Monoclonal antibody against liver stem cells and use thereof

Abstract

The present invention relates to a monoclonal antibody against liver stem cells and a use thereof and, more specifically, to a monoclonal antibody and a use thereof for cell detection and cancer diagnosis, wherein the monoclonal antibody has a predetermined complementarity determination region and specifically binds to IP3R3 on the surface of naive human pluripotent stem cells, primed human pluripotent stem cells, liver stem cells, and human cancer cells.

Description

Monoclonal antibodies against liver stem cells and their uses

[0001] The present invention relates to a monoclonal antibody that binds to cell surface IP3R3.

[0002]

[0003] Human pluripotent stem cells (hPSCs) are cells with the ability to proliferate indefinitely and differentiate into all cells that make up the body. The first human pluripotent stem cells, human embryonic stem cells (hESCs), were established in 1998 from frozen human embryos by Dr. James Thomson's team in the United States. In 2007, human induced pluripotent stem cells (hiPSCs), which are similar to hESCs, were established through gene introduction by Dr. Shinya Yamanaka's team in Japan. Professor Austin Smith of Cambridge University further classified mammalian pluripotent stem cells into two different states, and said that different pluripotent stem cells can be isolated from the pre-implantation epiblast or the post-implantation epiblast before and after the fertilized egg is implanted in the uterus. He named the pre-implantation pluripotent stem cells naive pluripotency and the post-implantation pluripotency. Human pluripotent stem cells, which were first established by the teams of Dr. James Thomson and Dr. Shinya Yamanaka, are primed pluripotency stem cells and show different characteristics from naive pluripotency. Pure pluripotent stem cells and pseudo-pluripotent stem cells differ greatly in cell shape, growth rate, differentiation ability, degree of methylation, germline transmission ability, etc. The pseudo-state grows in a largely flat state and has a slow growth rate, but differentiation can be easily induced, and the pure state grows in a small dome shape and grows well even when separated into single cells with trypsin, has a fast growth rate, is not biased, and is expected to have the ability to differentiate into more cells, and is known to be a pluripotent stem cell with better germline transmission ability.Semi-pluripotent stem cells and pure pluripotent stem cells can be converted into each other depending on the culture method. Many research groups have reported culture methods that induce pure human pluripotent stem cells using LIF and various chemical inhibitors from semi-human pluripotent stem cells with well-established culture methods.

[0004] Human pure pluripotent stem cells can not only be used to study human preimplantation embryos, but compared to human quasi-pluripotent stem cells, they are easier to cultivate even for beginners because they can be cultured as single cells by trypsin treatment, and they are easy to gene edit, so they are expected to be pluripotent stem cells that can accelerate practical use. However, as research is still in its early stages, the characteristics of human pure pluripotent stem cells vary depending on each method, and the exact pure pluripotent state and characteristics have not been standardized. Therefore, pure, quasi-, and intermediate states are mixed in each culture method, and research and standardization of markers that can purely isolate and utilize pure human pluripotent stem cells are needed.

[0005] Calcium ions (Ca 2+ ) regulates various cellular functions such as proliferation, differentiation, secretion, inflammation, fertilization, muscle contraction, gene transcription, metabolism, apoptosis, and autophagy. Inositol 1,4,5-triphosphate (IP3) formed by external stimuli releases intracellular Ca into the endoplasmic reticulum. 2+ Binding to the release channel, Inositol 1,4,5-triphosphate receptor (IP3R), releases Ca from the endoplasmic reticulum. 2+are released to transmit signals and perform various functions. There are three different IP3Rs, type 1 (ITPR1 / IP3R1), type 2 (ITPR2 / IP3R2), and type 3 (ITPR3 / IP3R3), which are encoded by different genes. IP3R is approximately 2700 amino acids long and can be divided into three major regions: the cytoplasmic ligand-binding domain at the N terminus, the regulatory and binding domain in the middle, and the C-terminal portion that forms six transmembrane helices and forms an ion channel. IP3R isoforms share 75% homology but differ in tissue distribution and function. IP3R1 is the most common isoform expressed mainly in the nervous system, IP3R2 has a very restricted expression pattern and is expressed in cardiomyocytes, hepatocytes, secretory cells, and blood cells, and IP3R3 is generally expressed in rapidly dividing cells and not in normal hepatocytes.

[0006] Ca 2+ Signal transduction regulates both cell proliferation and apoptosis. Therefore, IP3R and Ca 2+ Dysregulation of signal transduction has been linked to many carcinogenic processes, including cancer cell growth, migration, proliferation, and survival. While the involvement of IP3R in apoptosis has been primarily attributed to IP3R1 and IP3R2, changes in IP3R3 expression are also involved in various cancer development. Interestingly, IP3R3 is involved in the development of various cancers by promoting apoptosis and promoting survival during cancer progression. 2+ Both signal transduction pathways are involved. First, IP3R3 transports Ca to mitochondria at the ER-mitochondrial contact site. 2+ It suppresses tumorigenesis by inducing apoptosis by transmitting signals. High IP3R3 protein levels are maintained by the tumor suppressors BAP1 and PTEN. BAP1 deubiquitinates IP3R3, and PTEN competes with FBXL2 to protect IP3R3 from FBXL2-dependent ubiquitination, thereby inhibiting IP3R3-mediated pro-apoptotic Ca 2+It promotes signal transduction. However, some studies have shown that IP3R3 induces anti-apoptotic activity, thereby inducing cell proliferation, survival, migration, and invasion in cancer cells. If IP3R3 expression is elevated to cope with situations where apoptosis is promoted, high IP3R3 expression at the ER-mitochondrion contact site may cause resistance to apoptosis and promotion of proliferation, which may rather promote cancer development in clear cell renal cell carcinoma, cholangiocarcinoma, and hepatocellular carcinoma. In addition, IP3R3 maintains a cancer stem cell phenotype in bladder cancer cells by regulating CD44 expression, and Ca 2+ Induction of RELB expression promotes liver metastasis of colon cancer cells by inducing cell survival and resistance to anoikis. Therefore, IP3R3 promotes apoptosis-promoting Ca 2+ Ca that promotes signal transduction or promotes survival and proliferation 2+ It exhibits complex functions by facilitating signal transduction. Therefore, the fact that IP3R3 possesses seemingly conflicting mechanisms simultaneously suggests that much of its function remains unknown.

[0007] Integrins are glycoprotein receptors on the cell membrane that mediate cell-matrix or cell-cell adhesion and transmit signals that regulate gene expression and cell growth. Unlike other integrins, integrin β4 (ITGB4, CD104) possesses a long cytoplasmic tail and, together with integrin α6, binds to laminin in the integrin α6β4 form to form hemidesmosomes. ITGB4 is generally highly expressed in cancers and promotes cancer development by promoting anchorage-independent growth and invasion. Integrin β4 is phosphorylated by Met activated by HGF, activating the Shp2-Src-ERK signaling pathway to promote anchorage-independent growth. ITGB4 promotes lung metastasis of liver cancer by activating the FAK-AKT signaling pathway in conjunction with EGFR. ITGB4 also promotes migration, invasion, and metastasis of liver cancer through Slug expression. Higher expression of ITGB4 is associated with a poor prognosis in triple-negative breast cancer, pancreatic cancer, and non-small cell lung cancer. ITGB4 is also a molecule that promotes cancer cell recurrence and maintains cancer stemness in prostate cancer. ITGB4 is also known as a cancer stem cell marker that exhibits partial mesenchymal characteristics in triple-negative breast cancer. Its expression is regulated by ZEB1 and TAp63α, making it an important molecule for diagnosing cancer recurrence after treatment.

[0008] Liver transplantation is the only treatment available for chronic liver disease. Regenerative medicine using stem cells is considered the most effective technology to overcome these challenges. Therefore, active research is underway to use patient stem cells to obtain reliable cells necessary for liver regeneration. While hepatocytes for liver regeneration can be derived from induced pluripotent stem cells (iPSCs), directly reprogrammed cells, and small hepatocytes, further research is needed to determine their potential for treating chronic liver disease. Recently, chemically induced hepatic progenitor cells in rodents have emerged as a potential source for developing cell therapies and drug screening for various liver diseases. While specific markers for these various hepatic stem cell types have been proposed, no markers have been identified that can clearly distinguish between them. Furthermore, most of these results are derived from animal models, making it difficult to verify them in human-derived cells. Consequently, research on human hepatocyte proliferation is limited. We successfully transformed human-derived primary hepatocytes into human chemically derived hepatic progenitors (hCdHs), which have excellent proliferative potential, by treating them with small-molecule compounds. However, not all cells were transformed identically, so identifying a specific surface marker for hepatic stem cells is essential for efficiently isolating cells that have transformed into hepatic stem cells from the entire cell population. However, a marker capable of purely isolating hepatic stem cells has not yet been identified. In this invention, we aimed to identify antibodies capable of isolating hepatic stem cells using a library of monoclonal antibodies that recognize surface molecules of human pluripotent stem cells.This discovery strategy is based on the assumption that embryonic stem cells, which play a crucial role in early embryonic development as the origin of hepatic stem cells important for liver regeneration, remain in the liver after liver development and are activated when the liver is damaged to regenerate hepatocytes, and in addition to hepatocytes, they function as stem cells that regenerate biliary tract cells, pancreatic cells, and intestinal cells. This is because hepatic stem cells are likely embryonic remnants of embryonic stem cells remaining in the adult liver, and antibodies specific to hepatic stem cells can be discovered using antibody libraries specific to human embryonic stem cells, and using these antibodies, novel surface markers of hepatic stem cells can be discovered.

[0009] The present inventors induced pure human pluripotent stem cells using 2i / L / X / F / P medium according to a previously known method from quasi-pluripotent stem cells, and directly injected the cells into mice to produce a library of monoclonal antibodies that bind to pure human pluripotent stem cells. Among these antibodies, the NPB24 antibody exhibits universal pluripotent stem cell surface marker properties that simultaneously bind to pure human pluripotent stem cells and quasi-pluripotent stem cells. NPB24 does not bind to normal cells such as peripheral blood mononuclear cells or hepatocytes, but binds well to the surfaces of hepatic stem cells hCdHs and various cancer cells, including liver cancer. Analysis of the NPB24 antigen shows that NPB24 is an antibody that immunoprecipitates IP3R3 in hepatic stem cells, embryonic cancer cells, lung cancer, and liver cancer cells. In addition, NPB24 can immunoprecipitate ITGB4 together with IP3R3 in the same cells, demonstrating that this is due to the physical binding between IP3R3 and ITGB4. In this invention, we demonstrate that the NPB24 antibody is an antibody that can efficiently isolate liver stem cells from a mixture of compound-induced liver stem cells. In particular, when used in combination with the antibody NPB11 (Korean Patent Application No. 10-2023-0100927) that recognizes PODXL, only liver stem cells can be isolated from the mixture with high efficiency, and the liver stem cells thus isolated are significantly free of fibrotic cells, suggesting that they are suitable stem cells for liver stem cell transplantation.

[0010]

[0011] The present invention aims to provide a novel monoclonal antibody.

[0012] The purpose of the present invention is to provide a composition for cell detection comprising a novel monoclonal antibody.

[0013] The purpose of the present invention is to provide a composition for diagnosing cancer comprising a novel monoclonal antibody.

[0014]

[0015] 1. A monoclonal antibody comprising a heavy chain variable region comprising heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 1, heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 2, and heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 3; and a light chain variable region comprising light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 4, light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 5, and light chain complementary determining region 3 (LCDR3) of SEQ ID NO: 6.

[0016] 2. In the above 1, the heavy chain variable region is a monoclonal antibody having the sequence of sequence number 7.

[0017] 3. In the above 1, the light chain variable region is a monoclonal antibody having the sequence of sequence number 8.

[0018] 4. In the above 1, a monoclonal antibody that binds to IP3R3, a surface marker of pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells.

[0019] 5. A polynucleotide encoding the monoclonal antibody of 1 above.

[0020] 6. A polynucleotide comprising a polynucleotide of SEQ ID NO: 11 encoding HCDR1 in the above 5; a polynucleotide of SEQ ID NO: 12 encoding HCDR2; a polynucleotide of SEQ ID NO: 13 encoding HCDR3; a polynucleotide of SEQ ID NO: 14 encoding LCDR1; a polynucleotide of SEQ ID NO: 15 encoding LCDR2; and a polynucleotide of SEQ ID NO: 16 encoding LCDR3.

[0021] 7. A polynucleotide comprising a polynucleotide of sequence number 17 encoding a heavy chain variable region and a polynucleotide of sequence number 18 encoding a light chain variable region in the above 5.

[0022] 8. A vector containing the polynucleotide of 5 above.

[0023] 9. Hybridoma producing the monoclonal antibody of 1 above.

[0024] 10. A composition for detecting IP3R3 expressing cells comprising any one of the monoclonal antibodies 1 to 4 above.

[0025] 11. In the above 10, the IP3R3 expressing cells are pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells. A composition for detecting IP3R3 expressing cells.

[0026] 12. IP3R3 expression cell detection kit comprising the composition of the above 10.

[0027] 13. In the above 12, a kit for detecting IP3R3 expressing cells for detecting pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells.

[0028] 14. A composition for diagnosing cancer comprising the monoclonal antibody of the above 1.

[0029] 15. A composition for diagnosing cancer, wherein the cancer in the above 14 is human embryonic cancer, lung cancer, pancreatic cancer or liver cancer.

[0030] 16. A method for selecting liver stem cells, comprising: a step of treating a sample with the monoclonal antibody of the above 1; and a step of treating the sample with a PODXL antibody, wherein the PODXL antibody comprises a heavy chain variable region comprising heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 19, heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 20, and heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 21; and a light chain variable region comprising light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 22, light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 23, and light chain complementary determining region 3 (LCDR3) of SEQ ID NO: 24.

[0031]

[0032] The monoclonal antibody of the present invention binds to pure and quasi-human pluripotent stem cells, but does not bind to mesenchymal stem cells, hepatocytes, and peripheral blood monocytes, and thus can be used as a means for selecting pluripotent stem cells.

[0033] The monoclonal antibody of the present invention binds to IP3R3 on the cell surface. It can be used as a means for detecting pure human pluripotent stem cells, quasi-human pluripotent stem cells, and liver stem cells expressing IP3R3 on their surface.

[0034] The monoclonal antibody of the present invention binds to IP3R3 expressed on the surface of cancer cells and thus can be used for the diagnosis of cancer.

[0035] The monoclonal antibody of the present invention can select compound-derived liver stem cells. The selected liver stem cells possess the ability to differentiate into highly efficient hepatocytes and biliary epithelial cells, and can serve as a source of liver stem cells for liver regeneration, making them useful for the treatment of liver diseases. In particular, when used in conjunction with the NPB11 antibody (Korean Patent Application No. 10-2023-0100927), liver stem cells can be selected more effectively. These selected liver stem cells significantly eliminate fibrosis, making them useful for the treatment of liver diseases.

[0036]

[0037] Figure 1a shows the culture of H9 cells, which are human pluripotent stem cells (hPSCs), in three culture media (2i / L / X / F / P, 2i / L / F / A, 5i / LAF) that induce primed H9 cells and naive H9 cells. In the naive H9 medium, small dome-shaped naive H9 cells can be seen.

[0038] Figure 1b shows the growth of primed human pluripotent stem cells (primed H9), naive human pluripotent stem cells (naive H9) induced in 2i / L / F / A or 5i / LAF medium, mouse embryonic fibroblasts (MEFs), and 10 -5The expression level of NPB24 was confirmed by flow cytometry in H9 cells that were differentiated by treatment with M retinoic acid (RA-H9) for 7 days. The shaded background represents the negative control, and the solid line indicates NPB24 binding.

[0039] Figure 2 shows the extent to which the NPB24 antibody of the present invention binds to various cell lines or primary cells through flow cytometry. It shows the extent to which the NPB24 antibody binds to the surface of most cancer cells, including human embryonal carcinoma cells (NT-2 / D1, 2102EP), human embryonic kidney cells (HEK293FT), human lung cancer cells (A549, NCI-H460, Calu-3), human pancreatic cancer cells (PANC-1, BxPC-3, SNU-213), and human hepatoma cells (HepG2, Huh-7, SNU-387, SNU-449). In addition, it shows that NPB24 does not bind to bone marrow-derived mesenchymal stem cells (BM-MSC), human primary hepatocytes (hPHs), and peripheral blood mononuclear cells (PBMC), but binds to the surface of human hepatic stem cells (hCdHs).

[0040] Figures 3a to 3c illustrate the cloning of the antibody gene of NPB24. Figure 3a shows the DNA of the heavy and light chain variable regions of the NPB24 antibody amplified through PCR from the cDNA of NPB24 hybridoma cells.

[0041] Figure 3b shows the results of cloning the variable region of the NPB24 antibody heavy chain into the pBluescript KS+ vector and digesting it with EcoRI and SalI restriction enzymes.

[0042] Figure 3c shows the results of cloning the variable region of the NPB24 antibody light chain into the pBluescript KS+ vector and cutting it with HindIII and SalI restriction enzymes.

[0043] Figure 4 shows the base sequence and amino acid sequence of the NPB24 heavy chain gene variable region, with the CDR (Complementarity Determining Region) that binds to the antigen underlined.

[0044] Figure 5 is a diagram showing the base sequence and amino acid sequence of the NPB24 light chain gene variable region, with the CDR (Complementarity Determining Region) that binds to the antigen underlined.

[0045] Figures 6a to 6e are pictures showing the purification of NPB24 from NPB24 hybridoma cell culture solution and the results confirmed by Western blotting. Figure 6a shows the purity of NPB24 purified through a mouse IgM prepacked column (LigaTrap) and confirmed by electrophoresis and PageBlue staining. HC stands for immunoglobulin heavy chain, and LC stands for immunoglobulin light chain.

[0046] Figure 6b shows the result of Western blotting of purified NPB24 as in Figure 6a, and then confirming it using mIgM (μ chain-specific)-HRP secondary antibody, confirming that NPB24 is an IgM antibody having the μ chain of an IgM antibody.

[0047] Figure 6c shows NPB24 purified using Protein G agarose beads, which was confirmed through electrophoresis and PageBlue staining.

[0048] Figure 6d shows the result of Western blotting of NPB24 of Figure 6c using mIgG-(H+L)-HRP secondary antibody, confirming that NPB24 is an antibody that contains a Kappa chain but does not have an IgG heavy chain.

[0049] Figure 6e confirms the NPB24 antibody of Figure 6c using an mIgM (μ chain-specific)-HRP secondary antibody, reconfirming that NPB24 is an IgM antibody having the μ chain of an IgM antibody.

[0050] Figures 7a to 7d show the results of gene amplification by PCR for producing a chimeric NPB24 antibody, and Figure 7a shows the results of DNA amplification of the heavy chain leader sequence (HC-SP1,2) and variable region (VH1,2).

[0051] Figure 7b shows the PCR results confirming the connection between the heavy chain signal peptide (SP) sequence and the variable region (VH) using recombinant PCR.

[0052] Figure 7c shows the DNA amplification results of the light chain SP sequence (LC-SP1,2) and variable region (Vk1,2).

[0053] Figure 7d shows the PCR results confirming the linkage of the light chain SP sequence and the variable region (Vk) using recombinant PCR.

[0054] Figure 8a shows the results of confirming the chimeric NPB24 antibody heavy chain variable region (VH) and vector DNA cleaved by EcoR1 / Apa1 to produce a chimeric NPB24 antibody expression vector.

[0055] Figure 8b shows the results of confirming the chimeric NPB24 antibody light chain variable region (Vk) and vector DNA cleaved by HindIII / BsiWI to produce a chimeric NPB24 antibody expression vector.

[0056] Figure 8c is a diagram showing the completed chimeric NPB24 expression vector.

[0057] Figure 9a shows the heavy chain amino acid sequence (SEQ ID NO: 9) of the chimeric NPB24 antibody, confirming that the signal sequence and the antibody heavy chain variable region are linked, and that the variable region of the NPB24 mouse monoclonal antibody and the human heavy chain constant region are correctly linked.

[0058] Figure 9b shows the light chain amino acid sequence (SEQ ID NO: 10) of the chimeric NBP24 antibody, confirming that the signal sequence and the antibody light chain variable region are linked and that the variable region of the NPB24 mouse monoclonal antibody and the human light chain constant region are correctly linked.

[0059] Figure 10a shows the results of SDS-PAGE and PageBlue staining performed on human antibody IgG control and chimeric antibody Chi-NPB24 during the purification process of the Chi-NPB24 antibody. HC stands for immunoglobulin heavy chain, and LC stands for immunoglobulin light chain.

[0060] Figure 10b shows the results of Western blot analysis performed on a human antibody IgG control and chimeric antibody Chi-NPB24 during the purification process of the Chi-NPB24 antibody. The secondary antibody was used to bind to the IgG gamma and kappa chains of the human antibody. HC stands for immunoglobulin heavy chain, and LC stands for immunoglobulin light chain.

[0061] Figure 10c shows the results of flow cytometry analysis performed to analyze binding to hCdHs using purified Chi-NPB24. It was confirmed that, similar to NPB24, it does not bind to the surface of human primary hepatocytes (hPHs), but binds to hCdHs, NT-2 / D11, 2102Ep, A549, SNU449, and SNU387 cells.

[0062] Figure 11a is a drawing showing that, in order to identify the antigen immunoprecipitated by the NPB24 antibody, the 2102Ep cell lysate, whose cell surface was labeled with biotin, was immunoprecipitated with NPB24, developed on an SDS-PAGE gel, transferred to a nitrocellulose membrane, and then the size of the NPB24 antigen (arrow) was confirmed with streptavidin-horse radish peroxidase (SA-HRP).

[0063] Figure 11b is a drawing showing the size of the target antigen (arrow) for LC-MS / MS analysis after immunoprecipitating 2102Ep cells with NPB24 and staining with PageBlue to identify the antigen immunoprecipitated by the NPB24 antibody.

[0064] Figures 11c to 11e are drawings in which the peptide sequence obtained as a result of LC-MS / MS is underlined to indicate a portion that matches the amino acid sequence of Inositol 1,4,5-trisphosphate receptor type 3 (ITPR3).

[0065] Figure 12a shows the results of Western blotting using an α-IP3Rs antibody that can recognize three proteins, IP3R1, IP3R2, and IP3R3, after immunoprecipitation with NPB24(M) in 2102EP cells, confirming that the NPB24 antibody precipitates IP3Rs proteins.

[0066] Figure 12b is a Western blot result showing that all proteins immunoprecipitated with NPB24(G) antibody purified through Protein G beads in lung cancer cells A549, NPB24(M) antibody purified through Ligatrap column, chimeric NPB24 antibody Chi-NPB24, α-IP3Rs, and α-IP3R3 antibody were recognized by IP3R3 antibody, confirming that NPB24 antibody precipitates IP3R3 protein.

[0067] Figure 12c is a Western blot result confirming that IP3R3 protein was precipitated in the same manner as α-IP3Rs or α-IP3R3 antibody in all of NPB24(G), NPB24(M), and Chi-NPB24 in SNU-449 liver cancer cells.

[0068] Figure 12d is a Western blot result confirming that the proteins precipitated by NPB24(G), NPB24(M), Chi-NPB24 in hCdHs cells derived from adult hepatocytes and the proteins precipitated by IP3R3 antibody are the same.

[0069] Figure 12e is a Western blot result confirming that proteins precipitated by NPB24 antibody groups, including NPB24(G), NPB24(M), and Chi-NPB24, in fetal liver-derived hCdHs cells isolated from human fetal liver are detected by IP3R3 antibody. The arrow indicates IP3R3 immunoprecipitated by the antibody.

[0070] Figure 13a is a Western blot result showing that after transfection of HEK293FT cells with an ITPR3-FLAG expression vector having a FLAG tag, and immunoprecipitation with Input, Isotype antibody, NPB24, anti-IPRR3, and anti-FLAG, respectively, the antigen was confirmed at the same position as the anti-IP3R3 and anti-FLAG antibodies, confirming that NPB24 directly recognizes and immunoprecipitates IP3R3. The arrow indicates IP3R3 immunoprecipitated by the antibody.

[0071] Figure 13b is a Western blot result showing that the chimeric antibody Chi-NPB24 directly recognizes and immunoprecipitates IP3R3, as the antigen was identified at the same position as anti-IP3R3 and anti-FLAG after exogenous transfection of HEK293FT cells with an ITPR3-FLAG expression vector having a FLAG tag and immunoprecipitation was performed with input, isotype antibody, Chi-NPB24, anti-IPRR3, and anti-FLAG, respectively. The arrow indicates IP3R3 immunoprecipitated by the antibody.

[0072] Figure 14a is a drawing showing that, in order to confirm the antigen immunoprecipitated by the NPB24 antibody, 2102Ep cell lysate labeled on the cell surface with biotin was immunoprecipitated with NPB24 and Chi-NPB24, then developed on an SDS-PAGE gel, transferred to a nitrocellulose membrane, and the size of the NPB24 antigen was confirmed with streptavidin-horse radish peroxidase (SA-HRP).

[0073] Figure 14b is a diagram showing the size of the target antigen to be immunoprecipitated by NPB24 antibody, followed by PageBlue staining of 2102Ep cells and LC-MS / MS analysis to identify the antigen immunoprecipitated by NPB24 antibody.

[0074] Figures 14c to 14e are drawings in which the peptide sequence obtained as a result of LC-MS / MS is underlined to indicate a portion that matches the amino acid sequence of Integrin β4 (ITGB4).

[0075] Figure 15a shows the results of Western blotting after target protein precipitation with NPB24 antibody in 2102EP cells and confirmation using ITGB4 antibody. It was confirmed that ITGB4 protein was precipitated by all of the NPB24(G) antibody purified with Protein G beads, NPB24(M) purified with LigaTrap, and chimeric NPB24 antibody (Chi-NPB24) purified with Protein G beads.

[0076] Figure 15b shows the results of Western blotting after immunoprecipitating the target protein using NPB24(M) antibody and ITGB4 antibody in lung cancer cells A549, confirming that NPB24(M) antibody precipitates ITGB4 protein.

[0077] Figure 15c shows the results of Western blotting after immunoprecipitating the target protein using NPB24(M) antibody and ITGB4 antibody in liver cancer cells SNU449, confirming that NPB24(M) antibody precipitates ITGB4 protein.

[0078] Figure 15d shows the results of Western blotting after immunoprecipitating target proteins using NPB24(M) antibody and ITGB4 antibody in hepatic stem cells hCdHs, confirming that NPB24(M) antibody precipitates ITGB4 protein.

[0079] Figure 15e shows the results of immunoprecipitation of a target antigen using an antibody in A549 cells, followed by confirmation of a protein immunoprecipitated using a known rabbit α-ITGB4 antibody. It was confirmed that the chimeric NPB24 antibody (Chi-NPB24) precipitates ITGB4 protein in the same manner as NPB24.

[0080] Figure 15f shows the immunoprecipitated protein using a known rabbit α-ITGB4 antibody after immunoprecipitation of the target antigen using an antibody in SNU449 cells, and it was confirmed that the chimeric NPB24 antibody (Chi-NPB24) precipitated the ITGB4 protein in the same manner as NPB24.

[0081] Figure 16a shows the results of Western blot analysis using rabbit α-IP3R3 and rabbit α-ITGB4 antibodies to confirm the immunoprecipitated proteins by each antibody, α-IP3Rs, α-IP3R3, and α-ITGB4, in lung cancer cells A549.

[0082] Figure 16b shows the results of Western blotting using rabbit α-IP3R3 and rabbit α-ITGB4 antibodies to immunoprecipitate proteins from SNU449 hepatoma cells by antibodies against α-IP3Rs, α-IP3R3, and α-ITGB4, respectively. ITGB4 does not precipitate IP3R3, but IP3R3 precipitates ITGB4 protein, demonstrating that IP3R3 and ITGB4 proteins physically bind to each other.

[0083] Figure 17a shows the results of flow cytometry analysis confirming the binding affinity of NPB24 (G), NPB24 (M), Chi-NPB24, anti-ITPR3, and anti-Flag antibodies on the surface of cancer cells after exogenous transfection and overexpression (OE) of the ITPR3-Flag expression vector in A549 lung cancer cells. Each represents a negative control group containing only secondary antibodies (2nd only), an antibody reacted by transducing only PEI without an exogenous expression vector (Control), and an antibody reacted after exogenous transfection of ITPR3-Flag (ITPR3 OE).

[0084] Figure 17b shows the results of flow cytometry analysis confirming the binding affinity of NPB24(G), NPB24(M), Chi-NPB24, anti-ITPR3, and anti-Flag antibodies on the surface of cancer cells after exogenous transfection of the ITPR3-Flag expression vector into SNU449 liver cancer cells. Each represents a negative control group containing only secondary antibodies (2nd only), an antibody reacted by transducing only PEI without an exogenous expression vector (Control), and an antibody reacted after exogenous transfection of ITPR3-Flag (ITPR3 OE).

[0085] Figure 17c is a graph quantitatively obtained by averaging the results of Figure 17a twice.

[0086] Figure 17d is a graph quantitatively obtained by averaging the results of Figure 17b twice.

[0087] Figure 18a shows the results of flow cytometry analysis confirming the degree of binding of the NPB24 antibody group to the surface protein of siITPR3 knockdown A549 lung cancer cells. The results show a negative control group containing only the secondary antibody (2nd only), antibodies reacting after cells were treated with control siRNA (siCon), and antibodies reacting after cells were treated with siRNA against ITPR3 (siITPR3).

[0088] Figure 18b is a graph quantitatively obtained by averaging the results of Figure 18a twice.

[0089] Figure 18C shows the results of flow cytometry analysis confirming the degree of binding of the NPB24 antibody group to internal proteins of siITPR3 knockdown A549 lung cancer cells. Respectively, the negative control group containing only the secondary antibody (2nd only), the antibodies reacting after cells were treated with control siRNA (siCon), and the antibodies reacting after cells were treated with siRNA against ITPR3 (siITPR3) are shown.

[0090] Figure 18d is a graph quantitatively obtained by averaging the results of Figure 18c twice.

[0091] Figures 19a and 19b are pictures showing the fluorescence of the binding to the surface of each cell using immunocytochemistry using NPB24 antibody on compound-derived hepatocytes (hCdHs), human primary hepatocytes (hPHs), compound-derived hepatocyte-differentiated hepatocytes (hCdH-Heps), fibrotic hCdHs, human dermal fibroblasts (HDFs), neonatal human foreskin fibroblasts (hNuFFs), human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs), and adipose-derived mesenchymal stem cells (Adipose-MSCs). Red fluorescence indicates the binding of NPB24, and Hoechst staining indicates the nucleus of the cells. It is dyed blue. Scale bar = 50 ㎛.

[0092] Figure 20a shows the morphological changes (scale bar = 100 μm) of compound-derived hepatic stem cells separated into negative (unlabeled) and positive (labeled) cell groups by MACS using beads attached to NPB24 antibody.

[0093] Figure 20b shows the separation efficiency of compound-derived liver stem cells isolated from NPB24 of the present invention through flow cytometry analysis.

[0094] Figure 21 shows the group of cells simultaneously stained with NPB11 and Chi-NPB24 by performing double staining of hCdHs with NPB11 and Chi-NPB24 using flow cytometry.

[0095] Figure 22a shows the morphological changes (scale bar = 100 μm) of the negative (unlabeled) and positive cell groups (labeled) separated by first attaching beads to NPB11 antibody and then isolating NPB11 positive cells using MACS to increase the purity of compound-derived stem cells, and then attaching beads to NPB24 antibody and then further separating these cells using MACS for a second time.

[0096] Figure 22b shows the separation efficiency of NPB24-positive cells from compound-derived liver stem cells that were first separated by NPB11 antibody and then separated again by NPB24 antibody through flow cytometry.

[0097] Figure 23 shows the results of immunocytochemical fluorescence analysis of liver stem cell marker proteins in the negative / positive cell group, which was first separated with NPB11 antibody and then secondarily separated with NPB24 antibody to increase the purity of compound-derived liver stem cells (scale bar = 50 μm).

[0098] Figures 24a and 24b show the results of a quantitative comparison of the relative gene expression levels of liver stem cell markers in the NPB11 / NPB24 antibody-negative / positive cell groups, in which positive cells were first isolated with NPB11 antibody and then secondarily isolated with NPB24 antibody to increase the purity of compound-derived liver stem cells (data are presented as mean ± standard deviation). ** indicates p < 0.01, **** indicates p < 0.0001.

[0099] Figure 25 shows the results of a quantitative comparison of the relative gene expression levels of cell fibrosis-related markers in NPB11 / NPB24 antibody-negative / positive cell groups, in which positive cells were first isolated with NPB11 antibody and then secondarily isolated with NPB24 antibody to increase the purity of compound-derived stem cells (data are presented as mean ± standard deviation). ns indicates not significant, **** indicates p value <0.0001.

[0100]

[0101] The present invention provides a monoclonal antibody comprising a heavy chain variable region comprising a heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 1, a heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 2, and a heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 3; and a light chain variable region comprising a light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 4, a light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 5, and a light chain complementary determining region 3 (LCDR3) of SEQ ID NO: 6.

[0102] The monoclonal antibody of the present invention binds to IP3R3. IP3R3 refers to IP3 receptor subtype 3. In the present invention, the term "monoclonal antibody" may be expressed as "IP3R3 antibody," "anti-IP3R3 antibody," and "IP3R3 monoclonal antibody."

[0103] The monoclonal antibody of the present invention includes not only forms of IgG subclasses of IgG1 to IgG4 having the same complementarity determining region (CDR), but also functional fragments of antibody molecules such as Fab, F(ab'), F(ab')2 and Fv.

[0104] The monoclonal antibodies of the present invention include chimeric antibodies, humanized antibodies, etc.

[0105] In one embodiment, the monoclonal antibody of the present invention is an 'NPB24 antibody', 'NPB24' or 'Chi-NPB24 antibody'.

[0106] IP3R3 antibody binds to the IP3R3 protein on the surface of pure human pluripotent stem cells, quasi-human pluripotent stem cells, liver stem cells, and cancer cells.

[0107] Naive human pluripotent stem cells (NPS) are preimplantation human pluripotent stem cells, possessing naive or ground-state pluripotency. Postimplantation human pluripotent stem cells are primed human pluripotent stem cells, possessing pluripotency in a primed state.

[0108] Pure human pluripotent stem cells are distinguished from quasi-pluripotent stem cells, which grow in a colony-like formation by separating individual cells into small, dome-shaped clusters. Pure human pluripotent stem cells can be further subdivided into ground-state stem cells and intermediate, formative, or naive-like pure pluripotent stem cells.

[0109] Hepatic stem cells (HSCs) can refer to stem cells that have been reprogrammed into hepatocytes by treating human primary hepatocytes (hPHs) with specific compounds. These cells can also be referred to as human chemically derived hepatic progenitors (hCdHs).

[0110] Cancer cells express IP3R3 on their cell surface, but are not limited to specific cancers. Examples include liver cancer, pancreatic cancer, osteosarcoma, skin cancer, lung cancer, human embryonal cancer, neuroblastoma, uterine cancer, kidney cancer, prostate cancer, breast cancer, colon cancer, stomach cancer, biliary tract cancer, kidney cancer, bladder cancer, ovarian cancer, and brain tumors.

[0111] The IP3R3 antibody of the present invention has heavy and light chain CDRs of SEQ ID NOs: 1 to 6, and the other sequences are not limited to a specific one. For example, the heavy chain sequence of the IP3R3 antibody of the present invention may include the sequence of the heavy chain variable region of SEQ ID NO: 7 (Figure 4), and the light chain sequence of the IP3R3 antibody of the present invention may include the sequence of the light chain variable region of SEQ ID NO: 8 (Figure 5).

[0112] The amino acid sequences of sequence numbers 1 to 8 are as shown in Table 1.

[0113] Sequence numberAmino acid sequence1Ser Tyr Gly Val Ser2Val Ile Trp Gly Asp Gly Ser Thr Asn Tyr His Ser Ala Leu Ile Ser3Tyr Tyr Gly Tyr Pro Trp Phe Ala Tyr4Ser Ala Ser Ser Ser Val Ser Tyr Met His5Asp Thr Ser Lys Leu Ala Ser6Gln Gln Trp Ser Ser Asp Pro Pro Thr7Glu Val Lys Leu Glu Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Ser Tyr Gly Val Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Asp Gly Ser Thr Asn Tyr His Ser Ala Leu Ile Ser Arg Leu Arg Ile Ser Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Leu Asn Ser Leu Gln Thr Asp Asp Thr Ala Thr Tyr Tyr Cys Ala Asn Tyr Tyr Gly Tyr Pro Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala8Asp Ile Val Ile Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile His Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr IleSer Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

[0114] A monoclonal antibody is a protein molecule that specifically binds to a single antigenic site (a single epitope). The monoclonal antibody of the present invention specifically binds to IP3R3, a cell surface molecule found on pure human pluripotent stem cells, quasi-human pluripotent stem cells, liver stem cells, and cancer cells.

[0115] The main parts of antibodies that recognize specific epitopes of an antigen and form antigen-antibody complexes are the variable regions of the heavy and light chains, especially the complementarity determining regions (CDRs), which contribute to the formation of these complexes.

[0116] The present invention provides a polynucleotide encoding an IP3R3 antibody.

[0117] 'Polynucleotide' is used interchangeably with 'nucleic acid', 'nucleic acid molecule' and 'oligonucleotide'.

[0118] Polynucleotides include polymers of phosphate esters of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymine or deoxycytidine) in single-stranded or double-stranded helices or any of their phosphate ester analogs such as phosphorothioates and thioesters.

[0119] Double helix DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. DNA or RNA molecules refer only to the primary and secondary structures of the molecule and are not limited to any specific tertiary structure.

[0120] The polynucleotide of the present invention may be a polynucleotide comprising a polynucleotide of SEQ ID NO: 11 encoding HCDR1; a polynucleotide of SEQ ID NO: 12 encoding HCDR2; a polynucleotide of SEQ ID NO: 13 encoding HCDR3; a polynucleotide of SEQ ID NO: 14 encoding LCDR1; a polynucleotide of SEQ ID NO: 15 encoding LCDR2; and a polynucleotide of SEQ ID NO: 16 encoding LCDR3.

[0121] The polynucleotide of the present invention may include a polynucleotide of SEQ ID NO: 17 encoding a heavy chain variable region and a polynucleotide of SEQ ID NO: 18 encoding a light chain variable region.

[0122] The polynucleotide sequences of sequence numbers 11 to 18 are as shown in Table 2.

[0123] 서열번호폴리뉴클레오티드 서열11AGC TAT GGT GTA AGC12GTA ATA TGG GGT GAC GGG AGC ACA AAT TAT CAT TCA GCT CTC ATA TCC13TAC TAT GGT TAC CCC TGG TTT GCT TAC14AGT GCC AGC TCA AGT GTA AGT TAC ATG CAC15GAC ACC TCC AAA CTG GCT TCT16CAG CAG TGG AGT AGT GAC CCT CCG ACG17GAA GTT AAG CTG GAG GAG TCA GGA CCT GGC CTG GTG GCG CCC TCA CAG AGC CTG TCC ATC ACA TGC ACT GTC TCA GGG TTC TCA TTA ACC AGC TAT GGT GTA AGC TGG GTT CGC CAG CCT CCA GGA AAG GGT CTG GAG TGG CTG GGA GTA ATA TGG GGT GAC GGG AGC ACA AAT TAT CAT TCA GCT CTC ATA TCC AGA CTG CGC ATC AGC AAA GAT AAC TCC AAG AGC CAA GTT TTC TTA AAA CTG AAC AGT CTG CAA ACT GAT GAC ACA GCC ACG TAC TAC TGT GCC AAC TAC TAT GGT TAC CCC TGG TTT GCT TAC TGG GGC CAA GGG ACT CTG GTC ACT GTC TCT GCA18GAT ATT GTG ATC ACC CAA TCT CCA GCA ATC ATG TCT GCA TCT CCA GGG GAG AAG GTC ACC ATG ACC TGC AGT GCC AGC TCA AGT GTA AGT TAC ATG CAC TGG TAC CAG CAG AAG TCA GGC ACC TCC CCC AAA AGA TGG ATT CAT GAC ACC TCC AAA CTG GCT TCT GGA GTC CCT GCT CGC TTC AGT GGC AGT GGG TCT GGG ACT TCT TAC TCTCTC ACA ATC AGC AGC ATG GAG GCT GAA GAT GCT GCC ACT TAT TAC TGC CAG CAG TGG AGT AGT GAC CCT CCG ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA

[0124] The present invention provides a vector comprising a polynucleotide encoding an IP3R3 antibody.

[0125] 'Vector' includes viral and non-viral vehicles for introducing nucleic acids into cells in vitro, ex vivo or in vivo.

[0126] The present invention provides a hybridoma that produces an IP3R3 antibody.

[0127] A hybridoma is a cell created by artificially fusing two different cell types. A hybridoma is a cell or cell line that combines the different functions of two or more homologous or heterologous cells, using a fusion-inducing agent like polyethylene glycol (PEG) or a virus. This fusion process allows the fusion of two or more cells, either homologous or heterologous, into a single cell. Hybridomas include hybridoma cells or hybridoma cell lines.

[0128] One embodiment of the present invention is a hybridoma producing a monoclonal antibody. This is 2×10 6 The same number of H9 quasi-human pluripotent stem cells and H9 pure human pluripotent stem cells are injected into the right and left footpads of a mouse, respectively, and then the cells from the left lymph node of the mouse are fused with FO myeloma cells to produce hybridomas. Hybridomas can be cultured in large quantities in vitro or in vivo.

[0129] Monoclonal antibodies produced by hybridomas can be used unpurified, but it is preferable to purify them to a high purity (e.g., 95% or higher) using conventional methods. Purification methods include gel electrophoresis, dialysis, salt precipitation, and chromatography.

[0130] In one embodiment of the present invention, the culture medium of hybridoma can be purified by affinity chromatography using protein G-agarose beads.

[0131] The present invention provides a composition for detecting cells expressing IP3R3, comprising an IP3R3 antibody.

[0132] A cell expressing IP3R3 refers to any cell on which the IP3R3 protein, an antigen recognizable by the IP3R3 antibody of the present invention, is expressed on the cell surface. In one embodiment of the present invention, an antibody binding to pure human pluripotent stem cells, quasi-human pluripotent stem cells, liver stem cells, and cancer cells was prepared, and it was confirmed that the antigen of this antibody was IP3R3. Since the IP3R3 antibody of the present invention recognizes and binds to IB4AP on the cell surface, cells expressing IP3R3 can be detected by an antigen-antibody reaction.

[0133] The present invention provides a kit for detecting cells expressing IP3R3, comprising an IP3R3 antibody.

[0134] The antibody of the present invention and / or a composition comprising the antibody can be used not only to remove human pluripotent stem cells or liver stem cells from cells to be transplanted or transplanted through an antigen-antibody complex reaction, but can also be used to specifically detect human pluripotent stem cells or liver stem cells.

[0135] The detection kit includes the IP3R3 antibody of the present invention and conventional tools, reagents, etc. used in immunological analysis. Conventional tools and reagents include, but are not limited to, a suitable carrier, a label capable of generating a detectable signal, a solubilizer, a detergent, a buffer, a stabilizer, etc.

[0136] If the labeling agent is an enzyme, it may include a substrate and a reaction terminator that can measure enzyme activity. Suitable carriers include soluble carriers such as buffers such as PBS; polymers such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharides, and magnetic microparticles plated with metal on latex; and insoluble carriers such as other paper, glass, metal, agarose, and combinations thereof.

[0137] Antigen-antibody complex formation can be detected by, but is not limited to, tissue immunostaining, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation assay, immunodiffusion assay, complement fixation assay, flow cytometry, and protein chip.

[0138] The present invention provides a cancer diagnostic composition comprising an IP3R3 antibody. The IP3R3 antibody specifically binds to the IP3R3 protein of cancer cells, and since the IP3R3 protein is overexpressed in various cancer cells, if the IP3R3 antigen is identified in a target cell, there is a high probability that the cell is a cancer cell.

[0139] When a composition containing an IP3R3 antibody is treated to cancer cells expressing IP3R3, the IP3R3 antibody binds to the IP3R3 antigen of the cancer cells to form an antigen-antibody complex, so that the cancer cells can be classified into cancer cells that bind to the IP3R3 antibody and normal cells that do not bind to the IP3R3 antibody.

[0140] The present invention also provides a method for selecting liver stem cells, comprising a step of treating a sample with an IP3R3 antibody and a PODXL antibody.

[0141] The PODXL antibody may comprise a heavy chain variable region comprising heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 19, heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 20, and heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 21; and a light chain variable region comprising light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 22, light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 23, and light chain complementary determining region 3 (LCDR3) of SEQ ID NO: 24.

[0142] PODXL stands for podocalyxin-like protein 1. 'PODXL antibody' refers to an antibody that recognizes the PODXL protein as an antigen, and 'anti-PODXL antibody' and 'PODXL monoclonal antibody' also have the same meaning.

[0143] 'PODXL antibodies' include not only forms of IgG subclasses of IgG1 to IgG4 having the same complementarity determining region (CDR), but also functional fragments of antibody molecules such as Fab, F(ab'), F(ab')2 and Fv.

[0144] 'PODXL antibodies' include chimeric antibodies and humanized antibodies.

[0145] 'NPB11 antibody' is an example of a PODXL antibody.

[0146] The PODXL antibody of the present invention has heavy and light chain CDRs of SEQ ID NOs: 19 to 24, and the other sequences are not limited to a specific one. For example, the heavy chain sequence of the PODXL antibody may include the sequence of the heavy chain variable region of SEQ ID NO: 25, and the light chain sequence of the PODXL antibody may include the sequence of the light chain variable region of SEQ ID NO: 26.

[0147] The amino acid sequences of sequence numbers 19 to 26 are as shown in Table 3.

[0148] Sequence numberAmino acid sequence19Gly Phe Thr Phe Ser Asn Tyr Val Met Ser20Thr Ile Ser Gly Ser Glu Asn Tyr Met Tyr Tyr Pro Asp Ser Val Lys Gly21His Ala Gly Tyr Tyr Glu Gly Glu Gly Met Asp Tyr22Arg Ala Ser Gln Ser Ile Asn Asn Asn Leu His23Tyr Ala Ser Gln Ser Ile Ser24Gln Gln Ser Asp Ser Trp Pro Leu Thr25Glu Val Lys Leu Glu Gln Ser Gly Gly Asp Leu Val Lys Pro Gly Gly Ser Leu Lys Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Asn Tyr Val Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val Ala Thr Ile Ser Gly Ser Glu Asn Tyr Met Tyr Tyr Pro Asp Ser Val Lys Gly Arg Phe Asn Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu Gln Met Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr His Cys Ala Arg His Ala Gly Tyr Tyr Glu Gly Glu Gly Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser26Asp Ile Val Met Thr Gln Ser Thr Ala Thr Leu Ser Val Thr Pro Gly Asp Ser Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Ile Asn Asn Asn Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly IlePro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asn Phe Thr Leu Ser Ile Ser Gly Val Glu Thr Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser Asp Ser Trp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

[0149] Co-treatment with PODXL and IB4AP antibodies allows for more effective selection or isolation of liver stem cells. While isolation with PODXL antibody first, followed by isolation with IP3R3 antibody, is more efficient, there are no restrictions on the order of isolation.

[0150] Hereinafter, the present invention will be described in more detail with examples.

[0151]

[0152] Example 1. Culturing of human pluripotent stem cells and establishment of pure human pluripotent stem cells.

[0153] Primed human pluripotent stem cells (Primed hPSCs) H9 were cultured according to a previously described method (Choi et al., PLoS One. 17(6):e0269547) according to the protocol provided by Wicell Research Institute. First, mouse embryonic fibroblasts (MEFs) from pregnant CF1 mice were isolated and cultured, and then treated with γ-irradiation or mitomycin (10 μg / ml) to serve as feeder cells. The cells were cultured in DMEM / F12 (Invitrogen) medium supplemented with 20% (v / v) KOSR (knockout serum replacement), 1% (v / v) NEAA, 0.1 mM β-mercaptoethanol, 100 U / ml penicillin-G, 100 μg / ml streptomycin, and 8–12 ng / ml bFGF. When subcultured every 5–6 days, they were treated with collagenase IV (1 mg / ml) for 5 minutes, cut into appropriate sizes with a yellow tip, and cultured on new feeder cells. The term “naive hPSC” refers to stem cells that express markers of naive hPSCs that are different from those of primed hPSCs, and refers to stem cells that express markers that are different from those of primed hPSCs in the ground state, or intermediate, formative states. Primed hPSCs (H9) were used to induce conversion into naïve hPSCs, and the specific protocol was followed by a previously published method. First, primed hPSCs (H9) were treated with collagenase IV (1 mg / ml) for 5 minutes, cut into appropriate sizes using a yellow tip, and then transferred onto pre-distributed MEF.The next day, 2i / L / X / F / P medium (1 μM PD0325901, 3 μM CHIR99021, hLIF (20 ng / ml), 4 μM XAV939, 10 μM Forskolin, 2 μM Purmorphamine, 20% (v / v) KOSR, DMEM / F12, 1% (v / v) L-glutamine, 1% (v / v) NEAA, 0.1 mM β-mercaptoethanol, 1x penicillin / streptomycin) (Zimmerlin et al., 2016, Development 143:4368), 2i / L / F / A medium (1 μM PD0325901, 3 μM CHIR99021, hLIF (1000 U / ml), 10 μM Forskolin, ascorbic acid (50 ng / ml), bFGF (16 ng / ml), 20% (v / v) KOSR, KO-DMEM, 1% (v / v) L-glutamine, 1% (v / v) NEAA, 0.1 mM β-mercaptoethanol, 1x penicillin / streptomycin) (Duggal et al., 2015, Stem Cells 33:2686), or 5i / LAF medium (DMEM / F-12 and Neurobasal (1:1) medium, 1X N2 supplement, 1X B27 supplement, 1% NEAA, 1 mM GlutaMAX, Penicillin-streptomycin, 0.1 mM β-mercaptoethanol, 50 μg / mL BSA, 0.5% KSR, 10 ng / mL bFGF, 20 ng / mL Activin A, 20 ng / mL recombinant human LIF, The medium was replaced with culture medium containing 1 μM PD0325901 (MEKi), 0.5 μM IM-12 (GSKi), 0.5 μM SB590885 (B-Rafi), 1 μM WH-4-023 (SRCi), 10 mM Y-27632 (ROCKi) (Bruno Di Stefano et al., 2018, Nature methods, 15, 732-749).Human pluripotent stem cells cultured in 2i / L / X / F / P medium in a 5% (v / v) oxygen incubator transformed into dome-shaped pluripotent stem cells after 3 to 5 days, and it was confirmed that they also transformed into dome-shaped pluripotent stem cells in 2i / L / F / A and 5i / LAF medium (Fig. 1a). The established pluripotent stem cells, H9 cells, were subcultured at 3 to 4-day intervals using 0.05% (v / v) trypsin-EDTA (Welgene, Gyeongsan, Korea) (Choi et al., PLoS One. 17(6):e0269547 (Korean Patent Nos. 10-2235935, 10-2344948). The pluripotent stem cells established in this way were used in immunoblotting experiments to produce an antibody library.

[0154]

[0155] Example 2. Production of NPB24 hybridoma

[0156] 2-1. Immunotherapy for the production of antibodies specific to pure human pluripotent stem cells

[0157] To produce monoclonal antibodies against pure human pluripotent stem cells, pure human pluripotent stem cells induced in 2iL / X / F / P medium were injected into the footpads of mice, and the specific protocol followed a well-described method (Korean Patent No. 2235935). First, 2×10 cells were injected into the right footpads of 11 6-week-old female Balb / c mice. 6H9 cells, which are semi-human pluripotent stem cells, were injected at -3, 0, 3, 6, 13, 17, 20, and 21 days, and the same number of pure human pluripotent stem cells, H9 cells, were injected into the left footpad at 0, 3, 6, 13, 17, 20, and 21 days, and on the 22nd day, the immunized mice were subjected to cervical dislocation, and the popliteal lymph nodes were removed from the left hind paws, fat and muscle tissues were removed, and the popliteal lymph nodes were ground using frosted slide glass with an uneven surface and prepared as single cells. Left lymph node cells and FO myeloma cells were mixed at a ratio of 1:5, washed twice with serum-free medium DMEM (Invitrogen), and then 1 ml of 50% (w / v) PEG1500 (polyethylene glycol, BMS, Seoul, Korea) was added at a rate of 25 drops per minute. After 1 minute, 3 ml of DMEM medium was added successively for 1 minute, 17 ml for 1 minute, and 20 ml for 1 minute. After standing for 5 minutes, the cells were collected by centrifugation. 2 × 10 cells were seeded in a 96-well plate. 5 Cells / well were cultured for approximately 2 weeks in DMEM medium containing 20% ​​(v / v) FBS, 1xHAT (Sigma-Aldrich), and HCS (hybridoma cloning supplement), and hybridomas producing antibodies were selected using a sandwich ELISA method.

[0158]

[0159] 2-2. Binding specificity analysis for pure pluripotent stem cells and selection of NPB24 clones

[0160] To select antibody-expressing clones, a sandwich ELISA (Sandwich Enzyme Linked Immunosorbent Assay) method was used. 100 μl of hybridoma culture was added to a plate coated with 2 μg / ml of anti-mouse IgG or IgM antibody as a capture antibody, and the plate was incubated at 37°C for 1 hour. The plate was washed three times with PBST (0.05% (v / v) Tween-20 in PBS), and then incubated with a 1 / 5,000 dilution of anti-mouse IgG-HRP or anti-mouse IgM-HRP (horseradish peroxidase, Sigma-Aldrich) for another hour. After washing three times with PBST, a substrate solution containing OPD (o-phenylenediamine, Sigma) and H2O2 was added, and the absorbance was measured at 492 nm to first select antibody-producing clones. Next, the culture medium of each clone was analyzed by flow cytometry to select hybridomas that bind to pure human pluripotent stem cells, and among them, hybridomas that bind to both quasi-human pluripotent stem cells and pure human pluripotent stem cells were selected. For flow cytometry analysis of pluripotent stem cells, cells were detached with 0.05% Trypsin-EDTA (Welgene, Gyeongsan, Korea), neutralized with cell culture medium containing 10% fetal bovine serum (VWR), and then passed through a 40 μm strainer (SPL, Pocheon, Korea) to prepare single cells. Each single cell was prepared at a density of approximately 1 × 10 per ml. 6After mixing each cell with PBA (1% bovine serum albumin, 0.02% NaN3 in PBS), the antibody supernatant was reacted at 4℃ for 30 minutes. After washing twice with PBA, the cells were reacted with anti-mouse IgG-FITC or anti-mouse IgM-FITC (Invitrogen) corresponding to the primary antibody for another 20 minutes at 4℃. After washing twice with PBA, the antibody reactivity was analyzed for PI (propidium iodide)-negative cells using FACSCalibur and Cell Quest software (BD sciences). As a result, 33 hybridomas that simultaneously bind to both quasi-human pluripotent stem cells and pure human pluripotent stem cells were selected, and these were subcloned more than twice to secure stable clones. Among these antibodies, the monoclonal antibody NPB24 did not bind to mouse embryonic fibroblasts (MEFs), but simultaneously bound to both quasi-human pluripotent stem cells and pure human pluripotent stem cells (2iL / F / A, 5i / LAF) (Fig. 1b). 10 -5 When NPB24 binding was analyzed after 7 days of treatment with M retinoic acid (all-trans-retinoic acid, Sigma-Aldrich) to induce differentiation, good binding was still observed (Fig. 1b). These results indicate that the NPB24 antigen is expressed in pure and pluripotent stem cells and that expression is maintained even after pluripotent stem cells are differentiated. Isotyping was performed using the Mouse Immunoglobulin Isotyping ELISA Kit (BD Biosciences) according to the supplier's protocol, and NPB24 was found to be a monoclonal antibody with IgM and κ chains (Table 4).

[0161] IsotypingHeavy chainLight chainα-IgG1α-IgG2aα-IgG2bα-IgG3α-IgMα-IgAα-Igκα-IgλPositive antigen mixture1.371.3451.2251.2411.2061.2491.1641.22NPB240.1650.1170.1130.1591.1880.1111.1520.078

[0162]

[0163] Example 3. Analysis of the binding specificity of NPB24 to various cancer cells and normal cells.

[0164] To observe the degree of binding of NPB24 to various cells, flow cytometry was performed as in Example 2-2. Various cancer cells and normal cells were detached with 0.05% Trypsin-EDTA (Welgene) and neutralized with cell culture medium containing 10% fetal bovine serum (VWR). Then, the cells were passed through a 40 μm strainer (SPL) to prepare single cells. Each single cell was prepared at a density of approximately 1 × 10 per ml. 6After mixing each antibody with PBA, the antibody NPB24 was reacted at 4℃ for 30 minutes. After washing twice with PBA, the primary antibody corresponding to anti-mouse IgM-FITC (Invitrogen) was reacted for another 20 minutes at 4℃. After washing twice with PBA, the antibody reactivity was analyzed for PI (propidium iodide)-negative cells using FACSCalibur or FACSCanto and FlowJo software (BD sciences). NPB24 bound to the surface of embryonic carcinoma cells (NT-2 / D1, 2102Ep), human lung cancer cells (A549, NCI-H460, Calu-3), human pancreatic cancer cells (BxPC-3), and human hepatoma cells (Huh7, SNU387, SNU449). In addition, it bound well to the surface of compound-induced human hepatic stem cells (hCdHs), but did not bind to bone marrow-derived mesenchymal stem cells (BM-MSCs), normal human primary hepatocytes (hPHs), or normal peripheral blood mononuclear cells (Fig. 2, Table 5). Based on these results, we analyzed the possibility of discovering a new hCdHs surface marker with an epithelial phenotype using NPB24.

[0165] Cell linesSurface bindingPrimed H9Human embryonic stem cell, primed state+++Naive H9Human embryonic stem cell, naive state+++MEFMouse embryonic fibroblast-RA-H9Retinoic acid-treated primed H9+++NT-2 / D1Human embryonal carcinoma stem cell+++2102EpHuman embryonal carcinoma stem cell+++HEK293FTHuman embryonic kidney cell-A549Human non-small cell lung carcinoma+++NCI-H460Human non-small cell lung carcinoma+++Calu-3Human non-small cell lung carcinoma++PANC-1Human pancreatic adenocarcinoma cell-BxPC-3Human pancreatic adenocarcinoma cell++SNU-213Human pancreatic adenocarcinoma cell-HepG2Human hepatocellular carcinoma cell-Huh7Human hepatocellular carcinoma cell+++SNU-387Human hepatocellular carcinoma cell++SNU-449Human hepatocellular carcinoma cell+++hCdHsHuman chemical-derived hepatic progenitors+++hPHsHuman primary hepatocytes-PBMCHuman peripheral blood mononuclear cell-BM-MSCHuman bone marrow-mesenchymal stem cell-+++, strong binding; ++, medium binding; +, weak binding;-, no binding

[0166]

[0167] Example 4. Cloning and base sequence analysis of the antibody gene of NPB24.

[0168] To characterize the NPB24 antibody and analyze its antigen-binding site, the antibody gene was first cloned and the base sequence of the complementarity determining region (CDR) region was determined. Specifically, 5 × 10 NPB24 cell clones, which grow vigorously, were cultured. 6After harvesting dogs by centrifugation, total RNA was extracted using RNAiso Plus reagent (TaKaRa, Otsu, Japan) according to the supplier's protocol. The obtained total RNA was quantified by measuring the OD260 nm value. Total RNA was added to PrimeScript RT Master Mix (TaKaRa) to create a reverse transcription-polymerase chain reaction (RT) mixture, and cDNA was synthesized. To clone antibody genes, known PCR primers were modified and used (Wang, et al. 2000, J. Immunol. Methods 233:167). In order to clone the heavy chain of the antibody using the cDNA synthesized above, 10 pmoles of an oligonucleotide having the base sequence IgM:5`-gga gtc gac GAC ATT TGG GAA GGA CTG ACT CTC-3` (SEQ ID NO: 41), which is a polymerase chain reaction primer corresponding to the constant region of NPB24, an IgM subtype antibody, and oligonucleotides having the base sequence 5`MH1: 5`-ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG TC-3` (SEQ ID NO: 42) and 5`MH2: 5`-ctt ccg gaa ttc SAR GTN MAG CTG SAG SAG TCW GG-3` (SEQ ID NO: 43), which are primers corresponding to the N-terminus of the heavy chain variable region, were added to create a chain polymerization reaction mixture. For light chain cloning, the oligonucleotide 3`Ck:5`- ggt gtc gac GGA TAC AGT TGG TGC AGC ATC-3` (SEQ ID NO: 44), a primer corresponding to the kappa chain constant region, and the oligonucleotide 5`MK:5`-cgg aag ctt GAY ATT GTG MTS ACM CAR WCT MCA-3` (SEQ ID NO: 45), a primer corresponding to the N-terminus of the kappa chain variable region, were used.For efficient cloning of polymerase chain reaction products, a SalI restriction site was added to the 3'-primer for the light chain, and a HindIII restriction site was added to the 5'-primer. For the heavy chain, an EcoRI restriction site was added to the 5'-primer, and a SalI restriction site was added to the 3'-primer. After mixing the heavy and light chain reaction solutions, the reaction was performed 30 times at 95°C for 1 min, 35°C to 45°C for 1 min, and 72°C for 1 min, resulting in amplification of approximately 400 bp of the heavy and light chain variable regions (Fig. 3a). To clone the amplified NPB24 gene, first, the polymerase chain reaction product was treated with EcoRI and SalI for the heavy chain and with HindIII and SalI for the light chain, and then developed on a 1.0% (w / v) agarose gel. DNA corresponding to approximately 400 bp and 390 bp was isolated using FavorPrep Gel™PCR Purification Kit (Favorgen, Taiwan). pBluescript KS+, which was used as a vector for cloning the heavy chain gene, was treated with EcoRI and SalI, and pBluescript KS+, which was used as a cloning vector for the light chain gene, was treated with HindIII and SalI, and then isolated using FavorPrep GEL™PCR Purification Kit. These two DNAs were ligated with T4 DNA ligase (New England Biolab, USA) and transformed into Escherichia coli DH5α using the RbCl2 method. As a result, clones with DNA inserts of approximately 400 bp in size were selected for the heavy chain, and E. coli clones with DNA inserts of approximately 390 bp in size were selected for the light chain (Fig. 3b, 3c).For DNA sequence analysis of antibody genes, the above-mentioned multiple clones were cultured overnight in 3 ml of LB medium containing 50 ㎍ / ml of ampicillin, and then plasmid DNA was isolated using a DNA-Spin plasmid mini prep kit (Intron, Korea). The base sequence of each DNA insert was confirmed through nucleotide sequencing (Bionics, Korea). The confirmed heavy and light chain DNA sequences were translated into amino acids, and the CDR region, which is the antigen recognition determining site according to the antibody structure, was organized using Kabat numbering and designated as CDR 1, 2, and 3 in the sequence. As a result of comparative analysis of the antibody sequences, it was confirmed that the heavy chain of the NPB24 antibody belongs to subgroup IIB (Fig. 4), and the light chain has a functional antibody structure belonging to subgroup III (Fig. 5).

[0169]

[0170] Example 5. Purification of NPB24 antibody

[0171] To specifically obtain only antibodies in the NPB24 hybridoma cell culture, monoclonal antibody IgM was separated and purified according to the supplier's protocol using affinity chromatography using a mouse IgM prepacked column (LigaTrap, USA). Specifically, the hybridoma cell culture was mixed with Sample Diluent buffer (50 mg / ml Adipic Acid, 4.0 M NaCl, pH 5.8) at a ratio of 4:1 to ensure good binding of the hybridoma cell culture to the beads in the column. Afterwards, a tube-driven pump was connected to the column, and the diluted cell culture was passed through at a rate of 0.2 ml / min. To specifically isolate only mouse IgM antibodies bound to beads, the beads in the column were washed with approximately 10 to 15 ml of wash buffer (10 mg / ml Adipic Acid, 800 mM NaCl, pH 5.8), and then only mouse IgM antibodies were specifically eluted using 10 ml of elution buffer (500 mM Sodium Acetate, pH 3.8) and 1.25 ml of neutralization buffer (3.0 M Tris-Base, pH 11.1). The purity of the purified NPB24 (mIgM) antibody was then confirmed through SDS-PAGE and PageBlue staining (Fig. 6a). In addition, as a result of detection through Western blotting using goat anti-mouse heavy chain antibody (goat-α-mIgM-μ chain-specific-HRP, Invitrogen) as a secondary antibody, it was confirmed that the NPB24 antibody is an antibody having the μ chain (75 kDa) of mouse IgM antibody and that it is easily decomposed to 55 kDa (Fig. 6b).

[0172] The purification process of NPB24 antibody using Protein G agarose beads was also performed. To this end, the collected cell culture medium was placed in a column filled with Protein G agarose beads (Amicogen, Korea) to allow the antibody to bind to the Protein G agarose beads. After washing the beads with PBS (pH 8.0), 10 ml of 0.1 M glycine (pH 2.8) and 1 ml of 1 M Tris-HCl (pH 9.0) were added to elute the antibody from the Protein G agarose beads. The purity of the purified NPB24 chimeric antibody was confirmed through SDS-PAGE and PageBlue staining (Fig. 6c). When anti-mouse antibody (goat-a-mIgG-(H+L)-HRP) was used as a secondary antibody, the IgG chain was not detected and only the kappa chain of approximately 25 kDa was detected, confirming that NPB24 is an IgM type antibody that does not have an IgG (gamma chain) (Fig. 6d). Western blotting using goat anti-mouse heavy chain IgM antibody (goat-α-mIgM-μ chain-specific-HRP, Invitrogen) as a secondary antibody detected an IgM heavy chain (75, 55 kDa) antibody rather than an IgG heavy chain, confirming that the NPB24 antibody is an antibody that has the μ chain of a mouse IgM antibody (Fig. 6e).

[0173]

[0174] Example 6. Design of a chimeric Chi-NPB24 antibody having the CDR of NPB24 and production of an expression vector

[0175] NPB24 antibody is of the mouse IgM type, which is inconvenient to use. To increase antibody applicability, a chimeric antibody was prepared in which the entire heavy and light chain variable regions are derived from a mouse antibody and the constant region is derived from a human antibody IgG1. To prepare the chimeric antibody, PCR was first performed targeting the heavy and light chain genes of the mouse-derived NPB24 antibody, and DNA of approximately 400 bp and 390 bp was isolated using the FavorPrep Gel™ PCR Purification Kit (Favorgen). And, in order to synthesize the signal peptide sequence (SP) attached to the front of the heavy chain gene, PCR was performed using the pdCMV-dhfr vector (Korean Patent Application No. 10-2021-0079629) as a template and the primers h2B7-HC-SLIC-5` (5`-GCC AGT GTG CTG GAA TTC ACT CTA ACC-3`) (SEQ ID NO: 46) and NPB24-Chu-HC-SP-3` (5`CTT AAC TTC GGA GTG GAC ACC TGT AGT TA-3`) (SEQ ID NO: 47). And in order to amplify the heavy chain variable region of NPB24, PCR was performed using the DNA of the heavy chain variable region as a template and the primers NPB24-Chi-HC-VH-5` (5`-GTC CAC TCC GAA GTT AAG CTG GAG-3`) (SEQ ID NO: 48) and NPB24-Chi-HC-3` (5`-CCT TGG TGG AGG CTG CAG AGA CAG TGA C-3`) (SEQ ID NO: 49) (Fig. 7a). In order to link the heavy chain signal peptide sequence and the heavy chain variable region of the NPB24 antibody again, the DNAs prepared by the above PCR were mixed as a template and the primers h2B7-HC-SLIC-5` and H2B7-HC-SLIC-3` (5'-AAG ACC GAT GGG CCC TTG GTG GAG-3`) (SEQ ID NO: 50) were used to perform recombinant PCR.The PCR product was developed on a 1% agarose gel, and approximately 450 bp of DNA containing the heavy chain variable region (VH) and heavy chain signal peptide (SP) sequences was confirmed (Fig. 7b). This was isolated using the FavorPrep GEL™ PCR Purification Kit (Farvorgen), treated with EcoRI and ApaI, and then isolated again using the FavorPrep GEL™ PCR Purification Kit. This was inserted into the EcoRI and ApaI sites of the pdCMV-dhfr vector (Korean Patent Application No. 10-2021-0079629) containing the human heavy chain constant region (IgG1) gene using T4 DNA ligase (NEB) (Fig. 8a, 8c).

[0176] To synthesize a signal peptide sequence (SP) to be attached in front of the light chain gene, PCR was performed using the pdCMV-dhfr vector as a template, using the primers h2B7-LC-SILC-5` (5`-ATA GGG AGA CCC AAG CTT CGG CAC GAG CAG A-3`) (SEQ ID NO: 51) and NPB24-Chi-LC-SP-3` (5`-GAT CAC AAT ATC TCC TTC AAC ACC AGA CA-3`) (SEQ ID NO: 52). And, in order to amplify the light chain variable region of the NPB24 antibody, PCR was performed using the DNA of the light chain variable region as a template, the NPB24-Chi-LC-vk-5` (5`-GTT GAA GGA GAT ATT GTG ATC ACC CAA TC-3`) (SEQ ID NO: 53) primer, and Chi63-B6-LC-SLIC-3` (5`-TGG TGC AGC CAC CGT ACG TTT GAT TTC CA-3`) (SEQ ID NO: 54) primer (Fig. 7c). Again, in order to link the light chain signal peptide sequence (SP) and the light chain variable region (Vk) of the NPB24 antibody, the DNA prepared by the above PCR was mixed as a template, and recombinant PCR was performed using the h2B7-LC-SLIC-5` primer and the Chi63-B6-LC-SLIC-3` primer. The PCR product was developed on a 1% agarose gel, and approximately 430 bp of DNA linking the light chain variable region (Vk) and the light chain signal peptide sequence (SP) was identified (Fig. 7d). This was isolated using the FavorPrep GEL™ PCR Purification Kit, treated with HindIII and BsiwI, and then isolated again using the FavorPrep GEL™ PCR Purification Kit.This was cloned into the HindIII and BisWI sites of the pdCMV-dhfr-Chi-NPB24-HC vector, into which the heavy chain gene was inserted, to be linked to the human light chain constant region (Ck) gene, and named 'pdCMV-dhfr-Chi-NPB24' (Fig. 8b, 8c). The final vector DNA was transformed into Escherichia coli DH5α using the RbCl2 method, and clones with heavy chain gene inserts of approximately 450 bp in size and E. coli clones with light chain gene inserts of approximately 430 bp in size were selected. For DNA base sequence analysis of antibody genes, the above clones were cultured overnight in 5 ml of LB medium containing 50 μg / ml of ampicillin, and plasmid DNA was isolated using a DNA-spinTM Plasmid DNA purification kit (INTRON), and the base sequence of each DNA insert was confirmed (Bionics). The amino acid sequence of the heavy chain variable region of the chimeric antibody pdCMV-dhfr-Chi-NPB24 was identical to the amino acid sequence of the existing NPB24 heavy chain variable region, and it was confirmed that it was correctly linked to the signal peptide sequence and human heavy chain constant region sequence (Fig. 9a, SEQ ID NO: 9). In addition, the sequence of the light chain variable region of the chimeric antibody pdCMV-dhfr-Chi-NPB24 was identical to the sequence of the existing NPB24 light chain variable region, and it was confirmed that it was correctly linked to the signal peptide sequence and human heavy chain constant region sequence (Fig. 9b, SEQ ID NO: 10).

[0177] The chimeric antibody linked to the NPB24 mouse variable region and human constant region was named Chi-NPB24, and to produce and purify this chimeric antibody, 1×10 human embryonic kidney cell HEK293FT cell line was first cultured. 7Dogs were cultured in 150-mm culture dishes using 20 ml of DMEM (Biowest, France) medium. 50 μg of the pdCMV-dhfr-Chi-NPB24 expression vector and 75 μl of polyethyleneimine (1 mg / ml, Polysciences, USA) were mixed, mixed with 500 μl of transfection optimization medium (TOM™ Medium, Welgene), and spread onto the cultured cell culture medium. After 48 h of incubation, the cell culture medium was collected every 24 h and the antibody was purified. The collected cell culture medium was placed in a column filled with Protein G agarose beads (Amicogen) to allow the antibody to bind to the Protein G agarose beads. The beads were washed with PBS (pH 8.0), and then 10 ml of 0.1 M glycine (pH 2.8) and 1 M Tris-HCl (pH 9.0) were added to elute the antibody from the Protein G agarose beads. The purity of the purified Chi-NPB24 chimeric antibody was then confirmed through SDS-PAGE and PageBlue staining (Fig. 10a). In addition, the chimeric antibody was detected by Western blotting using goat anti-human heavy chain antibody (goat-α-hIgG-gamma chain-HRP, Invitrogen) and goat anti-human light chain antibody (goat-α-hIgG-kappa chain-HRP, Bethyl, USA) as secondary antibodies, and it was confirmed that the chimeric antibody was an antibody containing the constant region of a human antibody (Fig. 10b). To confirm the activity of the purified NPB24 chimeric antibody, the cell surface binding ability of 2102Ep and human hepatic stem cells (hCdHs) was confirmed by flow cytometry as in Example 3.The NPB24 chimeric antibody also did not bind to human primary hepatocytes (pPHs) like the mouse NPB24 antibody, but specifically bound to the surface of hCdHs, NT-2 / D1, 2102Ep, A549, SNU387, and SNU449 cells, as confirmed by flow cytometry, confirming that the chimeric Chi-NPB24 is a functional humanized antibody (Fig. 10c).

[0178]

[0179] Example 7. Identification of cell surface protein molecules recognized by NPB24

[0180] 7-1. Identification of molecules immunoprecipitated by NPB24

[0181] To analyze which antigen on the cell surface the NPB24 antibody recognizes, the surface of 2102Ep cells was first labeled with biotin. Biotinylation of the surface of the human embryonic carcinoma cell line 2012Ep was performed with a slight modification of the protocol suggested by EZ-Link Sulfo-NHS-LC-Biotin (Thermo Scientific). Human embryonic carcinoma 2120Ep cells cultured in 100 mm cell culture plates were washed twice with PBS (pH 7.4), and 5 ml of cold PBS (pH 8.0) containing 0.5 mg of biotin was added, followed by incubation at 4°C for 30 minutes. After washing three times with cold PBS (pH 8.0), biotin-labeled cells were incubated with lysis buffer (25 mM Tris-HCl, pH 7.5, 250 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 2 μg / ml Aprotinin, 100 μg / ml PMSF (phenylmethylsulphonyl fluoride), 5 μg / ml Leupeptin, 1 mM NaF, 1 mM Na3VO4) at 4°C for 30 min, centrifuged at 12,000 rpm for 40 min to remove nuclei, and stored at -70°C until use. To remove proteins that nonspecifically bind to Protein G agarose (Amicogen), approximately 2.0 × 10 720 μl Protein G agarose was added to the cell lysate of the canine cells and reacted at 4°C for 2 hours. The Protein G agarose was recovered by centrifugation. The sample washed 5 times with lysis buffer was used as a negative control. To immunoprecipitate the antigen recognized by NPB24, 4 μg of antibody was added to the cell lysate from which proteins that nonspecifically bind to Protein G agarose were removed and reacted at 4°C for 12 hours. Then, 20 μg Protein G agarose was added and reacted at 4°C for another 4 hours. The immunoprecipitated immune mixture was washed 5 times with lysis buffer, and 5X sample buffer was added to elute the antigen bound to the antibody and boiled at 100°C for 10 minutes. The negative control protein and the eluted proteins were separated by 8% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) and Western blotting was performed on a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk for 1 h at room temperature. After washing three times with 0.1% TBST (Tris-Buffered Saline, 0.1% Tween), the membrane was reacted with streptavidin-HRP (SA-HRP, GE healthcare) for 1 h at room temperature. After washing three times with 0.1% TBST, the biotin-labeled proteins were confirmed using an ECL detection kit (Advansta). As a result, it was confirmed that NPB24 immunoprecipitated proteins of approximately ~280, ~160, and ~80 kDa from the lysate of human embryonic carcinoma 2102Ep cells (Fig. 11a).

[0182]

[0183] 7-2. Identification of the 280kDa antigen immunoprecipitated by NPB24

[0184] A polyacrylamide gel containing proteins immunoprecipitated by NPB24 was stained with PageBlue Protein Staining Solution (Thermo Scientific) according to the supplier's protocol (Fig. 11b). The stained protein band located at 280 kDa, presumed to be a protein immunoprecipitated by NPB24, was excised from the gel and subjected to LC-MS / MS (Liquid Chromatography with Tandem Mass Spectrometry) analysis (ProteomeTech, Seoul, Korea). The ProFound search engine developed by Rockefeller University (http: / / 129.85.19.192 / profound_bin / WebProFound.exe) and the UniProt database (https: / / www.uniprot.org / ) were used for protein identification from the analyzed mass spectra. As a result, it was confirmed that the amino acid sequences of the five peptides matched those of inositol 1,4,5-trisphosphate receptor type 3 (IP3R3, ITPR3) (Figures 11c to 11e).

[0185]

[0186] 7-3. NPB24 antigen IP3R3 analysis

[0187] To determine whether NPB24 can recognize and immunoprecipitate IP3R3 / ITPR3, analyses were performed using commercially available antibodies against IP3Rs or IP3R3. First, to confirm that the protein immunoprecipitated by NPB24 was IP3R3, a rabbit anti-IP3Rs polyclonal antibody (Cell Signaling) that recognizes all three IP3Rs (IP3R1, IP3R2, and IP3R3) and a rabbit anti-IP3R3 antibody (Bethyl) that recognizes only IP3R3 were used for immunoprecipitation and Western blotting. A cell lysate was prepared from 2102Ep using 1% Triton X-100 lysis buffer (25 mM Tris-HCl, pH 7.5, 250 mM NaCl, 5 mM EDTA, 1% Triton X-100, 2 μg / ml Aprotinin, 100 μg / ml PMSF (phenylmethylsulphonyl fluoride), 5 μg / ml Leupeptin, 1 mM NaF, 1 mM Na3VO4) according to the method described in Example 7-1, and the lysate was immunoprecipitated using NPB24 antibody in a similar manner as in Example 7-1 described above. Thereafter, the cells were separated through 6% SDS-PAGE together with the immunoprecipitation negative control group using an isotype control IgM antibody that does not recognize the antigen, and transferred to a nitrocellulose membrane for Western blotting. The membrane was blocked with 5% skim milk powder for 1 hour at room temperature. After three washes with 0.1% TBST, the membrane was incubated with anti-IP3Rs antibody overnight at 4°C. After three washes with 0.1% TBST, the membrane was further incubated with anti-rabbit IgG-HRP (1:10,000) for 1 hour at room temperature. After three washes with 0.1% TBST, the membrane was detected using an ECL detection kit. As a result, it was confirmed that the approximately 280 kDa immunoprecipitate protein precipitated by NPB24 was detected by the IP3Rs antibody (Fig. 12a).

[0188] To confirm again whether NPB24 antibody immunoprecipitates IP3R3 in other cells, immunoprecipitation was performed using lung cancer cells A549 and liver cancer cells SNU449 by preparing cell lysates with cell lysis buffer as in Example 7-1. As negative controls, for NPB24 (G) separated with Protein G beads, mIgG isotype antibody was used, for NPB24 (M) separated with LigaTrap, mIgM isotype antibody was used, and for Chi-NPB24, hIgG isotype antibody was used. As positive controls, immunoprecipitation was performed using anti-IP3Rs and anti-IP3R3 antibodies, and all immunoprecipitates and cell lysates themselves (input) were separated through 6% SDS-PAGE and transferred to a nitrocellulose membrane for Western blotting. The membrane was blocked with 5% skim milk powder for 1 hour at room temperature. After washing three times with 0.1% TBST, it was reacted with rabbit anti-IP3R3 antibody (Bethyl) at 4℃ for 12 hours. After washing three times with 0.1% TBST, it was reacted with anti-rabbit IgG-HRP (1:10,000) for another hour at room temperature. After washing three times with 0.1% TBST, it was confirmed with an ECL detection kit. As a result, it was confirmed that proteins of approximately 280 kDa precipitated by all antibodies, NPB24(G), NPB24(M), Chi-NPB24, IP3Rs, and IP3R3, except for the negative control group, were detected by the IP3R3 antibody (Fig. 12b, 12c). In particular, it can be seen that more IP3R3 is immunoprecipitated by NPB24 in liver cancer cells (Fig. 12c) than in lung cancer cells (Fig. 12b). These results suggest that NPB24 can specifically bind to and immunoprecipitate IP3R3 in 2102Ep, A549, and SNU449 (Figs. 12b, 12c).

[0189] To confirm whether NPB24 also immunoprecipitates IP3R3 in hepatic stem cells (hCdHs), cell lysates were prepared from hCdHs cells (Fig. 12d) and fetal liver-derived hCdHs isolated from fetal liver (Fig. 12e) using the method described in Example 7-1, and these lysates were immunoprecipitated using NBP24(G), NPB24(M), or Chi-NPB24 antibodies and anti-IP3R3 antibodies as in Example 7-1. As a result, it was confirmed that NPB24(G), NPB24(M), and Chi-NPB24 antibodies precipitated IP3R3 protein located at ~300 kDa like the anti-IP3R3 antibody (Figs. 12d, 12e).

[0190] To distinguish whether NPB24 antibody directly recognizes and immunoprecipitates IP3R3 or indirectly recognizes and precipitates it, the IP3R3 (ITPR3) gene expression vector pcDNA3.1-ITPR3-(k)DYK (GenScript, Accession version: XM_011514577.3) was prepared, and FLAG-tagged recombinant IP3R3 was overexpressed in human embryonic kidney cells HEK293FT. The cell lysates were subjected to immunoprecipitation and Western blotting using mouse anti-FLAG monoclonal antibody (MBL), rabbit anti-IP3R3 antibody, and NPB24 antibody group. To overexpress IP3R3 in HEK293FT, 3.5 × 10 per well were seeded in a 6-well cell culture plate. 5HEK293FT cells were cultured for 24 hours, and 2 μg of the prepared vector DNA was mixed with 6 μg of PEI (Polyetherimide), and the mixture was reacted at room temperature for 20 minutes. Transfection was performed by adding the mixture to the cell culture medium. After culturing the cells for an additional 72 hours, a cell lysate was prepared using the lysis method described in Example 7-1. The prepared cell lysate was immunoprecipitated with NPB24 (G) antibody, Chi-NPB24 antibody, anti-IP3R3 antibody, and anti-FLAG antibody (α-DDDDK) in the same manner as described above. As a negative control, NPB24 (G) was immunoprecipitated together with mIgG Isotype antibody, and Chi-NPB24 was immunoprecipitated together with hIgG Isotype antibody. The precipitated proteins were separated using 6% SDS-PAGE and then subjected to Western blotting using the method described in Example 7-3, and the precipitated proteins were confirmed using anti-IP3R3 and anti-FLAG (α-DDDDK) antibodies. As a result, it was observed that each protein immunoprecipitated by NPB24 (G), anti-IP3R3, and anti-FLAG (α-DDDDK) antibodies was recognized by anti-IP3R3 and anti-FLAG (α-DDDDK) antibodies (Fig. 13a). In addition, it was observed that each protein immunoprecipitated by Chi-NPB24, anti-IP3R3, and anti-FLAG (α-DDDDK) antibodies was also recognized by anti-IP3R3 and anti-FLAG (α-DDDDK) antibodies (Fig. 13b). These results verify that both the monoclonal antibody NPB24 of the present invention and the Chi-NPB24 antibody, which is a chimeric antibody, are antibodies that directly recognize the IP3R3 protein present on the surface of human lung or liver cancer cell lines.

[0191]

[0192] 7-4. Identification of the 80kDa molecule recognized by NPB24

[0193] As in Example 7-1, the surface of 2102Ep cells was labeled with biotin, and cell lysates were prepared. Then, approximately 4 μg of NPB24 and Chi-NPB24 antibodies were used to immunoprecipitate the recognized antigens. Streptavidin-HRP (SA-HRP, GE healthcare) was reacted at room temperature for 1 hour. After washing three times with 0.1% TBST, biotin-labeled proteins were identified using an ECL detection kit (Advansta). As a result, it was confirmed that NPB24 and Chi-NPB24 simultaneously immunoprecipitated proteins of approximately ~280, ~160, and ~80 kDa from the lysate of human embryonic carcinoma 2102Ep cells (Fig. 14a). Among these, the protein band stained at approximately 80 kDa (Fig. 14b) was excised and subjected to LC-MS / MS (Liquid Chromatography with Tandem Mass Spectrometry) analysis (ProteomeTech, Seoul, Korea). For protein identification from the analyzed mass spectrum, the ProFound search engine developed at Rockefeller University (http: / 129.85.19.192 / profound_bin / WebProFound.exe) and the UniProt database (https: / www.uniprot.org / ) were used. As a result, the amino acid sequence of the protein was confirmed to be partially identical to that of integrin β4 (ITGB4, CD104) (Figs. 14c to 14e). The underlined amino acids indicate the amino acid sequences actually confirmed by mass spectrometry.

[0194]

[0195] 7-5. ITGB4 immunoprecipitation analysis of NPB24

[0196] To confirm whether the protein immunoprecipitated by NPB24 was ITGB4, immunoprecipitation and Western blotting were performed using rabbit anti-ITGB4 polyclonal antibody (Abcam) and rat anti-ITGB4 antibody (Thermo Fischer Scientific). Cell lysates were prepared from 2102Ep using the method described in Example 7-1, and the lysates were immunoprecipitated using NPB24(G), NPB24(M), and chimeric NPB24 antibodies in the same manner as in Example 7-1 described above. As a negative control, samples immunoprecipitated using mIgG and mIgM isotype antibodies that do not recognize specific antigens for NPB24 and hIgG1 for Chi-NPB24 were used. As a positive control, the eluted protein solution itself (input) was separated through 6% SDS-PAGE and transferred to a nitrocellulose membrane, and Western blotting was performed. The membrane was blocked with 5% skim milk powder for 1 hour at room temperature. After washing three times with 0.1% TBST, the membrane was incubated with rabbit anti-ITGB4 antibody (Abcam) at 4°C for 12 hours. After washing three times with 0.1% TBST, the membrane was further incubated with anti-rabbit IgG-HRP (1:10,000) at room temperature for 1 hour. After washing three times with 0.1% TBST, the membrane was detected using an ECL detection kit. As a result, it was confirmed that both NPB24 and Chi-NPB24 antibodies precipitated the ~210-kDa ITGB4 protein (Fig. 15a). Therefore, the ~80-kDa protein immunoprecipitated by NPB24 in Fig. 14 appears to be a degradation product or isotype protein of the 210-kDa ITGB4 protein.

[0197] To confirm again in other cells whether NPB24 antibody immunoprecipitates ITGB4 with a size of ~210 kDa, cell lysates were prepared from lung cancer cells A549 and liver cancer cells SNU449 as in Example 7-1. As a negative control, mIgM immunoprecipitate for NPB24 was used, and as a positive control, A549 cell lysate itself (input) and anti-ITGB4 antibody were used. The precipitates were separated through 6% SDS-PAGE and transferred to a nitrocellulose membrane for Western blotting. The membrane was blocked with 5% skim milk powder for 1 hour at room temperature. After washing three times with 0.1% TBST, it was reacted with rabbit anti-ITGB4 antibody (Abcam) at 4°C for 12 hours. After washing three times with 0.1% TBST, the cells were incubated with anti-rabbit IgG-HRP (1:10,000) at room temperature for an additional 1 hour. After washing three times with 0.1% TBST, the cells were detected using an ECL detection kit. As a result, both NPB24 and anti-ITGB4 antibodies precipitated a ~210 kDa protein recognized by the anti-ITGB4 antibody from A549 and SNU449 (Figs. 15b and 15c). These results suggest that the NPB24 antibody binds to and immunoprecipitates ITGB4.

[0198] In order to confirm whether NPB24 also immunoprecipitates ITGB4 in hepatic stem cells, cell lysates were prepared from hCdHs using the method described in Example 7-1, and the lysates were immunoprecipitated using NBP24 antibody and anti-ITGB4 antibody as in Example 7-1. As a result, it was confirmed that NPB24 antibody precipitates ~210 kDa ITGB4 protein like anti-ITGB4 antibody (Fig. 15d). Meanwhile, in order to confirm whether Chi-NPB24 antibody, which recognizes the same antigen as NPB24, also immunoprecipitates ITGB4, cell lysates were prepared from A549 and SNU449 cells using the method described in Example 7-1, and the lysates were immunoprecipitated using Chi-NBP24 antibody and anti-ITGB4 antibody as in Example 7-1. As a result, we confirmed that the Chi-NPB24 antibody precipitated the ~210-kDa ITGB4 protein, similar to the anti-ITGB4 antibody (Figs. 15e and 15f). These results suggest that NPB24 can bind to and immunoprecipitate ITGB4 in 2102Ep, A549, SNU449, and hCdHs.

[0199]

[0200] Example 8. Analysis of the interaction between IP3R3 and ITGB4 proteins.

[0201] To confirm the association between IP3R3 and ITGB4 proteins, which are co-immunoprecipitated by monoclonal antibody NPB24, analysis was performed using commercially available antibodies against IP3Rs, IP3R3, and ITGB4. Cell lysates were prepared from A549 and SNU449 cells using 1% Triton X-100 lysis buffer (25 mM Tris-HCl, pH 7.5, 250 mM NaCl, 5 mM EDTA, 1% Triton X-100, 2 μg / ml Aprotinin, 100 μg / ml PMSF (phenylmethylsulphonyl fluoride), 5 μg / ml Leupeptin, 1 mM NaF, 1 mM Na3VO4) according to the method described in Example 7-1, and the lysates were immunoprecipitated using IP3Rs, IP3R3, and ITGB4 antibodies, respectively, in a similar manner as in Example 7-1 described above. Western blotting was then performed, and the immunoprecipitated proteins were detected using IP3R3 or ITGB4 antibodies as the primary antibody and anti-rabbit IgG-HRP (1:10,00) as the secondary antibody. As a result, it was confirmed that ITGB4 protein was also precipitated when target proteins were immunoprecipitated using IP3R3 or IP3Rs antibodies in A549 (Fig. 16a) and SNU449 cell lines (Fig. 16b). These results indicate that IP3R3 and ITGB4 interact with each other on the cell surface to physically form a complex, and thus ITGB4 was also immunoprecipitated when IP3R3 was immunoprecipitated with NPB24 antibody.

[0202]

[0203] Example 9. Confirmation of NPB24 antibody binding affinity in ITPR3-overexpressing cell lines.

[0204] ITPR3 gene expression vector pcDNA3.1-ITPR3-Flag (GenScript, Accession version: XM_011514577.3) was prepared, and Flag-tagged recombinant ITPR3 was overexpressed in human lung cancer cells A549 or human hepatoma cells SNU-449 cultured in RPMI-1640 medium containing 10% FBS. The cells were subjected to flow cytometry analysis using NPB24 antibody, rabbit anti-ITPR3 antibody, and mouse anti-Flag antibody.

[0205] To overexpress ITPR3 in human lung cancer cells A549, 5.0 X 10 per well in a 6-well cell culture plate 4 A549 cells were cultured for 24 hours, and 1 μg of the pcDNA3.1-ITPR3-Flag vector DNA was mixed with 3 μg of polyetherimide (PEI) (DNA: PEI = 3:1), and the mixture was added to the cell culture medium for transfection. After culturing the cells for an additional 72 hours, the cells were detached with 0.05% trypsin-EDTA, neutralized with culture medium containing 10% FBS, and passed through a 40 μm strainer to prepare single cells. The cells were washed twice with PBA (pH 7.4), and the cells were cultured at a concentration of approximately 1.0 X 10 per ml. 6After mixing each antibody in PBA, each antibody was reacted at 4℃ for 30 minutes. After washing twice with PBA, each primary antibody was reacted with the corresponding secondary antibody at 4℃ for 30 minutes. After washing twice with PBA, antibody reactivity was analyzed for PI (Propidium iodide)-negative cells using FACS Canto II (BD Bioscience). When compared with A549 lung cancer cells transfected only with PEI without DNA as a control, there was no significant difference in Chi-NPB24 on the surface of ITPR3-overexpressing A549 lung cancer cells, but the binding affinity of NPB24 (G) and NPB24 (M) and the binding affinity of rabbit anti-ITPR3 antibody and mouse anti-Flag antibody were all increased (Fig. 17a, 17c).

[0206] To overexpress ITPR3 in human liver cancer cells SNU-449, 2.0 X 10 per well in a 6-well cell culture plate 5 After culturing SNU-449 cells for 24 hours, pcDNA3.1-ITPR3-Flag vector DNA was transfected as described above and harvested after 72 hours. As a result of flow cytometry analysis as described above, when compared with SNU-449 liver cancer cells transfected with only PEI without DNA as a control, it was confirmed that Chi-NPB24 did not show a significant difference in ITPR3-overexpressing SNU-449 liver cancer cells as in A549 cells, but the binding affinity of NPB24(G) and NPB24(M) and the binding affinity of rabbit anti-ITPR3 antibody and mouse anti-Flag antibody were all increased (Fig. 17b, 17d). These results indicate that overexpression of ITPR3 in cancer cells increases the binding affinity of NPB24 antibody that recognizes IPTR3.

[0207]

[0208] Example 10. Confirmation of NPB24 antibody binding affinity in ITPR3 knockdown cell lines

[0209] Human lung cancer cells A549 5.0 X 10 4 After dispensing the cells into 6-well cell culture plates using RPMI-1640 medium containing 10% FBS, the cells were cultured at 37°C, 5% CO 2 The cells were cultured for 24 h under the following conditions. 50 mM negative control siRNA (siCon), siRNA for ITPR3 5'-UCA GUG CGG UGA UGA UGU CTT-3' (siITPR3) (Bioneer, Korea) (SEQ ID NO: 55), and Lipofectamine RNAiMAX were each diluted in TOM embryos (Welgene) and incubated for 5 min at room temperature. Afterwards, each siRNA dilution and RNAiMAX dilution were mixed and incubated for 20 min at room temperature. Each dilution was transfected into A549 cells and cultured for 72 h. The cells were detached with 0.05% trypsin-EDTA, neutralized with cell culture medium containing 10% FBS, harvested, and passed through a 40 μm strainer to single cells. Afterwards, flow cytometry was performed using the same method as above. As a result, the binding affinity of the NPB24 antibody group (NPB24(G), NPB24(M), Chi-NPB24) to cell surface proteins was reduced in A549 lung cancer cells with ITPR3 knockdown (Fig. 18a, 18b).

[0210] To analyze the binding affinity of the NPB24 antibody group to intracellular proteins of A549 cells with knockdown of ITPR3, A549 cells with knockdown of ITPR3 were harvested using the above method, washed twice with PBA (PH7.4), and fixed with 4% paraformaldehyde for 15 minutes at room temperature. After that, each primary antibody was diluted in PBA containing 0.5% saponin and reacted at 4℃ for 30 minutes. After washing twice with PBA, the secondary antibody corresponding to each primary antibody was diluted in PBA containing 0.5% saponin and reacted at 4℃ for 30 minutes. After washing twice with PBA, the reaction of the antibodies to intracellular proteins was analyzed using FACS Canto II. As a result, we confirmed that the binding of NPB24 antibodies (NPB24(G), NPB24(M), Chi-NPB24) to intracellular proteins was reduced in A549 lung cancer cells with ITPR3 knockdown (Figs. 18c, 18d). These results indicate that when ITPR3 is knocked down in cancer cells, the binding affinity of NPB24 antibodies recognizing IPTR3 is reduced, confirming that ITPR3 is an antigen recognized by NPB24 antibodies.

[0211]

[0212] Example 11. Analysis of the specificity of NPB24 for compound-derived hepatic stem cells (hCdHs) by immunocytochemistry.

[0213] 11-1. Isolation of human primary hepatocytes

[0214] Human primary hepatocytes (hPHs) were obtained using a two-step collagenase perfusion method. In step 1, the liver was perfused with solution A consisting of EDTA as a calcium chelator for 5 min at 37°C. In step 2, the liver was perfused with solution B consisting of trypsin inhibitor and collagenase for 8 min at 37°C. The liver was then extracted and minced in a dish. The primary hepatocytes were washed with Williams' Medium E (Gibco, NY, USA) and treated with 25% Percoll (GE Healthcare, Bucks, UK).

[0215]

[0216] 11-2. Establishment of compound-derived hepatic stem cells (hCdHs)

[0217] To generate human chemically derived hepatic progenitors (hCdHs), we followed the method described in our previous publication (Y. Kim, K. Kang, SB Lee, D. Seo, S. Yoon, SJ Kim, K. Jang, YK Jung, KG Lee, VM Factor, J. Jeong, D. Choi, J Hepatol 2019, 70, 97.) and Korean Patent No. 10-2107602. Human primary hepatocytes (hPHs) cultured in William's medium for 24 h were cultured in DMEM / F12 (Gibco, CA, USA) supplemented with 10 mM nicotinamide (Sigma-Aldrech, MO, USA), 1% penicillin / streptomycin (Gibco), 20 ng / mL HGF (Peprotech, UJ, USA), 20 ng / mL EGF (Peprotech), and 4 μM A83-01 (Gibco) and 3 μM CHIR99021 (StemCell Technologies) at 37°C in a CO₂ cell incubator for 7 days, with daily medium changes.

[0218]

[0219] 11-3. Analysis of the specificity of NPB24-derived hepatic stem cells (hCdHs) using immunocytochemistry

[0220] To verify that the NPB24 antibody is a compound-derived liver stem cell-specific antibody, the surface binding of the NPB24 antibody to compound-derived liver stem cells (hCdHs), human primary hepatocytes (hPHs), compound-derived liver stem cell-differentiated hepatocytes (hCdH-Heps), fibrotic hCdHs, human dermal fibroblasts (HDFs), neonatal human foreskin fibroblasts (hNuFFs), human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs), and adipose-derived mesenchymal stem cells (Adipose-MSCs) was confirmed using immunocytochemistry. Cells were fixed in 4% paraformaldehyde (PFA) for 15 minutes and washed three times with PBS. The cells were blocked for 1 hour with a solution containing PBS and 2% BSA, and 20 μg of NPB24 antibody was added and incubated for 12 hours at 4°C, protected from light. After washing with PBS, the cells were incubated with a 1:200 dilution of Dylight 633-conjugated anti-mouse IgM (Invitrogen) and a 1:1000 dilution of Hoechst33342 (Molecular Probes) for 1 hour at room temperature, protected from light. The cells were imaged using a TCS SP5 confocal microscope (Leica, Germany). NPB24 was seen to specifically bind to the surface of compound-derived hepatic stem cells (Figs. 19a and 19b).

[0221]

[0222] Example 12. Isolation of compound-derived hepatic stem cells (hCdHs) using NPB24 antibody

[0223] 12-1. Isolation of compound-derived hepatic stem cells (hCdHs) using NPB24 antibody

[0224] hCdHs cultured in a T175 flask were collected by centrifugation and detaching attached cells using TrypLE (Gibco). 1 × 10 6 20 μg of NPB24 antibody per cell was added to 100 μl of PBS buffer (2 mM EDTA, 0.5% BSA) and incubated at 4 °C for 30 minutes. 1 ml of PBS buffer was added and the cells were centrifuged at 300 g for 10 minutes to wash the cells three times. 10 μl of anti-Mouse IgM Microbeads (130-047-302, Miltenyi Biotec) was added to the cells together with PBS buffer and incubated at 4 °C for 15 minutes. 1 ml of PBS buffer was added and washed three times to prepare for cell separation. MACS ® Using MultiStand (130-042-303, Miltenyi Biotec), MidiMACS™ Separator (130-042-302, Miltenyi Biotec), and LS Columns (130-042-401, Miltenyi Biotec), 500 μl of cells were loaded onto the column and separated into NPB24 antibody-negative cell population (unlabeled) and positive cell population (labeled). After culturing for 5 days with the medium replaced every 2 days, cell morphology was observed, and it was observed that the NPB24 antibody-positive cell population maintained the representative morphology of hCdHs (Fig. 20a).

[0225]

[0226] 12-2. Analysis of cell separation efficiency in NPB24 antibody-negative / positive cell populations by flow cytometry

[0227] To analyze the cell separation efficiency in the isolated NPB24 antibody-negative / positive cell populations, flow cytometry analysis was performed using NPB24 antibody. For the analysis, approximately 2 × 10 cells were used per sample of unisolated liver stem cells, NPB24 antibody-negative cell population (unlabeled), and NPB24 antibody-positive cell population (labeled). 5 Cells were used. 2×10 5 NPB24 antibody (4 μg per cell) was added to 100 μl of PBS buffer (2% BSA) and reacted at 4 °C for 1 hour. The cells were washed with PBS buffer and reacted with anti-mouse IgM-FITC (BD Biosciences) corresponding to the primary antibody at 4 °C for 1 hour. After washing twice with PBS buffer, the cells were analyzed using a FACS CantoⅡ (BD Biosciences). It was confirmed that NPB24 antigen-presenting cells were present in 22.1% of unseparated liver stem cells, 30% of NPB24-negative cell groups, and 58.3% of NPB24-positive cell groups (Fig. 20b). These results suggest that hCdHs cells can be separated more efficiently using the MACS method using NPB24 antibody.

[0228]

[0229] Example 13. Isolation of compound-derived hepatic stem cells (hCdHs) using NPB11 and NPB24 antibodies

[0230] 13-1. Analysis of compound-derived hepatic stem cells (hCdHs) using the NPB11 and Chi-NPB24 antibody combinations

[0231] In the process of selecting antibodies that bind to compound-derived liver stem cells using an antibody library for pluripotent stem cells by flow cytometry, NPB11 and NPB24 were selected as antibodies that bind to liver stem cells but not to normal hepatocytes. It was confirmed that Chi-NPB24, a humanized antibody of NPB11 and NPB24, binds to hCdHs (Fig. 2, Fig. 10C), and it is expected that the separation efficiency of liver stem cells can be further increased when the two antibodies are used in combination. Therefore, in order to analyze hCdHs by simultaneously binding to hCdHs, Chi-NPB24 was used instead of NPB24, and hCdHs simultaneously stained by the two antibodies were analyzed by double-staining flow cytometry with NPB11 / Chi-NPB24 antibodies stained with different colors of fluorescence. First, as in Example 3, hCdHs cells were cultured at a density of about 1 × 10 per ml. 6 After mixing each sample with PBA (1% bovine serum albumin, 0.02% NaN3 in PBS), the antibody NPB11 was reacted at 4°C for 30 minutes. After washing twice with PBA, the primary antibody corresponding to anti-mouse IgG-Alexa660 (Invitrogen) was reacted for another 20 minutes at 4°C. After washing twice with PBA, the Chi-NPB24 antibody was reacted at 4°C for 30 minutes, and then anti-human IgG-FITC (Invitrogen) was reacted for another 20 minutes at 4°C. After washing, the ratio of hCdHs double-stained with NPB11 and Chi-NPB24 in PI (propidium iodide)-negative cells was confirmed using FACSCalibur and Cell Quest software (BD sciences). As a result, it was confirmed that approximately 13.3% of the entire hCdHs cell population was double-stained with NPB11 and Chi-NPB24 (Fig. 21), and this result suggests that when two antibodies are used, up to 13.3% of hCdHs that are double positive for NPB11 and NPB24 can be isolated.

[0232]

[0233] 13-2. Isolation of compound-derived hepatic stem cells (hCdHs) using NPB11 and NPB24 antibodies

[0234] To increase the efficiency of hCdHs separation, the isolated cells were first separated using the NBP11 antibody, and then the separated cells were secondarily separated using the NPB24 antibody. hCdHs cultured in a T175 flask were collected by centrifugation using TrypLE (Gibco) to collect attached cells. 1 × 10 6 Add 20 μg of NPB11 antibody per cell to 100 μl of PBS buffer (2 mM EDTA, 0.5% BSA) and incubate at 4 °C for 30 minutes. Then, add 1 ml of PBS buffer and centrifuge at 300 g for 10 minutes to wash the cells three times. Add 10 μl of Anti-Mouse IgG Microbeads (130-048-402, Miltenyi Biotec) to the cells together with PBS buffer and incubate at 4 °C for 15 minutes. Then, add 1 ml of PBS buffer and wash three times. Then, add 500 μl of PBS to prepare for cell separation. MACS ® Using MultiStand (130-042-303, Miltenyi Biotec), MidiMACS™ Separator (130-042-302, Miltenyi Biotec), and LS Columns (130-042-401, Miltenyi Biotec), 500 μl of cells were loaded onto the column and separated into NPB11 antibody-negative and -positive cell groups, and cultured in a 6-well plate. The NPB11 antibody-positive cell group was collected by centrifugation using TrypLE and attached cells were collected. 1 × 10 5Add 2 μg of NPB24 antibody per cell to 100 μl of PBS buffer (2 mM EDTA, 0.5% BSA) and incubate at 4 °C for 30 minutes. Then, add 1 ml of PBS buffer and centrifuge at 300 g for 10 minutes to wash the cells three times. Add 10 μl of Anti-Mouse IgM Microbeads (130-047-302, Miltenyi Biotec) to the cells together with PBS buffer and incubate at 4 °C for 15 minutes. Then, add 1 ml of PBS buffer and wash three times. Then, add 500 μl of PBS to prepare for cell separation. MACS ® Using MultiStand (130-042-303, Miltenyi Biotec), MiniMACS™ Separator (130-042-102, Miltenyi Biotec), and MS Columns (130-042-201, Miltenyi Biotec), 500 μl of cells were loaded onto the column and separated into NPB24 antibody-negative and -positive cell groups. After the secondary separation, only cells with a purer, representative morphology of hCdHs were observed in the NPB24 antibody-positive cell group (labeled) compared to the -negative cell group (unlabeled) (Fig. 22a).

[0235]

[0236] 13-3. Analysis of the isolation efficiency of NPB24-positive cell populations separated through flow cytometry analysis

[0237] In Example 13-2, the separation efficiency of the isolated hCdHs recovered after the primary separation using NPB11 antibody and the secondary separation using NPB24 antibody was analyzed through flow cytometry. It was confirmed that NPB24-positive cells increased from 24.4% in unseparated liver stem cells to 54.3% in cells initially separated with NPB11, and to approximately 91% after secondary separation with NPB24 (Fig. 22b).

[0238]

[0239] Example 14. Analysis of liver stem cell characteristics of NPB11 / NPB24 antibody-negative / positive cell populations.

[0240] 14-1. Analysis of liver stem cell characteristics using immunocytochemical staining

[0241] Cells to be analyzed were fixed in 4% paraformaldehyde (PFA) for 15 minutes and washed three times with PBS. Blocked for 1 hour with a solution containing PBS and 2% BSA, 20 μg of NPB11, NPB24 antibodies, and liver stem cell markers EPCAM (ab71916, Abcam) and SOX9 (ab185966, Abcam) were added and reacted for 12 hours at 4℃, protected from light. After washing with PBS, a solution diluted 1:200 of Dylight 633-conjugated anti-mouse IgG (Invitrogen) or Alexa Fluor 488-conjugated anti-rabbit IgG (Invitrogen) and a solution diluted 1:1000 of Hoechst33342 (Molecular Probes, USA) were reacted for 1 hour at room temperature, protected from light. Cells were imaged using a TCS SP5 confocal microscope (Leica, Germany). In the negative cell population isolated with the NPB11 / NPB24 antibody combination, cells stained with and without NPB11 and NPB24 antibodies were mixed, but in the positive cell population, almost all cells were stained with NPB11 and NPB24. In addition, most cells in the positive cell population isolated with the NPB11 / NPB24 antibody combination were stained with the liver stem cell markers EPCAM and SOX9 proteins, indicating that the use of the two antibody combinations can significantly increase the hCdHs liver stem cell population (Fig. 23).

[0242]

[0243] 14-2. Analysis of the characteristics of hCdHs liver stem cells from NPB11 / NPB24 antibody-negative / positive cell populations using mRNA isolation and RT-PCR.

[0244] To verify the characteristics of hCdHs hepatic stem cells in NPB11 and NPB24 antibody-negative / positive cell groups, the expression of hepatic stem cell marker genes was analyzed using qPCR. Total RNA was isolated using Trizol reagent (Gibco), and 1 μg of RNA sample was reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, PA, USA). Real-time PCR was performed on a CFX Connect Real-Time PCR Detection system (Bio-rad, CA, USA) using 10 μl of qPCR PreMix (Dyne bio, Korea), 1 μl of cDNA, and oligonucleotide primers (Table 6). Reactions were analyzed in triplicate for each gene. The PCR cycle consisted of 40 cycles of 95°C for 20 s and 60°C for 40 s. Melting curve and melting peak data were obtained to characterize the PCR products. Quantitative data were analyzed as mean ± standard deviation (SD) along with inferential statistics (p values). Statistical significance was assessed by a two-tailed t-test with **p<0.01, ****p<0.0001 as significant. As a result, we observed that the gene expression of liver stem cell marker genes SOX9, CK19, EPCAM, and ITGA6 was significantly increased in the positive cell groups isolated by the primary NPB11 and secondary NPB24 antibodies (Figures 24a and 24b). This indicates that the liver stem cell characteristics were further increased in the NPB11 / NPB24 antibody-positive cell groups.

[0245] Gene Primer Primer Sequence (5'-3') CK19 Forward TTCCGGACCAAGTTTGAGAC (SEQ ID NO: 27) Reverse CTCCGTGGTTCTTCTTCAGG (SEQ ID NO: 28) EPCAM Forward GAACAATGATGGGCTTTATG (SEQ ID NO: 29) Reverse TGAGAAATTCAGGTGCTTTTT (SEQ ID NO: 30) SOX9 Forward GAGGAAGTCGGTGAAGAACG (SEQ ID NO: 31) Reverse ATCGAAAGGTCTCGATGTTGG (SEQ ID NO: 32) ITGA6 Forward TCGCTGGGATCTTGATGCTTGC (SEQ ID NO: 33) Reverse TGAGACATGGATCTCAGCCTTGTGA (SEQ ID NO: 34) α-SMA Forward GACAATGGCTCTGGGCTCTGTAA (SEQ ID NO: 35) Reverse CTGTGCTTCGTCACCCACGTA (SEQ ID NO: 36)COL1A Forward CCCGGGTTTCAGAGACAACTTC (SEQ ID NO: 37) Reverse TCCCACATGCTTTATTCCAGCAATC (SEQ ID NO: 38) GAPDH Forward TGCACCACCAACTGCTTAGC (SEQ ID NO: 39) Reverse GGCATGGACTGTGGTCATGAG (SEQ ID NO: 40)

[0246]

[0247] 14-3. Analysis of cell fibrosis in the hepatic stem cell antibody-positive cell population isolated by NPB11 / NPB24 antibodies

[0248] To analyze cell fibrosis in the NPB11, NPB24 antibody-negative / positive cell populations of compound-derived hepatic stem cells, fibrosis marker gene expression was analyzed using qPCR. The analysis method of Example 14-2 was followed. Quantitative data were performed as mean ± standard deviation (SD) with inferential statistics (p values). Statistical significance was assessed by a two-tailed t-test with ****p<0.0001 and ns set as not significant. It was confirmed that the gene expression of fibrosis marker genes α-SMA and COL1A, which were increased in unisolated hepatic stem cells, was significantly reduced in the primary NPB11 and secondary NPB24 antibody-positive cell populations (Fig. 25). These results suggest that analyzing hepatic stem cells using NPB11 and NPB24 antibodies can significantly eliminate cells that cause fibrosis.

Claims

1. A monoclonal antibody comprising a heavy chain variable region comprising heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 1, heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 2, and heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 3; and a light chain variable region comprising light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 4, light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 5, and light chain complementary determining region 3 (LCDR3) of SEQ ID NO:

6.

2. In claim 1, the heavy chain variable region is a monoclonal antibody having the sequence of SEQ ID NO:

7.

3. In claim 1, the light chain variable region is a monoclonal antibody having the sequence of SEQ ID NO:

8.

4. In claim 1, a monoclonal antibody that binds to IP3R3, which is a surface marker of pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells.

5. A polynucleotide encoding the monoclonal antibody of claim 1.

6. A polynucleotide according to claim 5, comprising a polynucleotide of SEQ ID NO: 11 encoding HCDR1; a polynucleotide of SEQ ID NO: 12 encoding HCDR2; a polynucleotide of SEQ ID NO: 13 encoding HCDR3; a polynucleotide of SEQ ID NO: 14 encoding LCDR1; a polynucleotide of SEQ ID NO: 15 encoding LCDR2; and a polynucleotide of SEQ ID NO: 16 encoding LCDR3.

7. A polynucleotide comprising a polynucleotide of SEQ ID NO: 17 encoding a heavy chain variable region and a polynucleotide of SEQ ID NO: 18 encoding a light chain variable region, according to claim 5.

8. A vector comprising the polynucleotide of claim 5.

9. A hybridoma producing the monoclonal antibody of claim 1.

10. A composition for detecting IP3R3 expressing cells comprising a monoclonal antibody according to any one of claims 1 to 4.

11. A composition for detecting IP3R3-expressing cells according to claim 10, wherein the IP3R3-expressing cells are pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells.

12. A kit for detecting IP3R3 expressing cells comprising the composition of claim 10.

13. In claim 12, a kit for detecting IP3R3-expressing cells for detecting pure human pluripotent stem cells, quasi-human pluripotent stem cells, human cancer cells, and liver stem cells.

14. A composition for diagnosing cancer comprising the monoclonal antibody of claim 1.

15. A composition for diagnosing cancer according to claim 14, wherein the cancer is human embryonic cancer, lung cancer, pancreatic cancer, or liver cancer.

16. A step of treating a sample with the monoclonal antibody of claim 1; and a step of treating the sample with the PODXL antibody, A method for selecting liver stem cells, wherein the PODXL antibody comprises a heavy chain variable region comprising heavy chain complementary determining region 1 (HCDR1) of SEQ ID NO: 19, heavy chain complementary determining region 2 (HCDR2) of SEQ ID NO: 20, and heavy chain complementary determining region 3 (HCDR3) of SEQ ID NO: 21; and a light chain variable region comprising light chain complementary determining region 1 (LCDR1) of SEQ ID NO: 22, light chain complementary determining region 2 (LCDR2) of SEQ ID NO: 23, and light chain complementary determining region 3 (LCDR3) of SEQ ID NO: 24.

Images