmable nucleotide binding domain by introducing one or more mutations into the active polynucleotide programmable nucleotide binding domain. In certain embodiments, where a polynucleotide programmable nucleotide binding domain comprises a nickase domain derived from Cas9.

[0289] In some embodiments, the Cas9-derived nickase has one or more mutations in the RuvC-1 domain. In one embodiment, the Cas9-derived nickase has a D10A mutation in the RuvC-1 domain. In some embodiments, the Cas9-derived nickase has one or more mutations in the REC Lobe domain. In one embodiment, the Cas9-derived nickase has a N497A, R661A, and / or Q695A mutation in the REC Lobe domain. In some embodiment, the Cas9-derived nickase has one or more mutations in the HNH domain. In one embodiment, the Cas9-derived nickase has H840A, N863A, and / or D839A in the HNH domain.

[0290] In certain embodiments, in the SpCas9-derived nickase, the residue H840 retains catalytic activity and can thereby cleave a single strand of the nucleobase duplex. In certain embodiments, a Cas9-derived nickase domain can comprise an H840A mutation, while the amino acid residue at position 10 remains a D. In certain embodiments, a Cas9-derivedRNG043-WO1 PCT Application nickase domain can comprise an N863A mutation, while the amino acid residue at position 10 remains a D. In some embodiments, the nickase is derived from a fully catalytically active (e.g., natural) form of a polynucleotide programmable nucleotide binding domain by removing all or a portion of a nuclease domain that is not required for the nickase activity. In certain embodiments, where a polynucleotide programmable nucleotide binding domain comprises a nickase domain derived from Cas9, the Cas9-derived nickase domain comprises a deletion of all or a portion of the RuvC domain or the HNH domain.

[0291] In certain embodiments, the nucleobase editing system is or comprises a CRISPR-Cas editor or Cas9 disclosed and described in one or more of US Application Publications US2015 / 0045546A1, US2019 / 0264232A1, US2018 / 0258417A1, and PCT Publications WO2013141680A1 and WO2021173359A1, each of which is incorporated by reference herein in their entirety.

[0292] Any of the above CRISPR-Cas editor embodiments or any variants, modifications, or derivatives thereof are contemplated herein to be delivered by the LNP systems disclosed in this specification for gene editing in cells, tissues, and / or organs under in vitro, ex vivo, or in vivo conditions. The various components described herein may be configured and delivered in any suitable manner. Any of the descriptions presented in this section are not intended to be strictly limiting. Prime editors

[0293] The chimeric gene editing systems described herein may include a prime editor or one or more components thereof, in combination with retron editing components.

[0294] Prime editing technology is a gene editing technology that can make targeted insertions, deletions, and all transversion and transition point mutations in a target genome. Without wishing to be bound by any particular theory, the prime editing process may search and replace endogenous sequences in a target polynucleotide. The spacer sequence of a prime editing guide RNA (“PEgRNA” or “pegRNA”) recognizes and anneals with a search target sequence in a target strand of a double stranded target polynucleotide, e.g., a double stranded target DNA. A prime editing complex may generate a nick in the target DNA on the edit strand which is the complementary strand of the target strand. The prime editing complex may then use a free 3’ end formed at the nick site of the edit strand to initiate DNA synthesis, where a “primer binding site sequence” (PBS) of the PEgRNA complexes with the free 3’ end, and a single stranded DNA is synthesized (by reverse transcriptase) using an editing template of the PEgRNA as a template. As used herein, a “primer binding site” is a single-stranded portion of the PEgRNA that comprises a region of complementarity to theRNG043-WO1 PCT Application PAM strand (i.e., the non-target strand or the edit strand). The PBS is complementary or substantially complementary to a sequence on the PAM strand of the double stranded target DNA that is immediately upstream of the nick site.

[0295] The term “prime editor (PE)” refers to the polypeptide or polypeptide components involved in prime editing, or any polynucleotide(s) encoding the polypeptide or polypeptide components. In various embodiments, a prime editor includes a polypeptide domain having DNA binding activity and a polypeptide domain having DNA polymerase activity. In some embodiments, the prime editor further comprises a polypeptide domain having nuclease activity. In some embodiments, the polypeptide domain having DNA binding activity comprises a nuclease domain or nuclease activity. In some embodiments, the polypeptide domain having nuclease activity comprises a nickase, or a fully active nuclease. As used herein, the term “nickase” refers to a nuclease capable of cleaving only one strand of a double-stranded DNA target. In some embodiments, the prime editor comprises a polypeptide domain that is an inactive nuclease. In some embodiments, the polypeptide domain having programmable DNA binding activity comprises a nucleic acid guided DNA binding domain, for example, a CRISPR-Cas protein, for example, a Cas9 nickase, a Cpf1 nickase, or another CRISPR-Cas nuclease. In some embodiments, the polypeptide domain having DNA polymerase activity comprises a template-dependent DNA polymerase, for example, an RNA- dependent DNA polymerase. In some embodiments, the DNA polymerase is a reverse transcriptase. In some embodiments, the prime editor comprises additional polypeptides involved in prime editing, for example, a polypeptide domain having 5’ endonuclease activity, e.g., a 5' endogenous DNA flap endonucleases (e.g., FEN1), for helping to drive the prime editing process towards the edited product formation. In some embodiments, the prime editor further comprises an RNA-protein recruitment polypeptide, for example, a MS2 coat protein.

[0296] A prime editor may be engineered. In some embodiments, the polypeptide components of a prime editor do not naturally occur in the same organism or cellular environment. In some embodiments, the polypeptide components of a prime editor may be of different origins or from different organisms. In some embodiments, a prime editor comprises a DNA binding domain and a DNA polymerase domain that are derived from different species. In some embodiments, a prime editor comprises a Cas polypeptide (DNA binding domain) and a reverse transcriptase polypeptide (DNA polymerase) that are derived from different species. For example, a prime editor may comprise a S. pyogenes Cas9 polypeptide and a Moloney murine leukemia virus (M-MLV) reverse transcriptase polypeptide. In some embodiments, aRNG043-WO1 PCT Application prime editor comprises an engineered pentamutant M-MLV RT. In some embodiments, a primer editor engineered to reduce size and improve efficiency is used.

[0297] In some embodiments, polypeptide domains of a prime editor may be fused or linked by a peptide linker to form a fusion protein. In other embodiments, a prime editor comprises one or more polypeptide domains provided in trans as separate proteins, which are capable of being associated to each other through non-peptide linkages or through aptamers or recruitment sequences. For example, a prime editor may comprise a DNA binding domain and a reverse transcriptase domain associated with each other by an RNA-protein recruitment aptamer, e.g., a MS2 aptamer, which may be linked to a PEgRNA. Prime editor polypeptide components may be encoded by one or more polynucleotides in whole or in part. In some embodiments, a single polynucleotide, construct, or vector encodes the prime editor fusion protein. In some embodiments, multiple polynucleotides, constructs, or vectors each encode a polypeptide domain or portion of a domain of a prime editor, or a portion of a prime editor fusion protein. For example, a prime editor fusion protein may comprise an N-terminal portion fused to an intein-N and a C-terminal portion fused to an intein-C, each of which is individually encoded by an AAV vector.

[0298] The editing template may comprise one or more intended nucleotide edits compared to the endogenous double stranded target DNA sequence. Accordingly, the newly synthesized single stranded DNA also comprises the nucleotide edit(s) encoded by the editing template. Through removal of the editing target sequence on the edit strand of the double stranded target DNA and DNA repair mechanism, the newly synthesized single stranded DNA replaces the editing target sequence, and the desired nucleotide edit(s) are incorporated into the double stranded target DNA.

[0299] In some embodiments, prime editing was first described in Anzalone et al., “Search-and-replace genome editing without double-strand breaks or donor DNA,” Nature, Dec 2019, 576 (7789): pp.149-157, which is incorporated herein in its entirety. In some examples, prime editing has subsequently been described and detailed in numerous follow-on publications, including but not limited to, for example, (i) Liu et al., “Prime editing: a search and replace tool with versatile base changes,” Yi Chuan, Nov.20, 2022, 44(11): 993-1008; (ii) Lu C et al., “Prime Editing: An All-Rounder for Genome Editing. Int J Mol Sci.2022 Aug 30;23(17):9862; (iii) Velimirovic M, Zanetti LC, Shen MW, Fife JD, Lin L, Cha M, Akinci E, Barnum D, Yu T, Sherwood RI. Peptide fusion improves prime editing efficiency. Nat Commun.2022 Jun 18;13(1):3512. doi: 10.1038 / s41467-022-31270-y. PMID: 35717416; PMCID: PMC9206660; (iv) Velimirovic M, Zanetti LC, Shen MW, Fife JD, Lin L, Cha M,RNG043-WO1 PCT Application Akinci E, Barnum D, Yu T, Sherwood RI. Peptide fusion improves prime editing efficiency. Nat Commun.2022 Jun 18;13(1):3512. doi: 10.1038 / s41467-022-31270-y. PMID: 35717416; PMCID: PMC9206660; (v) Habib O, Habib G, Hwang GH, Bae S. Comprehensive analysis of prime editing outcomes in human embryonic stem cells. Nucleic Acids Res.2022 Jan 25;50(2):1187-1197. doi: 10.1093 / nar / gkab1295. PMID: 35018468; PMCID: PMC8789035; (vi) Marzec M, Brąszewska-Zalewska A, Hensel G. Prime Editing: A New Way for Genome Editing. Trends Cell Biol.2020 Apr;30(4):257-259. doi: 10.1016 / j.tcb.2020.01.004. Epub 2020 Jan 27. PMID: 32001098; (vii) Tao R, Wang Y, Jiao Y, Hu Y, Li L, Jiang L, Zhou L, Qu J, Chen Q, Yao S. Bi-PE: bi-directional priming improves CRISPR / Cas9 prime editing in mammalian cells. Nucleic Acids Res.2022 Jun 24;50(11):6423-6434. doi: 10.1093 / nar / gkac506. PMID: 35687127; PMCID: PMC9226529; (viii) Nelson JW, Randolph PB, Shen SP, Everette KA, Chen PJ, Anzalone AV, An M, Newby GA, Chen JC, Hsu A, Liu DR. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol.2022 Mar;40(3):402-410. doi: 10.1038 / s41587-021-01039-7. Epub 2021 Oct 4. Erratum in: Nat Biotechnol.2021 Dec 8; PMID: 34608327; PMCID: PMC8930418; (ix) Doman JL, Sousa AA, Randolph PB, Chen PJ, Liu DR. Designing and executing prime editing experiments in mammalian cells. Nat Protoc.2022 Nov;17(11):2431-2468. doi: 10.1038 / s41596-022-00724-4. Epub 2022 Aug 8. PMID: 35941224; PMCID: PMC9799714; (x) Jiao Y, Zhou L, Tao R, Wang Y, Hu Y, Jiang L, Li L, Yao S. Random-PE: an efficient integration of random sequences into mammalian genome by prime editing. Mol Biomed.2021 Nov 18;2(1):36. doi: 10.1186 / s43556-021-00057-w. PMID: 35006470; PMCID: PMC8607425; (xi) Awan MJA, Ali Z, Amin I, Mansoor S. Twin prime editor: seamless repair without damage. Trends Biotechnol. 2022 Apr;40(4):374-376. doi: 10.1016 / j.tibtech.2022.01.013. Epub 2022 Feb 10. PMID: 35153078; and (xii) Doman JL, Pandey S, Neugebauer ME, An M, Davis JR, Randolph PB, McElroy A, Gao XD, Raguram A, Richter MF, Everette KA, Banskota S, Tian K, Tao YA, Tolar J, Osborn MJ, Liu DR. Phage-assisted evolution and protein engineering yield compact, efficient prime editors. Cell.2023 Aug 31;186(18):3983-4002.e26. doi: 10.1016 / j.cell.2023.07.039. PMID: 37657419; PMCID: PMC10482982, all of which are incorporated herein by reference.

[0300] In some examples, prime editing has been described and disclosed in numerous published patent applications, each of which their entire contents, amino acid sequences, nucleotide sequences, and all disclosures therein are incorporated herein by reference in their entireties: International Application No. PCT / US2022 / 074628, filed August 5, 2022; International Application No. PCT / US2022 / 074088, filed July 23, 2022; InternationalRNG043-WO1 PCT Application Application No. PCT / US2022 / 073819, filed July 16, 2022; International Application No. PCT / US2022 / 035613, filed June 29, 2022; International Application No. PCT / US2022 / 036230, filed July 6, 2022; International Application No. PCT / US2022 / 032267, filed June 3, 2022, European Application No. EP21707651.2, filed February 19, 2021; International Application No. PCT / EP2022 / 062223, filed May 5, 2022; U.S. Application No. 17 / 219,635, filed March 31, 2021; International Application No. PCT / CN2022 / 080595, filed March 14, 2022; International Application No. PCT / US2022 / 023175, filed April 1, 2022; International Application No. PCT / US2022 / 021879, filed March 25, 2022; International Application No. PCT / US2022 / 020392, filed March 15, 2022; U.S. Application No. 17 / 219,672, filed March 31, 2021, now U.S. Patent No.11,447,770, issued September 20, 2022; International Application No. PCT / CN2022 / 077097, filed February 21, 2022; International Application No. PCT / US2022 / 015260, filed February 4, 2022; International Application No. PCT / KR2022 / 001611, filed January 28, 2022; International Application No. PCT / IN2022 / 050017, filed January 7, 2022; International Application No. PCT / US2022 / 012054, filed January 11, 2022; U.S. Application No.17 / 427,040, filed July 29, 2021, now U.S. Patent No.11,384,353, issued July 12, 2022; International Application No. PCT / US2021 / 052097, filed September 24, 2021; International Application No. PCT / KR2021 / 017534, filed November 25, 2021; International Application No. PCT / CN2021 / 130059, filed November 11, 2021; International Application No. PCT / US2021 / 057908, filed November 3, 2021; International Application No. PCT / US2021 / 058079, filed November 4, 2021; International Application No. PCT / KR2021 / 013326, filed September 29, 2021; International Application No. PCT / US2021 / 052097, filed September 24, 2021; International Application No. PCT / KR2021 / 010740, filed August 12, 2021; U.S. Application No.17 / 427,040, filed July 29, 2021; International Application No. PCT / US2021 / 044924, filed August 6, 2021; International Application No. PCT / KR2021 / 009794, filed July 28, 2021; International Application No. PCT / US2021 / 031439, filed May 7, 2021; International Application No. PCT / US2021 / 034996, filed May 28, 2021; International Application No. PCT / KR2021 / 005244, filed April 26, 2021; International Application No. PCT / KR2021 / 005031, filed April 21, 2021; International Application No. PCT / US2020 / 023730, filed March 19, 2020; International Application No. PCT / US2020 / 023713, filed March 19, 2020; International Application No. PCT / EP2021 / 054228, filed February 19, 2021; International Application No. PCT / US2020 / 067535, filed December 30, 2020; International Application No. PCT / US2020 / 059149, filed November 5, 2020; International Application No.RNG043-WO1 PCT Application PCT / US2020 / 055959, filed October 16, 2020; International Application No. PCT / US2020 / 055156, filed October 9, 2020; International Application No. PCT / US2020 / 023553, filed March 19, 2020; International Application No. PCT / US2020 / 023583, filed March 19, 2020; International Application No. PCT / US2020 / 023730, filed March 19, 2020; International Application No. PCT / US2020 / 023721, filed March 19, 2020; International Application No. PCT / US2020 / 023728, filed March 19, 2020; International Application No. PCT / US2020 / 023732, filed March 19, 2020; International Application No. PCT / US2020 / 023712, filed March 19, 2020; International Application No. PCT / US2020 / 023725, filed March 19, 2020; International Application No. PCT / US2020 / 023713, filed March 19, 2020; International Application No. PCT / US2020 / 023727, filed March 19, 2020; International Application No. PCT / US2020 / 023724, filed March 19, 2020; International Application No. PCT / US2020 / 023583, filed March 19, 2020; International Application No. PCT / US2020 / 023723, filed March 19, 2020; International Application No. PCT / CN2020 / 074218, filed February 3, 2020; U.S. Application No.15 / 616,756, filed June 7, 2017, now U.S. Patent No.10,189,831, issued January 29, 2019; International Application No. PCT / US2018 / 042040, filed July 13, 2018; U.S. Application No.15 / 164,208, filed May 25, 2016, now U.S. Patent No.10,150,955, issued December 11, 2018; International Application No. PCT / US2017 / 050690, September 8, 2017; U.S. Application No.11 / 502,819, filed August 10, 2006, now U.S. Patent No.9,783,791, issued October 10, 2017; and U.S. Application No. 13 / 277,763, filed October 20, 2011, now U.S. Patent No.9,458,484, issued October 4, 2016.

[0301] In some embodiments, the chimeric gene editing composition comprises a prime editing system or a polynucleotide encoding a prime editing system. In some embodiments, the cargo comprises a component of a prime editing system or a polynucleotide encoding a component of a prime editing system.

[0302] Prime editing is a versatile and precise genome editing method that directly writes new genetic information into a specified DNA site using a catalytically impaired Cas fused to an engineered reverse transcriptase, also referred to as a prime editor, which is programmable using a prime editing guide RNA (“pegRNA”) that both specifies the target site and encodes the desired edit, such as, for example, as described in Anzalone et al., Nature 2019. Prime editing bypasses the need for DNA donor templates by using a prime editor having nickase or catalytically impaired enzymatic activity.RNG043-WO1 PCT Application

[0303] A prime editing system comprises a prime editor. The prime editor (“PE”) comprises a catalytically impaired Cas protein fused to an engineered reverse transcriptase which can precisely and permanently edit one or more target nucleobases in a target polynucleotide.

[0304] In some embodiments, the prime editor comprises an engineered Moloney murine leukemia virus (“M-MLV”) reverse transcriptase (“RT”) fused to a Cas-H840A nickase (called “PE2”). In some embodiments, the prime editor comprises an engineered M-MLV RT fused to a Cas9-H840A nickase. In some embodiments, the prime editor comprises an engineered M-MLV RT fused to a Streptococcus pyogenes Cas9 (spCas9)-H840A nickase. PE modifications include increased PAM flexibility to increase the utility of PE2 editing, expanding the coverage of targetable pathogenic variants in the ClinVar database that can now be prime edited to 94.4%.

[0305] In some embodiments, the prime editing system further comprises a prime editing guide RNA (“pegRNA”). In some embodiments, the cargo comprises a pegRNA or a polynucleotide encoding a pegRNA.

[0306] In some embodiments, the prime editing system further comprises a second guide RNA targeting the complementary strand, allowing the Cas9 nickase to also nick the non-edited strand (called “PE3”), which biases mismatch DNA repair in favor of the edited sequence. In some embodiments, the second guide RNA is designed to recognize the complementary strand of DNA only after the PE3 edit has occurred (called “PE3b”), which reduces indel formation.

[0307] In some embodiments, the prime editing system comprises an uracil glycosylase inhibitor. In some embodiments, the prime editing system comprises a Cas9 protein fused to an uracil glycosylase inhibitor. In some embodiments, the cargo comprises an uracil glycosylase inhibitor or a polynucleotide encoding an uracil glycosylase inhibitor. In some embodiments, the cargo comprises a Cas9 protein fused to an uracil glycosylase inhibitor or a polynucleotide encoding a Cas9 protein fused to an uracil glycosylase inhibitor.

[0308] Any of the above prime editor embodiments or variants, modifications, or derivatives thereof are contemplated herein to be delivered by the LNP systems disclosed in this specification for gene editing in cells, tissues, and / or organs under in vitro, ex vivo, or in vivo conditions. The various components described herein may be configured and delivered in any suitable manner. Any of the descriptions presented in this section are not intended to be strictly limiting. guide RNAsRNG043-WO1 PCT Application

[0309] The present disclosure further provides guide RNAs for use in accordance with the disclosed nucleic acid programmable DNA binding proteins (e.g., Cas9) for use in methods of editing. The disclosure provides guide RNAs that are designed to recognize target sequences. Such gRNAs may be designed to have guide sequences (or “spacers”) having complementarity to a target sequence. Such gRNAs may be designed to have not only a guide sequences having complementarity to a target sequence to be edited, but also to have a backbone sequence that interacts specifically with the nucleic acid programmable DNA binding protein.

[0310] In some embodiments, the guide RNA may be 15-100 nucleotides in length and comprise a sequence of at least 10, at least 15, or at least 20 contiguous nucleotides that is complementary to a target nucleotide sequence. The guide RNA may comprise a spacer sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous nucleotides that is complementary to a target nucleotide sequence. In some cases, the guide sequence has a length in a range of from 17-30 nucleotides (nt) (e.g., from 17-25, 17-22, 17-20, 19-30, 19-25, 19-22, 19-20, 20-30, 20-25, or 20-22 nt). In some cases, the guide sequence has a length in a range of from 17-25 nucleotides (nt) (e.g., from 17- 22, 17-20, 19-25, 19-22, 19-20, 20-25, or 20-22 nt). In some cases, the guide sequence has a length of 17 or more nt (e.g., 18 or more, 19 or more, 20 or more, 21 or more, or 22 or more nt; 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, etc.). In some cases, the guide sequence has a length of 19 or more nt (e.g., 20 or more, 21 or more, or 22 or more nt; 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, etc.). In some cases, the guide sequence has a length of 17 nt. In some cases, the guide sequence has a length of 18 nt. In some cases, the guide sequence has a length of 19 nt. In some cases, the guide sequence has a length of 20 nt. In some cases, the guide sequence has a length of 21 nt. In some cases, the guide sequence has a length of 22 nt. In some cases, the guide sequence has a length of 23 nt.

[0311] In some cases, the spacer sequence has a length of from 15 to 50 nucleotides (e.g., from 15 nucleotides (nt) to 20 nt, from 20 nt to 25 nt, from 25 nt to 30 nt, from 30 nt to 35 nt, from 35 nt to 40 nt, from 40 nt to 45 nt, or from 45 nt to 50 nt).

[0312] A subject guide RNA can interact with a target nucleic acid (e.g., double stranded DNA (dsDNA), single stranded DNA (ssDNA), single stranded RNA (ssRNA), or double stranded RNA (dsRNA)) in a sequence-specific manner via hybridization (i.e., base pairing).

[0313] The guide RNA can be modified to hybridize to any desired target sequence (e.g., while taking the PAM into account, e.g., when targeting a dsDNA target) within a targetRNG043-WO1 PCT Application nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA). In some cases, the percent complementarity between the spacer sequence of the guide and the target site of the target nucleic acid is 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the spacer and the target site of the target nucleic acid is 80% or more (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the spacer and the target site of the target nucleic acid is 90% or more (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the spacer and the target site of the target nucleic acid is 100%.

[0314] In some cases, the percent complementarity between the spacer sequence and the target site of the target nucleic acid is 100% over an at least 5-nucleotide contiguous region of the spacer. In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 6-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 7-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 8-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 9-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 10-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 11-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). InRNG043-WO1 PCT Application some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 12-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 13-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 14-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 15-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 16-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 17-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 18-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 19-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 20-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of theRNG043-WO1 PCT Application target nucleic acid over an at least 21-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 22-nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%).

[0315] In some cases, the percent complementarity between the spacer sequence and the target site of the target nucleic acid is 100% over an at least 5-10 nucleotide contiguous region of the spacer. In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 6-11 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 7-12 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 8-13 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 9-14 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 10-15 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 11-16 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 12-17 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% orRNG043-WO1 PCT Application more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 13-18 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 14-19 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 15-20 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 16-21 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 17-22 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 18-23 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 19-24 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 20-25 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 21-26 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, orRNG043-WO1 PCT Application 100%). In some cases, the percent complementarity between the guide sequence and the target site of the target nucleic acid over an at least 22-27 nucleotide contiguous region of the spacer is 60% or more (e.g., 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%).

[0316] In various embodiments, the guide RNAs may have a scaffold or core region that complexes with a cognate nucleic acid programmable DNA binding protein (e.g., CRISPR Cas9 or Cas12a). In some cases, a guide scaffold can have two stretches of nucleotides that are complementary to one another and hybridize to form a double stranded RNA duplex (dsRNA duplex). Thus, in some cases, the protein binding segment of a guide RNA includes a dsRNA duplex. In some embodiments, the dsRNA duplex region includes a range of from 5-25 base pairs (bp) (e.g., from 5-22, 5-20, 5-18, 5-15, 5-12, 5-10, 5-8, 8-25, 8-22, 8-18, 8-15, 8-12, 12- 25, 12-22, 12-18, 12- 15, 13-25, 13-22, 13-18, 13-15, 14-25, 14-22, 14-18, 14-15, 15-25, 15- 22, 15-18, 17-25, 17-22, or 17-18 bp, e.g., 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, etc.). In some cases, the dsRNA duplex region includes a range of from 6-15 base pairs (bp) (e.g., from 6-12, 6-10, or 6-8 bp, e.g., 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, etc.). In some cases, the duplex region includes 5 or more bp (e.g., 6 or more, 7 or more, or 8 or more bp). In some cases, the duplex region includes 6 or more bp (e.g., 7 or more, or 8 or more bp). In some cases, not all nucleotides of the duplex region are paired, and therefore the duplex forming region can include a bulge. The term “bulge” herein is used to mean a stretch of nucleotides (which can be one nucleotide) that do not contribute to a double stranded duplex, but which are surrounded 5’ and 3’ by nucleotides that do contribute, and as such a bulge is considered part of the duplex region. In some cases, the dsRNA includes 1 or more bulges (e.g., 2 or more, 3 or more, 4 or more bulges). In some cases, the dsRNA duplex includes 2 or more bulges (e.g., 3 or more, 4 or more bulges). In some cases, the dsRNA duplex includes 1-5 bulges (e.g., 1-4, 1-3, 2-5, 2-4, or 2-3 bulges).

[0317] Thus, in some cases, the stretches of nucleotides that hybridize to one another to form the dsRNA duplex in a guide scaffold region have 70%-100% complementarity (e.g., 75%-100%, 80%-10%, 85%-100%, 90%- 100%, 95%-100% complementarity) with one another. In some cases, the stretches of nucleotides that hybridize to one another to form the dsRNA duplex have 70%-100% complementarity (e.g., 75%-100%, 80%-10%, 85%-100%, 90%-100%, 95%-100% complementarity) with one another. In some cases, the stretches of nucleotides that hybridize to one another to form the dsRNA duplex have 85%-100% complementarity (e.g., 90%-100%, 95%-100% complementarity) with one another. In some cases, the stretches of nucleotides that hybridize to one another to form the dsRNA duplexRNG043-WO1 PCT Application have 70%-95% complementarity (e.g., 75%-95%, 80%-95%, 85%-95%, 90%-95% complementarity) with one another. In other words, in some cases, the dsRNA duplex includes two stretches of nucleotides that have 70%-100% complementarity (e.g., 75%-100%, 80%- 10%, 85%-100%, 90%-100%, 95%-100% complementarity) with one another. In some cases, the dsRNA duplex includes two stretches of nucleotides that have 85%-100% complementarity (e.g., 90%-100%, 95%-100% complementarity) with one another. In some cases, the dsRNA duplex includes two stretches of nucleotides that have 70%-95% complementarity (e.g., 75%- 95%, 80%-95%, 85%-95%, 90%-95% complementarity) with one another.

[0318] In various embodiments, the scaffold region of a guide RNA can also include one or more (1, 2, 3, 4, 5, etc.) mutations relative to a naturally occurring scaffold region. For example, in some cases a base pair can be maintained while the nucleotides contributing to the base pair from each segment can be different. In some cases, the duplex region of a subject guide RNA includes more paired bases, less paired bases, a smaller bulge, a larger bulge, fewer bulges, more bulges, or any convenient combination thereof, as compared to a naturally occurring duplex region (of a naturally occurring guide RNA).

[0319] Examples of various guide RNAs can be found in the art, and in some cases variations similar to those introduced into Cas9 guide RNAs can also be introduced into guide RNAs of the present disclosure (e.g., mutations to the dsRNA duplex region, extension of the 5’ or 3’ end for added stability for to provide for interaction with another protein, and the like). In some examples, the guide RNAs can be the guide RNAs described in Jinek et al., Science. 2012 Aug 17;337(6096):816-21; Chylinski et al., RNA Biol.2013 May;10(5):726- 37; Ma et al., Biomed Res Int.2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A.2013 Sep 24;110(39):15644-9; Jinek et al., Elife.2013;2:e00471; Pattanayak et al., Nat Biotechnol.2013 Sep;31(9):839-43; Qi et al, Cell.2013 Feb 28 ; 152(5): 1173-83 ; Wang et al., Cell.2013 May 9;153(4):910-8; Auer et al., Genome Res.2013 Oct 31; Chen et al., Nucleic Acids Res.2013 Nov 1 ;41(20):el9; Cheng et al., Cell Res.2013 Oct;23(10):1163-71; Cho et al., Genetics.2013 Nov;195(3):1177-80; DiCarlo et al., Nucleic Acids Res.2013 Apr;41(7):4336-43; Dickinson et al., Nat Methods.2013 Oct;10(10):1028-34; Ebina et al., Sci Rep.2013;3:2510; Fujii et. al, Nucleic Acids Res.2013 Nov l;41(20):el87; Hu et al., Cell Res.2013 Nov;23(ll):1322-5; Jiang et al., Nucleic Acids Res.2013 Nov l;41(20):el88; Larson et al., Nat Protoc.2013 Nov;8(l l):2180-96; Mali et. at., Nat Methods.2013 Oct;10(10):957-63; Nakayama et al., Genesis.2013 Dec;51(12):835-43; Ran et al., Nat Protoc.2013 Nov;8(l l):2281-308; Ran et al., Cell.2013 Sep 12;154(6):1380-9; Upadhyay et al., G3 (Bethesda).2013 Dec 9;3(12):2233-8; Walsh et al., Proc Natl Acad Sci U S A.2013 Sep 24;110(39):15514-5; Xie et al., Mol Plant.2013 Oct 9;RNG043-WO1 PCT Application Yang et al., Cell.2013 Sep 12;154(6):1370-9; Briner et al., Mol Cell.2014 Oct 23;56(2):333- 9; and U.S. patents and patent applications: 8,906,616; 8,895,308; 8,889,418; 8,889,356; 8,871,445; 8,865,406; 8,795,965; 8,771,945; 8,697,359; 20140068797; 20140170753; 20140179006; 20140179770; 20140186843; 20140186919; 20140186958; 20140189896; 20140227787; 20140234972; 20140242664; 20140242699; 20140242700; 20140242702; 20140248702; 20140256046; 20140273037; 20140273226; 20140273230; 20140273231; 20140273232; 20140273233; 20140273234; 20140273235; 20140287938; 20140295556; 20140295557; 20140298547; 20140304853; 20140309487; 20140310828; 20140310830; 20140315985; 20140335063; 20140335620; 20140342456; 20140342457; 20140342458; 20140349400; 20140349405; 20140356867; 20140356956; 20140356958; 20140356959; 20140357523; 20140357530; 20140364333; and 20140377868; all of which are hereby incorporated by reference in their entirety.

[0320] In one embodiment, the guide RNAs (including pegRNAs) contemplated herein comprise non-naturally occurring nucleic acids and / or non-naturally occurring nucleotides and / or nucleotide analogs, and / or chemical modifications. Non-naturally occurring nucleic acids can include, for example, mixtures of naturally and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and / or nucleotide analogs may be modified at the ribose, phosphate, and / or base moiety. In an embodiment of the present disclosure, a guide RNA (including pegRNA) component nucleic acid comprises ribonucleotides and non- ribonucleotides. In one such embodiment, a guide RNA (including pegRNA) component comprises one or more ribonucleotides and one or more deoxyribonucleotides. In an embodiment of the present disclosure, the guide RNA (including pegRNA) component comprises one or more non-naturally occurring nucleotide or nucleotide analog such as a nucleotide with phosphorothioate linkage, a locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2' and 4' carbons of the ribose ring, or bridged nucleic acids (BNA).

[0321] Other examples of modified nucleotides include 2'-O-methyl analogs, 2'-deoxy analogs, or 2'-fluoro analogs. Further examples of modified bases include, but are not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine, inosine, 7-methylguanosine. Examples of coRNA chemical modifications include, without limitation, incorporation of 2'-O-methyl (M), 2'-O-methyl 3 'phosphorothioate (MS), S-constrained ethyl(cEt), or 2'-O-methyl 3 'thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified oRNA components can comprise increased stability and increased activity as compared to unmodified oRNA components, though on-target vs. off-target specificity is not predictable. In someRNG043-WO1 PCT Application embodiments, the modified nucleotides can be those described in Hendel, 2015, Nat Biotechnol.33(9):985-9, doi: 10.1038 / nbt.3290, published online 29 June 2015 Ragdarm et al., 0215, PNAS, E7110-E7111; Allerson et al., J. Med. Chem.2005, 48:901-904; Bramsen et al., Front. Genet., 2012, 3:154; Deng et al., PNAS, 2015, 112: 11870-11875; Sharma et al., MedChemComm., 2014, 5: 1454-1471; Li et al., Nature Biomedical Engineering, 2017, 1, 0066 D01: 10.1038 / s41551-017-0066). In one embodiment, the 5’ and / or 3’ end of a guide RNA (including pegRNA) component is modified by a variety of functional moieties including fluorescent dyes, polyethylene glycol, cholesterol, proteins, or detection tags, such as, for example, as described in Kelly et al., 2016, J. Biotech.233:74-83). In one embodiment, a guide RNA (including pegRNA) component comprises ribonucleotides in a region that binds to a target sequence and one or more deoxyribonucletides and / or nucleotide analogs in a region that binds to a nucleic acid programmable DNA binding protein (e.g., Cas9 nickase).

[0322] In an embodiment, deoxyribonucleotides and / or nucleotide analogs are incorporated in engineered guide RNA (including pegRNA) component structures. In one embodiment, 3-5 nucleotides at either the 3’ or the 5’ end of a guide RNA (including pegRNA) component are chemically modified. In one embodiment, only minor modifications are introduced in the seed region, such as 2’-F modifications. In one embodiment, 2’-F modification is introduced at the 3’ end of a guide RNA (including pegRNA) component. In one embodiment, three to five nucleotides at the 5’ and / or the 3’ end of the reRNA component are chemically modified with 2’ -O-methyl (M), 2’-O-methyl 3’ phosphorothioate (MS), S- constrained ethyl(cEt), or 2’ -O-methyl 3’ thioPACE (MSP). Such modification can enhance genome editing efficiency, such as, for example, those described in Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989). In one embodiment, all of the phosphodiester bonds of a guide RNA (including pegRNA) component are substituted with phosphorothioates (PS) for enhancing levels of gene disruption. In one embodiment, more than five nucleotides at the 5’ and / or the 3’ end of the guide RNA (including pegRNA) component are chemically modified with 2’-0-Me, 2’-F or S-constrained ethyl(cEt). Such chemically modified guide RNA (including pegRNA) component can mediate enhanced levels of gene disruption, such as, for example, those described in Ragdarm et al., 2015, PNAS, E7110-E7111. In an embodiment of the present disclosure, a guide RNA (including pegRNA) component is modified to comprise a chemical moiety at its 3’ and / or 5’ end. Such moieties include, but are not limited to amine, azide, alkyne, thio, dibenzocyclooctyne (DBCO), or Rhodamine. In certain embodiment, the chemical moiety is conjugated to the guide RNA (including pegRNA) component by a linker, such as an alkyl chain. In one embodiment, the chemical moiety of the modified nucleic acidRNG043-WO1 PCT Application component can be used to attach the guide RNA (including pegRNA) component to another molecule, such as DNA, RNA, protein, or nanoparticles. Such chemically modified guide RNA (including pegRNA) component can be used to identify or enrich cells generically edited by a gene editing system described herein.

[0323] In some examples, other guide RNA (including pegRNA) modifications are described in Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol 40, 94–102 (2022).

[0324] Accordingly, in various aspects of the present disclosure, the guide RNA (including pegRNA) are modified in one or more locations within the molecule: MS1, an internal penta(uridinylate) (UUUUU) sequence in the tracrRNA; MS2, the 3′ terminus of the crRNA; MS3, the ‘stem 1’ region of the tracrRNA; MS4, the tracrRNA–crRNA complementary region; and MS5, the ‘stem 2’ region of the tracrRNA.

[0325] Various aspects of the present disclosure provide methods and compositions for improved guide RNA (including pegRNA) stability via chemical modifications, such as, for examples, the methods and compositions described in Braasch, D. A., Jensen, S., Liu, Y., Kaur, K., Arar, K., White, M. A., et al. (2003). RNA interference in mammalian cells by chemically-modified RNA. Biochemistry 42, 7967–7975. doi: 10.1021 / bi0343774. Chiu, Y. L., and Rana, T. M. (2003). siRNA function in RNAi: a chemical modification analysis. RNA 9, 1034–1048. doi: 10.1261 / rna.5103703. Behlke, M. A. (2008). Chemical modification of siRNAs for in vivo use. Oligonucleotides18, 305–319. doi: 10.1089 / oli.2008.0164. Bennett, C. F., and Swayze, E. E. (2010). RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu. Rev. Pharmacol. Toxicol.50, 259–293. doi: 10.1146 / annurev.pharmtox.010909.105654. Deleavey, G. F., and Damha, M. J. (2012). Designing chemically modified oligonucleotides for targeted gene silencing. Chem. Biol.19, 937–954. doi: 10.1016 / j.chembiol.2012.07.011. Lennox, K. A., and Behlke, M. A. (2020). Chemical modifications in RNA interference and CRISPR / Cas genome editing reagents. Methods Mol. Biol.2115, 23–55. doi: 10.1007 / 978-1-0716-0290-4_2.

[0326] In some examples, Hendel et al. improved guide RNA stability by chemically modifying gRNA ends to reduce degradation by exonucleases and RNA nuclease. See Hendel, A., Bak, R. O., Clark, J. T., Kennedy, A. B., Ryan, D. E., Roy, S., et al. (2015a). Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat. Biotechnol.33, 985–989. doi: 10.1038 / nbt.3290. Chemical modifications of gRNAs may enable more efficient and safer gene-editing in primary cells suitable for clinical applications.RNG043-WO1 PCT Application

[0327] In some examples, a review of types of chemical modifications is provided in Allen, Daniel et al. “Using Synthetically Engineered Guide RNAs to Enhance CRISPR Genome Editing Systems in Mammalian Cells.” Frontiers in genome editing vol.2617910.28 Jan.2021, doi:10.3389 / fgeed.2020.617910.

[0328] Accordingly, in various embodiments of the present disclosure, the genome editing system comprising a guide RNA (including pegRNA) and further comprises one or more chemical modifications selected from, but not limited to the modifications described in Allen et al.

[0329] In exemplary embodiments, chemical modifications to the guide RNA (including pegRNA) include modifications on the ribose rings and phosphate backbone of guide RNA (including pegRNA) and modifications at the 2′OH include 2′-O-Me, 2′-F, and 2′F- ANA. More extensive ribose modifications include 2′F-4′-Cα-OMe and 2′,4′-di-Cα-OMe combine modification at both the 2′ and 4′ carbons. Phosphodiester modifications include sulfide-based Phosphorothioate (PS) or acetate-based phosphonoacetate alterations. Combinations of the ribose and phosphodiester modifications have given way to formulations such as 2′-O-methyl 3′phosphorothioate (MS), or 2′-O-methyl-3′-thioPACE (MSP), and 2′-O- methyl-3′-phosphonoacetate (MP) RNAs. Locked and unlocked nucleotides such as locked nucleic acid (LNA), bridged nucleic acids (BNA), S-constrained ethyl (cEt), and unlocked nucleic acid (UNA) are examples of sterically hindered nucleotide modifications. Modifications to make a phosphodiester bond between the 2′ and 5′ carbons (2′,5′-RNA) of adjacent RNAs as well as a butane 4-carbon chain link between adjacent RNAs have been described.

[0330] In certain embodiments, the ncRNA and the guide RNA can be delivered as a single molecule, i.e., with the guide RNA fused to the 5’ and / or 3’ end of the ncRNA. The ncRNA may have guide RNAs located at both ends in some embodiments.

[0331] In other embodiments, the guide RNA and ncRNA may be provided and / or delivered as separate components. Separation of the guide RNA from the ncRNA can result in increased editing efficiency.

[0332] In still other embodiments, a ncRNA-gRNA fusion may be co-delivered with a separate guide RNA. B. Delivery Systems and Methods of Delivery Overview

[0333] In yet another aspect, the disclosure provides compositions for transferring and / or expressing the retron-based gene editing systems, e.g., under in vitro, ex vivo, and inRNG043-WO1 PCT Application vivo conditions. In still another aspect, the disclosure provides cell-delivery compositions and methods, including compositions for passive and / or active transport to cells (e.g., plasmids), delivery by virus-based recombinant vectors (e.g., AAV and / or lentivirus vectors), delivery by non-virus-based systems (e.g., liposomes and LNPs), and delivery by virus-like particles of the retron-based gene editing systems described herein. Depending on the delivery system employed, the retron-based gene editing systems described herein may be delivered in the form of DNA (e.g., plasmids or DNA-based virus vectors), RNA (e.g., guide RNA and mRNA delivered by LNPs), a mixture of DNA and RNA, protein (e.g., virus-like particles), a mixture of DNA or RNA and protein, and ribonucleoprotein (RNP) complexes. Any suitable combinations of approaches for delivering the components of the herein disclosed retron-based gene editing systems may be employed.

[0334] The retron-based gene editing systems and / or components thereof can be delivered by any known delivery system such as those described above, including (a) without vectors (e.g., electroporation), (b) viral delivery systems and (c) non-viral delivery systems. Viral delivery systems include expression vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentiviral vectors, and the like. An expression construct can be replicated in a living cell, or it can be made synthetically. Non-viral delivery systems include without limitation lipid particles (e.g. Lipid nanoparticles (LNPs)), non-lipid nanoparticles, exosomes, liposomes, micelles, viral particles, stable nucleic-acid-lipid particles (SNALPs), lipoplexes / polyplexes, DNA nanoclews, Gold nanoparticles, iTOP, Streptolysin O (SLO), multifunctional envelope-type nanodevice (MEND), lipid-coated mesoporous silica particles, inorganic nanoparticles, and polymeric delivery technology (e.g., polymer-based particles).

[0335] In some examples, delivery of nucleic acid modalities, including RNA therapeutics, can be described further in Paunovska K, Loughrey D, Dahlman JE. Drug delivery systems for RNA therapeutics. Nat Rev Genet.2022 May;23(5):265-280. doi: 10.1038 / s41576-021-00439-4. Epub 2022 Jan 4. PMID: 34983972; PMCID: PMC8724758; Hong CA, Nam YS. Functional nanostructures for effective delivery of small interfering RNA therapeutics. Theranostics.2014 Sep 19;4(12):1211-32. doi: 10.7150 / thno.8491. PMID: 25285170; PMCID: PMC4183999; Liu F, Wang C, Gao Y, Li X, Tian F, Zhang Y, Fu M, Li P, Wang Y, Wang F. Current Transport Systems and Clinical Applications for Small Interfering RNA (siRNA) Drugs. Mol Diagn Ther.2018 Oct;22(5):551-569. doi: 10.1007 / s40291-018- 0338-8. PMID: 29926308; Zhang Y, Almazi JG, Ong HX, Johansen MD, Ledger S, Traini D, Hansbro PM, Kelleher AD, Ahlenstiel CL. Nanoparticle Delivery Platforms for RNAi Therapeutics Targeting COVID-19 Disease in the Respiratory Tract. Int J Mol Sci.2022 FebRNG043-WO1 PCT Application 22;23(5):2408. doi: 10.3390 / ijms23052408. PMID: 35269550; PMCID: PMC8909959; Zhang M, Hu S, Liu L, Dang P, Liu Y, Sun Z, Qiao B, Wang C. Engineered exosomes from different sources for cancer-targeted therapy. Signal Transduct Target Ther.2023 Mar 15;8(1):124. doi: 10.1038 / s41392-023-01382-y. PMID: 36922504; PMCID: PMC10017761; Hastings ML, Krainer AR. RNA therapeutics. RNA.2023 Apr;29(4):393-395. doi: 10.1261 / rna.079626.123. PMID: 36928165; PMCID: PMC10019368; Miele E, Spinelli GP, Miele E, Di Fabrizio E, Ferretti E, Tomao S, Gulino A. Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy. Int J Nanomedicine.2012;7:3637-57. doi: 10.2147 / IJN.S23696. Epub 2012 Jul 20. PMID: 22915840; PMCID: PMC3418108, each of which are incorporated by reference in their entireties.

[0336] The engineered retron-based gene editing systems (or vectors containing them) may be introduced into any type of cell, including any cell from a prokaryotic, eukaryotic, or archaeon organism, including bacteria, archaea, fungi, protists, plants (e.g., monocotyledonous and dicotyledonous plants); and animals (e.g., vertebrates and invertebrates). Examples of animals that may be transfected with an engineered retron-based gene editing systems include, without limitation, vertebrates such as fish, birds, mammals (e.g., human and non-human primates, farm animals, pets, and laboratory animals), reptiles, and amphibians.

[0337] The engineered retron-based gene editing systems (or components thereof) can be introduced into a single cell or a population of cells. Cells from tissues, organs, and biopsies, as well as recombinant cells, genetically modified cells, cells from cell lines cultured in vitro, and artificial cells (e.g., nanoparticles, liposomes, polymersomes, or microcapsules encapsulating nucleic acids) may all be transfected with the engineered retron-based gene editing systems.

[0338] The engineered retron-based gene editing systems (or components thereof) can be introduced into cellular fragments, cell components, or organelles (e.g., mitochondria in animal and plant cells, plastids (e.g., chloroplasts) in plant cells and algae).

[0339] Cells may be cultured or expanded after transfection with the engineered retron- based gene editing systems.

[0340] Methods of introducing nucleic acids into a host cell are well known in the art. Commonly used methods include chemically induced transformation, typically using divalent cations (e.g., CaCl2), dextran-mediated transfection, polybrene mediated transfection, lipofectamine and LT-1 mediated transfection, electroporation, protoplast fusion, encapsulation of nucleic acids in liposomes, and direct microinjection of the nucleic acids comprising Cas12a editing systems into nuclei, such as, for example, the methods described in Sambrook et al.RNG043-WO1 PCT Application (2001) Molecular Cloning, a laboratory manual, 3rd edition, Cold Spring Harbor Laboratories, New York, Davis et al. (1995) Basic Methods in Molecular Biology, 2nd edition, McGraw- Hill, and Chu et al. (1981) Gene 13:197; herein incorporated by reference in their entireties.

[0341] Plant cells may also be targeted by the retron-based gene editing systems (or components thereof) disclosed herein. In some examples, methods for genetic transformation of plant cells can be those described in in US2022 / 0145296, and U.S. Pat. Nos.8,575,425; 7,692,068; 8,802,934; 7,541,517; Rakoczy-Trojanowska, M. (2002) Cell Mol Biol Lett.7:849- 858; Jones et al. (2005) Plant Methods 1:5; Rivera et al. (2012) Physics of Life Reviews 9:308- 345; Bartlett et al. (2008) Plant Methods 4:1-12; Bates, G. W. (1999) Methods in Molecular Biology 111:359-366; Binns and Thomashow (1988) Annual Reviews in Microbiology 42:575-606; Christou, P. (1992) The Plant Journal 2:275-281; Christou, P. (1995) Euphytica 85:13-27; Tzfira et al. (2004) TRENDS in Genetics 20:375-383; Yao et al. (2006) Journal of Experimental Botany 57:3737-3746; Zupan and Zambryski (1995) Plant Physiology 107:1041- 1047; and Jones et al. (2005) Plant Methods 1:5, each of which is herein incorporated by reference in its entirety.

[0342] The plant cells that have been transformed may be grown into a transgenic organism, such as a plant, in accordance with conventional methods for example, such as those described in McCormick et al. (1986) Plant Cell Reports 5:81-84.

[0343] Plant material that may be transformed with the retron-based gene editing systems (or components thereof) described herein includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the disclosure, provided that these parts comprise the genetic modification introduced by the retron-based gene editing systems. Further provided is a processed plant product or byproduct that retains the genetic modification introduced by the retron-based gene editing systems.

[0344] The retron-based gene editing systems described herein may be used to produce transgenic plants with desired phenotypes, including but not limited to, increased disease resistance (e.g., increased viral, bacterial of fungal resistance), increased insect resistance, increased drought resistance, increased yield, and altered fruit ripening characteristics, sugar and oil composition, and color.

[0345] In some embodiments involving retron-based gene editing systems, the retron msr gene, msd gene, and / or ret gene can be expressed in vitro from a vector, such as in an inRNG043-WO1 PCT Application vitro transcription system. The resulting ncRNA or msDNA can be isolated before being packaged and / or formulated for direct delivery into a host cell. For example, the isolated ncRNA or msDNA can be packaged / formulated in a delivery vehicle such as lipid nanoparticles as described in other sections.

[0346] In some embodiments involving retron-based gene editing systems, the retron msr gene, msd gene, and / or ret gene are expressed in vivo from a vector within a cell. The retron msr gene, msd gene, and / or ret gene can be introduced into a cell with a single vector or in multiple separate vectors to produce msDNA in a host subject.

[0347] In other embodiments, the retron msr gene, msd gene, and / or ret gene, and any other components of the retron-based genome editing systems described herein (e.g., guide RNA in trans, programmable nuclease (e.g., in trans)) may be expressed in vivo from RNA delivered to the cell. The retron msr gene, msd gene, and / or ret gene can be introduced into a cell with a single vector or in multiple separate vectors to produce msDNA in a host subject.

[0348] Vectors and / or nucleic acid molecules encoding the recombinant retron-based genome editing system or components thereof can include control elements operably linked to the retron sequences, which allow for the production of msDNA either in vitro, or in vivo in the subject species. For example, in embodiments relating to retron-based gene editing systems, the retron msr gene, msd gene, and / or ret gene can be operably linked to a promoter to allow expression of the retron reverse transcriptase and / or the msDNA product. In some embodiments, heterologous sequences encoding desired products of interest (e.g., polynucleotide encoding polypeptide or regulatory RNA, donor polynucleotide for gene editing, or protospacer DNA for molecular recording) may be inserted in the msr gene and / or msd gene.

[0349] In some embodiments, the retron-based gene editing systems are produced by a vector system comprising one or more vectors.

[0350] Numerous vectors are available for use in the vector or vector system, including but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. All-RNA format

[0351] In various embodiments, the retron-based gene editing systems (or components thereof) disclosed herein may be delivered in an “all-RNA” format. As used herein, the term “all-RNA” format refers to the fact that each of the components of a retron editing system (e.g., the retron RT, the programmable nuclease, the sgRNA, and the ncRNA) are delivered and / or administered as RNA (e.g., coding RNA or non-coding RNA). In some embodiments,RNG043-WO1 PCT Application the RNA components may be delivered to cells and / or tissues by direct means, such as electroporation or transfection. In other embodiments, the RNA components may be delivered to cells and / or tissues by way of a delivery vehicle, such as an LNP or liposome.

[0352] In various embodiments, the retron editing systems described herein may comprise a coding RNA (e.g., linear or circular mRNA) that encodes a retron reverse transcriptase (e.g., any RT from the abovementioned Table X or the abovementioned Table A), a coding RNA (e.g., linear or circular mRNA) that encodes a programmable nuclease (e.g., a Cas9, Cas12a, or TnpB nuclease), a retron ncRNA (e.g., a ncRNA from the abovementioned Table B), and a guide RNA for targeting the programmable nuclease to a particular desired target sequence.

[0353] In some embodiments, RT and nuclease components may be encoded on the same coding RNA molecule. The proteins may also be expressed from separate coding RNA molecules. In still other embodiments, the RT and the nuclease components can be fused together as a singular fusion polypeptide having an RT domain and a nuclease domain optionally joined by a linker.

[0354] In addition, in some embodiments, the ncRNA and the guide RNA may be fused together as a single RNA molecule. For example, the guide RNA may be located at the 5’ end of the ncRNA. In other embodiments, the guide RNA may be located at the 3’ end of the ncRNA. In some embodiments, the ncRNA may comprise a guide RNA at both the 3’ and the 5’ ends of the ncRNA.

[0355] In still other embodiments, the ncRNA and the guide RNA may be separate molecules, i.e., delivered separately.

[0356] In still other embodiments, the retron editing system may include both a ncRNA-guide RNA fusion and an additional guide RNA provided as a separate molecule.

[0357] In various embodiments, the different RNA components of the all-RNA retron editing system can be combined and administered (e.g., directly or within a delivery vehicle) in different ratios. In some embodiments, the ratios of such RNA components or species can be expressed as molar ratios.

[0358] For example, the molar ratio of RT coding RNA to nuclease coding RNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4RNG043-WO1 PCT Application to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0359] In another example, the molar ratio of nuclease coding RNA to RT coding RNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0360] In still another example, the molar ratio of ncRNA or ncRNA-guide RNA fusion to separate guide RNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0361] In still another example, the molar ratio of separate guide RNA to ncRNA or ncRNA-guide RNA fusion can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0362] In still another example, the molar ratio of ncRNA to separate guide RNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0363] In still another example, the molar ratio of separate guide RNA to ncRNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10,RNG043-WO1 PCT Application from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0364] In still another example, the molar ratio of a coding RNA (e.g., encoding RT and / or nuclease) to ncRNA or ncRNA-guide RNA fusion, as the case may be, can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0365] In still another example, the molar ratio of a coding RNA encoding a retron RT to ncRNA or ncRNA-guide RNA fusion, as the case may be, can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0366] In still another example, the molar ratio of a coding RNA encoding a programmable nuclease to ncRNA or ncRNA-guide RNA fusion, as the case may be, can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0367] In still another example, the molar ratio of a coding RNA encoding a retron RT or a nuclease to a separate guide RNA can be about 1:1, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0368] In still another example, the molar ratio of a separate guide RNA to a coding RNA encoding a retron RT or a nuclease can be about 1:1, about 1:1.5, about 1:2, about 1:2.5,RNG043-WO1 PCT Application about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40.

[0369] In certain embodiments, the amount of ncRNA-sgRNA relative to RT mRNA is augmented. In certain embodiments the RT mRNA: ncRNA-sgRNA ratio is about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40. In certain embodiments, an RT-Cas9 (or Cas9-RT) fusion is encoded by an mRNA. In certain embodiments, the RT-Cas9 mRNA: ncRNA-sgRNA ratio is about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, about 1:10, about 1:12, about 1:15, about 1:20. Useful ranges include from 1:1 to 1:2, from 1:1.5 to 1:4, from 1:2 to 1:4, from 1:2 to 1:8, from 1:2 to 1:10, from 1:3 to 1:9, from 1:3 to 1:12, from 1:3 to 1:15, from 1:4 to 1:8, from 1:4 to 1:12, from 1:4 to 1:20, from 1:5 to 1:10, from 1:5 to 1:15, from 1:5 to 1:20, from 1:10 to 1:20, or from 1:10 to 1:40. In certain embodiments, multiple genetic loci are targeted hence the ncRNA-sgRNA includes a mixture of ncRNA-sgRNA species and the same ratios and ranges are applicable. RNA-protein or DNA-protein format

[0370] In various embodiments, the retron-based gene editing systems (or components thereof) disclosed herein may be delivered in a composition comprising protein, DNA and / or RNAs. For example, some components of a retron editing system (e.g., the sgRNA, and the ncRNA) are delivered as RNA and other components (e.g., the retron RT, the programmable nuclease) are delivered as proteins.

[0371] In some embodiments, the RNA or DNA components and the protein components are delivered to cells or tissues by the same means, such as electroporation or transfection, LNP, liposome, exosomes, etc. In other embodiments, the RNA or DNA components and the protein components are be delivered to cells or tissues by different types of delivery vehicles.RNG043-WO1 PCT Application

[0372] In some embodiments, the RNA or DNA components and the protein components are delivered concurrently. In some embodiments, the RNA or DNA components and the protein components are delivered separately, e.g., sequentially. Viral vector delivery

[0373] In various embodiments, the retron-based gene editing systems described herein may be delivered in viral vectors.

[0374] Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentiviral vectors, and the like. An expression construct can be replicated in a living cell, or it can be made synthetically.

[0375] In some embodiments, the nucleic acid comprising an retron-based gene editing system (or component thereof) is under transcriptional control of a promoter. In some embodiments, the promoter is competent for initiating transcription of an operably linked coding sequence by a RNA polymerase I, II, or III.

[0376] Exemplary promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter such as the CMV immediate early promoter, such as, for example, as described in U.S. Patent Nos.5,168,062 and 5,385,839, incorporated herein by reference in their entireties), the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), and the herpes simplex virus promoter, among others. Other nonviral promoters, such as a promoter derived from the murine metallothionein gene, will also find use for mammalian expression.

[0377] In some examples, exemplary promoters for plant cell expression include the CaMV 35S promoter for example as described in Odell et al., 1985, Nature 313:810-812; the rice actin promoter for example as described in McElroy et al., 1990, Plant Cell 2:163-171; the ubiquitin promoter for example as described in Christensen et al., 1989, Plant Mol. Biol. 12:619-632; and Christensen et al., 1992, Plant Mol. Biol.18:675-689; the pEMU promoter for example as described in Last et al., 1991, Theor. Appl. Genet.81:581-588; and the MAS promoter for example as described in Velten et al., 1984, EMBO J.3:2723-2730.

[0378] In additional embodiments, the retron-based vectors may also comprise tissue- specific promoters to start expression only after it is delivered into a specific tissue. Non- limiting exemplary tissue-specific promoters include B29 promoter, CD14 promoter, CD43 promoter, CD45 promoter, CD68 promoter, desmin promoter, elastase- 1 promoter, endoglin promoter, fibronectin promoter, Flt-1 promoter, GFAP promoter, GPIIb promoter, ICAM- 2RNG043-WO1 PCT Application promoter, INF-b promoter, Mb promoter, Nphsl promoter, OG-2 promoter, SP-B promoter, SYN1 promoter, and WASP promoter.

[0379] In some examples, these and other promoters can be obtained from or incorporated into commercially available plasmids, using techniques as described in Sambrook et al., supra.

[0380] In some embodiments, one or more enhancer elements is / are used in association with the promoter to increase expression levels of the constructs. Examples include the SV40 early gene enhancer, as described in Dijkema et al., EMBOJ (1985) 4:761, the enhancer / promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79:6777, and elements derived from human CMV, as described in Boshart et al., Cell (1985) 41:521, such as elements included in the CMV intron A sequence. All such sequences are incorporated herein by reference.

[0381] In one embodiment, an expression vector for expressing a retron-based gene editing system (or component thereof) comprises a promoter operably linked to a polynucleotide encoding the components. The components of the retron-based gene editing system may be configured as individual gene transcripts or as fused constructs. For example, the nuclease component may be fused with the reverse transcriptase component. In another example, the ncRNA component may be fused with the guide RNA component. In another example, the nuclease component may be fused with the reverse transcriptase component, but the guide RNA and the ncRNA are separate. In other embodiments, the guide RNA and ncRNA components may be fused, but the reverse transcripase and nuclease components are separately provided. Any functional combinations of fused components and non-fused components are contemplated.

[0382] In some embodiments, the vector or vector system also comprises a transcription terminator / polyadenylation signal. Examples of such sequences include, but are not limited to, those derived from SV40, as described in Sambrook et al., supra, as well as a bovine growth hormone terminator sequence, as described in U.S. Patent No.5,122,458.

[0383] Additionally, 5ʹ- UTR sequences can be placed adjacent to the coding sequence to further enhance the expression. Such sequences may include UTRs comprising an internal ribosome entry site (IRES). Inclusion of an IRES permits the translation of one or more open reading frames from a vector. In some examples, the IRES element attracts a eukaryotic ribosomal translation initiation complex and promotes translation initiation, for example, as described in Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem.RNG043-WO1 PCT Application Biophys. Res. Comm. (1996) 229:295-298: Rees et al., BioTechniques (1996) 20:102-110; Kobayashi et al., BioTechniques (1996) 21:399-402; and Mosser et al., BioTechniques (199722 ISO- 161)c . In some examples, a multitude of IRES sequences are known and include sequences derived from a wide variety of viruses, such as, for example, from leader sequences of picomaviruses such as the encephalomyocarditis virus (EMCV) UTR, for example, as described in Jang et al. Virol. (1989) 63:1651-1660, the polio leader sequence, the hepatitis A virus leader, the hepatitis C virus IRES, human rhinovirus type 2 IRES, for example, as described in Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(251:15125-151301), an IRES element from the foot and mouth disease virus, for example, as described in Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700, a giardiavirus IRES, for example, as described in Garlapati et al., J Biol. Chem. (2004) 279(51):3389-33971, and the like. In some examples, a variety of nonviral IRES sequences will also find use herein, including, but not limited to IRES sequences from yeast, as well as the human angiotensin II type 1 receptor IRES for example as described in Martin et al., Mol. Cell Endocrinol. (2003) 212:51-61, fibroblast growth factor IRESs (FGF-1 IRES and FGF-2 IRES, for example as described in Martineau et al. (2004) Mol. Cell. Biol.24(17): 7622-7635), vascular endothelial growth factor IRES for example as described in Baranick et al. (2008) Proc. Natl. Acad Sci. U.S.A.105(12):4733-4738, Stein et al. (1998) Mol. Cell. Biol.18(6):3112-3119, Bert et al. (2006) RNA 12(6): 1074-1083, and insulin-like growth factor 2 IRES for example as described in Pedersen et al. (2002) Biochem. J.363(Pt l):37-44.

[0384] These elements are commercially available in plasmids sold, e.g., by Clontech (Mountain View, CA), Invivogen (San Diego, CA), Addgene (Cambridge, MA) and GeneCopoeia (Rockville, MD). See also IRESite: The database of experimentally verified IRES structures (iresite.org). An IRES sequence may be included in a vector, for example, to express multiple bacteriophage recombination proteins for recombineering or an RNA-guided nuclease (e.g., Cas9) for HDR in combination with a retron reverse transcriptase from an expression cassette.

[0385] In some embodiments, a polynucleotide encoding a viral self-cleaving 2A peptide, such as a T2A peptide, can be used to allow production of multiple protein products (e.g., Cas9, bacteriophage recombination proteins, retron reverse transcriptase) from a single vector or a single transcription unit under one promoter. One or more 2A linker peptides can be inserted between the coding sequences in the multicistronic construct. The 2A peptide, which is self-cleaving, allows co-expressed proteins from the multicistronic construct to be produced at equimolar levels. In some examples, 2A peptides from various viruses may be used,RNG043-WO1 PCT Application including, but not limited to 2A peptides derived from the foot-and-mouth disease virus, equine rhinitis A virus, Jhosea asigna virus and porcine teschovirus, such as those described in Kim et al. (2011) PLoS One 6(4): el8556, Trichas et al. (2008) BMC Biol.6:40, Provost et al. (2007) Genesis 45(10): 625-629, Furler et al. (2001) Gene Ther.8(11):864-873; herein incorporated by reference in their entireties.

[0386] In some embodiments, the expression construct comprises a plasmid suitable for transforming a bacterial host. Numerous bacterial expression vectors are known to those of skill in the art, and the selection of an appropriate vector is a matter of choice. Bacterial expression vectors include, but are not limited to, pACYC177, pASK75, pBAD, pBADM, pBAT, pCal, pET, pETM, pGAT, pGEX, pHAT, pKK223, pMal, pProEx, pQE, and pZA31. In some examples, bacterial plasmids may contain antibiotic selection markers (e.g., ampicillin, kanamycin, erythromycin, carbenicillin, streptomycin, or tetracycline resistance), a lacZ gene (b-galactosidase produces blue pigment from x-gal substrate), fluorescent markers (e.g., GFP. mCherry), or other markers for selection of transformed bacteria, such as, for example, those described in Sambrook et al., supra.

[0387] In other embodiments, the expression construct comprises a plasmid suitable for transforming a yeast cell. Yeast expression plasmids typically contain a yeast-specific origin of replication (ORI) and nutritional selection markers (e.g., HIS3, URA3, LYS2, LEU2, TRP1, METIS, ura4+, leul+, ade6+), antibiotic selection markers (e.g., kanamycin resistance), fluorescent markers (e.g., mCherry), or other markers for selection of transformed yeast cells. The yeast plasmid may further contain components to allow shuttling between a bacterial host (e.g., E coli) and yeast cells. A number of different types of yeast plasmids are available including yeast integrating plasmids (Yip), which lack an ORI and are integrated into host chromosomes by homologous recombination; yeast replicating plasmids (YRp), which contain an autonomously replicating sequence (ARS) and can replicate independently; yeast centromere plasmids (YCp), which are low copy vectors containing a part of an ARS and part of a centromere sequence (CEN); and yeast episomal plasmids (YEp), which are high copy number plasmids comprising a fragment from a 2 micron circle (a natural yeast plasmid) that allows for 50 or more copies to be stably propagated per cell.

[0388] In other embodiments, the expression construct does not comprise a plasmid suitable for transforming a yeast cell.

[0389] In other embodiments, the expression construct comprises a virus or engineered construct derived from a viral genome. A number of viral based systems have been developed for gene transfer into mammalian cells. In some examples, the viral based systems includeRNG043-WO1 PCT Application adenoviruses, retroviruses (g-retroviruses and lentiviruses), poxviruses, adeno-associated viruses, baculoviruses, and herpes simplex viruses, such as, for example, those described in Wamock et al. (2011) Methods Mol. Biol.737:1-25; Walther et al. (2000) Drugs 60(2):249- 271; and Lundstrom (2003) Trends Biotechnol.21(3): 117-122; herein incorporated by reference in their entireties). The ability of certain viruses to enter cells via receptor-mediated endocytosis, to integrate into host cell genomes and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells.

[0390] For example, retroviruses provide a convenient platform for gene delivery systems. Selected sequences can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. In some examples, the retroviral system can be the one described in U.S. Pat. No.5,219,740; Miller and Rosman (1989) BioTechniques 7:980- 990; Miller, A. D. (1990) Human Gene Therapy 1:5-14; Scarpa et al. (1991) Virology 180:849-852; Bums et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop.3:102-109; and Ferry et al. (2011) Curr. Pharm. Des.17(24): 2516-2527). Lentiviruses are a class of retroviruses that are particularly useful for delivering polynucleotides to mammalian cells because they are able to infect both dividing and nondividing cells, such as, for example, as described in Lois et al. (2002) Science 295:868- 872; Durand et al. (2011) Viruses 3(2): 132-159; herein incorporated by reference).

[0391] A number of adenoviral vectors have also been described. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis.

[0392] Additionally, various adeno-associated vims (AAV) vector systems have been developed for gene delivery. In some examples, AAV vectors can be readily constructed using techniques as described in U.S. Pat. Nos.5,173,414 and 5,139,941; International Publication Nos. WO 92 / 01070 (published 23 January 1992) and WO 93 / 03769 (published 4 March 1993); Lebkowski et al., Molec. Cell. Biol. (1988) 8:3988-3996; Vincent et al., Vaccines 90 (1990) (Cold Spring Harbor LaboratoryPress); Carter, B. J. Current Opinion in Biotechnology (1992) 3:533-539; Muzyczka, N. Current Topics in Microbiol and Immunol. (1992) 158:97-129; Kotin, R. M. Human Gene Therapy (1994) 5:793-801; Shelling and Smith, Gene Therapy (1994) 1:165-169; and Zhou et al., J. Exp. Med. (1994) 179:1867-1875.

[0393] In some examples, another vector system useful for delivering nucleic acids encoding the Cas12a editing system components is the enterically administered recombinantRNG043-WO1 PCT Application poxvirus vaccines as described by Small, Jr., P. A., et al. (U.S. Pat. No.5,676,950, issued Oct. 14, 1997, herein incorporated by reference).

[0394] Other viral vectors include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus. By way of example, vaccinia virus recombinants expressing a nucleic acid molecule of interest (e.g., Cas12a editing system) can be constructed as follows. The DNA encoding the particular nucleic acid sequence is first inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and flanking vaccinia DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells which are simultaneously infected with vaccinia. Homologous recombination serves to insert the vaccinia promoter plus the gene encoding the sequences of interest into the viral genome. The resulting TK-recombinant can be selected by culturing the cells in the presence of 5- bromodeoxyuridine and picking viral plaques resistant thereto.

[0395] In some embodiments, avipoxviruses, such as the fowlpox and canarypox viruses, can also be used to deliver the nucleic acid molecules of interest. The use of an avipox vector is particularly desirable in human and other mammalian species since members of the avipox genus can only productively replicate in susceptible avian species and therefore are not infective in mammalian cells. Methods for producing recombinant avipoxviruses are known in the art and employ genetic recombination, as described above with respect to the production of vaccinia viruse, such as, for example, the methods described in WO 91 / 12882; WO 89 / 03429; and WO 92 / 03545.

[0396] In some examples, molecular conjugate vectors, such as the adenovirus chimeric vectors described in Michael et al., J. Biol. Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.

[0397] Members of the alphavirus genus, such as, but not limited to, vectors derived from the Sindbis virus (SIN), Semliki Forest virus (SFV), and Venezuelan Equine Encephalitis virus (VEE), will also find use as viral vectors for delivering the polynucleotides of the present disclosure. In some examples, the Sindbis-virus derived vectors can be those described in Dubensky et al. (1996) J. Virol.70:508-519; and International Publication Nos. WO 95 / 07995, WO 96 / 17072; as well as, Dubensky, Jr., T. W., et al., U.S. Pat. No.5,843,723, issued Dec.1, 1998, and Dubensky, Jr., T. W., U.S. Patent No.5,789,245, issued Aug.4, 1998, which are each herein incorporated by reference. In some examples, particularly preferred are chimeric alphavirus vectors comprised of sequences derived from Sindbis virus and Venezuelan equine encephalitis virus, such as, for example, those described in Perri et al. (2003) J. Virol.77:RNG043-WO1 PCT Application 10394-10403 and International Publication Nos. WO 02 / 099035, WO 02 / 080982, WO 01 / 81609, and WO 00 / 61772; each herein incorp...

Claims

RNG043-WO1 PCT Application WHAT IS CLAIMED:

1. A non-coding RNA (ncRNA) variant comprising a reference retron ncRNA with one or more modifications, wherein the reference retron ncRNA comprises from 5’ to 3’ direction: a1 region, first branching guanosine, msr, msd, and a2 region; and the one or more modifications comprises (i) linkage of the a1 region and the a2 region, (ii) deletion of at least a portion of the msr; (iii) deletion of at least a portion of the msd, (iv) addition of a single-stranded RNA comprising a polymerase template, or (v) addition of an RNA motif.

2. The ncRNA variant of claim 1, wherein the one or more modifications comprise the linkage of the a1 region to the a2 region.

3. The ncRNA variant of claim 1 or 2, wherein the one or more modifications comprises the linkage of the a1 region and the a2 region, wherein the linkage of the a1 region and the a2 region is formed via a linker joining the 5’ end of the a1 region to the 3’ end of the a2 region.

4. The ncRNA variant of claim 1 or 2, wherein the one or more modifications comprises the linkage of the a1 region and the a2 region, wherein the linkage of the a1 region and the a2 region is formed by directly joining the 5’ end of the a1 region to the 3’ end of the a2 region without a linker.

5. The ncRNA variant of any one of claims 1-4, wherein the a1 region and the a2 region are partially or completely complementary to each other and the a1 region and the a2 region form a stem-loop structure after the linkage.

6. The ncRNA variant of any one of claims 1-5, wherein the ncRNA variant further comprises a second branching guanosine.

7. The ncRNA variant of any one of claims 2-6, wherein formation of the linkage of the a1 region and the a2 region circularizes the ncRNA variant.

8. The ncRNA variant of any one of claims 2-7, wherein the one or more modificationsRNG043-WO1 PCT Application further comprises a breakage between the msd and the a2 region, thereby generating the ncRNA variant comprising from 5’ to 3’ direction: the a2 region, the linkage between the a1 and the a2 region, the a1 region, the first branching guanosine, the msr, and the msd.

9. The ncRNA variant of any one of claims 1-8, wherein the one or more modifications comprises the deletion of at least a portion of the msr.

10. The ncRNA variant of claim 9, wherein the portion deleted from the msr comprises a spacer between two stem-loops in the msr or a portion of the spacer.

11. The ncRNA variant of claim 10, wherein the portion deleted from the msr comprises a portion of the spacer, whereby the deletion preserves a remaining 1-15 base pairs between the two stem-loops in the msr, as compared to the reference retron ncRNA.

12. The ncRNA variant of claim 11, wherein the deletion preserves a remaining 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 6 base pairs, 7 base pairs, 8 base pairs, 9 base pairs, 10 base pairs, 11 base pairs, 12 base pairs, 13 base pairs, 14 base pairs, or 15 base pairs between the two stem-loops in the msr, as compared to the reference retron ncRNA.

13. The ncRNA variant of claim 10, wherein the portion deleted from the msr comprises the entirety of the spacer between the two stem-loops in the msr, as compared to the reference retron ncRNA.

14. The ncRNA variant of any one of claims 9-13, wherein the portion deleted from the msr comprises a stem-loop in the msr or a portion thereof.

15. The ncRNA variant of any one of claims 1-14, wherein the one or more modifications comprises the deletion of at least a portion of the msd.

16. The ncRNA variant of claim 15, wherein the deleted portion of the msd comprises a spacer located between a stem-loop in the msd and the a2 region or a portion of the spacer.

17. The ncRNA variant of claim 16, wherein the deleted portion in the msd comprises aRNG043-WO1 PCT Application portion of the spacer located between the stem-loop in the msd and the a2 region, whereby the deletion preserves a remaining 1-15 base pairs between the stem-loop in the msd and the a2 region, as compared to the reference retron ncRNA.

18. The ncRNA variant of claim 17, wherein the deletion preserves a remaining 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 6 base pairs, 7 base pairs, 8 base pairs, 9 base pairs, 10 base pairs, 11 base pairs, 12 base pairs, 13 base pairs, 14 base pairs, or 15 base pairs between the stem-loop in the msd and the a2 region, as compared to the reference retron ncRNA.

19. The ncRNA variant of claim 16, wherein the deleted portion in the msd comprises the entire spacer between the stem-loop in the msd and the a2 region.

20. The ncRNA variant of any one of claims 16-19, wherein the deleted portion in the msd further comprises the stem-loop in the msd, thereby the deletion comprises deletion of the entire spacer between the stem-loop in the msd and the a2 region and the stem-loop in the msd.

21. The ncRNA variant of any one of claims 1-20, wherein the one or more modifications comprises the addition of the single-stranded RNA comprising the polymerase template.

22. The ncRNA variant of claim 21, wherein the one or more modifications comprise the addition of the single-stranded RNA comprising the polymerase template and the deletion of at least a portion of msd, and the single-stranded RNA comprising the polymerase template is added to the deleted portion of the msd.

23. The ncRNA variant of claim 21 or 22, wherein the single-stranded RNA comprising the polymerase template comprises a pair of homology arms specific to a target locus.

24. The method of claim 23, wherein each of the homology arms comprises 5-200 nucleotides.

25. The method of claim 24, wherein each of the homology arms comprises between 5 and 100 nucleotides, between 5 and 50 nucleotides, between 10 and 50 nucleotides, between 25 and 50 nucleotides, between 5 and 25 nucleotides, between 10 and 25RNG043-WO1 PCT Application nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 30 and 40 nucleotides, or between 40 to 50 nucleotides.

26. The ncRNA variant of any one of claims 21-25, wherein the single-stranded RNA comprising the polymerase template further comprises a donor sequence for integration into a target locus.

27. The ncRNA of claim 26, wherein the donor sequence comprises 2-100 nucleotides, 2- 50 nucleotides, 2-25 nucleotides, 5-25 nucleotides, 5-15 nucleotides, 5-10 nucleotides, 10-30 nucleotides, 10-20 nucleotides or 1-10 nucleotides.

28. The ncRNA variant of any one of claims 1-27, wherein the one or more modifications comprises the addition of the RNA motif.

29. The ncRNA variant of claim 28, wherein the RNA motif is a MS2 stem-loop or a 3’ tail of U7 small nuclear RNA (snRNA).

30. The ncRNA variant of any one of claims 1-29, wherein the one or more modifications comprise: a. a combination of (i) and (ii): the linkage of the a1 region and the a2 region and the deletion of at least a portion of the msr; b. a combination of (i) and (iii): the linkage of the a1 region and the a2 region and the deletion of at least a portion of the msd; c. a combination of (i) and (iv): the linkage of the a1 region and the a2 region and the addition of the single-stranded RNA comprising the polymerase template; d. a combination of (i) and (v): the linkage of the a1 region and the a2 region and the addition of the RNA motif; e. a combination of (ii) and (iii): the deletion of at least a portion of the msr and the deletion of at least a portion of the msd; f. a combination of (ii) and (iv): the deletion of at least a portion of the msr and the addition of the single-stranded RNA comprising the polymerase template; g. a combination of (ii) and (v): the deletion of at least a portion of the msr and the addition of the RNA motif at the 5’ end or 3’ end; orRNG043-WO1 PCT Application h. a combination of (iv) and (v): the addition of the single-stranded RNA sequence comprising the polymerase template and the addition of the RNA motif at the 5’ end or 3’ end.

31. The ncRNA variant of any one of claims 1-30, wherein the one or more modifications comprise: a. a combination of (i), (ii), and (iii): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msr, and the deletion of at least a portion of the msd; b. a combination of (i), (ii), and (iv): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msr, and the addition of the single-stranded RNA comprising the polymerase template; c. a combination of (i), (iii), and (iv): the linkage of the a1 region and the a2 region, the deletion of at least a portion of the msd, and the addition of the single-stranded RNA sequence comprising the polymerase template; or d. a combination of (ii), (iii), and (iv): the deletion of at least a portion of the msr, the deletion of at least a portion of the msd, and the addition of the RNA motif at the 5’ end or 3’ end.

32. The ncRNA variant of any one of claims 1-31, wherein the one or more modifications comprise: (i) the linkage of the a1 region and the a2 region, (ii) the deletion of at least a portion of the msr, (iii) the deletion of at least a portion of the msd, (iv) the addition of the single-stranded RNA sequence comprising the polymerase template, and (v) the addition of the RNA motif at the 5’ end or 3’ end region.

33. The ncRNA variant of any one of claims 1-32, wherein the one or more modifications further comprises substitution, insertion, or deletion of one or more nucleotides, or a combination thereof.

34. The ncRNA variant of claim 33, wherein the substitution, insertion, or deletion is capable of modulating activity of a first polymerase or a second polymerase, production of a single stranded DNA from the ncRNA variant, or immunogenicity of the ncRNA variant.RNG043-WO1 PCT Application 35. The ncRNA variant of any one of claims 1-34, wherein the reference retron ncRNA comprises a sequence of a naturally occurring retron or a portion thereof.

36. The ncRNA variant of any one of claims 1-35, wherein the reference retron ncRNA comprises a sequence selected from SEQ ID NO: 3980-4178, 11231-11429, 4671- 4825, 11922-12075, 4980-5143, 12229-12392, 367-368, 427-441, 494-521, 526-527, 536, 626, 649, 660-668, 675, 679, 687-692, 695, 697, 703, 716, 721-722, 751-763, 767, 770-1411, 1456-1462, 7624-7625, 7684-7698, 7751-7778, 7783-7784, 7793, 7883, 7906, 7917-7925, 7932, 7936, 7944-7949, 7952, 7954, 7960, 7973, 7978-7979, 8008- 8020, 8024, 8027-8667, 8712-8718, 1529-1569, 8784-8823, 6697-6701, 13943-13947, 4179-4670, 11430-11921, 4884-4909, 12134-12159, 6919-6972, 14163-14215, 2786- 2866, 2887-2938, 10039-10119, 10140-10191, 4826-4863, 12076-12113, 4864-4875, 12114-12125, 6974-7002, 14217-14244, 2598-2600, 2759-2785, 9851-9853, 10012- 10038, 2445-2582, 9699-9836, 1983-2158, 9237-9412, 1612-1982, 8866-9236, 2601- 2678, 9854-9931, 2679-2758, 9932-10011, 3442-3603, 10694-10855, 3604-3708, 10856-10959, 2939-3441, 3709-3979, 5177-5192, 10192-10693, 10960-111230, 12426-12441, 7003-7033, 14245-14275, 7054-7133, 14296-14374, 7034-7049, 14276- 14291, 6835-6918, 14079-14162, 6823-6834, 14068-14078, 298-366, 369-373, 442- 493, 522-525, 528-535, 537, 551-554, 557, 560-625, 672-674, 680-681, 684-686, 696, 698, 702, 723-742, 764-766, 1412-1453, 1463-1466, 1571-1577, 7555-7623, 2626- 7630, 7699-7750, 7785-7792, 7794, 7808-7811, 7814, 7817-7882, 7929-7931, 7937- 7938, 7941-7943, 7953, 7955, 7959, 7980-7999, 8021-8023, 8668-8706, 8708-8709, 8719-8722, 8825-8831, 374-426, 539-550, 555-556, 558-559, 671, 682-683, 743, 745- 750, 7631-7683, 7796-7807, 7812-7813, 7815-7816, 7928, 7939-7940, 800, 8002- 8007, 5942-6665, 13189-13911, 1-297, 715, 1580-1603, 7258-7554, 7972, 8834-8857, 705-714, 7962-7971, 6681-6694, 13927-13940, 6788-6803, 14033-14048, 1469-1526, 5147-5151, 8725-8781, 12396-12400, 2159-2428, 9413-9682, 646-648, 7903-7905, 2592-2595, 9846-9849, 676-678, 717-720, 7933-7935, 7974-7977, 538, 669, 704, 7795, 7926, 7961, 8710, 670, 699-701, 7927, 7956-7958, 4917-4979, 12167-12228, 4910-4916, 12160-12166, 5195-5941, 12444-13188, 627-645, 650-659, 693-694, 744, 768-769, 1451, 1455, 1467-1468, 1527-1528, 1570, 1578, 1579, 1604-1611, 2429- 2444, 2583-2591, 2596-2597, 2867-2886, 4876-4883, 5144-5146, 5152-5176, 5193- 5194, 6666-6680, 6695-6696, 6702-6787, 6804-6822, 6973, 7050-7053, 7134-7257, 7884-7902, 7907-7916, 7950-7951, 8001, 8025-8026, 8707, 8711, 8723-8724, 8782-RNG043-WO1 PCT Application 8783, 8824, 8832-8833, 8858-8865, 9683-9698, 9837-9845, 9850, 10120-10139, 12126-12133, 12393-12395, 12401-12425, 12442-12443, 13912-13926, 13941-13942, 13948-14032, 14049-14067, 14216, 14292-14295, 14375-14498, 16886-17078, 17478- 17622, 17677-17756, 14831-14833, 14838, 14847, 14850-15460, 17079-17477, 17660- 17676, 19031-19080, 16414-16516, 17623-17659, 19081-19108, 16397-16413, 16195- 16320, 15779-15925, 15476-15778, 16321-16366, 16367-16396, 16705-16814, 16815- 16885, 16517-16704, 18949-19030, 14657-14716, 14778-14824, 14834, 14835-14836, 14839, 15461-15475, 14717-14777, 14841-14846, 18413-18936, 14499-14656, 18939, 15926-16178, 14837, 17757-18412, 14825-14830, 14840, 14848-14849, 16179-16194, 18937-18938, and 18940-18948 (Table A or Table B of U.S. Application No. 18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872) or Table 31A of PCT Publication WO2024044723A1 (SEQ ID NOs: 19543-19733 of said PCT).

37. The ncRNA variant of any one of claims 1-36, comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% sequence identity to any one of the sequences in Table A or Table B of U.S. Application No.18 / 087,673, or International Application No. PCT / US2023 / 061038, or International Application No. PCT / US2023 / 072872 or Table 31A of PCT Publication WO2024044723A1 (SEQ ID NOs: 19543-19733 of said PCT).

38. The ncRNA variant of any one of claims 1-37, comprising a sequence selected from RTX3_6342_msr_stem_var1 (SEQ ID NO: 19644), RTX3_6342_msr_stem_var20 (SEQ ID NO: 19663), RTX3_6342_msr_stem_var5 (SEQ ID NO: 19648), RTX3_6342_a1a2_var6 (SEQ ID NO: 19548), RTX3_6342_a1a2_var10 (SEQ ID NO: 19552), RTX3_6342_a1a2_var15 (SEQ ID NO: 19557), RTX3_6342_a1a2_var16 (SEQ ID NO: 19558), RTX3_6342_a1a2_var19 (SEQ ID NO: 19561), RTX3_6342_a1a2_var20 (SEQ ID NO: 19562), RTX3_6342_a1a2_var21 (SEQ ID NO: 19563), RTX3_6342_a1a2_var26 (SEQ ID NO: 19568), RTX3_6342_a1a2_var27 (SEQ ID NO: 19569), and RTX3_6342_a1a2_var32 (SEQ ID NO: 19574).RNG043-WO1 PCT Application 39. The ncRNA variant of any one of claims 1-38, comprising one or more modifications in RTX3_6342_msr_stem_var1 (SEQ ID NO: 19644), RTX3_6342_msr_stem_var20 (SEQ ID NO: 19663), RTX3_6342_msr_stem_var5 (SEQ ID NO: 19648), RTX3_6342_a1a2_var6 (SEQ ID NO: 19548), RTX3_6342_a1a2_var10 (SEQ ID NO: 19552), RTX3_6342_a1a2_var15 (SEQ ID NO: 19557), RTX3_6342_a1a2_var16 (SEQ ID NO: 19558), RTX3_6342_a1a2_var19 (SEQ ID NO: 19561), RTX3_6342_a1a2_var20 (SEQ ID NO: 19562), RTX3_6342_a1a2_var21 (SEQ ID NO: 19563), RTX3_6342_a1a2_var26 (SEQ ID NO: 19568), RTX3_6342_a1a2_var27 (SEQ ID NO: 19569), or RTX3_6342_a1a2_var32 (SEQ ID NO: 19574) compared to RTX3_6342_WT (SEQ ID NO: 19734).

40. The ncRNA variant of any one of claims 1-38, comprising a sequence selected from msR Spacer Del-1 (SEQ ID NO: 19939), msD Spacer Del-1 (SEQ ID NO: 19940), msD Spacer Del-2 (SEQ ID NO: 19941), and msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19942).

41. The ncRNA variant of any one of claims 1-38, comprising one or more modifications in msR Spacer Del-1 (SEQ ID NO: 19939), msD Spacer Del-1 (SEQ ID NO: 19940), msD Spacer Del-2 (SEQ ID NO: 19941), or msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19942) compared to WT R6342 ncRNA (SEQ ID NO: 19734).

42. The ncRNA variant of any one of claims 1-38, comprising a sequence selected from Alt1 msR Spacer Del- (SEQ ID NO: 19947)1, Alt1 msD Spacer Del-1 (SEQ ID NO: 19948), Alt1 msD Spacer Del-2 (SEQ ID NO: 19949), Alt1 msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19950), Alt1 msR Spacer Del-2 / msD Del-3 (SEQ ID NO: 19951), Alt1 msR Spacer Del-2 / msD Del-3 MS2 (SEQ ID NO: 19952), and Alt1 msR Spacer Del-2 / msD Del-3 U7 (SEQ ID NO: 19953).

43. The ncRNA variant of any one of claims 1-38, comprising one or more modifications in Alt1 msR Spacer Del- (SEQ ID NO: 19947)1, Alt1 msD Spacer Del-1 (SEQ ID NO: 19948), Alt1 msD Spacer Del-2 (SEQ ID NO: 19949), Alt1 msR Spacer Del-1 / msD Spacer Del-2 (SEQ ID NO: 19950), Alt1 msR Spacer Del-2 / msD Del-3 (SEQ ID NO: 19951), Alt1 msR Spacer Del-2 / msD Del-3 MS2 (SEQ ID NO: 19952), or Alt1 msR Spacer Del-2 / msD Del-3 U7 (SEQ ID NO: 19953) compared to WT R6342 ncRNA (SEQ ID NO: 19734).RNG043-WO1 PCT Application 44. The ncRNA variant of any one of claims 1-38, comprising a sequence selected from msR spacer del_30HA (SEQ ID NO: 19955), msR spacer del_45HA (SEQ ID NO: 19956), WT PAM mt, (SEQ ID NO: 19957) Alt del1+del2 PAM mt (SEQ ID NO: 19958), or Alt del1+del2+U7 PAM mt (SEQ ID NO: 19959), and Alt del1+del225bp ins (SEQ ID NO: 19960).

45. The ncRNA variant of any one of claims 1-38, comprising one or more modifications in msR spacer del_30HA (SEQ ID NO: 19955), msR spacer del_45HA (SEQ ID NO: 19956), WT PAM mt, (SEQ ID NO: 19957) Alt del1+del2 PAM mt (SEQ ID NO: 19958), or Alt del1+del2+U7 PAM mt (SEQ ID NO: 19959), or Alt del1+del225bp ins (SEQ ID NO: 19960)compared to WT R6342 ncRNA (SEQ ID NO: 19734).

46. The ncRNA variant of any one of claims 1-45, wherein the one or more modifications further comprises addition of 2’O methyl or phosphorothioate bond at the 5’ or 3’ end of the ncRNA variant.

47. The ncRNA variant of claim 46, wherein the one or more modifications further comprises the addition of the 2’O methyl or the phosphorothioate bond at both the 5’ and 3’ ends of the ncRNA variant.

48. A retron variant comprising the ncRNA variant of any one of claims 1-47 and an RNA encoding a first polymerase, optionally downstream of the msd of the ncRNA variant.

49. The retron variant of claim 48, wherein the first polymerase is a reverse transcriptase, optionally wherein the reverse transcriptase is originated from a naturally occurring retron or retron-like sequence.

50. The retron variant of claim 48 or 49, wherein the first polymerase is a reverse transcriptase selected from: EcoI-RT, Efe1-RT, Mva1-RT, Cex1-RT, Eco8-RT, Vap1- RT, and Vro1-RT.

51. The retron variant of claim 50, wherein the reverse transcriptase is originated from a same naturally occurring retron as the reference retron ncRNA.RNG043-WO1 PCT Application 52. A chimeric gene editing composition comprising: a. the ncRNA variant of any one of claims 1-47, or the retron variant of any one of claims 48-51, b. a nuclease or a first mRNA encoding the nuclease, c. a guide RNA (gRNA) associated with the nuclease, and d. optionally, a second polymerase or a second mRNA encoding the second polymerase.

53. The chimeric gene editing composition of claim 52, comprising the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a reverse transcriptase.

54. The chimeric gene editing composition of claim 52, comprising the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a DNA polymerase.

55. The chimeric gene editing composition of any one of claims 52-54, wherein the nuclease is a nickase.

56. The chimeric gene editing composition of claim 55, wherein the nickase comprises a Cas9 nuclease, a Cas9(D10A) nuclease, a TnpB nuclease, or a Cas12a nuclease.

57. The chimeric gene editing composition of any one of claims 52-56, wherein the ncRNA variant or the retron variant is linked to the gRNA directly or indirectly.

58. The chimeric gene editing composition of claim 57, wherein the ncRNA variant or the retron variant, the gRNA, and the first mRNA encoding the nuclease are linked directly or indirectly.

59. The chimeric gene editing composition of any one of claims 52-58, further comprising delivery vehicles.

60. The chimeric gene editing composition of claim 59, wherein the delivery vehicles encapsulate one or more components selected from:RNG043-WO1 PCT Application a. the ncRNA variant or the retron variant, b. the nuclease or the first mRNA encoding the nuclease, c. the gRNA associated with the nuclease, and d. optionally, the second polymerase or the second mRNA encoding the second polymerase.

61. The chimeric gene editing composition of claim 59 or 60, wherein the delivery vehicle is a lipid nanoparticle.

62. One or more polynucleotides comprising a coding sequence of the ncRNA variant of any one of claims 1-47 or the retron variant of any one of claims 48-51.

63. The one or more polynucleotides of claim 62, further comprising a coding sequence of a nuclease or a coding sequence of a gRNA.

64. The one or more polynucleotides of claim 62, further comprising a coding sequence of a nuclease and a coding sequence of a gRNA.

65. The one or more polynucleotides of any one of claims 62-64, further comprising a coding sequence of the first polymerase.

66. The one or more polynucleotides of any one of claims 62-65, further comprising a coding sequence of a second polymerase.

67. The one or more polynucleotides of any one of claims 62-66, further comprising one or more promoters, wherein each of the one or more promoters is operably linked to (i) the coding sequence of the ncRNA variant or the retron variant, (ii) a coding sequence of a nuclease, (iii) a coding sequence of a gRNA, (iv) a coding sequence of the first polymerase, or (v) a coding sequence of a second polymerase.

68. A vector comprising the one or more polynucleotides of any one of claims 62-67.

69. The vector of claim 68, wherein the vector is a plasmid or a viral vector, optionally wherein the viral vector is an AAV or lentiviral vector.RNG043-WO1 PCT Application 70. A method of editing a target DNA, comprising interacting the target DNA with the chimeric gene editing composition of any one of claims 52-61, the one or more polynucleotides of any one of claims 62-67, or the vector of claim 68 or 69.

71. The method of claim 70, wherein the ncRNA variant in the chimeric gene editing composition, the one or more polynucleotides, or the vector comprises a pair of homology arms specific to a target locus and specific to the target DNA.

72. The method of claim 70 or 71, wherein the interacting step is performed in vivo or in vitro.

73. A chimeric gene editing composition comprising: a. a non-coding RNA (ncRNA) comprising a single-stranded RNA comprising a polymerase template, b. a nickase or a first mRNA encoding the nickase, c. a guide RNA (gRNA) associated with the nickase, and d. optionally, a second polymerase or a second mRNA encoding the second polymerase.

74. The chimeric gene editing composition of claim 73, comprising the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a reverse transcriptase.

75. The chimeric gene editing composition of claim 73, comprising the second polymerase or the second mRNA encoding the second polymerase, wherein the second polymerase is a DNA polymerase.

76. The chimeric gene editing composition of any one of claims 73-75, wherein the nickase comprises a Cas9 nuclease, a Cas9(D10A) nuclease, a TnpB nuclease, or a Cas12a nuclease.

77. The chimeric gene editing composition of any one of claims 73-76, wherein the ncRNARNG043-WO1 PCT Application is linked to the gRNA directly or indirectly.

78. The chimeric gene editing composition of claim 77, wherein the ncRNA, the gRNA, and the first mRNA encoding the nickase are linked directly or indirectly.

Images