Targeted viral particles

Abstract

Disclosed herein are compositions and methods for cell specific gene delivery using recombinant adeno-associated viruses (AAV). The AAV particles provided herein are conjugated to antibodies targeting the membrane protein of T cells or tumor antigens and carry transgenes, such as those encoding cytokines, to specifically deliver such cytokines to tumor microenvironment. Methods of producing such antibody conjugated AAV particles are also described. Also provided herein are methods of treating cancer using such antibody conjugated AAV particles.

Description

TARGETED VIRAL PARTICLES

[0001] This application claims priority to PCT Patent Application No. PCT / CN2023 / 126520, filed on October 25, 2023, and PCT Patent Application No. PCT / CN2023 / 126523, filed on October 25, 2023, which are incorporated by reference in their entireties.

[0002] 1. Reference to Sequence Listing Submitted Electronically

[0003] This application incorporates by reference a Sequence Listing as an XML file entitled “102A008WO02_SL” created on October 23, 2024 and having a size of 103, 788 bytes.2. Field

[0004] The present invention relates to molecular biology, cell biology, and medicine. Provided herein include targeted recombinant viral constructs and their uses in methods of cell therapy, gene therapy, and cancer immune therapy.3. Background

[0005] Adeno-associated virus (AAV) -based gene therapy has emerged as a promising approach for the targeted delivery of therapeutic genes. The fusion of gene therapy with cancer immunotherapy, utilizing AAV vectors to deliver therapeutic transgenes, including inflammatory cytokines, to cancer cells in vivo, offers a promising avenue for therapeutic advancement. Nevertheless, the inherent limitation of non-specific targeting by AAV vectors results in suboptimal infection rates within the tumor microenvironment and the emergence of side effects, thus posing a significant hurdle to the clinical implementation of such therapies. The compositions and methods disclosed herein address this need and provide related advantages.4. Summary

[0006] Provided herein are also compositions comprising (1) a recombinant Adeno-Associated Virus (AAV) particle that comprises a capsid protein linked to a first member of a binding pair, and (2) a second member of the binding pair that can be linked to an antibody or antigen-binding fragment that specifically binds to a surface antigen of a target cell. In some embodiments, the second member is linked to the antibody or antigen binding fragment.

[0007] In some embodiments, the first member of the binding pair is a protein catcher, and the second member of the binding pair is a protein tag. In some embodiments, the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length. In other embodiments, the protein catcher ranges from about 50 to about 200 amino acids in length, including ranges such as 50-150 or 100-150 amino acids. In further embodiments, the protein tag ranges from  about 10 to about 30 amino acids in length. In some embodiments, the protein catcher and peptide tag are SpyCatcher and SpyTag, SpyCatcher002 and SpyTag002, SpyCatcher003 and SpyTag003, SnoopCatcher and SnoopTag, or SdyCatcher and SdyTag.

[0008] In some embodiments, the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) , or a designed ankyrin repeat protein (DARPin) .

[0009] Further provided herein are compositions wherein the AAV particle is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, or any chimera thereof. In some embodiments, the AAV particle comprises a modified capsid protein having an insertion of a protein catcher. In some embodiments, the protein catcher is inserted at specific positions within the capsid protein, such as amino acid position 588 or the N-terminus of VP2. In other embodiments, the protein catcher replaces specific amino acids within the capsid protein, such amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0010] In some embodiments, the AAV particle encapsidates a nucleic acid comprising a transgene of interest. The transgene can encode a therapeutic protein, an antibody or fragment thereof, aCRISPR / Cas system, antisense RNA, shRNA, miRNA, or a suicide gene.

[0011] In some embodiments, the target cell is a tumor cell, and the antibody or antigen-binding fragment specifically binds to a tumor antigen. In this embodiment, the composition is specifically directed toward targeting tumor cells by binding to tumor-associated antigens such as CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα, and NY-ESO-1.

[0012] In some embodiments, the tumor targeting AAV particle encapsidates a nucleic acid comprising a transgene of interest. The transgene can encode a therapeutic protein, an antibody or fragment thereof, a CRISPR / Cas system, antisense RNA, shRNA, miRNA, or a suicide gene. The transgene encodes a cytokine such as IL-15, IL-12p35, or IL-12p40, or fusion proteins thereof.

[0013] In some embodiments, the target cell is a T cell, and the antibody or antigen-binding fragment specifically binds to a T cell-specific surface protein. The T cell surface proteins that can be targeted include, for example, CD3, CD4, or CD8.

[0014] In some embodiments, the T cell targeting AAV particle encapsidates a nucleic acid comprising a transgene of interest. The transgene can encode a chimeric antigen receptor (CAR) that specifically binds to a tumor antigen. The transgene can also encode a CD64 / CD16A chimera.

[0015] Also provided herein are kits comprising the described compositions, wherein the AAV particle and the antibody or antigen-binding fragment are placed in separate containers. In other  embodiments, the AAV particle and the antibody or antigen-binding fragment form a conjugate by the binding of the first and second members. The compositions can further include a pharmaceutically acceptable carrier.

[0016] Additionally, provided are methods of preparing AAV conjugates targeted to cells by incubating the compositions under conditions that allow binding of the first and second members. In some embodiments, methods of delivering a transgene of interest to a target cell are provided, comprising contacting the target cell with the composition in vitro, ex vivo, or in vivo. In some embodiments, methods of treating cancer in a subject in need thereof are also provided, comprising administering the compositions disclosed herein to the subject.

[0017] Provided herein are also methods for using the compositions in the delivery of transgenes of interest or in the treatment of cancer, as well as their use in the manufacture of medicaments for treating cancer.5. Brief Description of Drawings

[0018] FIGs. 1A-1B show characterization of anti-FRα-conjugated AAV6 particles. FIG. 1A provides representative western blot results characterizing anti-FRα-conjugated AAV6 particles. FIG. 1B provides representative FACS results showing the infection ratio of anti-FRα-conjugated AAV6 particles in FRα-expressing cancer cells (SKOV3) .

[0019] FIGs. 2A-2B show characterization of anti-FRα-conjugated AAV9 particles. FIG. 2A provides representative western blot results characterizing anti-FRα-conjugated AAV9 particles. FIG. 2B provides representative FACS results showing infection ratio of anti-FRα-conjugated AAV9 particles in FRα-expressing cancer cells (SKOV3) .

[0020] FIG. 3 provides representative western blot results characterizing anti-CD3-conjugated AAV9 particles (left) and anti-CD3-conjugated AAV6 particles (right) .

[0021] FIG. 4 provides representative FACS results showing T cell infection ratio of anti-CD3-conjugated AAV9 particles (left) and anti-CD3-conjugated AAV6 particles (right) in hPBMCs.

[0022] FIGs. 5A-5D show the characterization of the manufacture of antibody-conjugated AAV9 particles (tAAV9) . FIG. 5A provides the titer of different SpyCatcher modified AAV9s in comparison with rAAV9. FIG. 5B shows the expression and the VP1 / VP2 ratio of different SpyCatcher modified AAV9s monitored by SDS-PAGE. FIG. 5C shows the Spy-Ligation for anti-CD3 scFv-AAV conjugation monitored by SDS-PAGE. FIG. 5D shows the Spy-Ligation for anti-FRα scFv-AAV conjugation monitored by SDS-PAGE

[0023] FIGs. 6A-6B show in vitro potency for rAAV9 and tAAV9 targeting CD3 detected by GFP (GOI) signal in FACS in different cell lines such as CD3+T cell in hPBMC (FIG. 6A) and CD3-HepaRG cells (FIG. 6B) .

[0024] FIGs. 7A-7C show in vitro potency for rAAV9 and tAAV9 targeting hFRαdetected by GFP (GOI) signal in FACS in different cell lines such as hFRα-MC38 (FIG. 7A) , hFRα+SKOV-3 cells (FIG. 7B) , and CD3-HepaRG cells (FIG. 7C) .

[0025] FIGs. 8A-8B show the expression of GOIs (hIL-12) by hFRα-MC38 cells (FIG. 8A) or the mIL-12 expression by hFRα-MC38 cells (FIG. 8B) after the GOIs were delivered by rAAV9 and tAAV9, respectively.

[0026] FIG. 9 shows a schematic depiction of the design for the in vivo biodistribution study of rAAV9 and tAAV9.

[0027] FIGs. 10A-10B show the IVIS imaging of rAAV9 dosed (FIG. 10A) and tAAV9 dosed (FIG. 10B) NOG mice with tumor of hFRα-MC38. The circles highlighted the tumor specific distribution of tAAV9.

[0028] FIGs. 11A-11B show results of the in vivo biodistribution study of rAAV9 and tAAV9 by monitoring the enzyme activity of GOI (luciferase) (FIG. 11A) or the genome copy number in different organs (FIG. 11B) .

[0029] FIG. 12 shows a schematic depiction of the design of the anti-tumor efficacy study of tAAV9 in vivo.

[0030] FIGs. 13A-13B provide results of in vivo efficacy studies. FIG. 13A shows time-course analysis tumor volume after treatment (0-45 days post-treatment) . FIG. 13B shows time-course analysis of body weight after treatment (0-45 days post-treatment) .

[0031] FIGs. 14A-14F show the tumor volume of single mouse in the in vivo efficacy studies with the groups from A to F. FIG. 14A: Group 1: PBS; FIG. 14B: Group 2: rAAV9-4E12 vg / kg; FIG. 14C: Group 3: rAAV9-1E14 vg / kg; group; FIG. 14D: Group 4: tAAV9-4E12 vg / kg; FIG. 14E: Group 5: tAAV9-2E13 vg / kg; FIG. 14F: Group 6: tAAV9-1E14 vg / kg.

[0032] FIGs. 15A-15E show percentages of different immune cells such as CD45+cells (FIG. 15A) , CD4+T cells (FIG. 15B) , CD8+T cells (FIG. 15C) , NK cells (FIG. 15D) , and NKT cells (FIG. 15E) in mPBMC on day 14 after treatment. Each data was obtained from the mixed blood sample with 4 mice in the same group.

[0033] FIGs. 16A-16D show percentages of different PD-1+immune cells such as PD-1+ / CD4+T cells (FIG. 16A) , PD-1+ / CD8+T cells (FIG. 16B) , PD-1+NK cells (FIG. 16C) and PD-1+NKT cells  (FIG. 16D) in mPBMC on day 14 after treatment. Each data was obtained from the mixed blood sample with 4 mice in the same group.

[0034] FIGs. 17A-17B provide the mIL-12 (FIG. 17A) and mIFN-γ (FIG. 17B) level in peripheral blood after treatment. Data were obtained by mIL-12 and mIFN-γELISA kits, respectively.

[0035] FIG. 18 shows a schematic depiction of the design of safety study of tAAV9 in vivo.

[0036] FIG. 19 shows the weight of spleen on day 17 after rAAV9 or tAAV9 treatment.

[0037] FIGs. 20A-20F shows blood biochemistry analysis of AST (FIG. 20A) , ALT (FIG. 20B) , TBIL (FIG. 20C) , CRE (FIG. 20D) , UREA (FIG. 20E) , and LDH (FIG. 20F) .

[0038] FIG. 21 provides HE stained and IHC of IL-12 of liver on day-17 after rAAV9 or tAAV9 treatment. Arrows indicate the inflammatory regions around blood vessels with IL-12-positive hepatocytes.

[0039] FIG. 22 provides HE stained and IHC of IL-12 of liver on day-17 after rAAV9 or tAAV9 treatment. Arrows indicate the IL-12-positive cells in tumor.

[0040] FIGs. 23A-23C provide the design of tAAV9. FIG. 23A shows the preparation and conjugation of SpyCatcher modified AAV9 and scFv-SpyTag. FIG. 23B provides an example for VP2-split expression by two plasmids encoding VP2 only and VP1 / VP3, respectively. FIG. 23C provides a diagram illustrating the infection of tAAV9 in the cell with specific biomarkers.

[0041] FIG. 24 shows the mechanism-of-action (MOA) for anti-tumor effect by tAAV9 delivering IL-12.6. Detailed Description

[0042] The present invention features compositions and methods for delivering transgenes (e.g., cytokine-encoding transgenes) specifically to specific cells, including cancer cells and T cells. The compositions described herein include, e.g., one or more recombinant vectors (e.g., AAV vectors) modified to achieve cancer cell targeting or T cell targeting.

[0043] In some embodiments, provided herein are AAVs modified to achieve cancer cell targeting. Accordingly, compositions and methods provided herein can be used for the production of cytokines in the tumor microenvironment (TME) , which recruits and stimulates the proliferation and activation of immune effector cells, such as cytotoxic T cells, natural killer cells, and macrophages. Accordingly, compositions and methods for treating cancer are also provided herein.

[0044] In some embodiments, provided herein are AAVs modified to achieve T cell targeting. Cell therapy is increasingly used as an effective approach in the treatment of cancer. Typically, immune effector cells, such as T cells, are genetically engineered to enhance their ability to target and destroy  cancer cells and then administered to the patients. For example, specific transgenes, such as transgenes encoding chimeric antigen receptors (CARs) , can be introduced to T cells to enhance the proliferation and tumor killing of the T cells. However, ex vivo handling of cells for therapeutic purposes presents a multifaceted set of challenges. Ensuring the robust expansion and maintenance of cells in culture, preserving their identity and differentiation state, and conducting stringent quality control are fundamental hurdles, just to name a few.

[0045] Gene therapy utilizing adeno-associated viruses (AAV) has emerged as a promising approach for delivering therapeutic genes to target cells. However, cell or tissue specific targeting, which delivers therapeutic genes to specific tissues or cells in the body, while minimizing unintended effects on non-targeted tissues still presents a great challenge. The potential combination of gene therapy and cell therapy by using AAV particles to deliver therapeutic transgenes to T cells in vivo, thereby bypassing the hurdle of ex vivo genetic engineering, holds great therapeutic potential. But means to achieve specific T cell targeting and efficient in vivo engineering of the T cells are still lacking.

[0046] The present disclosure also features compositions and methods for delivering transgenes of interest specifically to T cells. The compositions described herein include, e.g., one or more recombinant vectors (e.g., AAV vectors) modified to achieve T cell targeting. The genetically engineered T cells can express transgene in sustained fashion. In some embodiments, the T cells are engineered to enhance their activities in attacking cancer cells. For example, compositions and methods provided herein can be used for delivering transgenes encoding CARs to T cells, or for delivering transgenes encoding chimeric CD16 / CD64 proteins to T cells. Therefore, compositions and methods provided herein can be used the production of CART cells or NK-like T cells ex vivo or in vivo, which can be used in, e.g., the treatment of cancer. Accordingly, compositions and methods for treating cancer are also provided herein.

[0047] Before the present disclosure is further described, it is to be understood that the disclosure is not limited to the particular embodiments set forth herein, and it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments, and is not intended to be limiting.

[0048] 6.1 Definitions

[0049] Unless otherwise defined herein, scientific and technical terms used in the present disclosures shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of,  cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art.

[0050] The term “a” or “an” entity refers to one or more of that entity; for example, “an antibody, ” is understood to represent one or more antibodies.

[0051] The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B, ” “A or B, ” “A” (alone) , and B” (alone) . Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone) ; B (alone) ; and C (alone) .

[0052] As used herein, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects. The term “about” encompasses the exact number recited. In some embodiments, “about” means within plus or minus 10%of a given value or range. In some embodiments, “about” means that the variation is±5%, ±4%, ±3%, ±2%, ±1%, ±0.5%, ±0.2%, or ±0.1%of the value to which “about” refers. In some embodiments, “about” means that the variation is±1%, ±0.5%, ±0.2%, or±0.1%of the value to which “about” refers.

[0053] As used herein, the term “endogenous” describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, a tissue, or a cell, such as a human cell) .

[0054] The terms “peptide, ” “polypeptide, ” “protein, ” as used interchangeably herein refer to polymers of amino acids of any length, which can be linear or branched. It can include unnatural or modified amino acids or be interrupted by non-amino acids. A polypeptide, peptide, polypeptide chain, peptide chain, or protein can also be modified with, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification.

[0055] The terms “polynucleotide, ” “nucleic acid, ” as used interchangeably herein mean polymers of nucleotides of any length and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.

[0056] The term “variant” as used herein in relation to a reference polynucleotide or reference polypeptide refers to a polynucleotide or a polypeptide having a nucleotide sequence or amino acid sequence that differs from that of the reference polynucleotide or reference polypeptide, wherein the  difference (s) does not generally alter at least one biological function of the reference polynucleotide or reference polypeptide, and / or the phylogenetic characterization of the reference polynucleotide or reference polypeptide, e.g., where the difference (s) may be due to degeneracy of the genetic code, isolate variations, length of the sequence, etc.

[0057] The terms “identical, ” percent “identity, ” and their grammatical equivalents as used herein in the context of two or more polynucleotides or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percentage identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variants thereof. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST.

[0058] In some embodiments, two polynucleotides or polypeptides provided herein are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of the amino acid sequences that is at least about 10 residues, at least about 20 residues, at least about 40-60 residues, at least about 60-80 residues in length or any integral value there between. In some embodiments, identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a target protein or an antibody. In some embodiments, identity exists over a region of the nucleotide sequences that is at least about 10 bases, at least about 20 bases, at least about 40-60 bases, at least about 60-80 bases in length or any integral value there between. In some embodiments, identity exists over a longer region than 60-80 bases, such as at least about 80-1000 bases or more, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as a nucleotide sequence encoding a protein of interest.

[0059] As one of skill in the art would understand, as used herein, for the purpose of determining percent sequence identity, a uridine nucleoside in an RNA molecule is considered equivalent to a thymidine nucleoside in a DNA molecule. Therefore, an RNA equivalent can be considered to have 100%sequence identity to a DNA polynucleotide if the RNA equivalent and DNA polynucleotide differ from one another only by the substitution of uridine nucleosides in the RNA equivalent with thymidine nucleosides in the DNA polynucleotide.

[0060] The term “antibody, ” and its grammatical equivalents as used herein refer to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or a combination of any of the foregoing, through at least one antigen-binding site wherein the antigen-binding site is usually within the variable region of the immunoglobulin molecule. As used herein, the term encompasses intact polyclonal antibodies, intact monoclonal antibodies, single-domain antibodies (sdAbs; e.g., camelid antibodies, alpaca antibodies) , single-chain Fv (scFv) antibodies, heavy chain antibodies (HCAbs) , light chain antibodies (LCAbs) , multispecific antibodies, bispecific antibodies, monospecific antibodies, monovalent antibodies, and any other modified immunoglobulin molecule comprising an antigen-binding site (e.g., dual variable domain immunoglobulin molecules) as long as the antibodies exhibit the desired biological activity. Antibodies also include, but are not limited to, mouse antibodies, camel antibodies, chimeric antibodies, humanized antibodies, and human antibodies. An antibody can be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) , based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. Unless expressly indicated otherwise, the term “antibody” as used herein include “antigen-binding fragment” of intact antibodies. The term “antigen-binding fragment” as used herein refers to a portion or fragment of an intact antibody that is the antigenic determining variable region of an intact antibody. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F (ab’) 2, Fv, linear antibodies, single chain antibody molecules (e.g., scFv) , heavy chain antibodies (HCAbs) , light chain antibodies (LCAbs) , disulfide-linked scFv (dsscFv) , diabodies, tribodies, tetrabodies, minibodies, dual variable domain antibodies (DVD) , single variable domain antibodies (sdAbs; e.g., camelid antibodies, alpaca antibodies) , and single variable domain of heavy chain antibodies (VHH) , and bispecific or multispecific antibodies formed from antibody fragments. A “bispecific” antibody is an artificial hybrid antibody having two different antigen binding sites, which recognize and specifically bind two different targets. Bispecific antibodies can be produced by a variety of methods  including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann, Clin. Exp. Immunol. 79: 315-321 (1990) ; Kostelny et al., J. Immunol. 148, 1547-53 (1992) .

[0061] The term “heavy chain” when used in reference to an antibody refers to a polypeptide chain of about 50-70 kDa, wherein the amino-terminal portion includes a variable region of about 120 to 130 or more amino acids and a carboxy-terminal portion that includes a constant region. The constant region can be one of five distinct types, referred to as alpha (α) , delta (δ) , epsilon (ε) , gamma (γ) and mu (μ) , based on the amino acid sequence of the heavy chain constant region. The distinct heavy chains differ in size: α, δ and γ contain approximately 450 amino acids, whileμandεcontain approximately 550 amino acids. When combined with a light chain, these distinct types of heavy chains give rise to five well known classes of antibodies, IgA, IgD, IgE, IgG and IgM, respectively, including four subclasses of IgG, namely IgGl, IgG2, IgG3 and IgG4. A heavy chain can be a human heavy chain.

[0062] The term “light chain” when used in reference to an antibody refers to a polypeptide chain of about 25 kDa, wherein the amino-terminal portion includes a variable region of about 100 to about 110 or more amino acids and a carboxy-terminal portion that includes a constant region. The approximate length of a light chain is 211 to 217 amino acids. There are two distinct types, referred to as kappa (κ) and lambda (λ) based on the amino acid sequence of the constant domains. Light chain amino acid sequences are well known in the art. A light chain can be a human light chain.

[0063] The term “variable domain” or “variable region” refers to a portion of the light or heavy chains of an antibody that is generally located at the amino-terminal of the light or heavy chains and has a length of about 120 to 130 amino acids in the heavy chain and about 100 to 110 amino acids in the light chain, and is used in the binding and specificity of each particular antibody for its particular antigen. The variable domain of the light chain is referred to as the “VL” ; and the variable domain of the heavy chain is referred to as the “VH. ” The variable domains differ extensively in sequence between different antibodies. The variability in sequence is concentrated in the CDRs while the less variable portions in the variable domain are referred to as framework regions (FR) . The CDRs of the light and heavy chains are primarily responsible for the interaction of the antibody with antigen. The numbering of amino acid positions used herein is according to the EU Index, as in Kabat et al. (1991) Sequences of proteins of immunological interest. (U.S. Department of Health and Human Services, Washington, D.C. ) 5th ed. A variable region can be a human variable region.

[0064] A CDR refers to one of three hypervariable regions (H1, H2 or H3) within the non-framework region of the immunoglobulin (Ig or antibody) VHβ-sheet framework, or one of three hypervariable regions (L1, L2 or L3) within the non-framework region of the antibody VL β-sheet  framework. Accordingly, CDRs are variable region sequences interspersed within the framework region sequences. CDR regions are well known to those skilled in the art and have been defined by a variety of methods / systems. These systems and / or definitions have been developed and refined over years and include Kabat, Chothia, IMGT, AbM, and Contact. For example, Kabat defines the regions of most hypervariability within the antibody variable (V) domains (Kabat et al., J. Biol. Chem. 252: 6609-6616 (1977) ; Kabat, Adv. Prot. Chem. 32: 1-75 (1978) ) . The Chothia definition is based on the location of the structural loop regions, which defines CDR region sequences as those residues that are not part of the conservedβ-sheet framework, and thus are able to adapt different conformations (Chothia and Lesk, J. Mol. Biol. 196: 901-917 (1987) ) . Both terminologies are well recognized in the art. Additionally, the IMGT system is based on sequence variability and location within the structure of the variable regions. The AbM definition is a compromise between Kabat and Chothia. The Contact definition is based on analyses of the available antibody crystal structures. Software programs (e.g., abYsis) are available and known to those of skill in the art for analysis of antibody sequence and determination of CDRs. The positions of CDRs within a canonical antibody variable domain have been determined by comparison of numerous structures (Al-Lazikani et al., J. Mol. Biol. 273: 927-948 (1997) ; Morea et al., Methods 20: 267-279 (2000) ) . Because the number of residues within a hypervariable region varies in different antibodies, additional residues relative to the canonical positions are conventionally numbered with a, b, c and so forth next to the residue number in the canonical variable domain numbering scheme (Al-Lazikani et al., supra (1997) ) . Such nomenclature is similarly well known to those skilled in the art.

[0065] For example, CDRs defined according to either the Kabat (hypervariable) or Chothia (structural) designations, are set forth in the table below. 1Residue numbering follows the nomenclature of Kabat et al., supra2Residue numbering follows the nomenclature of Chothia et al., supra

[0066] One or more CDRs also can be incorporated into a molecule either covalently or noncovalently to make it an immunoadhesin. An immunoadhesin can incorporate the CDR (s) as part of a larger polypeptide chain, can covalently link the CDR (s) to another polypeptide chain, or can incorporate the CDR (s) noncovalently. The CDRs permit the immunoadhesin to bind to a particular antigen of interest. The CDR regions can be analyzed by, for example, abysis website (http:  / / abysis. org / ) .

[0067] As used herein, the term “gene” refers to a region of DNA that encodes a protein. A gene can include regulatory regions and a protein-coding region. In some embodiments, a gene includes two or more introns and three or more exons, wherein each intron forms an intervening sequence between two exons.

[0068] As used herein, the term “encode” and its grammatical equivalents refer to the inherent property of specific sequences of nucleotides in a polynucleotide or a nucleic acid, such as a gene, acDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein. Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA can include introns.

[0069] The term “codon” as used herein refers to any group of three consecutive nucleotide bases in a given messenger RNA molecule, or coding strand of DNA, that specifies a particular amino acid or a starting or stopping signal for translation. The term codon also refers to base triplets in a DNA strand.

[0070] As used herein, the term “mutation” and its grammatical equivalents refer to a change in the nucleotide sequence of a gene or a change in the polypeptide sequence of a protein. Mutations in a gene or protein can occur naturally as a result of, for example, errors in DNA replication, DNA repair, irradiation, and exposure to carcinogens, or mutations can be induced as a result of administration of a transgene expressing a mutant gene. Mutations can result from single or multiple nucleotide insertions, deletions, or substitutions.

[0071] As used herein, the terms “conservative mutation, ” “conservative substitution, ” and “conservative amino acid substitution” refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume. It is appreciated that the conservative amino acid families  include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. A conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg) .

[0072] As used herein, the term “vector” refers to a nucleic acid, e.g., DNA or RNA, that may function as a vehicle for the delivery of a gene of interest into a host cell (e.g., a mammalian cell, such as a human cell) , such as for purposes of replication and / or expression. Exemplary vectors useful in conjunction with the compositions and methods described herein are plasmids, DNA vectors, RNA vectors, virions, or another suitable replicon (e.g., viral vector) . A variety of vectors have been developed for the delivery of polynucleotides encoding exogenous proteins into a prokaryotic or eukaryotic cell. Examples of such expression vectors are disclosed in, e.g., WO 1994 / 11026, the disclosure of which is incorporated herein by reference. Expression vectors described herein contain a polynucleotide sequence as well as, e.g., additional sequence elements used for the expression of proteins and / or the integration of these polynucleotide sequences into the genome of a mammalian cell. Certain vectors that can be used for the expression of transgenes described herein include plasmids that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription. Other useful vectors for expression of transgenes contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of the mRNA that results from gene transcription. These sequence elements include, e.g., 5’ and 3’ untranslated regions, an internal ribosomal entry site (IRES) , and polyadenylation signal site to direct efficient transcription of the gene carried on the expression vector. The expression vectors described herein can also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0073] As used here, a “binding pair” refers to two cognate members that can interact to form a bond. Two “cognate” members means that the two members function together. Non-limiting and exemplary binding pairs are listed in Buning and Srivastava (2019) Mol. Ther. Methods Clin Dev 12: 248-265. In some embodiments, the two members are both peptides. As used herein, a “peptide tag” is a short peptide that, when linked to a molecule (e.g., a protein) , allows for the easy detection, purification, or immobilization of the tagged molecule by providing a specific and high-affinity binding site. A peptide tag is generally 50 or fewer amino acids in length, or 30 or fewer amino acids in length. In some embodiments, a peptide tag is about 10 to about 30 amino acids in length. As used herein, a “protein catcher” when used in connection with a “peptide tag” refers to a protein that  captures or specifically binds to the peptide tag. A protein catcher is generally larger than the peptide tag. A protein catcher can be 50 or more amino acids in length. In some embodiments, a protein catcher can be 100 or more amino acids in length.

[0074] As used herein in the context of an AAV, the term “capsid protein” refers to the structural protein that forms the outer shell (capsid) of the virus. The capsid is critical for protecting the viral genome and facilitating its entry into host cells. AAV capsid proteins are primarily composed of three types of proteins: VP1, VP2, and VP3, which are derived from the same viral gene via alternative splicing and use of different start codons. These proteins assemble into a highly organized icosahedral structure. A capsid protein can be a wildtype capsid protein, or comprise at least mutation compared to the wildtype counterpart. In some embodiments, a capsid protein can include a sequence that is heterologous to the virus, which can be inserted into the capsid protein and displayed on the surface of the capsid. The heterologous sequence can be inserted between two adjacent amino acids of the wildtype capsid protein or replace a fragment of the wildtype capsid protein.

[0075] As used herein, the term “linked” refers to a physical juxtaposition (e.g., in three-dimensional space) of components or elements that interact, directly or indirectly with one another, or otherwise coordinate with each other to participate in a biological event, which juxtaposition achieves or permits such interaction and / or coordination. In some embodiments, the linkage can involve covalent linkage of relevant components or elements with one another. In some embodiments, a linkage can be mediated by at least one isopeptide bond. In some embodiments, covalent linkage is not required to achieve effective operable linkage. For example, proteins linked together can be associated with each other, e.g., via a covalent bond or a non-covalent bond.

[0076] As used herein, the term “pharmaceutical composition” refers to a mixture containing a therapeutic agent to be administered to a subject, such as a mammal, e.g., a human, in order to prevent, treat or control a particular disease or condition affecting or that may affect the subject. As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions and / or dosage forms, which are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human) without excessive toxicity, irritation, allergic response and other problem complications commensurate with a reasonable benefit / risk ratio.

[0077] The term “treat” and its grammatical equivalents as used herein in connection with a disease or a condition, or a subject having a disease or a condition (e.g., OA) refer to an action that prevent or slow down (lessen) an undesired physiological change or disorder, that suppresses, eliminates, reduces, and / or ameliorates a symptom, the severity of the symptom, and / or the frequency of the symptom associated with the disease or disorder being treated. Beneficial or desired clinical results  include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total) , whether detectable or undetectable.

[0078] The term “subject” as used herein refers to any animal (e.g., a mammal) , including, but not limited to, humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment. A subject can be a human. A subject can have a particular disease or condition.

[0079] The term “administer” and its grammatical equivalents as used herein refer to the act of delivering, or causing to be delivered, a therapeutic or a pharmaceutical composition to the body of a subject by a method described herein or otherwise known in the art. The therapeutic can be any compound, for example, a transgene, a vector, a peptide, or a virus. Administering a therapeutic or a pharmaceutical composition includes prescribing a therapeutic or a pharmaceutical composition to be delivered into the body of a subject. Exemplary forms of administration include oral dosage forms, such as tablets, capsules, syrups, suspensions; injectable dosage forms, such as intravenous (IV) , intramuscular (IM) , or intraperitoneal (IP) ; transdermal dosage forms, including creams, jellies, powders, or patches; buccal dosage forms; inhalation powders, sprays, suspensions, and rectal suppositories.

[0080] The terms “effective amount, ” “therapeutically effective amount, ” and their grammatical equivalents as used herein refer to the administration of an agent to a subject, either alone or as a part of a pharmaceutical composition and either in a single dose or as part of a series of doses, in an amount that is capable of having any detectable, positive effect on any symptom, aspect, or characteristics of a disease, disorder or condition when administered to the subject. The therapeutically effective amount can be ascertained by measuring relevant physiological effects. The exact amount required varies from subject to subject, depending on the age, weight, and general condition of the subject, the severity of the condition being treated, the judgment of the clinician, and the like. An appropriate “effective amount” in any individual case can be determined by one of ordinary skill in the art using routine experimentation.

[0081] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description  of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0082] Exemplary genes and polypeptides are described herein with reference to GenBank numbers, GI numbers and / or SEQ ID NOS. It is understood that one skilled in the art can readily identify homologous sequences by reference to sequence sources, including but not limited to GenBank (ncbi. nlm. nih. gov / genbank / ) and EMBL (embl. org / ) .

[0083] Suitable methods and materials for the practice and / or testing of embodiments of the disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which the disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Associates, 1992 (and Supplements to 2000) ; Ausubel et al., SHORT PROTOCOLS IN MOLECULAR BIOLOGY: A COMPENDIUM OF METHODS FROM CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 4th ed., Wiley & Sons, 1999; the disclosures of which are incorporated in their entirety herein by reference.

[0084] 6.2 Compositions

[0085] Provided herein are compositions comprising modified AAV particles capable of targeting specific cells or tissues. Specifically, the modified AAV particles provided herein comprise a capsid protein linked to a first member of a binding pair, which can specifically bind to a second member of the pair. The second member can be linked to an antibody or antigen-binding fragment that specifically targets a specific cell type or tissue. Upon binding of the first member to the second member, the AAV particles gain cell or tissue specificity by displaying the antibody or antigen binding fragment on its surface.

[0086] In previous attempts to modify viral capsids, small protein tags (e.g., less than 50 amino acids in length) were typically employed as the first member due to concerns that larger proteins might disrupt the structural integrity of the capsid. Methods disclosed herein successfully use a protein catcher (at least 50 amino acids in length, at least 80 amino acids in length, or at least 100 amino acids in length) to modify the capsid without compromising its structure. This approach allows  the use of a small protein tag as the second member of the binding pair, which facilitates the efficient production of the second member and enables flexible design to target a wide range of cell types. Accordingly, the methods provided herein allow maintenance of the stability of the viral capsid while offering versatile targeting capabilities.

[0087] Accordingly, provided herein are compositions comprising (1) a recombinant AAV particle comprising a capsid protein linked to a protein catcher, and (2) an antibody or antigen-binding fragment linked to a protein tag, wherein the antibody or antigen-binding fragment specifically binds to a surface antigen of a target cell. In some embodiments, the protein catcher is at least 50 amino acids in length, and the protein tag is 50 amino acids or fewer in length. In some embodiments, the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length. In some embodiments, the protein catcher ranges from about 50 to about 200 amino acids in length. In some embodiments, the protein catcher ranges from about 80 to about 200 amino acids in length. In some embodiments, the protein catcher ranges from about 100 to about 200 amino acids in length. In some embodiments, the protein catcher ranges from about 50 to about 150 amino acids in length. In some embodiments, the protein catcher ranges from about 80 to about 150 amino acids in length. In some embodiments, the protein catcher ranges from about 100 to about 150 amino acids in length. In some embodiments, the protein catcher ranges from about 100 to about 130 amino acids in length. In some embodiments, the protein catcher is about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 amino acids in length. In some embodiments, the protein catcher is about 80 amino acids in length. In some embodiments, the protein catcher is about 100 amino acids in length. In some embodiments, the protein catcher is about 110 amino acids in length. In some embodiments, the protein catcher is about 120 amino acids in length. In some embodiments, the protein catcher is about 130 amino acids in length.

[0088] In some embodiments, the protein tag ranges from about 10 to about 50 amino acids in length. In some embodiments, the protein tag ranges from about 10 to about 30 amino acids in length. In some embodiments, the protein tag is about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 amino acids in length. In some embodiments, the protein tag is about 10 amino acids in length. In some embodiments, the protein tag is about 15 amino acids in length. In some embodiments, the protein tag is about 20 amino acids in length. In some embodiments, the protein tag is about 25 amino acids in length. In some embodiments, the protein tag is about 30 amino acids in length.

[0089] In some embodiments, the protein catcher ranges from about 100 to about 150 amino acids in length, and the protein tag ranges from about 10 to about 30 amino acids in length. In some  embodiments, the protein catcher ranges from about 100 to about 130 amino acids in length, and the protein tag is about 15 amino acids in length.

[0090] FIGs. 23A-23C provides an exemplary illustration of the compositions disclosed herein. FIG. 23A illustrates the process of modifying an AAV with peptide catcher (e.g., SpyCatcher) to allow conjugation with peptide tags (e.g., SpyTags) that are linked to antibodies (e.g., scFvs) that recognize specific cells or tissues. As shown, after modification with SpyCatcher, the AAV particle can bind to scFv molecules via SpyTag-SpyCatcher conjugation, which allows the AAV particle to display specific targeting molecules (e.g., scFv) on its surface. FIG. 23B shows a schematic of the AAV genome that can be used to prepare the modified AAV particles. As shown, a dual-vector system can be used which allows recombinant production of modified VP2 and wildtype VP1 and VP3. The Rep and Cap genes are indicated, with VP1, VP2, and VP3 representing the viral capsid proteins. The Cap region is marked with an asterisk to show the site of modification, where SpyCatcher (SC) is introduced to the capsid proteins. FIG. 23C depicts an AAV displaying SpyCatcher-modified capsid proteins interacting with biomarkers on a cell. The AAV is conjugated to multiple antibodies (e.g., scFvs) and therefore binds to specific biomarkers on the cell surface. As such, the genetic modification of AAVs to display SpyCatcher allows for subsequent conjugation with SpyTag-tagged molecules (such as antibodies) , enabling targeted delivery or interaction with cells expressing specific biomarkers.

[0091] Compositions for targeting specific cell type, such as cancer cells and T cells, are also provided herein. In some embodiments, provided herein are compositions comprising cancer targeting AAV particles. In some embodiments, compositions provided herein comprise (1) a recombinant AAV particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a tumor antigen (e.g., FRα) . In some embodiments, a conjugate is formed by the binding of the first member and second member, wherein the AAV particle is conjugated to the antibody or antigen-binding fragment. For illustrative purposes, in some embodiments, the first member is a protein catcher, and the second member is a peptide tag. In some embodiments, the tumor antigen is FRα.

[0092] In some embodiments, provided herein are compositions comprising T cell targeting AAV particles. In some embodiments, compositions provided herein comprise (1) a recombinant AAV particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a T cell-specific surface protein. In some  embodiments, a conjugate is formed by the binding of the first member and second member, wherein the AAV particle is conjugated to the antibody or antigen-binding fragment. For illustrative purposes, in some embodiments, the first member is a protein catcher, and the second member is a peptide tag. In some embodiments, the T cell-specific surface protein is CD3.

[0093] 6.2.1 AAV particles

[0094] In some embodiments, compositions provided herein comprise one or more recombinant AAV particles that can be directed to target a specific cell or tissue, such as cancer cells or T cells.

[0095] As understood in the art, an “Adeno-Associated Virus” or “AAV” is a small, non-enveloped virus that belongs to the family Parvoviridae. It is a single-stranded DNA virus with a genome of approximately 4.7 kilobases in length, characterized by its ability to establish latent infections in host cells. An AAV typically requires a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome. An AAV’s genome typically contains two open reading frames encoding the proteins responsible for replication (Rep) and the structural protein of the capsid (Cap) . The open reading frames are flanked by two Inverted Terminal Repeat (ITR) sequences, which serve as the origin of replication of the viral genome. The wild-type AAV viral genome comprises nucleotide sequences for two open reading frames, one for the four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and one for the three capsids, or structural, proteins (VP1, VP2, VP3, encoded by capsid genes or Cap genes) . The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. Together, the three capsid proteins assemble to create the AAV capsid protein. While not wishing to be bound by theory, the AAV capsid protein typically comprises a molar ratio of 1: 1: 10 of VP1: VP2: VP3. As used herein, an “AAV serotype” is defined primarily by the AAV capsid.

[0096] As used herein, when a nucleotide sequence (e.g., ITR sequence etc. ) , a gene (e.g., rep, cap, etc. ) , a capsid protein (e.g., a VP1 capsid protein, a VP2 capsid protein, a VP3 capsid protein, etc. ) , or region of a capsid protein (e.g., PLA2 region, VP1u region, VP1 / VP2 common region, VP3 region) is referred to in connection with a specified AAV serotype (e.g., AAV9, AAV2, etc. ) the nucleotide sequence, gene, protein, or region of protein encompasses, in addition to the natural or wildtype nucleotide sequence, gene, protein, or region of protein for the specified AAV, also variants thereof,  including variants comprising the least number of nucleotides or amino acids required to retain one or more biological functions. For example, rep gene and the cap gene as used here can encompass rep and cap genes that differ from the wildtype gene in that the genes can encode one or more Rep proteins and Cap proteins, respectively. In some embodiments, a rep gene encodes at least Rep78 and / or Rep68. In some embodiments, cap gene includes those differ from the wildtype in that one or more alternative start codons or sequences between one or more alternative start codons are removed such that the cap gene encodes only a single Cap protein, e.g., wherein the VP2 and / or VP3 start codons are removed or substituted such that the cap gene encodes a functional VP1 capsid protein but not a VP2 capsid protein or a VP3 capsid protein. Accordingly, as used herein, a rep gene encompasses any sequence that encodes a functional Rep protein. A cap gene encompasses any sequence that encodes at least one functional Cap protein.

[0097] It is well-known that the wildtype cap gene expresses all three VP1, VP2, and VP3 capsid proteins from a single open reading frame of the cap gene under control of the p40 promoter found in the rep ORF. A “capsid protein” or “Cap protein” is a protein that forms a part of the capsid of the virus. For AAVs, the capsid proteins are generally referred to as VP1, VP2 and / or VP3, and can be encoded by the single cap gene. The three AAV capsid proteins are produced in nature an overlapping fashion from the cap ORF alternative translational start codon usage, although all three proteins use a common stop codon. The ORF of a wildtype cap gene encodes from 5’ to 3’ three alternative start codons: “the VP1 start codon, ” “the VP2 start codon, ” and “the VP3 start codon” ; and one “common stop codon. ” The largest viral protein, VP1, is generally encoded from the VP1 start codon to the “common stop codon. ” VP2 is generally encoded from the VP2 start codon to the common stop codon. VP3 is generally encoded from the VP3 start codon to the common stop codon. Accordingly, VP1 comprises at its N-terminus sequence that it does not share with the VP2 or VP3, referred to as the VP1-unique region (VP1u) . The VP1u region is generally encoded by the sequence of a wildtype cap gene starting from the VP1 start codon to the “VP2 start codon. ” VP1u comprises a phospholipase A2 domain (PLA2) , which can be important for infection, as well as nuclear localization signals which can aid the virus in targeting the nucleus for uncoating and genome release. The VP1, VP2, and VP3 capsid proteins share the same C-terminal sequence that makes up the entirety of VP3, which can also be referred to herein as the VP3 region. The VP3 region is encoded from the VP3 start codon to the common stop codon. VP2 has an additional about 60 amino acids that it shares with the VP1. This region is called the VP1 / VP2 common region.

[0098] In some embodiments, one or more of the capsid proteins disclosed herein can be encoded by one or more cap genes having one or more ORFs. In some embodiments, the VP proteins  disclosed herein can be expressed from more than one ORF comprising nucleotide sequence encoding any combination of VP1, VP2, and / or VP3 by use of separate nucleotide sequences operably linked to at least one expression control sequence for expression in packaging cell, each producing one or more of VP1, VP2, and / or VP3 capsid proteins disclosed herein. In some embodiments, a VP capsid protein disclosed herein can be expressed individually from an ORF comprising nucleotide sequence encoding any one of VP1, VP2, or VP3 by use of separate nucleotide sequences operably linked to one expression control sequence for expression in a viral replication cell, each producing only one of VP1, VP2, or VP3 capsid protein. In another embodiment, VP proteins can be expressed from one ORF comprising nucleotide sequences encoding VP1, VP2, and VP3 capsid proteins operably linked to at least one expression control sequence for expression in a viral replication cell, each producing VP1, VP2, and VP3 capsid protein. Accordingly, although amino acid positions provided herein can be provided in relation to the VP1 capsid protein of the referenced AAV, a skilled artisan would be able to readily determine the position of that same amino acid within the VP2 and / or VP3 capsid protein of the AAV, and the corresponding position of amino acids among different AAVs.

[0099] A “chimeric AAV capsid protein, ” as used herein, refers to an AAV capsid protein that comprises amino acid sequences, e.g., from two or more different AAV and that can form an AAV viral capsid / viral particle. A chimeric AAV capsid protein is encoded by a chimeric AAV capsid gene, e.g., a chimeric nucleotide comprising a plurality, e.g., at least two, nucleic acid sequences, each of which plurality is identical to a portion of a capsid gene encoding a capsid protein of distinct AAV, and which plurality together encodes a functional chimeric AAV capsid protein. Association of a chimeric capsid protein to a specific AAV indicates that the capsid protein comprises one or more portions from a capsid protein of that AAV and one or more portions from a capsid protein of a different AAV. For example, a chimeric AAV2 capsid protein includes a capsid protein comprising one or more portions of a VP1, VP2, and / or VP3 capsid protein of AAV2 and one or more portions of a VP1, VP2, and / or VP3 capsid protein of a different AAV.

[0100] The term “portion” refers to at least 5 amino acids or at least 15 nucleotides, but less than the full-length polypeptide, with 100%identity to a sequence from which the portion is derived, see Penzes (2015) J. General Virol. 2769. A “portion” encompasses any contiguous segment of amino acids or nucleotides sufficient to determine that the polypeptide or nucleic acid molecule form which the portion is derived is of a specified AAV or has significant identity to a particular AAV. In some embodiments, a portion comprises at least 5 amino acids or 15 nucleotides with 100%identity to a sequence associated with the specified AAV.

[0101] As used herein, the term “an inverted terminal repeat, ” or “ITR” is a palindromic nucleic acid that is about 120 nucleotides to about 250 nucleotides in length and capable of forming a hairpin. The term “ITR” includes the site of the viral genome replication that can be recognized and bound by a parvoviral protein (e.g., Rep78 / 68) . An ITR includes a replication protein binding element (RBE) and a terminal resolution sequence (TRS) . A “D” region of the ITR comprises the DNA nick site where DNA replication initiates and provides directionality to the nucleic acid replication step. An AAV replicating in a mammalian cell typically comprises two ITR sequences. The ITRs serve as the origins of replication for viral DNA synthesis and are essential cis components for generating AAV particles, e.g., packaging into AAV particles. An ITR can be from any AAV. An ITR can be a wildtype ITR or a variant thereof. For example, a wildtype ITR can be altered by insertion, deletion, truncation, or missense mutations, as long as the ITR functions to mediate virus packaging, replication, integration, and / or provirus rescue, and the like are maintained. The “5’ ITR” is intended to mean the parvoviral ITR located at the 5’ boundary of the nucleic acid molecule; and the term “3’ ITR” is intended to mean the parvoviral ITR located at the 3’ boundary of the nucleic acid molecule.

[0102] A single ITR can be engineered with Rep binding sites on both strands of the “A” regions and two symmetrical D regions on each side of the ITR palindrome. Such an engineered construct on a double-stranded circular DNA template allows Rep78 or Rep68 initiated nucleic acid replication that proceeds in both directions. A single ITR is sufficient for AAV replication of a circular particle. In methods of producing an AAV viral particle disclosed herein, the rep encoding sequence encodes a Rep protein, including variants of wildtype Rep proteins capable of binding an ITR comprised on the transfer plasmid.

[0103] The Cap proteins disclosed herein, when expressed with appropriate Rep proteins by a packaging cell, can encapsidate a transfer plasmid comprising a nucleic acid of interest and an even number of two or more ITR sequences. In some embodiments, a transfer plasmid comprises one ITR sequence. In some embodiments, a transfer plasmid comprises two ITR sequences.

[0104] Either Rep78 and / or Rep68 bind to unique and known sites on the sequence of the ITR hairpin, and act to break and unwind the hairpin structures on the end of an AAV genome, thereby providing access to replication machinery of the viral replication cell. As is well-known, Rep proteins can be expressed from more than one ORF comprising nucleotide sequence encoding any combination of Rep78, Rep68, Rep 52 and / or Rep40 by use of separate nucleotide sequences operably linked to at least one expression control sequence for expression in a viral replication cell, each producing one or more of Rep78, Rep68, Rep 52 and / or Rep40 Rep proteins. Alternatively, Rep proteins can be expressed individually from an ORF comprising a nucleotide sequence encoding any  one of Rep78, Rep68, Rep 52, or Rep40 by use of separate nucleotide sequences operably linked to one expression control sequence for expression in a packaging cell, each producing only one Rep78, Rep68, Rep 52, or Rep40 Rep protein. In another embodiment, Rep proteins can be expressed from one ORF comprising nucleotide sequences encoding Rep78 and Rep52 Rep proteins operably linked to at least one expression control sequence for expression in a viral replication cell each producing Rep78 and Rep52 Rep protein.

[0105] In a method of producing an AAV viral particle disclosed herein, a rep encoding sequence and a cap gene disclosed herein can be provided in a single packaging plasmid. A skilled artisan will recognize that such viral particles may or may not include a genome.

[0106] As used herein, the term “recombinant AAV” or “rAAV” refers to a modified or engineered version of naturally occurring AAV.

[0107] As used herein, the term “AAV particle” comprises a capsid and a viral genome. In some embodiments, the viral genome comprises a transgene of interest.

[0108] AAV vectors have been investigated for delivery of gene therapeutics because of several unique features. Non-limiting examples of the features include (i) the ability to infect both dividing and non-dividing cells; (ii) a broad host range for infectivity, including human cells; (iii) wild-type AAV has not been associated with any disease and has not been shown to replicate in infected cells; and (iv) the non-integrative nature in a host chromosome thereby reducing potential for long-term genetic alterations. Moreover, infection with AAV vectors has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148, the contents of which are herein incorporated by reference in their entirety) . Typically, AAV vectors for delivery of transgenes of interest can be recombinant viral vectors which are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the defective AAV vectors may lack most or all coding sequences and essentially only contain one or two AAV ITR sequences and a transgene sequence.

[0109] The viral genome of the AAV particles of the present disclosure can be single or double stranded. The size of the vector genome can be small, medium, large or the maximum size. In some embodiments, the AAV vector used in the present disclosure is a single strand vector (ssAAV) . In some embodiments, the AAV vectors can be self-complementary AAV vectors (scAAVs) . See, e.g., US7,465,583. scAAV vectors contain both DNA strands that anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell. In some embodiments, the AAV vector used in the present disclosure is a scAAV.

[0110] Methods for producing and / or modifying AAV vectors are disclosed in the art such as pseudotyped AAV vectors (International Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO 2005005610 and WO 2005072364, the content of each of which are incorporated herein by reference in their entirety) .

[0111] In some embodiments, AAV vectors can be modified to enhance the efficiency of delivery. Such modified AAV vectors of the present disclosure can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.

[0112] AAV particles of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, the AAV particles can utilize or be based on a serotype or include a peptide selected from any of the following: AAV1, AAV2, AAV2.5, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV13, and any other AAV now known or later discovered. See, e.g., Fields et al. VIROLOGY, 4th ed. Lippincott-Raven Publishers, Philadelphia, 1996. Additional AAV serotypes and clades have been identified recently. See, e.g., Gao et al. J. Virol. 78: 6381 (2004) ; Moris et al. Virol. 33: 375 (2004) .

[0113] Additionally, the AAV particles can also utilize or be based on a serotype or include a peptide selected from any of the following VOY101, VOY201, AAVPHP. B (PHP. B) , AAVPHP. A (PHP. A) , AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP. B2 (PHP. B2) , AAVPHP. B3 (PHP. B3) , AAVPHP. N / PHP. B-DGT, AAVPHP. B-EST, AAVPHP. B-GGT, AAVPHP. B-ATP, AAVPHP. B-ATT-T, AAVPHP. B-DGT-T, AAVPHP. B-GGT-T, AAVPHP. B-SGS, AAVPHP. B-AQP, AAVPHP. B-QQP, AAVPHP. B-SNP (3) , AAVPHP. B-SNP, AAVPHP. B-QGT, AAVPHP. B-NQT, AAVPHP. B-EGS, AAVPHP. B-SGN, AAVPHP. B-EGT, AAVPHP. B-DST, AAVPHP. B-DST, AAVPHP. B-STP, AAVPHP. B-PQP, AAVPHP. B-SQP, AAVPHP. B-QLP, AAVPHP. B-TMP, AAVPHP. B-TTP, AAVPHP. S / G2A12, AAVG2A15 / G2A3 (G2A3) , AAVG2B4 (G2B4) , AAVG2B5 (G2B5) , PHP. S, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-amino acids, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7 / rh. 48, AAV1-8 / rh. 49, AAV2-15 / rh. 62, AAV2-3 / rh. 61, AAV2-4 / rh. 50, AAV2-5 / rh. 51, AAV3.1 / hu. 6, AAV3.1 / hu. 9, AAV3-9 / rh. 52, AAV3-11 / rh. 53, AAV4-8 / r11.64, AAV4-9 / rh. 54, AAV4-19 / rh. 55, AAV5-3 / rh. 57, AAV5-22 / rh. 58, AAV7.3 / hu. 7, AAV16.8 / hu. 10, AAV16.12 / hu. 11, AAV29.3 / bb. 1,  AAV29.5 / bb. 2, AAV106.1 / hu. 37, AAV114.3 / hu. 40, AAV127.2 / hu. 41, AAV127.5 / hu. 42, AAV128.3 / hu. 44, AAV130.4 / hu. 48, AAV145.1 / hu. 53, AAV145.5 / hu. 54, AAV145.6 / hu. 55, AAV161.10 / hu. 60, AAV161.6 / hu. 61, AAV33.12 / hu. 17, AAV33.4 / hu. 15, AAV33.8 / hu. 16, AAV52 / hu. 19, AAV52.1 / hu. 20, AAV58.2 / hu. 25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh. 72, AAVhu. 8, AAVrh. 68, AAVrh. 70, AAVpi. 1, AAVpi. 3, AAVpi. 2, AAVrh. 60, AAVrh. 44, AAVrh. 65, AAVrh. 55, AAVrh. 47, AAVrh. 69, AAVrh. 45, AAVrh. 59, AAVhu. 12, AAVH6, AAVLK03, AAVH-1 / hu. 1, AAVH-5 / hu. 3, AAVLG-10 / rh. 40, AAVLG-4 / rh. 38, AAVLG-9 / hu. 39, AAVN721-8 / rh. 43, AAVCh. 5, AAVCh. 5R1, AAVcy. 2, AAVcy. 3, AAVcy. 4, AAVcy. 5, AAVCy. 5R1, AAVCy. 5R2, AAVCy. 5R3, AAVCy. 5R4, AAVcy. 6, AAVhu. 1, AAVhu. 2, AAVhu. 3, AAVhu. 4, AAVhu. 5, AAVhu. 6, AAVhu. 7, AAVhu. 9, AAVhu. 10, AAVhu. 11, AAVhu. 13, AAVhu. 15, AAVhu. 16, AAVhu. 17, AAVhu. 18, AAVhu. 20, AAVhu. 21, AAVhu. 22, AAVhu. 23.2, AAVhu. 24, AAVhu. 25, AAVhu. 27, AAVhu. 28, AAVhu. 29, AAVhu. 29R, AAVhu. 31, AAVhu. 32, AAVhu. 34, AAVhu. 35, AAVhu. 37, AAVhu. 39, AAVhu. 40, AAVhu. 41, AAVhu. 42, AAVhu. 43, AAVhu. 44, AAVhu. 44R1, AAVhu. 44R2, AAVhu. 44R3, AAVhu. 45, AAVhu. 46, AAVhu. 47, AAVhu. 48, AAVhu. 48R1, AAVhu. 48R2, AAVhu. 48R3, AAVhu. 49, AAVhu. 51, AAVhu. 52, AAVhu. 54, AAVhu. 55, AAVhu. 56, AAVhu. 57, AAVhu. 58, AAVhu. 60, AAVhu. 61, AAVhu. 63, AAVhu. 64, AAVhu. 66, AAVhu. 67, AAVhu. 14 / 9, AAVhu. t 19, AAVrh. 2, AAVrh. 2R, AAVrh. 8, AAVrh. 8R, AAVrh. 10, AAVrh. 12, AAVrh. 13, AAVrh. 13R, AAVrh. 14, AAVrh. 17, AAVrh. 18, AAVrh. 19, AAVrh. 20, AAVrh. 21, AAVrh. 22, AAVrh. 23, AAVrh. 24, AAVrh. 25, AAVrh. 31, AAVrh. 32, AAVrh. 33, AAVrh. 34, AAVrh. 35, AAVrh. 36, AAVrh. 37, AAVrh. 37R2, AAVrh. 38, AAVrh. 39, AAVrh. 40, AAVrh. 46, AAVrh. 48, AAVrh. 48.1, AAVrh. 48.1.2, AAVrh. 48.2, AAVrh. 49, AAVrh. 51, AAVrh. 52, AAVrh. 53, AAVrh. 54, AAVrh. 56, AAVrh. 57, AAVrh. 58, AAVrh. 61, AAVrh. 64, AAVrh. 64R1, AAVrh. 64R2, AAVrh. 67, AAVrh. 73, AAVrh. 74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAAV, BAAV, caprine AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2,  AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh. 50, AAVrh. 43, AAVrh. 62, AAVrh. 48, AAVhu. 19, AAVhu. 11, AAVhu. 53, AAV4-8 / rh. 64, AAVLG-9 / hu. 39, AAV54.5 / hu. 23, AAV54.2 / hu. 22, AAV54.7 / hu. 24, AAV54.1 / hu. 21, AAV54.4R / hu. 27, AAV46.2 / hu. 28, AAV46.6 / hu. 29, AAV128.1 / hu. 43, true type AAV(ttAAV) , UPENN AAV 10, Japanese AAV 10 serotypes, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5,AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5,AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1,AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV. hu. 48R3, AAV. VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, and / or AAVF9 / HSC9 and variants thereof.

[0114] The genomic sequences of various serotypes of AAV, as well as the sequences of the native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883,  NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579; the disclosures of which are incorporated by reference herein for teaching AAV nucleic acid and amino acid sequences. See also, e.g., Bantel-Schamino acidsl et al. J. Virol. 73: 939 (1999) ; Chiorini et al. J. Virol. 71: 6823 (1997) ; Chiorini et al. J. Virol. 73: 1309 (1999) ; Gao et al. Proc. Nat. Acad. Sci. USA 99: 11854 (2002) ; Moris et al. Virol. 33: 375 (2004) ; Muramatsu et al. Virol. 221: 208 (1996) ; Ruffing et al. J. Gen. Virol. 75: 3385 (1994) ; Rutledge et al. J. Virol. 72: 309 (1998) ; Schmidt et al. J. Virol. 82: 8911 (2008) ; Shade et al. J. Virol. 58: 921 (1986) ; Srivastava et al. J. Virol. 45: 555 (1983) ; Xiao et al. J. Virol. 73: 3994 (1999) ; Pulicherla et al., Molecular Therapy, 19 (6) : 1070-1078 (2011) ; US 6, 156, 303; US20030138772; US20150159173; US 7,198,951; US9,475,845; US20140359799; US9,233,131; US20150376607; US9,163,261; US20150376240; US20160017295; US20150238550; US20150315612; US9,238,800; US9,193,769; US7,427,396; US9,624,274; S20150159173; US20160017005; US8,734,809; WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; WO1998011244; WO2014144229; WO2005033321; WO2015168666; WO2015121501; WO2015038958; WO2016049230; WO2016065001; WO2017100671; WO2017058892; the disclosures of which are incorporated by reference herein forteaching AAV nucleic acid and amino acid sequences.

[0115] In some embodiments, AAV particles used in compositions and methods disclosed herein are of serotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, or AAVrh-74. In some embodiments, AAV1 particles are used. In some embodiments, AAV2 particles are used. In some embodiments, AAV3 particles are used. In some embodiments, AAV4 particles are used. In some embodiments, AAV5 particles are used. In some embodiments, AAV6 particles are used. In some embodiments, AAV7 particles are used. In some embodiments, AAV8 particles are used. In some embodiments, AAV9 particles are used. In some embodiments, AAVrh-10particles are used. In some embodiments, AAVrh-74 particles are used.

[0116] In some embodiments, AAV9 particles are used. In some embodiments, AAV6 particles are used.

[0117] 6.2.2 Capsid proteins

[0118] In some embodiments, a capsid protein, e.g., a VP1 capsid protein as described herein, a VP2 capsid protein as described herein, and / or a VP3 capsid protein as described herein, is modified to be linked to a member of a binding pair. In some embodiments, the capsid protein comprises insertion of a member of a binding pair. Generally, modification of specified AAV capsid protein  results in an amino acid sequence that differs from the wildtype amino acid sequence set forth herein for the specified AAV. Linkage to the first member of the binding pair, such as insertion of a first member of a binding pair, can reduce the natural tropism of the capsid protein, and redirect the capsid to a specific cell or tissue, such as cancer cells or T cells.

[0119] In some embodiments, an antibody or antigen-binding fragment that targets a surface antigen of a specific cell or tissue can be associated with (e.g., conjugated to, operably linked to, bound to, displayed by) a modified AAV capsid protein and resulting AAV capsids according to indirect recombinatorial approaches, wherein the AAV capsid protein is modified to be linked to a first member of a binding pair (e.g., a protein catcher) that can bind to (e.g., covalently or non-covalently) a second member of the binding pair (e.g., a peptide tag) , wherein the second member of the binding pair is linked to the antibody or antigen-binding fragment.

[0120] Binding pairs capable of interacting to form a covalent isopeptide bond are reviewed in Veggiani et al. (2014) Trends Biotechnol. 32: 506, and include binding pairs such as SpyCatcher and SpyTag, SpyCatcher002 and SpyTag002, SpyCatcher003 and SpyTag003, SnoopCatcher and SnoopTag, SdyCatcher and SdyTag, and variants thereof. In some embodiments, the first and second members interact by forming a covalent peptide, e.g., an isopeptide bond. As is known in the art, an isopeptide bond refers to the chemical bond that forms between two amino acids in a protein or polypeptide chain. Unlike the more common peptide bond, which links amino acids in a linear fashion during protein synthesis, isopeptide bonds connect amino acids in a non-linear, cross-linking manner. Isopeptide bonds can be formed by a covalent linkage between the side chains of amino acids, typically involving the amino group (-NH2) of one amino acid and the carboxyl group (-COOH) of another amino acid. The specific amino acids involved can vary, but they often include lysine (Lys) , asparagine (Asn) , and glutamine (Gln) . In some embodiments, the two members of the binding pair, e.g., SpyCatcher003 and SpyTag003, can spontaneously form a covalent isopeptide bond.

[0121] Table 1: Exemplary binding pairs

[0122] The SpyCatcher and SpyTag system is used for the covalent and irreversible conjugation of proteins or peptides, which is described in U.S. Patent No. 9,547,003 and Zaveri et al. (2012) PNAS 109: E690-E697. The SpyCatcher and SpyTag system is derived from the CnaB2 domain of the Streptococcuspyogenes fibronectin-binding protein FbaB. Splitting the domain produces a peptide “SpyTag” having a reactiveα-amine group that can form an amide bond with its cognate protein “SpyCatcher” having a reactive thioester group. The SpyCatcher002 and SpyTag002 system is modified version of the SpyCatcher and SpyTag system, and is described in Keeble et al. (2017) Angew Chem Int Ed Engl 56: 16521-25. The SpyCatcher003 and SpyTag003 system is also a modified version of the SpyCatcher and SpyTag system, and is described in Keeble et al., PNAS, 116.52 (2019) : 26523-33.

[0123] The SdyCatcher and SdyTag system is described in Tan et al., PLoS One. 2016; 11 (10) . Engineered from a related fibronectin-binding protein in Streptococcus dysgalactiae, the polypeptide Tag, SdyTag was constructed based on the native Cna protein B-type (CnaB) domain and found to be highly unreactive to SpyCatcher. Instead, SdyTag has a 75-fold specificity for its optimized Catcher, named SdyCatcher, compared to SpyCatcher. Incubation of SdyCatcher and SdyTag results in a spontaneous isopeptide bond that is specific between the complementary proteins.

[0124] The SnoopCatcher and SnoopTag system is described in Veggiani (2016) PNAS 113: 1202-07. The D4 Ig-like domain of RrgA, an adhesion from Streptococcuspneumoniae, was split to form SnoopTag (residues 734-745) and SnoopCatcher (residues 749-860) . Incubation of SnoopTag and SnoopCatcher results in a spontaneous isopeptide bond that is specific between the complementary proteins.

[0125] In some embodiments, the first and second members interact by forming a non-covalent bond. For example, one member can be an epitope and the other can be an antibody or antigen-binding fragment that specifically recognizes the epitope. For another example, one member can be a ligand and the other can be the cognate receptor. For yet another example, both members of the binding pair can comprise an intein. See, e.g., Wagner et al., (2021) Adv. Set. 8: 2004018 (1 of 22) ; Muik et al. (2017) Biomaterials 144: 84. A person of ordinary skill in the art would understand, the compositions disclosed herein are not limited by specific binding pairs. Instead, any binding pair disclosed herein or otherwise known in the art can be adopted.

[0126] In some embodiments, compositions provided herein comprise a recombinant AAV particle having a capsid protein linked to a first member of a binding pair. In some embodiments, the first member of the binding pair can bind to a second member of the binding pair that is linked to the antibody or antigen-binding fragment that specifically binds to, e.g., tumor antigen or T cell antigen. In previous efforts to modify an AAV particle with a peptide, peptides of relatively small size (i.e., having 50 amino acids or less, or 30 amino acids or less, such as the SpyTag) , are used to modify capsid protein, as insertion of larger peptide is generally believed to affect the stability of the virus particle. Here, inventors of present disclosure generated AAV particles comprising capsid protein modified with peptides having over 100 amino acids (such as the SpyCatcher003) , and found that, surprisingly, these modified AAV particles were sufficiently stable to deliver transgenes of interest to target cells (e.g., cancer cells or T cells) . This allowed the use of the smaller member of the binding pair (e.g., SpyTag003) to tag the antibody or antigen-binding fragment, making the part of recombinant production of the tagged antibody easier and more efficient.

[0127] In some embodiments, the first member of the binding pair as described herein is at least 50 amino acids in length. The first member can be about 60 amino acids in length. The first member can be about 70 amino acids in length. The first member can be about 80 amino acids in length. The first member can be about 90 amino acids in length. The first member can be about 100 amino acids in length. The first member can be about 110 amino acids in length. The first member can be about 120 amino acids in length. The first member can be about 130 amino acids in length. The first member can be about 140 amino acids in length. The first member can be about 150 amino acids in length. The first member can be about 160 amino acids in length. The first member can be about 170 amino acids in length. The first member can be about 190 amino acids in length. The first member can be about 200 amino acids in length. The first member can range from about 50 to about 200 amino acids in length. The first member can range from about 80 to about 200 amino acids in length. The first member can range from about 100 to about 200 amino acids in length. The first member can range  from about 120 to about 200 amino acids in length. The first member can range from about 150 to about 200 amino acids in length. The first member can range from about 50 to about 150 amino acids in length. The first member can range from about 80 to about 150 amino acids in length. The first member can range from about 100 to about 150 amino acids in length. The first member can range from about 120 to about 150 amino acids in length.

[0128] As such, accordingly, compositions provided herein comprise a binding pair having a first member and a second member, wherein the first member is linked to the capsid protein and the second member is linked to the antibody or antigen-binding fragment. In some embodiments, the first member is SpyCatcher (SEQ ID NO: 1) or a variant thereof and the second member is SpyTag (SEQ ID NO: 2) or a variant thereof. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 1. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 11. In some embodiments, the second member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 2. In some embodiments, the first member is SpyCatcher (SEQ ID NO: 1) and the second member is SpyTag (SEQ ID NO: 2) . In some embodiments, the first member is SpyCatcherδN1δC1 (SEQ ID NO: 11) and the second member is SpyTag (SEQ ID NO: 2) .

[0129] In some embodiments, the first member is SpyCatcher002 (SEQ ID NO: 3) or a variant thereof and the second member is SpyTag002 (SEQ ID NO: 4) or a variant thereof. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 3. In some embodiments, the second member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 4. In some embodiments, the first member is SpyCatcher002 (SEQ ID NO: 3) and the second member is SpyTag002 (SEQ ID NO: 4) .

[0130] In some embodiments, the first member is SpyCatcher003 (SEQ ID NO: 5) or a variant thereof and the second member is SpyTag003 (SEQ ID NO: 6) or a variant thereof. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5. In some embodiments, the second member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 6. In some embodiments, the first member is SpyCatcher003 (SEQ ID NO: 5) and the second member is SpyTag003 (SEQ ID NO: 6) .

[0131] In some embodiments, the first member is SnoopCatcher (SEQ ID NO: 7) or a variant thereof and the second member is SnoopTag (SEQ ID NO: 8) or a variant thereof. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 7. In some embodiments, the second member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 8. In some embodiments, the first member is SnoopCatcher (SEQ ID NO: 7) and the second member is SnoopTag (SEQ ID NO: 8) .

[0132] In some embodiments, the first member is SdyCatcher (SEQ ID NO: 9) or a variant thereof and the second member is SdyTag (SEQ ID NO: 10) or a variant thereof. In some embodiments, the first member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 9. In some embodiments, the second member can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 10. In some embodiments, the first member is SdyCatcher (SEQ ID NO: 9) and the second member is SdyTag (SEQ ID NO: 10) .

[0133] In some embodiments, a first member of the binding pair (e.g., a peptide catcher) is linked to (translated in frame with, chemically attached to, and / or displayed by) a capsid protein via a first or second linker, e.g., an amino acid spacer that is at least one amino acid in length. In some embodiments, the first member of the binding pair is flanked by a first and / or second linker, wherein the first linker is directly connected to the N-terminus of the first member and the second linker is directly connected to the C-terminus of the first member. In some embodiments, the first and second linkers are not identical. In some embodiments, the first and or second linker is each independently five, six, seven, eight, nine, ten, eleven, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids in length. In some embodiments, the first and second linkers are identical in length. In some embodiments, the first and second linkers are identical, i.e., having the same amino acid sequences. In some embodiments, the first and second linkers are each five amino acids in length, e.g., the linker  is GGGGS (SEQ ID NO: 44) . In some embodiments, the first and second linkers are each six amino acids in length, e.g., the first and second linkers each comprise a sequence of GSGSGS (SEQ ID NO: 14) . In some embodiments, the first and second linkers are each seven amino acids in length. In some embodiments, the first and second linkers are each eight amino acids in length. In some embodiments, the first and second linkers are each nine amino acids in length. In some embodiments, the first and second linkers are each ten amino acids in length, e.g., the first and second linkers each comprise a sequence of GGGGSGGGGS (SEQ ID NO: 45) . In some embodiments, the first and second linkers are each eleven amino acids in length. In some embodiments, the first and second linkers are each 12 amino acids in length. In some embodiments, the first and second linkers are each thirteen amino 13 in length. In some embodiments, the first and second linkers are each fourteen amino acids in 14. In some embodiments, the first and second linkers are each 15 amino acids in length, e.g., the first and second linkers each comprise a sequence of GGGGSGGGGSGGGGS (SEQ ID NO: 46) . In some embodiments, the first and second linkers are each 16 amino acids in length. In some embodiments, the first and second linkers are each 17 amino acids in length. In some embodiments, the first and second linkers are each 18 amino acids in length. In some embodiments, the first and second linkers are each 19 amino acids in length. In some embodiments, the first and second linkers are each 20 amino acids in length, e.g., the first and second linkers each comprise a sequence of GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 47) .

[0134] In some embodiments, a second member of the binding pair (e.g., a peptide tag) is linked to (translated in frame with, chemically attached to, and / or displayed by) an antibody or antigen-binding fragment via a linker, e.g., an amino acid spacer that is at least one amino acid in length. In some embodiments, the second member of the binding pair is directly connected to the antibody or antigen-binding fragment. In some embodiments, the second member is directly connected to the N-terminus of the antibody or antigen-binding fragment. In some embodiments, the second member is directly connected to the C terminus of the antibody or antigen-binding fragment. In some embodiments, the second member is connected to the N-terminus of the antibody or antigen-binding fragment via a linker. In some embodiments, the second member is connected to the C-terminus of the antibody or antigen-binding fragment via a linker. In some embodiments, the linker is five, six, seven, eight, nine, ten, eleven, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids in length. In some embodiments, the linker is five amino acids in length, e.g., the linker is GGGGS (SEQ ID NO: 44) . In some embodiments, the linker is six amino acids in length, e.g., the linker comprises a sequence of GSGSGS (SEQ ID NO: 14) . In some embodiments, the inker is seven amino acids in length. In some embodiments, the inker is eight amino acids in length. In some embodiments, the  inker is nine amino acids in length. In some embodiments, the inker is ten amino acids in length, e.g., the linker comprises a sequence of GGGGSGGGGS (SEQ ID NO: 45) . In some embodiments, the linker is eleven amino acids in length. In some embodiments, the linker is 12 amino acids in length. In some embodiments, the linker is 13 amino acids in length. In some embodiments, the linker is 14 amino acids in length. In some embodiments, the linker is 15 amino acids in length, e.g., the linker comprises a sequence of GGGGSGGGGSGGGGS (SEQ ID NO: 46) . In some embodiments, the linker is 16 amino acids in length. In some embodiments, the linker is 17 amino acids in length. In some embodiments, the linker is 18 amino acids in length. In some embodiments, the linker is 19 amino acids in length. In some embodiments, the linker is 20 amino acids in length, e.g., the linker comprises a sequence of GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 47) .

[0135] Due to the high conservation of at least large stretches and the large member of closely related family members, the corresponding insertion sites for AAV other than the enumerated AAV can be identified by performing an amino acid alignment or by comparison of the capsid structures. See, e.g., Rutledge et al. (1998) J. Virol. 72: 309-19; Mietzsch et al. (2019) Viruses 11, 362, 1-34, and U.S. Patent No. 9,624,274 for exemplary alignments of different AAV capsid proteins. Using structural analysis and sequence analysis, a skilled artisan can determine which amino acids within the variable region correspond to amino acid sequence of AAV that can accommodate the insertion of, e.g., a first member of a binding pair disclosed herein.

[0136] Generally, the first member of a binding pair is inserted into a variable region or variable loop of an AAV capsid protein, a GH loop of an AAV capsid protein, etc. In some embodiments, the insertion into the corresponding position of the coding nucleic acid of one of these sites of the cap gene leads to an insertion into VP1, VP2 and / or VP3, as the capsid proteins are encoded by overlapping reading frames of the same gene with staggered start codons. Therefore, for AAV9, for example, according to this nomenclature insertions between amino acids 1 and 138 are only inserted into VP1, insertions between 138 and 203 are inserted into VP1 and VP2, and insertions between 203 and the C-terminus are inserted into VP1, VP2 and VP3. Therefore, the present disclosure encompasses structural genes of AAV with corresponding insertions in the VP1, VP2 and / or VP3 proteins. The positions referred to herein are relative to the VP1 protein encoded by an AAV capsid gene, and corresponding positions (and point mutations thereof) can be easily identified for the VP2 and VP3 capsid proteins encoding by the capsid gene by performing a sequence alignment of the VP1, VP2 and VP3 proteins encoded by the appropriate AAV capsid gene. For example, the AAV9 capsid proteins include VP1 (736 amino acids; SEQ ID NO: 20) , VP2 (amino acids 138 to 736 of SEQ ID NO: 20) , and VP3 (amino acids 203 to 736 of SEQ ID NO: 20) . For another example, the  AAV6 capsid proteins include VP1 (736 amino acids; SEQ ID NO: 19) , VP2 (amino acids 138 to 736 of SEQ ID NO: 19) , and VP3 (amino acids 203 to 736 of SEQ ID NO: 19) .

[0137] In some embodiments, the cap gene is modified to only allow the expression of one or two capsid proteins. For example, in some embodiments, the cap gene is modified to allow the expression of VP1, but not VP2 or VP3. In some embodiments, the cap gene is modified to allow the expression of VP2, but not VP1 or VP3. In some embodiments, the cap gene is modified to allow the expression of VP1 and VP2, but not VP3. In some embodiments, the cap gene is modified to allow the expression of VP3, but not VP1 or VP2. The methods to modify the cap gene for selective expression are well known in the art.

[0138] In some embodiments of the AAV particles (e.g., AAV9 or AAV6) disclosed herein, the first member replaces amino acids 453-459 of capsid protein. In some embodiments, the first member replaces amino acids 453-459 of VP1. In some embodiments, the first member replaces amino acids 453-459 of VP2. In some embodiments, the first member replaces amino acids 453-459 of VP1 and VP2. In some embodiments, the first member replaces amino acids 453-459 of VP3.

[0139] In some embodiments of the AAV particles (e.g., AAV9 or AAV6) disclosed herein, the first member of a binding pair is inserted at positions 588, namely, inserted between amino acid residues 587 and 588. In some embodiments, the first member is inserted at position 588 of VP1 only. In some embodiments, the first member is inserted at position 588 of VP2 only. In some embodiments, the first member is inserted at position 588 of VP1 and VP2 only. In some embodiments, the first member is inserted at position 588 of VP3 only.

[0140] In some embodiments of the AAV particles (e.g., AAV9 or AAV6) disclosed herein, the first member of a binding pair is inserted at N terminal of VP2.

[0141] In some embodiments, a viral capsid provided herein is a mosaic capsid, which comprises at least two sets of VP1, VP2, and / or VP3 proteins, each encoded by a different cap gene. A mosaic capsid herein generally refers to a mosaic of a first viral capsid protein modified to comprise a first member of a binding pair and a second corresponding viral capsid protein lacking the first member of a binding pair. The second viral capsid protein lacking the first member of a binding pair can be referred to as a reference capsid protein encoded by a reference cap gene. In some embodiments, mosaic capsids comprise the VP1, VP2, and / or VP3 capsid proteins modified with a first member of binding pair, and the VP1, VP2, and / or VP3 reference capsid protein which comprise an amino acid sequence identical to that of the viral VP1, VP2, and / or VP3 capsid protein modified with a first member of a binding pair, except that the reference capsid protein lacks the first member of a binding pair. In some embodiments, a VP1 reference capsid protein corresponds to the viral VP1 capsid  protein modified with a first member of a binding pair, except that the reference capsid protein lacks the first member of a binding pair. In some embodiments, a VP2 reference capsid protein corresponds to the viral VP2 capsid protein modified with a first member of a binding pair, except that the reference capsid protein lacks the first member of a binding pair. In some embodiments, a VP3 reference capsid protein corresponds to the viral VP3 capsid protein modified with a first member of a binding pair, except that the reference capsid protein lacks the first member of a binding pair.

[0142] Generally, mosaic particles can be generated by transfecting mixtures of the modified and reference cap genes into production cells at the indicated ratios. The protein subunit ratios, e.g., ratio of modified VP protein to unmodified VP protein, can, but do not necessarily, stoichiometrically reflect the ratios of the at least two species of the cap gene encoding the capsid protein modified with a first member of a binding pair and the one or more reference capsid proteins, i.e., the ratio of modified cap gene (s) to reference cap gene (s) transfected into packaging cells.

[0143] In some embodiments of mosaic viral particles provided herein, the ratio of modified capsid protein to reference capsid protein ranges from about 1: 59 to about 15: 45. The ratio of modified capsid protein to reference capsid protein can be about 15: 45 (e.g., the mosaic viral particle comprises about 15 modified capsid proteins and about 45 reference capsid proteins) . I The ratio of modified capsid protein to reference capsid protein can be about 12: 48 (e.g., the mosaic viral particle comprises about 12 modified capsid proteins and 48 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 10: 50 (e.g., the mosaic viral particle comprises 10 modified capsid proteins and 50 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 6: 54 (e.g., the mosaic viral particle comprises 6 modified capsid proteins and 54 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 5: 55 (e.g., the mosaic viral particle comprises 5 modified capsid proteins and 55 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 4: 56 (e.g., the mosaic viral particle comprises 4 modified capsid proteins and 56 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 3: 57 (e.g., the mosaic viral particle comprises 3 modified capsid proteins and 57 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 2: 58 (e.g., the mosaic viral particle comprises 2 modified capsid proteins and 58 reference capsid proteins) . The ratio of modified capsid protein to reference capsid protein can be about 1: 59 (e.g., the mosaic viral particle comprises 1 modified capsid protein and 59 reference capsid proteins) .

[0144] In some embodiments, the AAV particles disclosed herein comprise 5 modified VP1 proteins, 5 unmodified VP2 proteins, and 50 unmodified VP3 proteins. In some embodiments, the AAV particles disclosed herein comprise 5 unmodified VP1 proteins, 5 modified VP2 proteins, and 50 unmodified VP3 proteins. In some embodiments, the AAV particles disclosed herein comprise 5 modified VP1 proteins, 5 modified VP2 proteins, and 50 unmodified VP3 proteins. In some embodiments, the AAV particles disclosed herein comprise 5 unmodified VP1 proteins, 5 unmodified VP2 proteins, and a mixture of modified and unmodified VP3 proteins. In some embodiments, AAV particles disclosed herein comprise about 5 modified VP3 proteins and about 45 unmodified VP3 proteins. In some embodiments, AAV particles disclosed herein comprise about 10 modified VP3 proteins and about 40 unmodified VP3 proteins. In some embodiments, AAV particles disclosed herein comprise about 15 modified VP3 proteins and about 35 unmodified VP3 proteins. In some embodiments, AAV particles disclosed herein comprise about 20 modified VP3 proteins and about 30 unmodified VP3 proteins.

[0145] For illustrative purposes, in some embodiments, the AAV particles disclosed herein comprise modified VP1 proteins, unmodified VP2 proteins, and unmodified VP3 proteins with the ratio of 5: 5: 50. In some embodiments of the modified AAV particles, the first member (e.g., SpyCatcher, SpyCatcher003) replaces amino acids 453-459 of VP1. In some embodiments, the first member (e.g., SpyCatcher, SpyCatcher003) is inserted at position 588 of VP1. In some embodiments, the first member is linked to the amino acid residues of the VP1 via a first linker (e.g., GGGGSGGGGSGGGGS (SEQ ID NO: 46) ) at its N-terminus and a second linker (e.g., GGGGSGGGGSGGGGS (SEQ ID NO: 46) ) at its C-terminus.

[0146] In some embodiments, the AAV particles disclosed herein comprise unmodified VP1 proteins, modified VP2 proteins, and unmodified VP3 proteins with the ratio of 5: 5: 50. In some embodiments, the first member (e.g., SpyCatcher, SpyCatcher003) replaces amino acids 453-459 of VP2. In some embodiments, the first member (e.g., SpyCatcher, SpyCatcher003) is inserted at position 588 of VP2. In some embodiments, the first member (e.g., SpyCatcher, SpyCatcher003) is located at N-terminus of VP2. In some embodiments, the first member is linked to the amino acid residues of the VP2 via a first linker (e.g., GGGGSGGGGSGGGGS (SEQ ID NO: 46) ) at its N-terminus and a second linker (e.g., GGGGSGGGGSGGGGS (SEQ ID NO: 46) ) at its C-terminus. In some embodiments, the first member is linked to the N-terminal amino acid residue of VP2 via a linker (e.g., GGGGSGGGGSGGGGS (SEQ ID NO: 46) ) .

[0147] Capsid proteins of the AAV particles disclosed herein are linked to a first member of a binding pair (e.g., SpyCatcher003) . In some embodiments, the capsid protein disclosed herein also  comprises a detectable label. The detectable label can be used for the detection and / or isolation of the capsid protein. Many detectable labels are known in the art. (See, e.g.: Nilsson et al. (1997) Protein Expression and Purification 11: 1-16, Terpe et al. (2003) Applied Microbiology and Biotechnology 60: 523-533, and references therein) . Detectable labels include, but are not limited to, a polyhistidine detectable labels (e.g., a His-6, His-8, or His-10) that binds immobilized divalent cations (e.g., Ni2+) , a biotin moiety (e.g., on an in vivo biotinylated polypeptide sequence) that binds immobilized avidin, a GST (glutathione S-transferase) sequence that binds immobilized glutathione, an S tag that binds immobilized S protein, an antigen that binds an immobilized antibody or domain or fragment thereof (including, e.g., T7, myc, FLAG, and B tags that bind corresponding antibodies) , a FLASH Tag (a high detectable label that couples to specific arsenic based moieties) , a receptor or receptor domain that binds an immobilized ligand (or vice versa) , protein A or a derivative thereof (e.g., Z) that binds immobilized IgG, maltose-binding protein (MBP) that binds immobilized amylose, an albumin-binding protein that binds immobilized albumin, a chitin binding domain that binds immobilized chitin, a calmodulin binding peptide that binds immobilized calmodulin, and a cellulose binding domain that binds immobilized cellulose. Another exemplary detectable label is a SNAP-tag (Covalys) .

[0148] 6.2.3 Targeted cells or tissues

[0149] The AAV particles disclosed herein can be used for targeting specific cell type or tissue. In some embodiments, provided herein are compositions comprising (1) a recombinant AAV particle comprising a capsid protein linked to a protein catcher, and (2) a protein tag that can be linked to an antibody or antigen-binding fragment, wherein the antibody or antigen-binding fragment specifically binds to a surface antigen of a target cell. In some embodiments, the first and second members bind to each other to form a conjugate of the AAV particle and the antibody or antigen-binding fragment. The target cell can include a wide range of cell types, such as liver cells, brain cells, T cells, B cells, NK cells, endothelial cells, epithelial cells, fibroblasts, glial cells, stem cells, pancreatic cells, cardiac muscle cells, skeletal muscle cells, kidney cells, intestinal cells, lung cells, adipocytes, tumor cells, or cells infected with a heterologous antigen. The surface antigen of the target cell can be, e.g., an oligosaccharide, a receptor, cell surface marker, etc., expressed on the surface of the target cell.

[0150] In some embodiments, the antibody or antigen-binding fragment can be replaced with other moieties that specifically bind to a surface antigen of a target cell. For example, the antigen-binding component can be a natural ligand that interacts with the target cell’s surface receptor. Other possible binding moieties include aptamers, which are short, single-stranded nucleic acids or peptides that can bind to specific molecular targets with high affinity. Additionally, peptides or small molecules with  binding specificity for cell surface antigens can also be utilized. These alternative binding moieties allow for increased versatility and adaptability in targeting a wide range of cell types and tissues for therapeutic or diagnostic applications.

[0151] In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on liver cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on brain cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on lymphocytes. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on T cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on B cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on dendritic cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on macrophages. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on NK cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on kidney cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on tumor cells. In some embodiments, the antibody or antigen-binding fragment specifically binds to a receptor expressed primarily on cell infected with a heterologous pathogen.

[0152] Cell surface proteins, e.g., cell surface receptors, that can serve as a target include, but are not limited to: the class I and class II Major Histocompatibility Antigens; receptors for a variety of cytokines (e.g., receptors for IL-1, IL-4, IL-6, IL-13, IL-22, IL-25, IL-33, etc. ) , cell-type specific growth hormones, brain derived neurotrophic factor (BDNF) , ciliary neurotrophic factor (CTNF) , colony stimulating growth factors, endothelial growth factors, epidermal growth factors, fibroblast growth factors, glially derived neurotrophic factor, glial growth factors, gro-beta / mip 2, hepatocyte growth factors, insulin-like growth factor, interferons (α-IFN, β-IFN, γ-IFN) , interleukins (IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14) , keratinocyte growth factor, leukemia inhibitory factors, macrophage / monocyte chemotactic activating factor, nerve growth factor, neutrophil activating protein 2, platelet derived growth factor, stem cell factor, transforming growth factor, tumor necrosis factors, vascular endothelial growth factor, lipoproteins, including additional or other type 1 transmembrane receptors such as PRLR, G-protein coupled receptors such as GCGR, ion channels such as Navl. 7, ASIC1 or ASIC2; cell adhesion molecules; transport molecules for metabolites such as amino acids; the antigen receptors of B-and T- lymphocytes (e.g., B cell receptors and associated proteins (e.g., CD19, CD20, etc. ) and T cell receptors and associated proteins (e.g., CD3, CD4, CD8, etc. ) ; a tetraspanin protein (e.g., CD63) . A recombinant viral capsid described herein allows for the specific infection of a cell type by employing an antibody or antigen binding fragment that binds differentiation cell surface antigens as targets for the viral vector complex. Proteins that are specifically or primarily expressed by a cell / tissue, which can be recognized by as a targeting for compositions and methods disclosed herein are well-known and can also be found at www. proteinatlas. org; see also Uhlen et al. (2010) Nat. Biotech. 28: 1248-50, incorporated herein in its entirety by reference.

[0153] In some embodiments, the antibody or antigen binding fragment binds a receptor expressed by a liver cell, e.g., an asialoglycoprotein receptor, e.g., hASGRl. In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a neuronal cell, e.g., GABA, transferrin, etc. In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a T cell, e.g., CD3. In some embodiments, the antibody or antigen binding fragment binds CD63. In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a hematopoietic stem cell, e.g., CD34. In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a kidney cell. In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a muscle cell, e.g., an integrin.

[0154] In some embodiments, the antibody or antigen binding fragment binds a molecule expressed by a tumor cell, e.g., a tumor antigen. Tumor antigens are well known in the art, for example, Adipophilin, AFP (alpha-fetoprotein) , AIM-2, ALDH1A1, ALK, alpha-actinin-4, ARTC1, AXL, B7-H3, B-RAF, BAGE-1, BAGE proteins, BCLX (L) , BCMA, BCR-ABL fusion protein (b3a2) , beta-catenin, BORIS, BRCA1, brc-abl, CA-125, CA-IX (carbonic anhydrase IX) , CALCA, carcinoembryonic antigen (CEA) , caspase-8 (CASP-8) , CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD22, CD30, CD33, CD38, CD44v6, CD45, CD70, CD79a, CD79b, CD80, CD86, CD117, CD123, CD133, CD147, CD171, CD274 (PD-L1) , CD276 (B7-H3) , Cdc27, CDK12, CDK4, CDKN2A, claudin 18.2, CLPP, COA-1, CPSF, CSNK1A1, CTAG1 (NY-ESO-1) , CTAG2, CTLA-4, Cyclin D1, cyclin A1, cyclin B1, CYP1B1, dek-can fusion protein, DLL3, DKK1, DR5, EGFR, EGFRvIII, Elongation factor 2, ENAH (hMena) , EpCAM, EphA2, EphA3, epithelial tumor antigen (ETA) , ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML1 fusion protein, EZH2, FAP, FGF5, folate receptor alpha (FRa) , FLT3-ITD, FN1, Fra-1, G250 / MN / CAIX, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAS7, GD2, GD3, GloboH, GM3, glypican-3 (GPC3) , GnTV, gp100 / Pmel 17, GPNMB, HAUS3, hepsin, HER-2 / neu (ErbB2) , HERV-K-MEL, HLA-A11, HLA-A2, HLA-DOB, hsp70-2, IDO1, IGF2B3, IL3Ra, IL13Ralpha2, intestinal carboxyl esterase, K- ras, kallikrein 4, KIF20A, KK-LC-1, KM-HN-1 (CCDC110) , LAGE-1, LDLR-fucosyltransferase-AS fusion protein, Lengsin, Lewis Y, LMP1 (EBV) , LMP2, M-CSF, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-C1, MAGE-C2, malic enzyme, mammaglobin-A, MART-1 / Melan-A, MART2, MATN, MC1R, MCSP, MDM-2, ME1, Melan-A / MART-1, Meloe, mesothelin, MG7 (glycosylated CEA) , Midkine, MMP-2, MMP-7, MUC1, MUC2, MUC3, MUC4, MUC5, MUC5AC, mucin, MUC16 (CA-125) , MUM-1, MUM-2, MUM-3, myosin, myosin class I, Nectin4, NKG2D-Ligands (MIC-A, MIC-B, ULBP1-6) , N-ras, NA17, NA88-A, neo-PAP, NFYC, NY-BR-1, NY-BR62, NY-BR85, NY-ESO-1 / LAGE-2, OX40, OA1, OGT, OS-9, P16, P53, PAP, PAX3, PAX5, PBF, PCTA-1, PLAC1, pml-RARalpha fusion protein, polymorphic epithelial mucin (PEM) , PPP1R3B, PRAME, PRDX5, PRLR, PSA, PSCA, PSMA, PTPRK, RAB38 / NY-MEL-1, RAGE-1, RAGE proteins, RBAF600, RGS5, Rho, RhoC, RF43, ROR1, ROR2, RU2AS, SAGE, SART-1, SART-3, secernin 1, SIRT2, SNRPD1, SOX10, SP17, SPA17, SSX-2, SSX-4, STEAP1, STEAP2, survivin, SYT-SSX1 or SSX2 fusion protein, TAG-1, TAG-2, TAG-72, telomerase, TGF-beta, TGF-betaRII, TIM-3, TM4SF1, TMPRSS2, TPBG, TRAG-3, triosephosphate isomerase, TRP-1 / gp75, TRP-2, TRP2-INT2, tyrosinase (TYR) , uroplakin-3, VEGF, VEGFR2, WT1, and XAGE-1b / GAGED2a.

[0155] In some embodiments, the tumor antigen is CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα or NY-ESO-1. In some embodiments, the tumor antigen is CD19. In some embodiments, the tumor antigen is BCMA. In some embodiments, the tumor antigen is FRα.

[0156] In some embodiments, the modified AAV particles disclosed herein can be conjugated to an antibody or antigen-binding fragment that specifically binds to a surface antigen of a target cell (e.g., a cancer cell or a T cell) , via the conjugation of the catcher peptide that is displayed on the modified AAV capsid and the tag peptide that is linked to the antibody or antigen binding fragment. In some embodiments, the antibody or antigen-binding fragment described herein specifically binds a tumor antigen (e.g., FRα) . In some embodiments, the antibody or antigen-binding fragment described herein specifically binds a surface protein expressed by a T cell (e.g., CD3, CD4, or CD9) . For illustrative purposes, in some embodiments, compositions provided herein also comprise an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a tumor antigen (e.g., FRα) . In some embodiments, compositions provided herein also comprise an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically  binds to a T cell antigen (e.g., CD3) . In some embodiments, the second member is a peptide tag, such as SpyTag, SpyTag002, SpyTag003, SnoopTag, or SdyTag. In some embodiments, the second member is SpyTag. In some embodiments, the second member is SpyTag002. In some embodiments, the second member is SpyTag003. In some embodiments, the second member is SnoopTag. In some embodiments, the second member is SdyTag.

[0157] The antibody or antigen-binding fragment provided herein that is linked to the second member of the binding pair specifically binds to a cell surface antigen, such as a tumor antigen (e.g., FRα) or T cell antigen (e.g., CD3) , can take any form or configuration that is disclosed herein or otherwise known in the art. For illustrative purposes, in some embodiments, antigen-binding fragments provided herein can be a variable domain of heavy chain-only antibodies or nanobodies (VHH) , a heavy chain antibody (HCAb) , a single domain antibody (sdAb) , two-variable domain fragments (dAb) , a fragment antigen-binding (Fab) , a modified Fab (Fab’) , a Fab with two antigen-binding sites [F (ab’) 2] , a variable fragment (Fv) , a single-chain variable fragment (scFv) , or a disulfide-linked scFv [ (scFv) 2] . In some embodiments, the antigen-binding fragment disclosed herein is a VHH. In some embodiments, the antigen-binding fragment disclosed herein is an HcAb. In some embodiments, the antigen-binding fragment disclosed herein is a sdAb. In some embodiments, the antigen-binding fragment disclosed herein is a dAb. In some embodiments, the antigen-binding fragment disclosed herein is an Fab. In some embodiments, the antigen-binding fragment disclosed herein is an Fab’. In some embodiments, the antigen-binding fragment disclosed herein is an F (ab’) 2. In some embodiments, the antigen-binding fragment disclosed herein is an Fv. In some embodiments, the antigen-binding fragment disclosed herein is an scFv. In some embodiments, the antigen-binding fragment disclosed herein is a disulfide-linked scFv [ (scFv) 2] .

[0158] Configurations for antigen-binding fragments, such as those described above, are well known in the art. For illustrative purpose, an “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen) . Also, “F (ab’) 2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ab’) (bivalent) regions, wherein each (ab’) region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S-S bond for binding an antigen and where the remaining H chain portions are linked together. A “F (ab’) 2” fragment can be split into two individual Fab’ fragments.

[0159] In other embodiments, the antibody or antigen-binding fragment disclosed herein can be antibody mimetic protein such as, for example, designed ankyrin repeat protein (DARPin) , affibody, monobody, (i.e., adnectin) , affilin, affimer, affitin, alphabody, avimer, Kunitz domain peptide, or anticalin. Constructs with specific binding affinities can be generated using DARPin libraries e.g., as described in Seeger, et al., Protein Sci., 22: 1239-1257 (2013) .

[0160] For illustrative purposes, in some embodiments, the antibody or antigen-binding fragment that specifically binds to a tumor antigen is an anti-FRα antibody or antigen-binding fragment. In some embodiments, the anti-FRα antibody or antigen-binding fragment comprises (i) a light chain variable domain (VL) and a first heavy chain variable domain (VH) , wherein the VL comprises VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of SEQ ID NOs: 21, 22, and 23, respectively, and wherein the VH comprises VH CDR1, VH CDR2, and VH CDR3 having the amino acid sequences of SEQ ID NOs: 24, 25, and 26, respectively. The VL has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, or 100%sequence identity to SEQ ID NO: 27. In some embodiments of the bispecific antibodies disclosed herein, the VH has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, or 100%sequence identity to SEQ ID NO: 28, respectively. In some embodiments, the VL and VH have amino acid sequences of SEQ ID NOs: 27 and 28, respectively.

[0161] Table 2: Exemplary sequences of anti-human FRα antibodies

[0162] Table 3: Exemplary sequences of anti-human CD3 antibodies

[0163] In some embodiments, the antibody or antigen-binding fragment that specifically binds to a T cell antigen is an anti-CD3 antibody or antigen-binding fragment. In some embodiments, the anti-CD3 antibody or antigen-binding fragment comprises (i) a light chain variable domain (VL) and a first heavy chain variable domain (VH) , wherein the VL comprises VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences of SEQ ID NOs: 74, 75, and 76, respectively, and wherein the VH comprises VH CDR1, VH CDR2, and VH CDR3 having the amino acid sequences of SEQ ID NOs: 77, 78, and 79, respectively. The VL has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, or 100%sequence identity to SEQ ID NO: 80. In some embodiments of the bispecific antibodies disclosed herein, the VH has an amino acid sequence that is at least 85%,  at least 90%, at least 95%, at least 98%, or 100%sequence identity to SEQ ID NO: 81, respectively. In some embodiments, the VL and VH have amino acid sequences of SEQ ID NOs: 80 and 81, respectively.

[0164] A single chain Fv ( “scFv” ) polypeptide is a fusion protein of VL and VH domains covalently linked either directly or by a peptide linker. The scFv fragment includes CDRs that are held in appropriate conformation, in particular by using gene recombination techniques. In some embodiments of scFvs, the N-terminus of VL is linked to the C-terminus of the VH. In some embodiments of scFvs, the N-terminus of VH is linked to the C-terminus of the VL.

[0165] In some embodiments, compositions provided herein comprising an AAV particle linked to a first member of a binding pair and an scFv linked to a second member of a binding pair. The scFv can comprise, from N-terminus to C-terminus, a VL domain, a linker, and a VH domain. The scFv can comprise, from N-terminus to C-terminus, a VH domain, a linker, and a VL domain. Those of skill in the art would be able to select the appropriate configuration for use in compositions and methods disclosed herein. The linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80 (6) : 1910-1917 (2008) and WO 2014 / 087010. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers. Those of skill in the art would be able to select the appropriate linker sequence for use in compositions and methods disclosed herein. For example, in some embodiments, the linker is a GS linker having the amino acid sequence of (G3S) n; n=1-10 (SEQ ID NO: 41) . The GS linker can have the amino acid sequence of GGGSGGGSGGGSGGGS (SEQ ID NO: 42) . In some embodiments, the linker is a GS linker having the amino acid sequence of (G4S) n; n=1-7 (SEQ ID NO: 43) . The GS linker can have the amino acid sequence of GGGGS (SEQ ID NO: 44) . The GS linker can have the amino acid sequence of GGGGSGGGGS (SEQ ID NO: 45) . The GS linker can have the amino acid sequence of GGGGSGGGGSGGGGS (SEQ ID NO: 46) . The GS linker can have the amino acid sequence of GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 47) . The linker that connects the VL and VH domains can be any suitable linker disclosed herein or otherwise known in the art.

[0166] In some embodiments, the anti-FRα scFv has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 29. In some embodiments, the anti-FRα scFv has an amino acid sequence that is at least 85%identical to SEQ ID NO: 29. The anti-FRα scFv can have an amino acid sequence that is at least 90%identical to SEQ ID NO: 29. The anti-FRα scFv can have an amino acid sequence  that is at least 95%identical to SEQ ID NO: 29. The anti-FRα scFv can have an amino acid sequence that is at least 98%identical to SEQ ID NO: 29. The anti-FRα scFv can have an amino acid sequence that is at least 99%identical to SEQ ID NO: 29. The anti-FRα scFv can have the amino acid sequence of SEQ ID NO: 29.

[0167] Although some exemplary sequences are provided herein for the anti-FRα antibody, expressly contemplated herein are sequences of other anti-FRα antibodies that are known in the art, such as mirvetuximab (light chain: SEQ ID NO: 30; heavy chain: SEQ ID NO: 31) . In some embodiments, the anti-FRα antibody or antigen binding fragment can have VL and VH from mirvetuximab.

[0168] In some embodiments, the anti-CD3 scFv has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 82. In some embodiments, the anti-CD3 scFv has an amino acid sequence that is at least 85%identical to SEQ ID NO: 82. The anti-CD3 scFv can have an amino acid sequence that is at least 90%identical to SEQ ID NO: 82. The anti-CD3 scFv can have an amino acid sequence that is at least 95%identical to SEQ ID NO: 82. The anti-CD3 scFv can have an amino acid sequence that is at least 98%identical to SEQ ID NO: 82. The anti-CD3 scFv can have an amino acid sequence that is at least 99%identical to SEQ ID NO: 82. The anti-CD3 scFv can have the amino acid sequence of SEQ ID NO: 82.

[0169] In some embodiments, the anti-CD3 VHH has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 83. In some embodiments, the anti-CD3 VHH has an amino acid sequence that is at least 85%identical to SEQ ID NO: 83. The anti-CD3 VHH can have an amino acid sequence that is at least 90%identical to SEQ ID NO: 83. The anti-CD3 VHH can have an amino acid sequence that is at least 95%identical to SEQ ID NO: 83. The anti-CD3 VHH can have an amino acid sequence that is at least 98%identical to SEQ ID NO: 83. The anti-CD3 VHH can have an amino acid sequence that is at least 99%identical to SEQ ID NO: 83. The anti-CD3 VHH can have the amino acid sequence of SEQ ID NO: 83.

[0170] Although some exemplary sequences for provided herein for the anti-CD3 antibody, expressly contemplated herein are other anti-CD3 antibodies that are known in the art, such as muromonab, otelixizumab, teplizumab, visilizumab, SP34, or TR66.

[0171] Compositions provided herein comprise (1) a recombinant AAV particle comprising a capsid protein linked to a first member of a binding pair (e.g., SpyCatcher003) , and (2) an antibody or antigen-binding fragment linked to second member of the binding pair (e.g., SpyTag003) , wherein the antibody or antigen-binding fragment specifically binds to a surface antigen of a target cell, such as a tumor antigen (e.g., FRα) or a T cell specific cell surface protein (e.g., CD3) . In some embodiments, the two components of the compositions disclosed herein, namely, the AAV particle linked to the first member and the antibody or antigen-binding fragment linked to the second member are separately placed. In some embodiments, the second member of the binder pair is not yet linked to the antibody or antigen-binding fragment. In some embodiments, the compositions further comprise reagents that assist in the linkage of the second member to the antibody or antigen-binding fragment of choice.

[0172] For example, in some embodiments, provided herein are kits for cell or tissue specific (e.g., tumor specific or T cell specific) gene delivery comprising both components in, for example, separate containers. That is, kits provided herein comprise the AAV particles linked to the peptide catcher (e.g., SpyCatcher003) in one container, and the peptide tag (e.g., SpyTag003) in a second container. The peptide tag can be linked to an antibody or antigen-binding fragment that specifically binds to a surface antigen of the target cell or tissue. Alternatively, the peptide tag is not yet linked to the antibody or antigen-binding fragment, and kit can further comprise reagents that assist in the linkage of the second member to an antibody or antigen-binding fragment of choice.

[0173] In some embodiments, kits can further include reagents and / or instructions for creating and / or synthesizing compounds and / or compositions of the present disclosure. In some embodiments, kits can also include one or more buffers. In some embodiments, kits of the disclosure can include components for making protein or nucleic acid arrays or libraries and thus, can include, for example, solid supports.

[0174] In some embodiments, kit components can be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component can be placed, and suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together) , kits can also generally contain second, third or other additional containers into which additional components can be separately placed. In some embodiments, kits can also comprise a second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components can be comprised in one or more vials. Kits of the present disclosure can also typically include means for containing compounds  and / or compositions of the present disclosure, e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale.

[0175] In some embodiments, kit components are provided in one and / or more liquid solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly used. In some embodiments, kit components can be provided as dried powder (s) . When reagents and / or components are provided as dry powders, such powders can be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents can also be provided in another container means.

[0176] In some embodiments, kits can include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions can include variations that may be implemented.

[0177] In some embodiments, compositions provided herein comprise a conjugate formed by the binding of the first member and the second member of the binding pair (e.g., SpyCatcher003 and SpyTag003) . In some embodiments, provided herein are also methods of preparing an antibody conjugated AAV particle that specifically targets a cell or tissue (e.g., cancer cells or T cells) comprising incubating the two components of the compositions disclosed herein, namely, the AAV particle linked to the first member and the tumor antigen-targeting antibody or antigen-binding fragment linked to the second member under a condition that allows the binding of the first member and the second member.

[0178] In some embodiments, provided herein are also methods of preparing an antibody conjugated AAV particle that specifically targets T cells comprising incubating the two components of the compositions disclosed herein, namely, the AAV particle linked to the first member and the T cell targeting antibody or antigen-binding fragment linked to the second member under a condition that allows the binding of the first member and the second member. In some embodiments, the conjugate can be formed spontaneously when the two components are mixed. For illustrative purposes, the isopeptide bond can be formed when a protein catcher (e.g., SpyCatcher003) and a peptide tag (e.g., SpyTag003) are mixed at a neutral pH and physiological temperature (e.g., about 37℃) .

[0179] 6.2.4 Viral genomes

[0180] The AAV particle conjugates disclosed herein can be used for targeted delivery of transgenes of interest. In some embodiments, AAV particle conjugates disclosed herein can be used for cancer targeted delivery of transgenes of interest. In some embodiments, AAV particle conjugates disclosed herein can be used for T cell targeted delivery of transgenes of interest. In some  embodiments, the AAV particle of the present disclosure serves as an expression vector comprising a viral genome comprising a nucleic acid encoding a transgene of interest. In some embodiments, an AAV particle described herein comprises a viral genome. In some embodiments, for example, the AAV viral genome comprises an ITR region, a promoter, a Kozak sequence, a nucleic acid encoding a transgene, a polyA signal region, or a combination thereof. The AAV viral genome can further comprise an enhancer, an intron, or a spacer, or any combination thereof. The elements of AAV viral genome can be operably linked together. As a nonlimiting example, a promoter is operably linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell. Additionally, two portions of a transcription regulatory element are operably linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion. Two transcription regulatory elements can be operably linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or can be operably linked to one another with no intervening nucleotides present. When two or more polynucleotides are to be co-expressed, both polynucleotides can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding polynucleotides can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The introduction of polynucleotides into a host cell can be confirmed using methods well known in the art. It is understood by those skilled in the art that the polynucleotides are expressed in a sufficient amount to produce a desired product, and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.

[0181] Table 3: Exemplary promoter sequences.

[0182] Inverted Terminal Repeats (ITRs)

[0183] In some embodiments, the viral genome comprises at least one ITR region. The AAV particles of the present disclosure comprise a viral genome with at least one ITR region and a transgene region. In some embodiments, the viral genome has two ITRs. These two ITRs flank the transgene region at the 5’ and 3’ ends. In some embodiments, the ITR functions as an origin of replication comprising a recognition site for replication. In some embodiments, the ITR comprises a sequence region which can be complementary and symmetrically arranged. In some embodiments, the ITR incorporated into a viral genome described herein can be comprised of a naturally occurring polynucleotide sequence or a recombinantly derived polynucleotide sequence.

[0184] The ITRs can be derived from the same serotype as the capsid, selected from any of the known serotypes. The ITR can be of a different serotype than the capsid. In some embodiments, the AAV particle has more than one ITR. In a non-limiting example, the AAV particle has a viral genome comprising two ITRs. In some embodiments, the ITRs are of the same serotype as one another. In another embodiment, the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In some embodiments both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

[0185] Independently, each ITR can be about 100 to about 150 nucleotides in length. In some embodiments, the ITR comprises 100-180 nucleotides in length, e.g., about 100-115, about 100-120, about 100-130, about 100-140, about 100-150, about 100-160, about 100-170, about 100-180, about 110-120, about 110-130, about 110-140, about 110-150, about 110-160, about 110-170, about 110-180, about 120-130, about 120-140, about 120-150, about 120-160, about 120-170, about 120-180, about 130-140, about 130-150, about 130-160, about 130-170, about 130-180, about 140-150, about 140-160, about 140-170, about 140-180, about 150-160, about 150-170, about 150-180, about 160-170, about 160-180, or about 170-180 nucleotides in length. In some embodiments, the ITR comprises about 120-140 nucleotides in length, e.g., about 130 nucleotides in length. In some embodiments, the ITRs are 140-142 nucleotides in length, e.g., 141 nucleotides in length. In some embodiments, the ITR comprises 1205-135 nucleotides in length, e.g., 130 nucleotides in length. Non-limiting examples of ITR length are 102, 130, 140, 141, 142, 145 nucleotides in length, and those having at least 95%identity thereto.

[0186] Promoters and Expression Enhancers

[0187] In some embodiments, the viral genome comprises expression cassettes disclosed herein that comprise at least one element to enhance the transgene target specificity and expression. See, e.g., Powell et al., Discov Med., 2015, 19 (102) : 49-57; the contents of which are herein incorporated by reference in their entirety. Non-limiting examples of elements to enhance the transgene target specificity and expression include promoters, polyadenylation (PolyA) signal sequences, enhancers, and introns.

[0188] In some embodiments, the viral genome comprises a promoter that is sufficient for expression of the transgene. In some embodiments, the promoter is deemed to be efficient when it drives expression of the transgene of the viral genome of the AAV particle. Expression driven by a promoter can range from a period of hours, days, weeks, months, or years. Promoters can be naturally occurring or non-naturally occurring. Examples of other transcription regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185 (Academic Press, San Diego, CA, 1990) . In some embodiments, the promoter is a ubiquitous promoter as described in Yu et al., (Molecular Pain 2011, 7: 63) , Soderblom et al. (E. Neuro 2015) , Gill et al., (Gene Therapy 2001, Vol. 8, 1539-1546) , and Husain et al. (Gene Therapy 2009) , each of which are incorporated by reference in their entirety. In some embodiments, the promoter is not cell specific. In some embodiments, the promoter is a constitutive promoter. In alternate embodiments, the promoter is an inducible promoter. In a preferred embodiment, strong constitutive promoters that provide for sustained expression of the transgenes are used.

[0189] In some embodiments, the promoter comprises a TATA box. In some embodiments, the promoter comprises one or more elements. In some embodiments, the one or more promoter elements can be inverted or moved relative to one another. In some embodiments, the elements of the promoter are positioned to function cooperably. In some embodiments, the elements of the promoter are positioned to function independently. In some embodiments, the expression cassettes provided herein comprise one or more promoters selected from the group consisting of CB promoter, ubiquitin c (UBC) promoter, cytomegalovirus (CMV) promoter, the SV40 early promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, β-glucuronidase (GUSB) promoter, chicken beta-actin (CBA) promoter, rat insulin promoter, CAG promoter, RPE65 promoter and opsin promoter.

[0190] In some embodiments, the promoter is a ubiquitin c (UBC) promoter. The UBC promoter can have a size of 300-350 nucleotides. In some embodiments, the promoter is a β-glucuronidase (GUSB) promoter. The GUSB promoter may have a size of 350-400 nucleotides. In some  embodiments, the promoter is a chicken β-actin (CBA) promoter, or a functional variant thereof. In some embodiments, the promoter is a CB6 promoter, or a functional variant thereof. In some embodiments, the promoter is a minimal CB promoter, or a functional variant thereof. In some embodiments, the promoter is a CBA promoter, or functional variant thereof. In some embodiments, the promoter is a minimal CBA promoter, or functional variant thereof. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter, or a functional variant thereof. In some embodiments, the promoter is a CAG promoter, or a functional variant thereof. In some embodiments, the promoter is an EF1αpromoter or functional variant thereof. In some embodiments, the promoter is an RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is H1.

[0191] In some embodiments, the promoter may be less than 1 kb. The promoter may have a length between 50-100, 50-200, 50-300, 50-400, 100-200, 100-300, 100-400, 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 nucleotides.

[0192] In some embodiments, the promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 48-50, or a nucleotide sequence substantially identical (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%or 100%identical) to any of the aforesaid sequences. In some embodiments, the promoter comprises the nucleotide sequence having one, two, or three but no more than four modifications, e.g., substitutions, relative to a nucleotide sequence selected from a group consisting of SEQ ID NOs: 48-50. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 48, or a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%or 100%identical to SEQ ID NO: 48. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 50, or a nucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%or 100%identical to SEQ ID NO: 50.

[0193] Introns

[0194] In some embodiments, the vector genome comprises at least one intron or a fragment or derivative thereof. In some embodiments, the at least one intron can enhance expression of transgene described herein. Non-limiting examples of introns include, MVM (67-97 bps) , F. IX truncated intron 1 (300 bps) , β-globin SD / immunoglobulin heavy chain splice acceptor (250 bps) , adenovirus splice donor / immunoglobin splice acceptor (500 bps) , SV40 late splice donor / splice acceptor (19S / 16S) (180 bps) , and hybrid adenovirus splice donor / IgG splice acceptor (230 bps) .

[0195] In some embodiments, the intron can be 100-500 nucleotides in length. The intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500 nucleotides. The intron may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500 nucleotides.

[0196] Untranslated Regions (UTRs)

[0197] In some embodiments, a wildtype UTR of a gene is transcribed but not translated. Generally, the 5’ UTR starts at the transcription start site and ends at the start codon and the 3’ UTR starts immediately following the stop codon and continues until the termination signal for transcription.

[0198] Features typically found in abundantly expressed genes of specific target organs can be engineered into UTRs to enhance the stability and protein production. In some embodiments, the viral genome encoding a transgene described herein comprises a Kozak sequence. While not wishing to be bound by theory, wild-type 5’ UTRs include features that play roles in translation initiation. Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5’ UTRs. Kozak sequences have the consensus CCR (A / G) CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG) , which is followed by another ‘G’ .

[0199] While not wishing to be bound by theory, wild-type 3’ UTRs are known to have stretches of adenosines and uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Introduction, removal or modification of 3’ UTR AU rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., payload regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.

[0200] In some embodiments, the 3’ UTR of the viral genome can include an oligo (dT) sequence for templated addition of a poly-A tail.

[0201] Any UTR from any gene known in the art can be incorporated into the viral genome of the AAV particle. These UTRs, or portions thereof, can be placed in the same orientation as in the gene from which they were selected, or they can be altered in orientation or location. In some embodiments, the UTR used in the viral genome of the AAV particle can be inverted, shortened, lengthened, or made with one or more other 5’ UTRs or 3’ UTRs known in the art. In some  embodiments, the viral genome of the AAV particle comprises at least one artificial UTR, which is not a variant of a wildtype UTR. In some embodiments, the viral genome of the AAV particle comprises UTRs which have been selected from a family of transcripts whose proteins share a common function, structure, feature, or property.

[0202] Polyadenylation (polyA) Sequence

[0203] In some embodiments, the viral genome of the AAV particles of the present disclosure comprises at least one polyA sequence. The viral genome of the AAV particle can comprise a polyA sequence between the 3’ end of the transgene coding sequence and the 5′end of the 3’ UTR. In some embodiments, the polyA signal region is positioned 3’ relative to the nucleic acid comprising the transgene.

[0204] In some embodiments, the polyA signal region comprises a length of about 100-600 nucleotides, e.g., about 100-500 nucleotides, about 100-400 nucleotides, about 100-300 nucleotides, about 100-200 nucleotides, about 200-600 nucleotides, about 200-500 nucleotides, about 200-400 nucleotides, about 200-300 nucleotides, about 300-600 nucleotides, about 300-500 nucleotides, about 300-400 nucleotides, about 400-600 nucleotides, about 400-500 nucleotides, or about 500-600 nucleotides. In some embodiments, the polyA signal region comprises a length of about 100 to 150 nucleotides, e.g., about 127 nucleotides. In some embodiments, the polyA signal region comprises a length of about 450 to 500 nucleotides, e.g., about 477 nucleotides.

[0205] Filler Sequence

[0206] In some embodiments, the viral genome comprises one or more filler sequences. The filler sequence can be a wildtype sequence or an engineered sequence. A filler sequence can be a variant of a wild-type sequence. In some embodiments, the viral genome comprises one or more filler sequences in order to have the length of the viral genome be the optimal size for packaging. For illustrative purposes, in some embodiments, the viral genome is a single stranded (ss) viral genome and comprises one or more filler sequences that, independently or together, have a length about between 0.1 kb-3.8 kb; in some embodiments, the viral genome is a self-complementary (sc) viral genome and comprises one or more filler sequences in order to have the length of the viral genome be about 2.3 kb.

[0207] In some embodiments, the viral genome comprises one or more filler sequences between one of more regions of the viral genome. In some embodiments, the filler region can be located before a region such as, but not limited to, a transgene region, an ITR, a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In some embodiments, the filler region can be located after a region such as, but not limited to, a payload  region, an ITR, a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region.

[0208] Transgene of interest

[0209] Generally, a transgene of interest can be a nucleotide sequence that encodes a detectable marker, e.g., reporter, or a therapeutic polypeptide. In some embodiments, the transgene of interest is a reporter gene. In some embodiments, the transgene of interest is a reporter gene that encodes a detectable marker selected from the group consisting of green fluorescent protein, luciferase, β-galactosidase, etc. In some embodiments, the detectable marker is green fluorescent protein.

[0210] In other embodiments, the transgene of interest can encode a therapeutic molecule that serves a specific function in the context of disease treatment or modulation. For example, therapeutic proteins could include cytokines, such as IL-2, IL-12, or IL-15, which modulate the immune response, or enzymes, such as Factor VIII or IX, used in gene therapies for hemophilia. Additionally, the transgene could encode antibodies or antibody fragments, such as single-chain variable fragments (scFv) , nanobodies, or bispecific antibodies (bsAb) , which target specific antigens on cancer cells, viruses, or other pathological agents.

[0211] In the context of gene editing, the transgene can encode a CRISPR / Cas system or portions thereof, such as the Cas9 or Cas12 nuclease, or a catalytically inactive Cas (dCas) protein, which can be fused to transcriptional activators or repressors for gene regulation without cutting DNA. The transgene can also encode guide RNAs (gRNAs) that direct the Cas protein to specific genomic loci.

[0212] In some embodiments, the transgene can encode antisense RNA, shRNA (short hairpin RNA) , or miRNA (microRNA) that regulate gene expression post-transcriptionally by degrading mRNA or inhibiting its translation.

[0213] In some embodiments, the transgene can encode a suicide protein, such as thymidine kinase from herpes simplex virus (HSV-TK) , which converts prodrugs like ganciclovir into toxic compounds that kill the cells expressing the suicide gene for selectively eliminating diseased cells, such as cancer cells.

[0214] Accordingly, in some embodiments, the transgene of interest encodes a therapeutic protein, an antibody or fragment thereof, a CRISPR / Cas system or portion (s) thereof, an antisense RNA, a shRNA, a miRNA, or a suicide protein, etc.

[0215] In one embodiment, the nucleotide of interest encodes a multidomain therapeutic, e.g., a protein that comprises at least two domains providing two distinct functions.

[0216] 6.2.4.1 Exemplary transgenes for cancer delivery

[0217] The AAV particles disclosed herein can be used for cancer targeted delivery of transgenes of interest. In some embodiments, the transgene of interest encodes a cytokine. Cytokines are pivotal mediators of cell communication in the tumor microenvironment (TME) . Multiple cytokines are involved in the host antitumor response, but the production and function of these cytokines are usually dysregulated during malignant tumor progression. Early successful uses of cytokines in cancer immunotherapy include interferon alpha-2b (IFNα-2b;  ) and IL-2 However, clinical application of cytokines has been greatly limited owing to their high-degree pleiotropic features (therefore severe dose-limiting toxicities) and poor pharmacokinetics (therefore a short half-life) . Here, by using antibody conjugated AAV particles to specifically deliver therapeutic cytokines to cancer cells, compositions and methods disclosed herein achieve both high specificity and sustained expression, overcoming the challenges associated with systemic administration.

[0218] In some embodiments, the AAV particle of the present disclosure serves as an expression vector comprising a viral genome comprising a nucleic acid having a transgene of interest, wherein the transgene of interest encodes a cytokine. Cytokines exert biological functions via the extracellular domains of cell membrane receptors. The main classes of cytokines engaged in cellular communication include interleukins (ILs) , interferons (IFNs) , certain members of the tumor necrosis factor (TNF) superfamily, and other effector molecules. In some embodiments, the cytokine is interleukin. In some embodiments, the cytokine is IL-12 (e.g., SEQ ID NO: 32 and 33) , IL-15 (e.g., SEQ ID NO: 35) , IL-2 (e.g., SEQ ID NO: 51) , IL-7 (e.g., SEQ ID NO: 52) , IL-21 (e.g., SEQ ID NO: 53) , IL-18 (e.g., SEQ ID NO: 54) , IL-23 (e.g., SEQ ID NO: 55) , or IL-17 (e.g., SEQ ID NO: 56) , or a variant thereof any of the above. In some embodiments, the cytokine is IL-12 (e.g., SEQ ID SEQ ID NO: 32 and 33) or a variant thereof. In some embodiments, the cytokine is IL-15 (e.g., SEQ ID NO: 35) or a variant thereof. In some embodiments, the cytokine is IL-2 (e.g., SEQ ID NO: 51) or a variant thereof. In some embodiments, the cytokine is IL-7 (e.g., SEQ ID NO: 52) or a variant thereof. In some embodiments, the cytokine is IL-21 (e.g., SEQ ID NO: 53) or a variant thereof. In some embodiments, the cytokine is IL-18 (e.g., SEQ ID NO: 54) or a variant thereof. In some embodiments, the cytokine is IL-23 (e.g., SEQ ID NO: 55) or a variant thereof. In some embodiments, the cytokine is IL-17 (e.g., SEQ ID NO: 56) or a variant thereof. In some embodiments, the cytokine is interferon (IFN) . In some embodiments, the cytokine is IFNγ (e.g., SEQ ID NO: 57) , or a variant thereof. In some embodiments, the cytokine is tumor necrosis factor (TNF) . In some embodiments, the cytokine is TNFα (e.g., SEQ ID NO: 58) . In some embodiments, the cytokine is GM-CSF (e.g., SEQ ID NO: 59) .

[0219] IL-12

[0220] Due to its prominent proinflammatory and immunomodulatory capabilities, IL-12 can convert immunologically suppressed “cold” tumors into inflamed “hot” tumors. Structurally, human IL-12 is a typical heterodimeric cytokine consisting of two subunits: an α subunit (IL-12p35, or p35) and a β subunit (IL-12p40, or p40) , which are linked by disulfide bonds. Biologically active IL-12 is produced primarily by activated inflammatory cells, including monocytes, macrophages, DCs, and other antigen-presenting cells. IL-12 activates the immune system by binding to its receptor (IL-12R) , which consists of IL-12Rβ1 and IL-12Rβ2 and is predominantly expressed by activated T cells, NK cells, and DCs. Engagement of IL-12 with its heterodimeric receptors induces phosphorylation of JAK2 and TYK2, followed by STAT4 phosphorylation, dimerization, nuclear translocation, and IFN-γ secretion. Functionally speaking, IL-12 induces the differentiation of Th1 cells; increases the activation and cytotoxicity of NK and T lymphocytes; inhibits or reprograms immunosuppressive cells, such as MDSCs and tumor-associated macrophages (TAMs) ; upregulates the expression of MHC-I and MHC-II on tumor cells to enhance recognition and lysis; suppresses IgE production but enhances IgG production by B cells; and shows anti-angiogenic effects. Overall, IL-12 activates the innate and adaptive immune systems and exerts excellent therapeutic effects by shrinking syngeneic tumors.

[0221] In some embodiments, the cytokine is IL-12 or a variant thereof. In some embodiments, the cytokine is mouse IL-12 (mIL-12) or a variant thereof. In some embodiments, the cytokine is human IL-12 or a variant thereof. In some embodiments, AAV particles provided herein comprise a nucleic acid having a first transgene encoding p35 or a variant thereof, and a second transgene encoding p40 or a variant thereof. In some embodiments, AAV particles provided herein comprise a nucleic acid having a transgene encoding a fusion protein comprising p35 or a variant thereof, and p40 or a variant thereof (the “p35-p40 fusion” ) . In some embodiments, the p35-p40 fusion can comprise, from N-terminus to C-terminus, p35 or a variant thereof, a linker, and p40 or a variant thereof. In some embodiments, the p35-p40 fusion can comprise, from N-terminus to C-terminus, p40 or a variant thereof, a linker, and p35 or a variant thereof. The linker can be a cleavable linker. The cleavable linker can be a 2A peptide. A2A peptide, as understood in the art, encoding self-cleaving short peptides (about 20 amino acids) that provide a mechanism for subsequent separation of equimolarly produced polypeptides of interest. Illustrative 2A self-cleaving peptides include P2A, E2A, F2A, and T2A.

[0222] In some embodiments, the In some embodiments, the p35 or a variant thereof has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%,  at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 32. In some embodiments, the p35 has the amino acid sequence of SEQ ID NO: 32. In some embodiments, the p35 has amino acids 23-219 of SEQ ID NO: 32. In some embodiments, the p40 or a variant thereof has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 33. In some embodiments, the p40 has the amino acid sequence of SEQ ID NO: 33. In some embodiments, the p40 has amino acids 23-328 of SEQ ID NO: 33. In some embodiments, the p40-p35 fusion has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 34. In some embodiments, the p40-p35 fusion has the amino acid sequence of SEQ ID NO: 34.

[0223] In some embodiments, the cytokine is mIL-12 or a variant thereof. In some embodiments, the mIL-12 or a variant thereof has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 60. In some embodiments, the mIL-12 has the amino acid sequence of SEQ ID NO: 60.

[0224] IL-15

[0225] Interleukin-15 (IL-15) is a potent immunoregulator that is typically produced by monocytes and macrophages and can stimulate the proliferation of immune cells such as NK cells, CD8+T lymphocytes, and γδ T cells. The receptor for IL-15 has a common β chain, a common γ chain, and a distinct α-receptor, IL-15Rα (CD215) . Upon binding to IL-15, IL-15Rα forms an immunological synapse with the IL-15Rβγ chain on peripheral effector NK cells and T lymphocytes, and activates the JAK-STAT signaling pathway in NK cells and T cells. Due to its powerful effects on cytolytic NK and T cells without causing the expansion of suppressive Treg cells, IL-15 is extensively explored in cancer therapy. In some embodiments, the cytokine is IL-15 or a variant thereof. In some embodiments, AAV particles provided herein comprise a nucleic acid having a transgene encoding IL-15 or a variant thereof. In some embodiments, the IL-15 or a variant thereof has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 35. In some embodiments, the IL-15 has the amino acid sequence of SEQ ID NO: 35.

[0226] In some embodiments, the transgene encodes a fusion protein of IL-12 and IL-15. In some embodiments, the transgene encodes a fusion protein comprising p35 or a variant thereof, and IL-15 or a variant thereof (the “IL-15-p35 fusion” ) . In some embodiments, the IL-15-p35 fusion comprises, from N-terminus to C-terminus, p35 or a variant thereof, a linker, and IL-15 or a variant thereof. In some embodiments, the IL-15-p35 fusion comprises, from N-terminus to C-terminus, IL-15 or a variant thereof, a linker, and p35 or a variant thereof. The linker can be a cleavable linker. The cleavable linker can be a 2A peptide. A2A peptide, as understood in the art, encoding self-cleaving short peptides (about 20 amino acids) that provide a mechanism for subsequent separation of equimolarly produced polypeptides of interest. Illustrative 2A self-cleaving peptides include P2A, E2A, F2A, and T2A. In some embodiments, the IL-15-p35 fusion has the amino acid sequence of SEQ ID NO: 36. In some embodiments, the IL-15-p35 fusion has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 36. In some embodiments, the IL-15-p35 fusion has the amino acid sequence of SEQ ID NO: 36.

[0227] In some embodiments, the transgene encodes a fusion protein comprising p40 or a variant thereof, p35 or a variant thereof, and IL-15 or a variant thereof (the “IL-15-p35-p40 fusion” ) . In some embodiments, the IL-15-p35-p40 fusion comprises, from N-terminus to C-terminus, p35 or a variant thereof, a first linker, p40 or a variant thereof, a second linker, and IL-15 or a variant thereof. In some embodiments, the IL-15-p35-p40 fusion comprises, from N-terminus to C-terminus, p40 or a variant thereof, a first linker, p35 or a variant thereof, a second linker, and IL-15 or a variant thereof. In some embodiments, the IL-15-p35-p40 fusion comprises, from N-terminus to C-terminus, IL-15 or a variant thereof, a first linker, p35 or a variant thereof, a second linker, and p40 or a variant thereof. In some embodiments, the IL-15-p35-p40 fusion comprises, from N-terminus to C-terminus, IL-15 or a variant thereof, a first linker, p40 or a variant thereof, a second linker, and p35 or a variant thereof. The linkers can be cleavable linkers. The cleavable linker can be a 2A peptide. A2A peptide, as understood in the art, encoding self-cleaving short peptides (about 20 amino acids) that provide a mechanism for subsequent separation of equimolarly produced polypeptides of interest. Illustrative 2A self-cleaving peptides include P2A, E2A, F2A, and T2A.

[0228] In some embodiments, the IL-15-p35-p40 fusion has an amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or  100%identical to SEQ ID NO: 37. In some embodiments, the IL-15-p40-p35 fusion has the amino acid sequence of SEQ ID NO: 37.

[0229] For illustrative purposes, in some embodiments, the AAV viral genome comprises an ITR region, a promoter, a nucleic acid encoding a cytokine (e.g., IL-12, IL-15, IL-15-p35 fusion, or IL-15-p35-p40 fusion) , a polyA signal region, or a combination thereof. The AAV viral genome can further comprise an enhancer, an intron, or a spacer, or any combination thereof.

[0230] FIG. 24 illustrates the effects of administration of tAAV9 (AAV9 modified for tumor targeting) on tumor cells and the resulting immune responses. Step 1) : administration of tAAV9 which targets tumor cells. Step 2) : secretion of cytokines (e.g., IL-12) by the infected tumor cell. Step3) : activation of innate immune cells in tumor microenvironment. The released IL-12 triggers the activation innate immune cells to kill the tumor cell by promoting maturation of dendritic cells (DCs) and the polarization of macrophages into the M1 phenotype (which is pro-inflammatory and involved in killing tumor cells) . Step 4) : activation of adaptive immune cells. The activated antigen-presenting cells (APCs) , such as mature dendritic cells, further stimulate adaptive immune responses by activating T cells. These activated T cells then contribute to the killing of the tumor cell.

[0231] 6.2.4.2 Exemplary transgenes for T cell delivery

[0232] Chimeric antigen receptors (CARs)

[0233] The AAV particles disclosed herein can be used for T cell targeted delivery of transgenes of interest. In some embodiments, the transgene of interest encodes a chimeric antigen receptor (CAR) , and the expression of the CAR in T cells transforms the T cell to a CART cell that can be used in cancer therapy.

[0234] In certain embodiments, the CAR to be expressed in T cells using methods disclosed herein comprises an antigen-binding domain (e.g., a tumor antigen-binding domain) , a transmembrane domain, and an intracellular domain. The antigen-binding domain of the CAR is operably linked to another domain of the CAR, such as a hinge, a transmembrane domain or an intracellular domain, each described elsewhere herein. In one embodiment, a first nucleotide sequence encoding the antigen-binding domain is operably linked to a second nucleotide sequence encoding a hinge and / or transmembrane domain, and further operably linked to a third nucleotide sequence encoding an intracellular domain.

[0235] The antigen-binding domain described herein can be combined with any of the transmembrane domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that can be included in a CAR disclosed herein, such as a hinge domain or a spacer sequence.

[0236] The CAR disclosed herein can also include a leader sequence as described herein. The CAR disclosed herein can also include a hinge domain as described herein. The CAR disclosed herein can also include one or more spacer domains or linkers as described herein which can serve to link one domain of the CAR to the next domain.

[0237] Antigen-Binding Domain

[0238] The antigen-binding domain of a CAR is an extracellular region of the CAR for binding to a specific target antigen including proteins, carbohydrates, and glycolipids. The CAR disclosed herein can comprises an antigen-binding domain that specifically binds to a tumor antigen. Suitable tumor antigens are known in the art and include, but are not limited to, alpha fetoprotein (AFP)  / HLA-A2, AXL, B7-H3, BCMA, CA-1X, CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD22, CD30, CD33, CD38, CD44v6, CD70, CD79a, CD79b, CD80, CD86, CD117, CD123, CD133, CD147, CD171, CD276, CEA, claudin 18.2, c-Met, DLL3, DR5, EGFR, EGFRvIII, EpCAM, EphA2, FAP, folate receptor alpha (FRa)  / folate binding protein (FBP) , GD-2, Glycolipid F77, glypican-3 (GPC3) , HER2, HLA-A2, ICAM1, IL3Ra, IL13Ra2, LAGE-1, Lewis Y, LMP1 (EBV) , MAGE-A1, MAGE-A3,MAGE-A4, Melan A, mesothelin, MG7 (glycosylated CEA) , MMP, MUC1, Nectin4 / FAP, NKG2D-Ligands (MIC-A, MIC-B, and the ULBPs 1 to 6) , NY-ESO-1, P16, PD-L1, PSCA, PSMA, ROR1, ROR2, TIM-3, TM4SF1, VEGFR2, and any combination thereof. In some embodiments, the tumor antigen is CD19. In some embodiments, the antigen-binding domain is an anti-CD19 antigen-binding fragment, such as the FMC63 scFv known in the art.

[0239] The antigen-binding domain can include any domain that binds to the antigen (e.g., tumor antigen) and can include, but is not limited to, a monoclonal antibody (mAb) , a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, a single-domain antibody, a full length antibody or any antigen-binding fragment thereof, a Fab, and an scFv. In some embodiments, the antigen-binding domain comprises an aglycosylated antibody or a fragment thereof or scFv thereof.

[0240] In some embodiments, the antigen-binding domain can be derived from the same species in which the CAR will ultimately be used. For example, for use in humans, the antigen-binding domain of the CAR can comprise a human antibody or a fragment thereof. In some embodiments, the antigen-binding domain can be derived from a different species in which the CAR will ultimately be used. For example, for use in humans, the antigen-binding domain of the CAR can comprise a murine antibody or a fragment thereof, or a humanized murine antibody or a fragment thereof.

[0241] In certain embodiments, the antigen-binding domain comprises a heavy chain variable region that comprises three VH CDRs and a light chain variable region that comprises three VL CDRs. In certain embodiments, the antigen-binding domain comprises a linker.

[0242] Transmembrane Domain

[0243] CARs disclosed herein can comprise a transmembrane domain that connects the antigen-binding domain of the CAR to the intracellular domain of the CAR. The transmembrane domain of the CAR is a region that spans the plasma membrane of a cell (e.g., an immune cell or precursor thereof) . In some embodiments, the transmembrane domain is interposed between the antigen-binding domain and the intracellular domain of a CAR. In some embodiments, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In some embodiments, the transmembrane domain can be selected or modified by one or more amino acid substitutions to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, to minimize interactions with other members of the receptor complex.

[0244] The transmembrane domain can be derived either from a natural or a synthetic source. Where the source is natural, the domain can be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain can be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence. Examples of the transmembrane domain of particular use in this CARs disclosed herein include, without limitation, transmembrane domains derived from (i.e., comprising at least the transmembrane region (s) of) the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40) , CD137 (4-1BB) , CD154 (CD40L) , ICOS, CD278, Toll-like receptor 1 (TLR1) , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 or a transmembrane domain derived from a killer immunoglobulin-like receptor (KIR) .

[0245] In certain embodiments, the transmembrane domain comprises a transmembrane domain of CD8. In certain embodiments, the transmembrane domain of CD8 is a transmembrane domain of CD8a.

[0246] In some embodiments, the transmembrane domain can be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.

[0247] The transmembrane domains described herein can be combined with any of the antigen-binding domains described herein, any of the intracellular domains described herein, or any of the other domains described herein that can be included in the CAR.

[0248] In some embodiments, the transmembrane domain further comprises a hinge region. The CAR disclosed herein can also include a hinge region. The hinge region of the CAR is a hydrophilic region which is located between the antigen-binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the CAR. The hinge region is an optional component for the CAR. The hinge region can include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof. Examples of hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as, three glycines (Gly) , as well as CH1 and CH3 domains of IgGs (such as human IgG4) .

[0249] In some embodiments, the CAR disclosed herein includes a hinge region that connects the antigen-binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain. The hinge region is preferably capable of supporting the antigen-binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3 (2) : 125-135) . In some embodiments, the hinge region is a flexible domain, thus allowing the antigen-binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell. The flexibility of the hinge region permits the hinge region to adopt many different conformations.

[0250] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (e.g., a CD8-derived hinge region) .

[0251] The hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 40 amino acids, or from about 40 amino acids to about 50 amino acids. In some embodiments, the hinge region can have a length of greater than 5 amino acids, greater than 10 amino acids, greater than 15 amino acids, greater than 20 amino acids, greater than 25 amino acids, greater than 30 amino acids, greater than 35 amino acids, greater than 40 amino acids, greater than 45 amino acids, greater than 50 amino acids, greater than 55 amino acids, or more.

[0252] Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be  1, 2, 3, 4, 5, 6, or 7 amino acids. Suitable hinge regions can have a length of greater than 20 amino acids (e.g., 30, 40, 50, 60 or more amino acids) . For example, hinge regions include glycine polymers (G) n, glycine-serine polymers, glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components. Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine, and is much less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142) . The hinge region can comprise an amino acid sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region (see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897) . In one embodiment, the hinge region can comprise an amino acid sequence derived from human CD8, or a variant thereof.

[0253] Intracellular Signaling Domain

[0254] The CAR disclosed herein also includes an intracellular signaling domain. The terms “intracellular signaling domain” and “intracellular domain” are used interchangeably herein. The intracellular signaling domain of the CAR is responsible for activation of at least one of the effector functions of the cell in which the CAR is expressed (e.g., immune cell) . The intracellular signaling domain transduces the effector function signal and directs the cell (e.g., immune cell) to perform its specialized function, e.g., harming and / or destroying a target cell.

[0255] Examples of an intracellular domain for use in the CARs disclosed herein include, but are not limited to, the cytoplasmic portion of a surface receptor, co-stimulatory molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.

[0256] Examples of the intracellular signaling domain include, without limitation, the signaling domain derived from ζ chain of the T cell receptor complex or any of its homologs, e.g., η chain, FcεRI and P chains, MB1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (Δ, δ and ε) , syk family tyrosine kinases (Syk, ZAP 70, etc. ) , src family tyrosine kinases (Lek, Fyn, Lyn, etc. ) , and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. In one embodiment, the intracellular signaling domain can comprise an intracellular signaling domain of a protein selected from human CD3 zeta chain, FcγRIII, FcεRI, DAP 10, DAP 12, cytoplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (ITAM) bearing cytoplasmic receptors, and combinations thereof. In one embodiment, the intracellular signaling domain of the CAR includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, ICOS, 4-1BB, PD-1, any derivative or variant thereof,  such as any synthetic sequence thereof, that has the same functional capability, and any combination thereof.

[0257] Other examples of the intracellular domain include a fragment or domain from one or more molecules or receptors including, but not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib) , CD79a, CD79b, Fcgamma RIIa, DAP10, DAP12, T cell receptor (TCR) , CD8, CD27, CD28, 4-1BB (CD137) , OX9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1) , CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR) , SLAMF7, NKp80 (KLRF1) , CD127, CD160, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, ITGAE, CD 103, ITGAL, CD11a, LFA-1, ITGAM, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226) , SLAMF4 (CD244, 2B4) , CD84, CD96 (Tactile) , CEACAM1, CRT AM, Ly9 (CD229) , CD160 (BY55) , PSGL1, CD100 (SEMA4D) , CD69, SLAMF6 (NTB-A, Lyl08) , SLAM (SLAMF1, CD 150, IPO-3) , BLAME (SLAMF8) , SELPLG (CD162) , LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1) , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other co-stimulatory molecules described herein, any derivative, variant, or fragment thereof, any synthetic sequence of a co-stimulatory molecule that has the same functional capability, and any combination thereof.

[0258] Additional examples of intracellular domains include, without limitation, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins including CD3, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33 (6) : 651-653) . Additionally, intracellular signaling domains can include signaling domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol. (2015) 6: 195) such as signaling domains of NKp30 (B7-H6) (see, e.g., Zhang et al., J. Immunol. (2012) 189 (5) : 2290-2299) , and DAP 12 (see, e.g., 31 Topfer et al., J. Immunol. (2015) 194 (7) : 3201-3212) , NKG2D, NKp44, NKp46, DAP10, and CD3z.

[0259] Intracellular signaling domains suitable for use in the CARs disclosed herein include any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity of a protein; change in cell behavior, e.g., cell death; cellular proliferation; cellular differentiation; cell survival; modulation of cellular signaling responses; etc. ) in response to activation of the CAR (e.g.,  activated by antigen and dimerizing agent) . In some embodiments, the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc. ) ITAM motifs as described below. In some embodiments, the intracellular signaling domain includes DAP10 / CD28 type signaling chains. In some embodiments, the intracellular signaling domain is not covalently attached to the membrane bound CAR, but is instead diffused in the cytoplasm.

[0260] Intracellular signaling domains suitable for use in the CARs disclosed herein include ITAM-containing intracellular signaling polypeptides. In some embodiments, an ITAM motif is repeated twice in an intracellular signaling domain, where the first and second instances of the ITAM motif are separated from one another by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of the CAR comprises 3 ITAM motifs.

[0261] In some embodiments, intracellular signaling domains includes the signaling domains of human immunoglobulin receptors that contain ITAMs such as, but not limited to, FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, FcRL5 (see, e.g., Gillis et al., Front. Immunol. (2014) 5: 254) .

[0262] A suitable intracellular signaling domain can be an ITAM motif-containing portion that is derived from a polypeptide that contains an ITAM motif. For example, a suitable intracellular signaling domain can be an ITAM motif-containing domain from any ITAM motif-containing protein. Thus, a suitable intracellular signaling domain need not contain the entire sequence of the entire protein from which it is derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fc epsilon receptor I gamma chain) , CD3D (CD3 delta) , CD3E (CD3 epsilon) , CD3G (CD3 gamma) , CD3Z (CD3 zeta) , and CD79A (antigen receptor complex-associated protein alpha chain) . In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX-activation protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor associated protein; killer-activating receptor-associated protein; etc. ) . In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fc epsilon receptor I gamma chain; Fc receptor gamma-chain; fc-epsilon RI-gamma; FcRgamma; FcεRI gamma; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc. ) . In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide; OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc. ) . In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 epsilon chain (also known as CD3ε, T-cell surface antigen T3 / Leu-4  epsilon chain, T-cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3epsilon, T3e, etc. ) . In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide, etc. ) . In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 zeta chain (also known as CD3Z, T-cell receptor T3 zeta chain, CD247, CD3-ZETA, CD3H, CD3Q, T3Z, TCRZ, etc. ) . In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-associated alpha) ; MB-1 membrane glycoprotein; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc. ) . In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes a cytoplasmic signaling domain of human CD3 zeta. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire molecule. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion can be used in place of the intact chain as long as it transduces the effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.

[0263] The intracellular domains described herein can be combined with any of the antigen-binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in the CAR.

[0264] In certain embodiments, the intracellular domain comprises a costimulatory domain of CD28. In certain embodiments, the intracellular domain comprises a costimulatory domain of 4-1BB. In certain embodiments, the intracellular domain comprises an intracellular domain of CD3 zeta or a variant thereof. In certain embodiments, the intracellular domain comprises a costimulatory domain of 4-1BB and an intracellular domain of CD3 zeta. In certain embodiments, the intracellular domain comprises a costimulatory domain of CD28 and an intracellular domain of CD3 zeta.

[0265] Tolerable variations of the individual CAR domain sequences (leader, antigen-binding domain, hinge, transmembrane, and / or intracellular domains) will be known to those of skill in the art. For example, in certain embodiments the CAR domain comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least  94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any naturally occurring or known sequence.

[0266] In some embodiments, compositions disclosed herein comprise a CAR comprising a tumor antigen-binding domain, a transmembrane domain, and an intracellular domain. In certain embodiments, the CAR comprises an anti-CD19 antigen-binding domain, a transmembrane domain, a CD28 costimulatory domain, and a CD3ζ intracellular domain. In certain embodiments, the CAR comprises an anti-CD19 antigen-binding domain, a transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ intracellular domain. In certain embodiments, the CAR comprises an anti-BCMA antigen-binding domain, a transmembrane domain, a CD28 costimulatory domain, and a CD3ζ intracellular domain. In certain embodiments, the CAR comprises an anti-BCMA antigen-binding domain, a transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ intracellular domain.

[0267] In some embodiments, the CAR is the CAR comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 61-67. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 61. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 62. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 63. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 64. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 65. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 66. In some embodiments, the CAR has the amino acid sequence that is at least 85%, at  least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identical to SEQ ID NO: 67.

[0268] For illustrative purposes, in some embodiments, the AAV viral genome comprises an ITR region, a promoter, a nucleic acid having a transgene encoding a CAR, a polyA signal region, or a combination thereof. The AAV viral genome can further comprise an enhancer, an intron, or a spacer, or any combination thereof.

[0269] CD64 / CD16A Chimera

[0270] The AAV particle conjugates disclosed herein can be used for T cell targeted delivery of transgenes of interest. In some embodiments, the transgene of interest is a chimeric Fc receptor, specifically, a CD64 / CD16A chimera, and the expression of the CD64 / CD16A chimera in T cells confer on their T cells antibody-dependent cellular cytotoxicity (ADCC) , as well as their potency in cancer therapy.

[0271] Humans express three classes of FcγRs: FcγRI (CD64) , FcγRII (CD32) , and FcγRIII (CD16) . CD16A is an IgG Fc receptor expressed by human natural killer (NK) cells and is their sole means of recognizing IgG bound to tumor cells or virus-infected cells. CD16A is a potent activating receptor that induces ADCC by NK cells. The CD16A transmembrane region is responsible for the association with CD3ζ and / or FcγR that contain immunoreceptor tyrosine-based activation motifs, and the CD16A cytoplasmic domain interacts with intracellular molecules critical for receptor functions. CD16A undergoes a rapid downregulation in expression upon cell activation that markedly reduces its cell surface density and avidity for IgG. CD16A downregulation occurs by a proteolytic event at an extracellular site proximal to the plasma membrane and is referred to as ectodomain shedding (Jing et al., 2015. PLoS One 10: e0121788) . An exemplary sequence of human CD16A is provided in Table 4 below. Human CD16A comprises an extracellular domain (amino acid 17-208 of SEQ ID NO: 71) , a transmembrane domain (amino acids 209-229 of SEQ ID NO: 71) and a cytoplasmic domain (amino acid 230-254 of SEQ ID NO: 71) .

[0272] CD64 is another IgG Fc receptor and is expressed by monocytes, macrophages, and activated neutrophils. CD64 is a high affinity IgG receptor. This receptor does not undergo ectodomain shedding upon cell activation and does not naturally transduce signals for ADCC in NK cells. An exemplary sequence of human CD64 is provided in Table 4 below. Human CD64 comprises an extracellular domain (amino acids 16-292 of SEQ ID NO: 72) , a transmembrane domain (amino acids 293-313 of SEQ ID NO: 72) and a cytoplasmic domain (amino acids 314-374 of SEQ ID NO: 72) .

[0273] Provided herein are chimeric Fc receptors that include the extracellular region of human CD64 and the cytoplasmic region of human CD16A ( “CD64 / CD16A chimera) , which are not susceptible to ectodomain shedding due to the lack of the CD16A extracellular cleavage site. The CD64 / CD16A chimera can also include the CD64 transmembrane region or the CD16A transmembrane region.

[0274] Table 4: Sequence regions for CD16A, CD64, and CD64 / CD16A chimeras

[0275] In some embodiments, the CD64 / CD16A chimera to be expressed in T cells using methods disclosed herein comprises, an extracellular domain comprising the CD64 extracellular domain (amino acids 1-292 of SEQ ID NO: 72) or a functional variant thereof; a transmembrane domain; and an intracellular domain comprising the CD16A intracellular domain (amino acid 230-254 of SEQ ID NO: 71) or a functional variant thereof.

[0276] In some embodiments, the extracellular domain of the CD64 / CD16A chimera comprises the CD64 extracellular domain (amino acids 1-292 of SEQ ID NO: 72) . In some embodiments, the extracellular domain of the CD64 / CD16A chimera comprises a variant of the CD64 extracellular domain (amino acids 1-292 of SEQ ID NO: 72) that retains its binding to an IgG Fc region. II to  amino acids 1-292 of SEQ ID NO: 72. In some embodiments, the functional variant of the CD64 extracellular domain can be a truncated version of the CD64 extracellular domain. For example, in some embodiments, the functional variant of the CD64 extracellular domain can have amino acids 1-282 of SEQ ID NO: 72. In some embodiments, the extracellular domain comprises the ADAM17 cleavage region of CD16A, i.e., S196 of SEQ ID NO: 71. In some embodiments, the extracellular domain comprises amino acids 193-208 of SEQ ID NO: 71.

[0277] In some embodiments, the intracellular domain of the CD64 / CD16A chimera comprises the CD16A intracellular domain (amino acid 230-254 of SEQ ID NO: 71) . In some embodiments, the intracellular domain of the CD64 / CD16A chimera comprises a functional variant of CD16A intracellular domain that retains its function to initiate cell signaling when an IgG Fc region binds to the extracellular domain. In some embodiments, the functional variant of the CD16A intracellular domain can have an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to amino acid 230-254 of SEQ ID NO: 71.

[0278] The CD64 / CD16A chimera disclosed herein can also comprise a transmembrane domain. The transmembrane domain can be the transmembrane domain of CD16A (amino acids 209-229 of SEQ ID NO: 71) or a functional variant thereof. In some embodiments, the transmembrane domain can be the transmembrane domain of CD64 (amino acids 293-313 of SEQ ID NO: 72) or a functional variant thereof.

[0279] In some embodiments, the CD64 / CD16A chimera disclosed herein has an amino acid sequence that is at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%sequence identity to SEQ ID NO: 73. The CD64 / CD16A chimera can have an amino acid sequence that is at least 85%identity of SEQ ID NO: 73. The CD64 / CD16A chimera can have an amino acid sequence that is at least 90%identity of SEQ ID NO: 73. The CD64 / CD16A chimera can have an amino acid sequence that is at least 95%identity of SEQ ID NO: 73. The CD64 / CD16A chimera can have an amino acid sequence that is at least 98%identity of SEQ ID NO: 73. The CD64 / CD16A chimera can have an amino acid sequence that is at least 99%identity of SEQ ID NO: 73. The CD64 / CD16A chimera can have the amino acid sequence of SEQ ID NO: 73.

[0280] For illustrative purposes, in some embodiments, the AAV viral genome comprises an ITR region, a promoter, a nucleic acid having a transgene encoding a CD64 / CD16A chimera, a polyA signal region, or a combination thereof. The AAV viral genome can further comprise an enhancer, an intron, or a spacer, or any combination thereof.

[0281] In some embodiments, methods described herein involving using T cells genetically engineered to express a CD64 / CD16A chimera in the treatment of cancer can be used in combination with a therapeutic antibody. The CD64 / CD16A chimera is deployed in conjunction with therapeutic antibodies to augment the potency of antibody-based immunotherapies. In the context of cancer immunotherapy, for instance, a therapeutic antibody is formulated to recognize and bind to a particular tumor antigen. The CD64 / CD16A chimera, when expressed on T cells, interfaces with the Fc region of the therapeutic antibody. This interaction precipitates the activation of T cells, resulting in a more robust and precise elimination of target cancer cells. This mechanism of action amplifies ADCC, thereby enhancing the therapeutic antibody’s efficacy in the eradication of the designated cellular targets.

[0282] 6.3 Methods of production

[0283] The AAV particles disclosed herein can be prepared using any methods known in the art. For example, known strategies that provide for packaging nucleotides of interest that exceed the packaging capacity of an individual AAV can be adopted. Such strategies include, but are not limited to dual-vector strategies that exploit ITR-mediated recombination to express genes of interest that are larger than a wildtype AAV genome by way of transcript splicing across intermolecularly recombined ITRs from two complementary vector genomes, vector recombination by homology, RNA trans-splicing, and / or protein “trans-splicing” via split intein designs. See, e.g., Nakai et al. (2000) Nat. BiotechnoL 18: 527-532; Sun (2000) Nat. Med. 6: 599-602 (2000) ; Ghosh et al. (2008) Mol. Ther. 16: 124-130 (2008) ; Lai (2005) Nat. BiotechnoL 23: 1435-1439; Chew et al. (2016) Nat. Methods 13: 868-874; Li (2008) Hum. Gene Ther. 19: 958-964.

[0284] Dual AAV vector strategies to transfer of a large gene into target cells have been described, which rely on different mechanisms including, but not limited to, trans-splicing, including overlapping regions in the dual vectors, and a hybrid of the two. Tomabene and Trapani (2020) Human Gene Ther. 31: 47-56; see also U.S. Patent No. 8,236,557. A trans-splicing approach takes advantage of the ability of AAV ITR sequences to concatemerized to reconstitute full-length genomes, wherein each of two or more viral capsids respectively encapsulate one of two or more transfer plasmids, each of which transfer plasmid comprises a portion of the gene of interest. For example, in a dual vector approach, the two transfer plasmids may be designed as follows: the 5’-transfer plasmid comprises the promoter, the 5’ portion of the coding sequence of the gene of interest, and a splicing donor (SD) signal; the 3’-transfer plasmid comprise a splicing acceptor (SA) signal, the 3’ portion of the gene of interest, and the polyA signal. Upon tail-to-head ITR-mediated  concatemerization of the two AAV genomes, the SD and SA signals will allow splicing of the recombined genome.

[0285] A large gene of interest is also split when taking an overlapping region approach. In the overlapping region approach, the 5’ and 3’ portions (and thus the 5’ transfer plasmid and 3’ transfer plasmid) share a recombinogenic sequence, e.g., region of homology, e.g., each portion comprises an overlapping sequence. The gene of interest is made whole in a targeted cell via homologous recombination mediated by the recombinogenic sequence, e.g., homology / overlapping region.

[0286] In a hybrid approach, the 5’-transfer plasmid and 3’-transfer plasmid each comprise a highly recombinogenic sequence, wherein the recombinogenic sequence is placed downstream of an SD signal of a 5’ portion of the coding sequence of the gene of interest and upstream of an SA signal of a 3’ portion of the coding sequence of the gene of interest. In this hybrid system, the gene of interest may be made whole either via ITR-mediated concatemerization and splicing and / or by homologous recombination.

[0287] Trans-splicing at the RNA or protein levels can also be utilized. In an RNA trans-splicing approach, two transfer plasmids may respectively encode for 5’ and 3’ fragments of the pre-mRNA of a large gene and share an intronic hybridization domain that can favor trans-splicing, leading to joining of the two half-transcripts into an intact full-length mRNA.

[0288] Protein trans-splicing occurs post-translationally and is catalyzed by intervening proteins called split-inteins. Split-inteins are expressed as two independent polypeptides (N-intein and C-intein) at the extremities of two host proteins. The N-intein and C-intein polypeptides remain catalytically inactive until they encounter each other. Upon encountering each other, each intein precisely excises itself from the host protein while mediating ligation of the N-and C-host polypeptides via a peptide bond. Split-intein use has been used in AAV-based delivery of therapeutic geens of interest in muscle, liver, and retinal diseases. For example, on co-delivery of two halves of the mini-dystrophin cDNA fused to N-and C-intein coding sequences, efficient production of the two polypeptides was shown. Li et al. (2008) Hum Gene Ther 19: 958-64.

[0289] The dual vector approaches are well-known in the art. Thus, in some embodiments, amodified viral capsid described herein encapsulates a nucleic acid comprising a portion of a gene of interest. In some embodiments, the nucleic acid comprising a portion of a gene of interest further comprises a splicing donor signal or a splicing acceptor signal and / or a recombinogenic sequence. In some embodiments, the nucleic acid comprising a portion of a gene of interest comprises an intronic hybridization domain encoding sequence. In some embodiments, the nucleic acid comprising a portion of a gene of interest comprises a N-intein or C-intein encoding sequence.

[0290] Design of the transfer plasmid / nucleotide of interest includes including one or more regulatory elements, e.g., promoter and / or enhancer elements, that control expression of the gene of interest. Non-limiting examples of useful promoters include, e.g., cytomegalovirus (CMV) -promoter, the spleen focus forming virus (SFFV) -promoter, the elongation factor 1 alpha (EFla) -promoter (the 1.2 kb EF1a-promoter or the 0.2 kb EF1a-promoter) , the chimeric EF 1a / IF4-promoter, and the phospho-glycerate kinase (PGK) -promoter. An internal enhancer can also be present in the viral construct to increase expression of the gene of interest. For example, the CMV enhancer (Karasuyama et al. 1989. J. Exp. Med. 169: 13, which is incorporated herein by reference in its entirety) may be used. In some embodiments, the CMV enhancer can be used in combination with the chicken P-actin promoter. In some embodiments, tissue specific regulatory elements, e.g., amuscle specific promoter and / or regulatory element may be used to drive the expression of the gene of interest. For example, the use of muscle-specific regulatory elements based on the muscle creatine kinase gene has been employed for muscle gene therapy treatments, such as Duchenne muscular dystrophy (DMD) and limb-girdle muscular dystrophy (LGMD) . See, e.g., Salva et al. (2007) Mol. Ther. 15: 320-329, incorporated herein in its entirety by reference. In some embodiments, a transfer plasmid and / or nucleotide of interest herein comprises an enhancer and / or promoter of muscle creatine kinase (MCK) , wherein the enhancer and / or promoter of MCK drives expression of the gene of interest. In some embodiments, a transfer plasmid and / or nucleotide of interest herein comprises an enhancer and / or promoter element that recruits RNA Polymerase II, wherein the enhancer and / or promoter of MCK drives expression of the gene of interest. In some embodiments, a transfer plasmid and / or nucleotide of interest herein comprises an enhancer and / or promoter element that recruits RNA Polymerase III, wherein the enhancer and / or promoter of MCK drives expression of the gene of interest.

[0291] In some embodiments, bidirectional promoters vectors have also been employed for delivery of dual therapeutic gene cassettes. An example of this is the bidirectional chicken P-actin ubiquitous promoter that drives the simultaneous expression of the hexosaminidase a-and P-subunits of the HexA enzyme, the two respective genes involved in Tay-Sachs and Sandhoff diseases. Lahey, et al. (2020) Mol. Ther. 28: 2150-2160, incorporated herein in its entirety by reference. In some embodiments, a transfer plasmid and / or nucleotide of interest herein comprises a bidirectional promoter, wherein the bidirectional promoter drives the expression of two different genes of interest.

[0292] In addition to the transgene that encodes a CAR or a CD64 / CD16A chimera, a variety of reporter genes (or detectable moieties) can be encapsidated in a multimeric structure comprising the modified viral capsid proteins described herein. Exemplary reporter genes include, for example, P- galactosidase (encoded lacZ gene) , Green Fluorescent Protein (GFP) , enhanced Green Fluorescent Protein (eGFP) , MmGFP, blue fluorescent protein (BFP) , enhanced blue fluorescent protein (eBFP) , mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed, mOrange, mKO, mCitrine, Venus, YPet, yellow fluorescent protein (YFP) , enhanced yellow fluorescent protein (eYFP) , Emerald, CyPet, cyan fluorescent protein (CFP) , Cerulean, T-Sapphire, luciferase, alkaline phosphatase, or a combination thereof. The methods described herein demonstrate the construction of targeting particles that employ the use of a reporter gene that encodes green fluorescent protein, however, persons of skill upon reading this disclosure will understand that the viral capsids described herein can be generated in the absence of a reporter gene or with any reporter gene known in the art.

[0293] Provided here are also methods for the preparation of a modified capsid protein, comprising the steps of: a) expressing a nucleic acid encoding the modified capsid protein under suitable conditions, and b) isolating the expressed capsid protein of step a) .

[0294] In some embodiments, a viral particle as described herein comprises a mosaic capsid, e.g., a capsid comprising capsid proteins genetically modified as described herein (in the absence or presence of a covalent bond with a targeting ligand) in a certain ratio with reference capsid proteins. A method for making such a mosaic viral particle comprises a) expressing a nucleic acid encoding the modified capsid protein and a nucleotide encoding a reference capsid protein at a ratio (wt / wt) of at least about 59: 1 to about 1: 59, e.g., 1: 14, 1: 12, 1: 9, 1: 5, 1: 3, etc. under suitable conditions, and b) isolating the expressed capsid protein of step a) .

[0295] Provided here are also methods for the preparation of a cancer targeting AAV particle with modified capsid protein, comprising: (a) inserting a nucleic acid encoding an amino acid sequence into a nucleic acid sequence encoding an viral capsid protein to form a nucleotide sequence encoding a genetically modified capsid protein comprising the amino acid sequence and / or (b) culturing a packaging cell in conditions sufficient for the production of viral particles, wherein the packaging cell comprises the nucleic acid. In some embodiments, methods provided herein comprise the steps of: (a) expressing a nucleic acid encoding a modified viral capsid protein as described herein (and optionally with a nucleotide encoding a reference capsid protein) under suitable conditions, wherein the nucleic acid encodes a capsid protein comprising a first member of a specific binding pair, (b) isolating the expressed capsid protein comprising a first member of a specific binding pair of step (a) or capsid comprising same, and (c) incubating the capsid protein or capsid with second member of the binding pair under conditions suitable for allowing the formation of an isopeptide bond between the first and second member, wherein the second member of the specific binding pair is linked to an antibody or antigen-binding fragment that specifically binds to a tumor antigen.

[0296] Provided here are also methods for the preparation of a T cell targeting AAV particle with modified capsid protein, comprising: (a) inserting a nucleic acid encoding an amino acid sequence into a nucleic acid sequence encoding an viral capsid protein to form a nucleotide sequence encoding a genetically modified capsid protein comprising the amino acid sequence and / or (b) culturing a packaging cell in conditions sufficient for the production of viral particles, wherein the packaging cell comprises the nucleic acid. In some embodiments, methods provided herein comprise the steps of: (a) expressing a nucleic acid encoding a modified viral capsid protein as described herein (and optionally with a nucleotide encoding a reference capsid protein) under suitable conditions, wherein the nucleic acid encodes a capsid protein comprising a first member of a specific binding pair, (b) isolating the expressed capsid protein comprising a first member of a specific binding pair of step (a) or capsid comprising same, and (c) incubating the capsid protein or capsid with second member of the binding pair under conditions suitable for allowing the formation of an isopeptide bond between the first and second member, wherein the second member of the specific binding pair is linked to an antibody or antigen-binding fragment that specifically binds to a T cell antigen.

[0297] In some embodiments, the packaging cell further comprises a helper plasmid and / or a transfer plasmid comprising a nucleic acid encoding a transgene of interest. In some embodiments, the methods further comprise isolating self-complementary AAV particles from culture supernatant. In some embodiments, the methods further comprise lysing the packaging cell and isolating single-stranded AAV particles from the cell lysate. In some embodiments, the methods further comprise (a) clearing cell debris, (b) treating the supernatant containing viral particles with nucleases, e.g., DNase I and MgCL, (c) concentrating viral particles, (d) purifying the viral particles, and (e) any combination of (a) - (d) .

[0298] Packaging cells useful for production of the viral particles described herein include, e.g., animal cells permissive for the virus, or cells modified to be permissive for the virus; or the packaging cell construct, for example, with the use of a transformation agent such as calcium phosphate. Non-limiting examples of packaging cell lines useful for producing viral particles described herein include, e.g., human embryonic kidney 293 (HEK-293) cells (e.g., ATCC No. CRL-1573) , HEK-293 cells that contain the SV40 Large T-antigen (HEK-293T or 293T) , HEK293T / 17 cells, human sarcoma cell line HT-1080 (CCL-121) , lymphoblast-like cell line Raji (CCL-86) , glioblastoma-astrocytoma epithelial-like cell line U87-MG (HTB-14) , T-lymphoma cell line HuT78 (TIB-161) , NIH / 3T3 cells, Chinese Hamster Ovary cells (CHO) (e.g., ATCC Nos. CRL9618, CCL61, CRL9096) , HeLa cells (e.g., ATCC No. CCL-2) , Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658) , Huh-7 cells, BHK cells (e.g., ATCC No. CCL10) , PC12 cells (ATCC No.  CRL1721) , COS cells, COS-7 cells (ATCC No. CRL1651) , RATI cells, mouse L cells (ATCC No. CCLI. 3) , HLHepG2 cells, CAP cells, CAP-T cells, and the like, L929 cells, the FLY viral packaging cell system outlined in Cosset et al (1995) J Virol 69, 7430-7436, NS0 (murine myeloma) cells, human amniocytic cells (e.g., CAP, CAP-T) , yeast cells (including, but not limited to, S. cerevisiae, Pichia pastoris) , plant cells (including, but not limited to, Tobacco NT1, BY-2) , insect cells (including but not limited to SF9, S2, SF21, Tni (e.g. High 5) ) or bacterial cells (including, but not limited to, E. coli) . Additional packaging cells and systems, packaging techniques and particles for packaging the nucleic acid genome into the pseudotyped viral particle are also known in the art, see for example, Polo, et al, Proc Natl Acad Sci USA, (1999) 96: 4598-4603. Methods of packaging include using packaging cells that permanently express the viral components, or by transiently transfecting cells with plasmids.

[0299] In some embodiments, methods provided herein comprise contacting an AAV particle having a modified capsid protein as described herein with the antibody or antigen-binding fragment that specifically binds to a tumor antigen in conditions sufficient to form an antibody-conjugated AAV particle, e.g., under conditions sufficient to promote association of the first member, which is linked to the modified capsid and the second member, which is linked the antibody or antigen binding fragment by, e.g., covalent binding and / or non-covalent binding. In some embodiments, the capsid protein of the AAV particle is linked to a first member of a binding pair (e.g., SpyCatcher003) either directly or via a peptide linker, and the antibody or antigen-binding fragment that specifically binds to a tumor antigen (e.g., FRα) is linked to a first member of a binding pair (e.g., SpyTag003) either directly or via a peptide linker. Provided herein are methods of mixing the AAV particle and the antibody or antigen-binding fragment under conditions sufficient to promote association of the first and the second members. The formation of the tumor targeting AAV particles, or the antibody conjugated AAV particles by the association of the first and second members can be performed according to well-known methods.

[0300] In some embodiments, methods provided herein comprise contacting an AAV particle having a modified capsid protein as described herein with the antibody or antigen-binding fragment that specifically binds to a T cell antigen in conditions sufficient to form an antibody-conjugated AAV particle, e.g., under conditions sufficient to promote association of the first member, which is linked to the modified capsid and the second member, which is linked the antibody or antigen binding fragment by, e.g., covalent binding and / or non-covalent binding. In some embodiments, the capsid protein of the AAV particle is linked to a first member of a binding pair (e.g., SpyCatcher003) either directly or via a peptide linker, and the antibody or antigen-binding fragment that specifically  binds to a T cell antigen (e.g., CD3) is linked to a first member of a binding pair (e.g., SpyTag003) either directly or via a peptide linker. Provide herein are methods of mixing the AAV particle and the antibody or antigen-binding fragment under conditions sufficient to promote association of the first and the second members. The formation of the T cell targeting AAV particles, or the antibody conjugated AAV particles by the association of the first and second members can be performed according to well-known methods.

[0301] Further provided herein include methods of redirecting a virus and / or delivering a transgene of interest to a target cell (e.g., cancer cells or T cells) comprising a method for transducing cells in vitro (e.g., ex vivo) or in vivo, including the steps of: contacting the target cell (or a population of cells having the target cell) with antibody conjugated AAV particles described herein. In some embodiments, the target cell is in vitro (e.g., ex vivo) . In other embodiments, the target cell is in vivo in a subject, e.g., a human.

[0302] In some embodiments, antibody conjugated AAV particles disclosed herein can infect the target cell (e.g., cancer cells or T cells) with higher efficiency, namely, having an enhanced capacity to target and bind the target cell (e.g., cancer cells or T cells) compared to that of a control AAV particle that is unconjugated to an antibody or antigen binding fragment recognizing the target cell. In some embodiments, antibody conjugated AAV particles disclosed herein exhibit a detectable transduction efficiency compared to the undetectable transduction efficiency of a control AAV particle. In some embodiments, antibody conjugated AAV particles disclosed herein exhibit a transduction efficiency that is 10%greater than the transduction efficiency of a control AAV particle. In some embodiments, antibody conjugated AAV particles disclosed herein exhibit a transduction efficiency that is 20%greater, 30%greater, 40%greater, 50%greater, 60%greater, 70%greater, 80%greater, 90%greater, or 99%greater than the transduction efficiency of a control AAV particle. In some embodiments, antibody conjugated AAV particles disclosed herein exhibit a transduction efficiency that is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70-fold greater, at least 80-fold greater, at least 90-fold greater, or at least 100-fold greater than the transduction efficiency of a control AAV particle.

[0303] 6.4 Pharmaceutical Compositions

[0304] The present disclosure also provides pharmaceutical compositions for delivering a transgene (e.g., a cytokine, a CAR or a CD64 / CD16 chimera) described herein to a subject, including a human subject. In some embodiments, the composition comprises any of the AAV particles or AAV viral  genomes described herein. In some embodiments, pharmaceutical compositions disclosed herein comprise any AAV genome or AAV particle disclosed herein and one or more pharmaceutically acceptable carrier.

[0305] Although the descriptions of pharmaceutical compositions provided herein, e.g., AAV particles or viral genomes comprising a transgene to be delivered, are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0306] In some embodiments, compositions are to be administered to humans.

[0307] Pharmaceutical composition in accordance with the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. Examples of a unit dose form include an ampoule, a vial, a prefilled syringe, or a cartridge.

[0308] The pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single-or multi-dose unit.

[0309] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered.

[0310] The AAV particles of the disclosure can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types) ; (5) increase the translation of encoded protein in vivo; (6) alter the release profile of encoded protein in vivo and / or (7) allow for regulatable expression of the payload.

[0311] The pharmaceutical compositions of the present disclosure can include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject) , nanoparticle mimics and combinations thereof. Further, the viral vectors of the present disclosure can be formulated using self-assembled nucleic acid nanoparticles.

[0312] The pharmaceutical compositions of the disclosure can include one or more excipients, each in an amount that together increases the stability of the AAV particle, increases cell transfection or transduction by the viral particle, increases the expression of viral particle encoded protein, and / or alters the release profile of AAV particle encoded proteins. In some embodiments, a pharmaceutically acceptable excipient can be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%pure. In some embodiments, an excipient is approved for use for humans and for veterinary use.

[0313] Excipients, which, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, 21st Edition, A.R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006; the contents of which are herein incorporated by reference in their entirety) . The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component (s) of the pharmaceutical composition.

[0314] The pharmaceutical compositions of AAV particles disclosed herein can include cations or anions. In some embodiments, the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+, or combinations thereof. In some embodiments, the pharmaceutical compositions can include polymers or polynucleotides complexed with a metal cation (see, e.g., U.S. Pat. Nos.  6,265,389 and 6,555,525, the contents of each of which are herein incorporated by reference in their entirety) .

[0315] In some embodiments, the pharmaceutical compositions provided herein are liquid compositions. In some embodiments, the pharmaceutical compositions are frozen compositions. In some embodiments, the pharmaceutical compositions are lyophilized compositions or reconstituted lyophilized compositions. In some embodiments, the pharmaceutical compositions provided herein can be formulated in various dosage forms for administration, such as intra-articular administration.

[0316] 6.5 Methods and Uses

[0317] The compositions provided herein (e.g., the antibody conjugated AAV particles disclosed herein) can be used for expressing transgenes of interest in target cells (e.g., tumor cells or T cells) . The method of delivering the AAV particle to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo. In some embodiments, provided herein are methods of delivering a transgene of interest to a target cell comprising contacting the target cell with the compositions disclosed herein. In some embodiments, the contacting is performed in vitro or ex vivo. In some embodiments, the contacting is performed in vivo.

[0318] In some embodiments, the present disclosure provides a method of delivering the above-described AAV particles to tumor cells, comprising contacting the cell with the AAV particles or contacting the cell with any of the described compositions, including pharmaceutical compositions comprising the AAV particles. In some embodiments, the AAV particles comprise a transgene. In some embodiments, the present disclosure provides administration and / or delivery methods for viral particles disclosed herein (e.g., anti-FRα conjugated AAV particles) that comprise a transgene encoding a cytokine disclosed herein, for the prevention, treatment, or amelioration of diseases or disorders. In some embodiments, the present disclosure provides a method of delivering to a subject, including a mammalian subject, any of the above-described antibody conjugated (e.g., an anti-FRαconjugated) AAV particles comprising administering to the subject such AAV particles, or administering to the subject any of the described compositions, including pharmaceutical compositions comprising such AAV particles. In some embodiments, systemic delivery is desired. In some embodiments, methods provided herein comprise administering the above-described antibody conjugated (e.g., anti-FRα conjugated) AAV particles or pharmaceutical compositions intravenously. In some embodiments, systemic delivery is desired. In some embodiments, methods provided herein comprise administering the above-described AAV particles or pharmaceutical compositions subcutaneously. In some embodiments, local delivery to an area of interest is desired. In some embodiments, the compositions provided herein can be delivered to such an area of interest (e.g., a  tumor) . Provided herein are methods of administration and / or delivery of the AAV particles or pharmaceutical compositions described herein to such an area of interest.

[0319] The present disclosure also provides methods of using the antibody conjugated (e.g., anti-FRα conjugated) AAV particles or pharmaceutical compositions disclosed herein in treating cancer. In some embodiments, provided herein are methods of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the antibody conjugated (e.g., anti-FRα conjugated) AAV particles or pharmaceutical compositions disclosed herein. In some embodiments, provided herein are uses of the antibody conjugated (e.g., anti-FRα conjugated) AAV particles or pharmaceutical compositions disclosed herein in the treatment of cancer. In some embodiments, provided herein are uses of the antibody conjugated (e.g., anti-FRα conjugated) AAV particles or pharmaceutical compositions provided herein for the preparation of a medicament for the treatment of cancer.

[0320] While anti-FRαis provided as an example for tumor cell targeting in this application, it is expressly contemplated that any antibody capable of specifically recognizing and targeting tumor cells can be substituted, including antibodies targeting the tumor antigens disclosed herein. The therapeutic effect in cancer treatment is achieved through the targeted delivery of transgenes encoding therapeutic proteins (e.g., cytokines) , and this effect is independent of the biological function of the surface marker or the specific antibody used for targeting. This allows flexibility in selecting antibodies based on tumor specificity without reliance on the functional role of the surface antigen for the therapeutic outcome.

[0321] In some embodiments, the compositions provided herein (e.g., the antibody conjugated AAV particles disclosed herein) can also be introduced into T cells in intro or in vivo for expressing the transgene. In some embodiments, the present disclosure provides a method of delivering to T cells of the above-described AAV particles, comprising contacting the T cells with the AAV particles or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions comprising the AAV particles. The method of delivering the AAV particle to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo.

[0322] In some embodiments, the T cell to be engineered with methods disclosed herein can be a cytotoxic T cell, a helper T cell, or a gamma delta T, a CD4+ / CD8+double positive T cell, a CD4+T cell, a CD8+T cell, a CD4 / CD8 double negative T cell, a CD3+T cell, a naive T cell, an effector T cell, a cytotoxic T cell, a helper T cell, a memory T cell, a regulator T cell, a Th0 cell, a Th1 cell, a Th2 cell, a Th3 (Treg) cell, a Th9 cell, a Th17 cell, a Thαβhelper cell, a Tfh cell, a stem memory TSCM cell, a central memory TCM cell, an effector memory TEM cell, an effector memory TEMRA  cell, or a gamma delta T cell. In some embodiments, the T cell is a cytotoxic T cell. In some embodiments, the genetically engineered T cells provided herein are isolated. In some embodiments, the genetically engineered T cells provided herein are substantially pure.

[0323] In some embodiments, the T cells to be engineered with methods disclosed herein are derived from cells isolated from a subject. The source cell can be from a natural source. For example, the source cell can be a primary cell isolated from a subject. The subject can be an animal or a human. The source cell can also be a cell that has undergone passages or genetically manipulation in vitro. In some embodiments, the T cells to be engineered with methods disclosed herein are derived from cells isolated from a human. T cells can be obtained from many sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell lines available in the art can be used. In some embodiments, T cells are derived from cells isolated from peripheral blood. In some embodiments, T cells are derived from cells isolated from bone marrow. In some embodiments, T cells are derived from cells isolated from peripheral blood mononuclear cells (PBMC) .

[0324] In some embodiments, the T cells to be engineered with methods disclosed herein are derived from cells differentiated in vitro from a stem or progenitor cell. In some embodiments, the stem or progenitor cell is selected from the group consisting of a T cell progenitor cell, a hematopoietic stem and progenitor cell, a hematopoietic multipotent progenitor cell, an embryonic stem cell, and an induced pluripotent cell. In some embodiments, genetically engineered cells provided herein are derived from cells differentiated in vitro from a T cell progenitor cell. In some embodiments, genetically engineered cells provided herein are derived from cells differentiated in vitro from a hematopoietic stem and progenitor cell. In some embodiments, genetically engineered cells provided herein are derived from cells differentiated in vitro from a hematopoietic multipotent progenitor cell. In some embodiments, genetically engineered cells provided herein are derived from cells differentiated in vitro from an embryonic stem cell. In some embodiments, genetically engineered cells provided herein are derived from cells differentiated in vitro from an induced pluripotent cell.

[0325] In some embodiments, compositions and methods disclosed herein are used in modifying T cells that are mixed within a population of cells. The population of cells can be a homogenous population of cells. The population of cells can be a heterogeneous population of cells. In some embodiments, the population of cells can be a heterogeneous population of cells comprising any combination of the cells disclosed herein. In some embodiments, the population of genetically  engineered cells provided herein are derived from tumor-infiltrating lymphocytes (TIL) . In some embodiments, the population of genetically engineered cells provided herein are derived from peripheral blood mononuclear cells (PBMC) . In some embodiments, the population of genetically engineered cells provided herein are derived from peripheral blood leukocytes (PBL) . In some embodiments, the population of genetically engineered cells provided herein are derived from tumor infiltrating lymphocytes (TIL) . In some embodiments, the population of genetically engineered cells provided herein are derived from marrow infiltrate lymphocytes (MILs) . In some embodiments, the population of genetically engineered cells provided herein are derived from cytokine-induced killer cells (CIK) . In some embodiments, the population of genetically engineered cells provided herein are derived from lymphokine-activated killer cells (LAK) .

[0326] In some embodiments, the present disclosure provides administration and / or delivery methods for viral particles, e.g., anti-CD3 conjugated AAV particles disclosed herein, encoding a CAR transgene or a CD64 / CD16A chimera transgene disclosed herein, for the prevention, treatment, or amelioration of diseases or disorders. In some embodiments, the present disclosure provides a method of delivering to a subject, including a mammalian subject, any of the above-described antibody conjugated (e.g., anti-CD3 conjugated) AAV particles comprising administering to the subject such AAV particles, or administering to the subject any of the described compositions, including pharmaceutical compositions comprising such AAV particles. In some embodiments, systemic delivery is desired. In some embodiments, methods provided herein comprise administering the above-described antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions intravenously. In some embodiments, systemic delivery is desired. In some embodiments, methods provided herein comprise administering the above-described AAV particles or pharmaceutical compositions subcutaneously. In some embodiments, local delivery to an area of interest is desired. In some embodiments, the compositions provided herein can be delivered to such an area of interest (e.g., a tumor) . Provided herein are methods of administration and / or delivery of the AAV particles or pharmaceutical compositions described herein to such an area of interest.

[0327] The present disclosure also provides methods of using the antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions disclosed herein in treating cancer. In some embodiments, provided herein are methods of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions disclosed herein. In some embodiments, provided herein are uses of the antibody conjugated (e.g., anti-CD3 conjugated) AAV  particles or pharmaceutical compositions disclosed herein in treatment of cancer. In some embodiments, provided herein are uses of the antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions provided herein for the preparation of a medicament for the treatment of cancer.

[0328] In some embodiments, methods of treatment provided herein comprise a cell therapy involving genetically engineered T cells. In some embodiments, the T cells are engineered in vitro or ex vivo by methods disclosed herein, i.e., by (1) contacting the T cells with the antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions provided herein under conditions sufficient for the AAV particles to infect the T cells and for the T cells to express the transgenes of interest (CAR or CD64 / CD16A chimera) to express; and (2) administering the modified T cells to a subject in need thereof. In some embodiments, the T cells are engineered in vivo. Accordingly, methods provided herein comprise administering the antibody conjugated (e.g., anti-CD3 conjugated) AAV particles or pharmaceutical compositions provided herein to a subject in need thereof, wherein the T cell-targeted infection by AAV particles and the expression of the transgenes of interest takes place inside the subject.

[0329] Actual dosage levels of the active ingredients (i.e., the genetically engineered T cells or the antibody conjugated AAV particles) to be used in methods described herein can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions described herein, the route of administration, the time of administration, the rate of excretion, the duration of the treatment, other drugs, compounds and / or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. In addition, the dose can also be adjusted to account for whether a single dose is being administered or whether multiple doses are being administered.

[0330] Cancers or tumors to be treated using the fusion proteins, cells, or pharmaceutical compositions provided herein comprise cancers typically responsive to immunotherapy. In some embodiments, cancers or tumors that can be treated with the AAV particles, cells, or pharmaceutical compositions disclosed herein are solid tumors. In some embodiments, cancers or tumors that can be treated with the fusion proteins, cells, or pharmaceutical compositions disclosed herein are hematological cancers. In cancer treatment, eliminating cancer or tumor cells in a subject can occur, but any clinical improvement constitutes a benefit. An anti-tumor effect can be manifested by a  decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or amelioration of various physiological symptoms associated with the cancerous condition. An anti-tumor effect can also be manifested by the ability of the cells or pharmaceutical compositions provided herein in prevention of the occurrence of tumor in the first place. In some embodiments, an “anti-tumor effect” can be manifested by the reduction in cancer-induced immunosuppression. Clinical improvement comprises decreased risk or rate of progression or reduction in pathological consequences of the cancer or tumor. It is also understood that a method of treating cancer can include any effect that ameliorates a sign or symptom associated with cancer. Such signs or symptoms include, but are not limited to, reducing tumor burden, including inhibiting growth of a tumor, slowing the growth rate of a tumor, reducing the size of a tumor, reducing the number of tumors, eliminating a tumor, all of which can be measured using routine tumor imaging techniques well known in the art. Other signs or symptoms associated with cancer include, but are not limited to, fatigue, pain, weight loss, and other signs or symptoms associated with various cancers.

[0331] 6.6 Exemplified embodiments

[0332] Embodiment 1. A composition comprising (1) a recombinant AAV particle comprising a capsid protein linked to a protein catcher, and (2) a protein tag that can be linked to an antibody or antigen-binding fragment that specifically binds to a surface antigen of a target cell.

[0333] Embodiment 2. The composition of Embodiment 1, wherein the protein tag is linked to the antibody or antigen-binding fragment.

[0334] Embodiment 3. The composition of Embodiment 1 or 2, wherein the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length.

[0335] Embodiment 4. The composition of Embodiment 3, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.

[0336] Embodiment 5. The composition of Embodiment 3, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.

[0337] Embodiment 6. The composition of any one of Embodiments 3 to 5, wherein the protein tag ranges from about 10 to about 30 amino acids in length.

[0338] Embodiment 7. The composition of Embodiment 1, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively;  SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.

[0339] Embodiment 8. The composition of Embodiment 7, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.

[0340] Embodiment 9. The composition of any one of Embodiments 1 to 8, wherein the target cell is a T cell.

[0341] Embodiment 10. The composition of any one of Embodiments 1 to 8, wherein the target cell is a tumor cell.

[0342] Embodiment 11. The composition of Embodiment 10, wherein the tumor cell surface antigen is CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα or NY-ESO-1.

[0343] Embodiment 12. The composition of any one of Embodiments 1 to 11, wherein the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .

[0344] Embodiment 13. The composition of any one of Embodiments 1 to 12, wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.

[0345] Embodiment 14. The composition of any one of Embodiments 1 to 13, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.

[0346] Embodiment 15. The composition of Embodiment 14, wherein the AAV is AAV9.

[0347] Embodiment 16. The composition of Embodiment 14, wherein the AAV is AAV6.

[0348] Embodiment 17. The composition of Embodiment 15 or 16, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0349] Embodiment 18. The composition of Embodiment 15 or 16, wherein the protein catcher is inserted at the N-terminus of the VP2 capsid protein.

[0350] Embodiment 19. The composition of Embodiment 15 or 16, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0351] Embodiment 20. The composition of any one of Embodiments 1 to 19, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.

[0352] Embodiment 21. The composition of Embodiment 20, wherein the transgene of interest is a gene encoding a therapeutic protein, a nucleotide encoding an antibody or fragment thereof, a nucleotide encoding a CRISPR / Cas system or portion (s) thereof, a nucleotide encoding antisense RNA, a nucleotide encoding shRNA, a nucleotide encoding a miRNA, or a suicide gene.

[0353] Embodiment 22. A kit comprising the composition of any one of Embodiments 1 to 21, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.

[0354] Embodiment 23. The composition of any one of Embodiments 1 to 21, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0355] Embodiment 24. The composition of Embodiment 23 further comprising a pharmaceutically acceptable carrier.

[0356] Embodiment 25. A method of preparing an AAV conjugate targeted to a cell comprising incubating the composition of any one of Embodiments 1 to 21 under a condition that allows the binding of the first member and the second member.

[0357] Embodiment 26. A method of delivering a transgene of interest to a target cell comprising contacting the target cell with the composition of Embodiment 20 or 21.

[0358] Embodiment 27. The method of Embodiment 26, wherein the contacting is performed in vitro or ex vivo.

[0359] Embodiment 28. A method of delivering a transgene to a target cell of a subject in need thereof, comprising administering an effective amount of the composition of Embodiment 20 or 21 to the subject.

[0360] Embodiment 29. The method of Embodiment 28, wherein the subject is a human.

[0361] Embodiment 30. Use of the composition of Embodiment 20 or 21 in delivering a transgene of interest to a target cell.

[0362] Embodiment 31. A composition comprising (1) a recombinant Adeno-Associated Virus (AAV) particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a tumor antigen.

[0363] Embodiment 32. The composition of Embodiment 31, wherein the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .

[0364] Embodiment 33. The composition of Embodiment 31 or 32, wherein the antibody or antigen-binding fragment is an scFv.

[0365] Embodiment 34. The composition of any one of Embodiments 31 to 33, wherein the tumor antigen is CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα or NY-ESO-1.

[0366] Embodiment 35. The composition of Embodiment 34, wherein the tumor antigen is FRα.

[0367] Embodiment 36. The composition of any one of Embodiments 31 to 35, wherein the first member is a protein catcher, and the second member is a peptide tag.

[0368] Embodiment 37. The composition of Embodiment 36, wherein the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length.

[0369] Embodiment 38. The composition of Embodiment 37, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.

[0370] Embodiment 39. The composition of Embodiment 37, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.

[0371] Embodiment 40. The composition of any one of Embodiments 37 to 39, wherein the protein tag ranges from about 10 to about 30 amino acids in length.

[0372] Embodiment 41. The composition of Embodiment 36, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively; SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.

[0373] Embodiment 42. The composition of Embodiment 36, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.

[0374] Embodiment 43. The composition of any one of Embodiments 31 to 42, wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.

[0375] Embodiment 44. The composition of any one of Embodiments 31 to 43, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.

[0376] Embodiment 45. The composition of Embodiment 44, wherein the AAV is AAV9.

[0377] Embodiment 46. The composition of Embodiment 44, wherein the AAV is AAV6.

[0378] Embodiment 47. The composition of Embodiment 45 or 46, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0379] Embodiment 48. The composition of Embodiment 45 or 46, wherein the protein catcher is inserted at the N-terminus of the VP2 capsid protein.

[0380] Embodiment 49. The composition of Embodiment 45 or 46, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0381] Embodiment 50. The composition of Embodiment 49, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1.

[0382] Embodiment 51. The composition of any one of Embodiments 31 to 50, wherein the protein catcher is linked to the capsid protein via a first linker, a second linker, or both.

[0383] Embodiment 52. The composition of any one of Embodiments 31 to 51, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.

[0384] Embodiment 53. The composition of Embodiment 52, wherein the transgene of interest encodes a therapeutic protein, an antibody or fragment thereof, a CRISPR / Cas system or portion (s) thereof, an antisense RNA, a shRNA, a miRNA, or a suicide protein.

[0385] Embodiment 54. The composition of Embodiment 52, wherein the transgene encodes a cytokine.

[0386] Embodiment 55. The composition of Embodiment 54, wherein the cytokine is IL-15 or a variant thereof.

[0387] Embodiment 56. The composition of Embodiment 55, wherein the IL-15 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 35.

[0388] Embodiment 57. The composition of Embodiment 54, wherein the cytokine is IL-12p35 or a variant thereof.

[0389] Embodiment 58. The composition of Embodiment 57, wherein the IL-12p35 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 32.

[0390] Embodiment 59. The composition of Embodiment 54, wherein the cytokine is IL-12p40 or a variant thereof.

[0391] Embodiment 60. The composition of Embodiment 59, wherein the IL-12p40 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 33.

[0392] Embodiment 61. The composition of Embodiment 54, wherein the cytokine is a fusion protein comprising IL-12p40 or a variant thereof, and IL-12p35 or a variant thereof.

[0393] Embodiment 62. The composition of Embodiment 61, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 34.

[0394] Embodiment 63. The composition of Embodiment 54, wherein the cytokine is mIL-12 or a variant thereof.

[0395] Embodiment 64. The composition of Embodiment 63, wherein the mIL-12 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 60.

[0396] Embodiment 65. The composition of Embodiment 54, wherein the cytokine is a fusion protein comprising IL-15 or a variant thereof, and IL-12p35 or a variant thereof.

[0397] Embodiment 66. The composition of Embodiment 65, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 36.

[0398] Embodiment 67. The composition of Embodiment 65, wherein the fusion protein further comprises IL-12p40 or a variant thereof.

[0399] Embodiment 68. The composition of Embodiment 67, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 37.

[0400] Embodiment 69. A kit comprising the composition of any one of Embodiments 31 to 68, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.

[0401] Embodiment 70. The composition of any one of Embodiments 31 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0402] Embodiment 71. The composition of any one of Embodiments 52 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0403] Embodiment 72. The composition of any one of Embodiments 53 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0404] Embodiment 73. The composition of Embodiment 72 further comprising a pharmaceutically acceptable carrier.

[0405] Embodiment 74. A method of preparing a cancer targeting AAV conjugate comprising incubating the composition of any one of Embodiments 31 to 68 under a condition that allows the binding of the first member and the second member.

[0406] Embodiment 75. A method of delivering a transgene of interest to a cancer cell comprising contacting the cancer cell with the composition of Embodiment 71.

[0407] Embodiment 76. The method of Embodiment 75, wherein the contacting is performed in vitro or ex vivo.

[0408] Embodiment 77. A method of delivering a transgene to cancer cells of a subject in need thereof, comprising administering an effective amount of the composition of Embodiment 71 to the subject.

[0409] Embodiment 78. A method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of the composition of Embodiment 72 to the subject.

[0410] Embodiment 79. The method of Embodiment 77 or 78, wherein the subject is a human.

[0411] Embodiment 80. Use of the composition of Embodiment 71 in delivering a transgene of interest to a cancer cell.

[0412] Embodiment 81. Use of the composition of Embodiment 72 in treating cancer.

[0413] Embodiment 82. Use of the composition of Embodiment 72 in the manufacture of a medicament for treating cancer.

[0414] Embodiment 83. A composition comprising (1) a recombinant AAV particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a T cell-specific surface protein.

[0415] Embodiment 84. The composition of Embodiment 83, wherein the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .

[0416] Embodiment 85. The composition of Embodiment 83 or 84, wherein the antibody or antigen-binding fragment is an scFv.

[0417] Embodiment 86. The composition of any one of Embodiments 83 to 85, wherein the T cell-specific surface protein is CD3, CD4, or CD8.

[0418] Embodiment 87. The composition of Embodiment 86, wherein the T cell-specific surface protein is CD3.

[0419] Embodiment 88. The composition of any one of Embodiments 83 to 87, wherein the first member is a protein catcher, and the second member is a peptide tag.

[0420] Embodiment 89. The composition of Embodiment 88, wherein the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length.

[0421] Embodiment 90. The composition of Embodiment 89, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.

[0422] Embodiment 91. The composition of Embodiment 88, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.

[0423] Embodiment 92. The composition of any one of Embodiments 88 to 91, wherein the protein tag ranges from about 10 to about 30 amino acids in length.

[0424] Embodiment 93. The composition of Embodiment 88, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively; SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.

[0425] Embodiment 94. The composition of Embodiment 88, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.

[0426] Embodiment 95. The composition of any one of Embodiments 83 to 94, wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.

[0427] Embodiment 96. The composition of any one of Embodiments 83 to 95, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.

[0428] Embodiment 97. The composition of Embodiment 96, wherein the AAV is AAV9.

[0429] Embodiment 98. The composition of Embodiment 96, wherein the AAV is AAV6.

[0430] Embodiment 99. The composition of Embodiment 97 or 98, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0431] Embodiment 100. The composition of Embodiment 97 or 98, wherein the protein catcher is inserted at the N-terminus of the VP2 capsid protein.

[0432] Embodiment 101. The composition of Embodiment 97 or 98, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.

[0433] Embodiment 102. The composition of Embodiment 101, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1.

[0434] Embodiment 103. The composition of any one of Embodiments 83 to 102, wherein the protein catcher is linked to the capsid protein via a first linker, a second linker, or both.

[0435] Embodiment 104. The composition of any one of Embodiments 83 to 103, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.

[0436] Embodiment 105. The composition of Embodiment 104, wherein the transgene encodes a chimeric antigen receptor (CAR) that specifically binds to a tumor antigen.

[0437] Embodiment 106. The composition of Embodiment 105, wherein the tumor antigen is selected from the group consisting of CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα and NY-ESO-1.

[0438] Embodiment 107. The composition of Embodiment 106, wherein the tumor antigen is CD19 or BCMA.

[0439] Embodiment 108. The composition of Embodiment 104, wherein the transgene encodes a CD64 / CD16A chimera.

[0440] Embodiment 109. The composition of Embodiment 108, wherein the CD64 / CD16A chimera comprises an extracellular domain, a transmembrane domain, and an intracellular domain; wherein the extracellular domain comprises the extracellular domain of CD64, or a functional variant thereof, and the intracellular domain contains the intracellular domain of CD16A, or a functional variant thereof; wherein the extracellular domain further comprises a CD16 cleavage site.

[0441] Embodiment 110. A kit comprising the composition of any one of Embodiments 83 to 109, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.

[0442] Embodiment 111. The composition of any one of Embodiments 83 to 109, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0443] Embodiment 112. The composition of any one of Embodiments 104 to 109, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0444] Embodiment 113. The composition of any one of Embodiments 105 to 109, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.

[0445] Embodiment 114. The composition of Embodiment 113 further comprising a pharmaceutically acceptable carrier.

[0446] Embodiment 115. A method of preparing a T-cell targeting AAV conjugate comprising incubating the composition of any one of Embodiments 83 to 109 under a condition that allows the binding of the first member and the second member.

[0447] Embodiment 116. A method of delivering a transgene of interest to a T cell comprising contacting the T cell with the composition of Embodiment 112.

[0448] Embodiment 117. The method of Embodiment 116, wherein the contacting is performed in vitro or ex vivo.

[0449] Embodiment 118. A method of delivering a transgene to T cells of a subject in need thereof, comprising administering an effective amount of the composition of Embodiment 112 to the subject.

[0450] Embodiment 119. A method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of the composition of Embodiment 113 to the subject.

[0451] Embodiment 120. The method of Embodiment 118 or 119, wherein the subject is a human.

[0452] Embodiment 121. Use of the composition of Embodiment 112 in delivering a transgene of interest to a T cell.

[0453] Embodiment 122. Use of the composition of Embodiment 113 in treating cancer.

[0454] Embodiment 123. Use of the composition of Embodiment 113 in the manufacture of a medicament for treating cancer.

[0455] 6.7 Experimental

[0456] The examples provided below are for purposes of illustration only, which are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0457] Briefly, results from the studies described below demonstrate that AAV particles (e.g., AAV9 particles and AAV6 particles) conjugated with scFv specifically targeting cancer cells were redirected to specifically target cancer cells, and exhibited improved safety compared to rAAV particles. Additionally, results from the studies described below also demonstrate that AAV particles (e.g., AAV9 particles and AAV6 particles) conjugated with anti-CD3 scFv were redirected to  specifically target T cells. tAAV: targeted AAV, AAV particles conjugated with antibodies via SpyCatcher / SpyTag paring; rAAV: recombinant AAV particles with unmodified capsids.

[0458] 6.7.1 Example 1: Preparation of antibody conjugated AAV particles

[0459] Preparation of AAV particles with modified capsid proteins: The Ad helper plasmid pAdDeltaF6 and AAV transgene plasmid were provided by Genscript. The protein binder (SpyCatcher or variant) was engineered into surface exposed of regions of AAV capsid, including at VP1-453 of (i.e., the protein catcher replaces amino acids 453-459 of VP1) , VP2-453 (i.e., the protein catcher replaces amino acids 453-459 of VP2) , VP1-588 (inserted between 587 and 588 of VP1) , VP2-588 (inserted between 587 and 588 of VP2) , and N-terminus of VP2.

[0460] AAV vector was produced by tetra-plasmid co-transfection. Briefly, four plasmids (11.5μg of AAV transgene plasmid, 14.3μg of AAV helper plasmid 1 (encoding AAV capsid proteins modified with the protein catcher, e.g., AAV-VP1-453-Spycatcher003, AAV-VP1-588-Spycatcher003, AAV-VP2-453-Spycatcher003, AAV-VP2-588-Spycatcher003 or AAV-Spycatcher003-N-VP2) , 14.3μg of AAV helper plasmid 2 (encoding AAV capsid proteins without modification, e.g., AAV-VP2 / VP3 or AAV-VP1 / VP3) and 22μg of Ad helper plasmid (pAdDeltaF6) and PEI (144μg) were co-transfected into a 15-cm dish of HEK293 cells. After 96 h, HEK293 cells were then harvested, followed by cell lysis and iodixanol gradient ultracentrifuged.

[0461] Preparation of tagged antibodies (anti-FRα and anti-CD3) : The anti-FRα or anti-CD3 scFv linked to the peptide Tag was expressed in CHO S cells. Total plasmids 0.5μg / mL (VH: VL=1: 1) were added into 40μL / mL buffer (OptiPRO SFM, Gibco, Cat#12309019) followed by mixing the transfection buffer (ExpiFectamineTM CHO Transfection Kit, Gibco, Gibco, Cat#A29129, with 36.8 μL / mL OptiPRO SFM) for less than 5 min. The buffer was transferred to the medium (EmCD CHO-S 203 medium, Cat#L20300.1000) of the CHO S cells, and the cells were cultured at 37℃with 8%CO2 for 7 days. The Feed (240μL / mL) and Enhancer (6μL / mL) were added to expression medium after 16-22 h of transfection to feed the CHO S cells. Then, the supernatant of medium was collected, filtered (0.45μm) , and then purified using Protein A column and SP FF with standard protocol. The purification was also performed in Ni column in some parallel experiments.

[0462] Conjugation: The purified AAV particles and the peptide of tagged anti-FRα or anti-CD3 scFv were mixed at ratio of 1: 50 at room temperature overnight to allow conjugation of the AAV particles and the antibody peptide (the “antibody conjugated AAV particle” ) . Then, unbound peptides were eliminated using 100KDa ultrafiltration tubes in 0.1%F68 PBS buffer (18℃, 8,000g ×5 min) .

[0463] 6.7.2 Example 2: Characterization of the antibody conjugated AAV particles

[0464] The antibody conjugated AAV particles were characterized by Western Blot. The proteins at different steps (1.2E10-1.2E11 vg / lane) were incubated in 4x-reducing protein loading buffer (BioRad) at 70℃for 10 min for 4-12%SDS-PAGE.

[0465] For western blotting, anti-AAV VP1 / VP2 / VP3 mouse mAb (Progen, dilution 1: 5, 00) and the HRP-anti-mouse pAb (R&D system) were used. The results were shown by enhanced chemiluminescence in a gel imager (Tanon Science and Technology) .

[0466] As shown, the anti-FRα antibody conjugated AAV particles were formed based on both AAV6 (FIG. 1A) and AAV9 (FIG. 2A) . Similarly, the anti-CD3 antibody conjugated AAV particles were formed based on both AAV9 (FIG. 3 left) and AAV6 (FIG. 3 right) .

[0467] Also as shown in FIG. 5, the antibody conjugated AAV particles were formed based on both AAV6 (left) and AAV9 (right) .

[0468] 6.7.3 Example 3: Characterization of the antibody conjugated AAV particles

[0469] The AAV particles with modified capsid proteins were prepared as described in Example 1, except that Ni column was used in the purification step instead of the Protein A column and SP FF. The titers of Spycather003 modified AAVs were monitored by qPCR, which were comparable to that of rAAV9 (FIG. 5A) .

[0470] The AAV particles, including those modified with SpyCatcher, and those conjugated with antibody were characterized by Western Blot as described in Example 2. As shown in FIG. 5B, AAV9 particles modified with SpyCatcher (FIG. 5B) , anti-CD3 antibody conjugated AAV particles (FIG. 5C) , and anti-FRα antibody conjugated AAV particles (FIG. 5D) were properly formed.

[0471] 6.7.4 Example 4: T cell targeting of antibody conjugated AAV particles

[0472] The targeting effects of the anti-CD3 antibody conjugated AAV particles were measured by FACS. hPBMCs were washed once in T-cell medium (ImmunoCultTM-XF T Cell Expansion Medium, Stemcell, Cat#10981) without IL-2 and then suspended at a concentration of 2E6 / mL in T-cell medium containing IL-2 (200 IU / mL) and 3E6 / mLαCD3 / αCD28 beads (Thermo, Cat#40203D) for stimulation. Cells were incubated in 5%CO2 at 37℃for 72 h until AAV transduction.

[0473] On Day 3, the beads were removed by magnetic stand, T cells were then diluted to 1E6 / mL, 0.5mL / well. The anti-CD3 antibody conjugated AAV particles were added to each well at different MOI ( “Multiplicity of Infection” ) and incubated at 37℃ in the presence of 5%CO2. Fresh media containing 200 IU / mL IL-2 was added for the following transduction, the cells were cultured for 3 days and then analyzed by FACS.

[0474] As shown in FIG. 4, anti-CD3 scFv conjugated AAV9 particles (left) showed>45%infection in T cell while unconjugated AAV9 particles showed<1%infection.

[0475] In a parallel study with the same procedure as described above, the HepaRG (human hepatic cell, ATCC) were also used to test the infection efficiency of the modified AAVs in human hepatic cells. The HepaRG without CD3 were cultured in the medium (DMEM medium+10%FBS) and diluted 48-well-plate at 1E5 cells / mL, 0.5 mL / well. The antibody conjugated AAV particles were then added to each well in different MOIs and incubated at 37℃ in the presence of 5%CO2. The cells were cultured for 2 days, followed by FACS analysis.

[0476] As shown in FIG. 6A, anti-CD3 scFv conjugated AAV9 particles showed>45%infection in CD3+T cell while unconjugated AAV9 particles showed<1%infection. Similarly, as shown in FIG. 6B, anti-CD3 scFv conjugated AAV9 particles showed lower infection in HepaRG than unconjugated AAV9 particles. The results confirmed that the antibody conjugated AAVs preferentially infected cells expressing the target of the antibody, sparing the cells not expressing the target.

[0477] 6.7.5 Example 5: cancer targeting antibody conjugated AAV particles

[0478] The targeting effects of the anti-FRα antibody conjugated AAV particles were measured by FACS. The SKOV3 (human epithelial ovarian cancer cell) cells, which overexpressed FRαwere cultured in McCoy’s 5A medium with 10%FBS and seeded at 2E5 / mL, 0.5mL / well. The antibody conjugated AAV particles were added to each well at different MOIs ( “Multiplicity of Infection” ) and incubated at 37℃ in the presence of 5%CO2. Following transduction, the cells were cultured for 2 days and then analyzed by FACS.

[0479] As shown in FIG. 1B, anti-FRα conjugated AAV6 particles showed significantly increased infection rate (about 15%) in SKOV3 cells than unmodified AAV6 particles and modified but unconjugated AAV6 particles. Similarly, as shown in FIG. 2B, anti-FRα conjugated AAV9 particles showed significantly increased infection rate (about 15%) in SKOV3 cells than unmodified AAV9.

[0480] In a parallel study with the same procedure, both the SKOV3 cells and hFRa-MC38 (murine colon adenocarcinoma cell, Biocytogen) , which also overexpressed FRα, were cultured in McCoy’s 5A medium with 10%FBS or DMEM+10%FBS, respectively, and seeded at 1E5 cells / mL, 0.5 mL / well. The antibody conjugated AAV particles were added to each well at different MOIs ( “Multiplicity of Infection” ) and incubated at 37℃ in the presence of 5%CO2. Following transduction, the cells were cultured for 2 days and then analyzed by FACS.

[0481] As shown in FIGs. 7A-7C, anti-FRα conjugated AAV9 particles showed significantly increased infection rate in hFRa-MC38 cells (FIG. 7A) and SKOV3 cells (FIG. 7B) , while unmodified  AAV9 showed higher infection rate than the anti-FRα conjugated AAV9 particles in HepaRG (FIG. 7C) , again confirming that the antibody conjugated AAVs preferentially infected cells expressing the target of the antibody, sparing the cells not expressing the target.

[0482] 6.7.6 Example 6: Cancer cell targeting GOI delivery

[0483] The hFRα-MC38 cells were separately diluted in a 48-well plate at 1E5 cells / mL, with 0.5 mL per well. The tAAV9 (anti-FRα conjugated AAV9) and rAAV9 (recombinant AAV9 with unmodified capsid) were then added to each well at different MOIs and incubated at 37℃ in the presence of 5%CO2. After 2 days of culture, the supernatant was collected for IL-12 detection using either the mouse IL-12p70 High Sensitivity ELISA Kit (LiankeBio, Cat#EK212HS-96) or the human IL-12p70 ELISA Kit (LiankeBio, Cat#EK112 / 2-96) , following the manufacturer’s instructions.

[0484] As shown, hFRα-MC38 cells exhibited significantly increased hIL-12 secretion (FIG. 8A) and mIL-12 secretion (FIG. 8B) after infection with tAAV9, compared to rAAV9.

[0485] 6.7.7 Example 7: Biodistribution of cancer targeted AAV

[0486] The hFRα-MC38 tumor cells were cultured and expanded over 7–9 days (3–4 passages) . On the day of tumor inoculation, cells were harvested using 0.25%Trypsin, followed by two washes with PBS. Subsequently, 100μL of the cell suspension was injected subcutaneously into NOG mice (Charles River Company) . Subcutaneous tumor volumes were assessed by measuring the length, width, and height with a caliper, and tumor volume (mm3) was calculated using the formula: length×width×height.

[0487] Twenty days after tumor injection, the NOG tumor-bearing mice were randomized into treatment groups and intravenously injected with rAAV9 (5E12 vg / kg, n=3) , a low dose of tAAV9 (1E12 vg / kg, n=4) , a high dose of tAAV9 (5E12 vg / kg, n=4) , or PBS (n=2) .

[0488] On days 7 and 12 post-treatment, the mice were immobilized using an intraperitoneal (i. p. ) injection of 1.25%tribromoethanol buffer (Nanjing Aibei Bio, Cat#M2910) and subsequently injected i. p. with the substrate D-luciferin (150μg / kg dissolved in phosphate-buffered saline; Promega, Cat#88293) . Ten minutes later, the animals or their organs were placed in a dark chamber for light acquisition using an IVIS Lumina III system (PerkinElmer) and analyzed with Living Software 4.4 (PerkinElmer) . A region of interest (ROI) encompassing the entire animal or specific organs was defined, and quantification of light emission was performed in photons / second.

[0489] To quantify the number of viral genomes, total DNA (tDNA) was extracted from frozen organs (heart, liver, spleen, lung, kidney) using the FastPure DNA Isolation Mini Kit (Vazyme, Cat#DC112) , following the manufacturer’s instructions. AAV copy numbers in the tDNA were analyzed by quantitative PCR (qPCR) using TaqManTM Gene Expression Master Mix (Thermo,  Cat#4369016) on a 7500 Real-Time PCR System (ABI) . The primers used were ITR-F: GGAACCCCTAGTGATGGAGTT, ITR-R: CGGCCTCAGTGAGCGA, and the ITR-probe: 5’-FAM-CACTCCCTCTCTGCGCGCTCG-BHQ1-3’.

[0490] FIG. 9 provides a schematic depiction of this study.

[0491] Imaging from the IVIS system clearly demonstrated that the tAAV9 group delivered the gene of interest (GOI) for luciferase specifically to the tumor (FIG. 10B) , in comparison to the rAAV9 group (FIG. 10A) . Circles highlighted the tumor distribution of tAAV9. Furthermore, luciferase expression (FIG. 11A) and vector genome copy numbers (FIG. 11B) were detected in various mouse tissues post-systemic administration of AAV vectors by ex vivo IVIS and qPCR. The data revealed higher luciferase expression in the tumors of the tAAV9-treated groups compared to the liver, but a lower AAV genome copy number in tumors relative to the liver (FIGs. 11A-11B) . Consistent with the in vitro infection data, these findings further confirmed that the tumor-targeting tAAVs had lower infection rate in cells lacking target expression (e.g., liver cells) , compared to the unmodified rAAVs, despite the fact that the viruses might enrich in the surrounding organ tissue.

[0492] 6.7.8 Example 8: In vivo anti-tumor efficacy and safety of cancer targeted AAV

[0493] The hFRα-MC38 tumor cells were cultured and expanded for 7–9 days (3–4 passages) . On the day of tumor inoculation, cells were harvested using 0.25%Trypsin, washed twice with PBS, and adjusted to a concentration of 2E7 cells / mL for C57-6N mice (Charles River Company) . A100μL suspension of cells was injected subcutaneously into the mice. Subcutaneous tumor volumes were assessed by measuring the length, width, and height with a caliper, and tumor volume (mm3) was calculated as length×width×height.

[0494] For the anti-tumor efficacy study, C57 tumor-bearing mice were intravenously injected with rAAV9 (5E12 vg / kg and 1E14 vg / kg, n=4) , tAAV9 (5E12 vg / kg, 2E13 vg / kg, and 1E14 vg / kg, n=4) , or PBS (n=4) on day 14 after tumor inoculation. Blood samples were collected weekly, while tumor size and body weight were measured twice a week. All animal studies were conducted in accordance with the accreditation of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) . Animals were housed in individually ventilated cages under controlled conditions of temperature, humidity, and light, and were fed a diet of C060 irradiation-sterilized dry granule food. All mice were acclimated to the facility for at least 7 days. Euthanasia criteria included a body weight reduction of>20%for 72 hours, hypoactivity, hypothermia, respiratory distress, or tumor volume reaching 3500 mm3.

[0495] For immune cell analysis, 400μL of blood were collected on day 14 post-treatment, centrifuged for 5 minutes at 1, 800×g, and resuspended in 400μL of PBS. The cells were stained  with Alexa Fluor 700-mCD45 (Biolegend, Cat#103128) , BV421-mCD3e (BD, Cat#562600) , BV510-mCD4 (BD, Cat#563106) , PerCP-Cy5.5-mCD8a (BD, Cat#551162) , PE-NK1.1 (BD, Cat#553165) , and FITC-mPD1 (Biolegend, Cat#135214) , followed by incubation at 4℃ for 30 minutes in the dark. PBS was then added to remove excess antibodies. Red blood cells were lysed with 1×lysing solution (BD, Cat#349202) at room temperature for 10 minutes. After washing with PBS, the cells were analyzed by FACS.

[0496] The IL-12 and IFN-γlevels in mouse serum were determined using the mouse IL-12p70 High Sensitivity ELISA Kit (LiankeBio, Cat#EK212HS-96) and the mouse IFN-gamma ELISA Kit (LiankeBio, Cat#EK280-96T) , according to the manufacturer’s instructions.

[0497] For the anti-tumor safety study, C57 tumor-bearing mice received PBS (n=3) , rAAV9 (4E12 vg / kg, n=4) , or tAAV9 (4E12 vg / kg, n=5) via tail vein on day 29 after tumor inoculation. Tumor size and body weight were measured weekly. Blood samples were collected for liver and kidney function analysis, including alanine aminotransferase (ALT) , aspartate aminotransferase (AST) , total bilirubin (TBIL) , serum creatinine (CRE) , blood urea nitrogen (BUN) , and lactate dehydrogenase (LDH) , which were analyzed using the Hitachi LABOSPECT 006 automatic analyzer (Hitachi, Japan) . FIG. 12 provides a schematic depiction of this study.

[0498] The spleen and tumor were harvested for net weight measurement and immunohistochemistry (IHC) , respectively. IHC sample preparation and staining were performed according to standard protocols, using the following materials: anti-IL12A antibody (Abcam, Cat#ab131039) , anti-rabbit IgG isotype antibody (Abcam, Cat#ab172730) , anti-rabbit HRP-conjugated polymer (Absin, Cat#abs998) , CD3e (E4T1B)  rabbit mAb (CST, Cat#78588) , CD8a recombinant rabbit mAb (STARTER, Cat#S0B0034) , Anti-NKR-P1C antibody (Abcam, Cat#ab289542) , PD-1 (Intracellular Domain) (D7D5W)  rabbit mAb (CST, Cat#84651) , a five-color multiplex fluorescent immunohistochemistry staining kit (Absin, Cat#abs50029) , Harris hematoxylin (Baso, Cat#BA-4097) , and eosin (Baso, Cat#BA-4022) . FIG. 18 provides a schematic depiction of this study.

[0499] In the in vivo efficacy study, both tAAV9 and rAAV9 delivered mIL-12 effectively inhibited tumor growth compared to PBS in the hFRα-MC38 tumor model. In the high-dose tAAV9 group (G6) , 3 out of 4 mice exhibited a complete response with no deaths, while the high-dose rAAV9 group (G3) showed 1 complete response out of 4 mice, with 2 deaths (FIG. 13A) . This efficacy was correlated with a significant increase in CD8+T cells and NKT cells in the tAAV9-treated group (FIG. 15C, FIG. 15E) and a dose-dependent increase in PD-1+lymphocytes, including CD4+T cells, CD8+T cells, NK cells, and NKT cells, following tAAV9 and rAAV9 treatment  (FIGs. 16A-16D) . Moreover, the high-dose rAAV9 group resulted in apparent weight loss and 2 deaths (FIG. 13B) . Cytokine levels (mIL-12 and mIFN-γ) in serum rapidly increased after high-dose rAAV9 administration, whereas tAAV9 groups showed lower cytokine release, indicating reduced toxicity (FIGs. 17A-17B) .

[0500] Additionally, multicolor histochemical staining of tumors was used to measure the immune cell markers within the tumor. As shown in the table below, tumors in the tAAV group showed a significantly higher number of immune cells compared to rAAV group, further demonstrating the improved efficacy of the tAAV delivery.

[0501] Table 5. Statistics for the percentage of each cell type of immune cell in TMEs

[0502] Regarding safety and toxicity, splenomegaly was observed in the rAAV9 groups compared to normal spleens in the tAAV9 and PBS groups (FIG. 19) . Significant elevations in AST and TBIL levels following rAAV9 treatment indicated liver toxicity (FIGs. 20A and 20C) . Additionally, higher expression levels of IL-12 were detected in the liver (FIG. 21; indicated by arrows) after rAAV9 treatment than tAAV, with lower levels in the tumor (FIG. 22; indicated by arrows) after rAAV treatment than tAAV. These findings demonstrated the superiority of the tAAV delivery in both efficacy and efficacy compared to rAAV.

[0503] 6.8 Sequences

[0504] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications can be made thereto without departing from the spirit or scope of the appended claims. Unless the context indicates otherwise, it is specifically intended that the various features described herein can be used in any combination. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0505] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims.

[0506] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

Claims

1.A composition comprising (1) a recombinant AAV particle comprising a capsid protein linked to a protein catcher, and (2) a protein tag that can be linked to an antibody or antigen-binding fragment that specifically binds to a surface antigen of a target cell.2.The composition of claim 1, wherein the protein tag is linked to the antibody or antigen-binding fragment.3.The composition of claim 1 or 2, wherein the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length.4.The composition of claim 3, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.5.The composition of claim 3, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.6.The composition of any one of claims 3 to 5, wherein the protein tag ranges from about 10 to about 30 amino acids in length.7.The composition of claim 1, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively; SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.8.The composition of claim 7, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.9.The composition of any one of claims 1 to 8, wherein the target cell is a T cell.10.The composition of any one of claims 1 to 8, wherein the target cell is a tumor cell.11.The composition of claim 10, wherein the tumor cell surface antigen is CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRαor NY-ESO-1.12.The composition of any one of claims 1 to 11, wherein the antibody or antigen-binding  fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .13.The composition of any one of claims 1 to 12, wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.14.The composition of any one of claims 1 to 13, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.15.The composition of claim 14, wherein the AAV is AAV9.16.The composition of claim 14, wherein the AAV is AAV6.17.The composition of claim 15 or 16, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.18.The composition of claim 15 or 16, wherein the protein catcher is inserted at the N-terminus of the VP2 capsid protein.19.The composition of claim 15 or 16, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.20.The composition of any one of claims 1 to 19, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.21.The composition of claim 20, wherein the transgene of interest is a gene encoding a therapeutic protein, a nucleotide encoding an antibody or fragment thereof, a nucleotide encoding a CRISPR / Cas system or portion (s) thereof, a nucleotide encoding antisense RNA, a nucleotide encoding shRNA, a nucleotide encoding a miRNA, or a suicide gene.22.A kit comprising the composition of any one of claims 1 to 21, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.23.The composition of any one of claims 1 to 21, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.24.The composition of claim 23 further comprising a pharmaceutically acceptable carrier.25.A method of preparing an AAV conjugate targeted to a cell comprising incubating the composition of any one of claims 1 to 21 under a condition that allows the binding of the first member and the second member.26.A method of delivering a transgene of interest to a target cell comprising contacting the target cell with the composition of claim 20 or 21.27.The method of claim 26, wherein the contacting is performed in vitro or ex vivo.28.A method of delivering a transgene to a target cell of a subject in need thereof, comprising administering an effective amount of the composition of claim 20 or 21 to the subject.29.The method of claim 28, wherein the subject is a human.30.Use of the composition of claim 20 or 21 in delivering a transgene of interest to a target cell.31.A composition comprising (1) a recombinant Adeno-Associated Virus (AAV) particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a tumor antigen.32.The composition of claim 31, wherein the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .33.The composition of claim 31 or 32, wherein the antibody or antigen-binding fragment is an scFv.34.The composition of any one of claims 31 to 33, wherein the tumor antigen is CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRα or NY-ESO-1.35.The composition of claim 34, wherein the tumor antigen is FRα.36.The composition of any one of claims 31 to 35, wherein the first member is a protein catcher, and the second member is a peptide tag.37.The composition of claim 36, wherein the protein catcher is at least 50 amino acids in length,  and the protein tag is 30 amino acids or fewer in length.38.The composition of claim 37, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.39.The composition of claim 37, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.40.The composition of any one of claims 37 to 39, wherein the protein tag ranges from about 10 to about 30 amino acids in length.41.The composition of claim 36, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively; SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.42.The composition of claim 36, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.43.The composition of any one of claims 31 to 42, wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.44.The composition of any one of claims 31 to 43, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.45.The composition of claim 44, wherein the AAV is AAV9.46.The composition of claim 44, wherein the AAV is AAV6.47.The composition of claim 45 or 46, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.48.The composition of claim 45 or 46, wherein the protein catcher is inserted at the N-terminus of the VP2 capsid protein.49.The composition of claim 45 or 46, wherein the protein catcher replaces amino acids 453- 459 of capsid protein VP1 or VP2, or both VP1 and VP2.50.The composition of claim 49, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1.51.The composition of any one of claims 31 to 50, wherein the protein catcher is linked to the capsid protein via a first linker, a second linker, or both.52.The composition of any one of claims 31 to 51, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.53.The composition of claim 52, wherein the transgene of interest encodes a therapeutic protein, an antibody or fragment thereof, a CRISPR / Cas system or portion (s) thereof, an antisense RNA, a shRNA, a miRNA, or a suicide protein.54.The composition of claim 52, wherein the transgene encodes a cytokine.55.The composition of claim 54, wherein the cytokine is IL-15 or a variant thereof.56.The composition of claim 55, wherein the IL-15 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 35.57.The composition of claim 54, wherein the cytokine is IL-12p35 or a variant thereof.58.The composition of claim 57, wherein the IL-12p35 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 32.59.The composition of claim 54, wherein the cytokine is IL-12p40 or a variant thereof.60.The composition of claim 59, wherein the IL-12p40 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 33.61.The composition of claim 54, wherein the cytokine is a fusion protein comprising IL-12p40 or a variant thereof, and IL-12p35 or a variant thereof.62.The composition of claim 61, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ  ID NO: 34.63.The composition of claim 54, wherein the cytokine is mIL-12 or a variant thereof.64.The composition of claim 63, wherein the mIL-12 or a variant thereof has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 60.65.The composition of claim 54, wherein the cytokine is a fusion protein comprising IL-15 or a variant thereof, and IL-12p35 or a variant thereof.66.The composition of claim 65, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 36.67.The composition of claim 65, wherein the fusion protein further comprises IL-12p40 or a variant thereof.68.The composition of claim 67, wherein the fusion protein has an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 98%, at least 99%or 100%identical to SEQ ID NO: 37.69.A kit comprising the composition of any one of claims 31 to 68, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.70.The composition of any one of claims 31 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.71.The composition of any one of claims 52 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.72.The composition of any one of claims 53 to 68, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.73.The composition of claim 72 further comprising a pharmaceutically acceptable carrier.74.A method of preparing a cancer targeting AAV conjugate comprising incubating the  composition of any one of claims 31 to 68 under a condition that allows the binding of the first member and the second member.75.A method of delivering a transgene of interest to a cancer cell comprising contacting the cancer cell with the composition of claim 71.76.The method of claim 75, wherein the contacting is performed in vitro or ex vivo.77.A method of delivering a transgene to cancer cells of a subject in need thereof, comprising administering an effective amount of the composition of claim 71 to the subject.78.A method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of the composition of claim 72 to the subject.79.The method of claim 77 or 78, wherein the subject is a human.80.Use of the composition of claim 71 in delivering a transgene of interest to a cancer cell.81.Use of the composition of claim 72 in treating cancer.82.Use of the composition of claim 72 in the manufacture of a medicament for treating cancer.83.A composition comprising (1) a recombinant AAV particle comprising a capsid protein linked to a first member of a binding pair, and (2) an antibody or antigen-binding fragment linked to a second member of the binding pair, wherein the antibody or antigen-binding fragment specifically binds to a T cell-specific surface protein.84.The composition of claim 83, wherein the antibody or antigen-binding fragment is selected from the group consisting of a Fab, a Fab’, a F (ab’) 2, a Fv, a scFv, a (scFv) 2, a single domain antibody (sdAb) , a VHH, a heavy chain antibody (HCAb) and a designed ankyrin repeat protein (DARPin) .85.The composition of claim 83 or 84, wherein the antibody or antigen-binding fragment is an scFv.86.The composition of any one of claims 83 to 85, wherein the T cell specific-surface protein is CD3, CD4, or CD8.87.The composition of claim 86, wherein the T cell-specific surface protein is CD3.88.The composition of any one of claims 83 to 87, wherein the first member is a protein catcher,  and the second member is a peptide tag.89.The composition of claim 88, wherein the protein catcher is at least 50 amino acids in length, and the protein tag is 30 amino acids or fewer in length.90.The composition of claim 89, wherein the protein catcher ranges from about 50 to about 200 amino acids, from about 80 to about 200 amino acids, from about 100 to about 200 amino acids, from about 50 to about 150 amino acids, from about 80 to about 150 amino acids, or from about 100 to about 150 amino acids in length.91.The composition of claim 88, wherein the protein catcher ranges from about 100 to about 150 amino acids in length.92.The composition of any one of claims 88 to 91, wherein the protein tag ranges from about 10 to about 30 amino acids in length.93.The composition of claim 88, wherein the protein catcher and peptide tag are SpyCatcher and SpyTag, respectively; SpyCatcher002 and SpyTag002, respectively; SpyCatcher003 and SpyTag003, respectively; SnoopCatcher and SnoopTag, respectively; or SdyCatcher and SdyTag, respectively.94.The composition of claim 88, wherein the protein catcher and peptide tag are SpyCatcher003 and SpyTag003, respectively.95.The composition of any one of claims 83 to 94 wherein the AAV particle comprises a modified capsid protein having an insertion of a protein catcher.96.The composition of any one of claims 83 to 95, wherein the AAV is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh-10, AAVrh-74, and any chimera thereof.97.The composition of claim 96, wherein the AAV is AAV9.98.The composition of claim 96, wherein the AAV is AAV6.99.The composition of claim 97 or 98, wherein the protein catcher is inserted at amino acid position 588 of capsid protein VP1 or VP2, or both VP1 and VP2.100.The composition of claim 97 or 98, wherein the protein catcher is inserted at the N-terminus  of the VP2 capsid protein.101.The composition of claim 97 or 98, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1 or VP2, or both VP1 and VP2.102.The composition of claim 101, wherein the protein catcher replaces amino acids 453-459 of capsid protein VP1.103.The composition of any one of claims 83 to 102, wherein the protein catcher is linked to the capsid protein via a first linker, a second linker, or both.104.The composition of any one of claims 83 to 103, wherein the AAV particle comprises a nucleic acid comprising a transgene of interest encapsidated within the viral capsid.105.The composition of claim 104, wherein the transgene encodes a chimeric antigen receptor (CAR) that specifically binds to a tumor antigen.106.The composition of claim 105, wherein the tumor antigen is selected from the group consisting of CD19, CD20, CD22, CD30, CD123, CD138, CD33, CD70, BCMA, CS1, C-Met, IL13Ra2, EGFRvIII, CEA, Her2, GD2, MAGE, GPC3, Mesothelin, PSMA, ROR1, EGFR, MUC1, FRαand NY-ESO-1.107.The composition of claim 106, wherein the tumor antigen is CD19 or BCMA.108.The composition of claim 104, wherein the transgene encodes a CD64 / CD16A chimera.109.The composition of claim 108, wherein the CD64 / CD16A chimera comprises an extracellular domain, a transmembrane domain, and an intracellular domain; wherein the extracellular domain comprises the extracellular domain of CD64, or a functional variant thereof, and the intracellular domain contains the intracellular domain of CD16A, or a functional variant thereof; wherein the extracellular domain further comprises a CD16 cleavage site.110.A kit comprising the composition of any one of claims 83 to 109, wherein the AAV particle and the antibody or antigen binding fragment are placed in separate containers.111.The composition of any one of claims 83 to 109, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.112.The composition of any one of claims 104 to 109, wherein the AAV particle and the antibody  or antigen binding fragment forms a conjugate by the binding of the first member and the second member.113.The composition of any one of claims 105 to 109, wherein the AAV particle and the antibody or antigen binding fragment forms a conjugate by the binding of the first member and the second member.114.The composition of claim 113 further comprising a pharmaceutically acceptable carrier.115.A method of preparing a T-cell targeting AAV conjugate comprising incubating the composition of any one of claims 83 to 109 under a condition that allows the binding of the first member and the second member.116.A method of delivering a transgene of interest to a T cell comprising contacting the T cell with the composition of claim 112.117.The method of claim 116, wherein the contacting is performed in vitro or ex vivo.118.A method of delivering a transgene to T cells of a subject in need thereof, comprising administering an effective amount of the composition of claim 112 to the subject.119.A method of treating cancer in a subject in need thereof, comprising administering a therapeutically effective amount of the composition of claim 113 to the subject.120.The method of claim 118 or 119, wherein the subject is a human.121.Use of the composition of claim 112 in delivering a transgene of interest to a T cell.122.Use of the composition of claim 113 in treating cancer.123.Use of the composition of claim 113 in the manufacture of a medicament for treating cancer.

Images