ADNP syndrome antisense treatment

Abstract

ADNP syndrome, also known as Helsmoortel-Van Der Aa syndrome, is a neurodevelopmental genetic disorder caused by changes (mutations) in the ADNP gene. ADNP syndrome involves loss of function mutations in one ADNP allele that results in a haploinsufficient phenotype. Disclosed herein are antisense oligonucleotides that can increase ADNP protein express from the healthy allele to combat this haploinsufficiency. This is based on the recognition that upstream open reading frames (uORFs) in 5' UTR may be reducing translation efficiency from the primary open reading frame (pORF) of WT ADNP mRNA. The disclosed antisense oligonucleotides inhibit translation of the uORFs, thereby increasing ADNP translation efficiency from the pORF.

Description

ADNP SYNDROME ANTISENSE TREATMENTCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 63 / 593,581 , filed October 27, 2023, which is hereby incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] This application contains a sequence listing filed in ST.26 format entitled “320317-2120 Sequence Listing” created on September 30, 2024, and having 1 ,827,429 bytes. The content of the sequence listing is incorporated herein in its entirety.BACKGROUND OF THE INVENTION

[0003] ADNP syndrome, also known as Helsmoortel-Van Der Aa syndrome, is a neurodevelopmental genetic disorder caused by changes (mutations) in the ADNP gene. These mutations occur spontaneously in the majority (97%) of reported patients, meaning there has been no family history of the disorder (de novo mutations).

[0004] The hallmark features of the syndrome are intellectual disability, global developmental delays, global motor planning delays and autism spectrum disorder or autistic features. Although ADNP syndrome was only discovered in 2014, it is projected to be one of the most frequent single gene causes of autism.

[0005] The genetic changes that cause ADNP syndrome vary from person to person. The symptoms can also vary and can cause a wide range of medical, developmental, intellectual and behavioral changes. The most common characteristics found in those with ADNP syndrome are developmental delays (100%), intellectual delays (100%), motor planning delays (96%) of varying degrees, delayed or absent speech (98%) and autism spectrum disorder including autistic features (93%). Autistic features in ADNP syndrome are quite similar and most children display a very happy demeanor similar to Angelman syndrome as infants and toddlers. Feeding and gastrointestinal problems (83%) are also very common. Additional symptoms are low or weak muscle tone in newborns and infants (hypotonia) (78%), neonatal / infant feeding disorders, sensory processing disorder, sleep disorder, high pain threshold and additional symptoms and behavioral disorders of varying levels of severity.

[0006] The disorder can potentially affect multiple systems of the body including the brain, heart, immune system, gastrointestinal system, endocrine system, and musculoskeletal system. The specific signs and symptoms associated with the disorder can vary greatly from one individual to another but the majority of children exhibit distinctive facial features. Many infants (>80%) develop early primary tooth eruption and often have a happy disposition andunprovoked episodes of daughter and smiling. Parents report that approximately 50% of the children develop breathing irregularities (breath holding episodes) and episodes of developmental regression of speech that is usually regained over time with intensive therapy.

[0007] ADNP syndrome is caused by a change (mutation) in the activity-dependent neuroprotective protein (ADNP) gene. Genes provide instructions for creating proteins that play a critical role in many functions of the body. When a mutation of a gene occurs, the protein product may be faulty, inefficient, absent, or overproduced. Depending upon the functions of the particular protein, this can affect many organ systems of the body, including the brain.

[0008] Researchers have determined that the ADNP gene produces a protein called activity-dependent neuroprotective protein that helps to regulate as many as 400 other genes in the body. These genes and the proteins they produce are extremely important for the proper development and maturation of the brain and other organs. Collectively, they are involved with almost every system of the body. SUMMARY OF THE INVENTION

[0009] With ADNP syndrome, de novo loss of function mutations in one ADNP allele results in a haploinsufficient loss-of-function phenotype because the amount of protein production from the healthy allele is inadequate. Disclosed herein are antisense oligonucleotides that can increase ADNP protein express from the healthy allele to combat this haploinsufficiency. This is based on the recognition that upstream open reading frames (uORFs) in 5’ UTR may be reducing translation efficiency from primary open reading frame (pORF) of WT ADNP mRNA. In general, uORFs are thought to occupy translational machinery away from pORF 30-80% of the time, causing widespread reduction of protein expression. The disclosed antisense oligonucleotides inhibit translation of the uORFs, thereby increasing ADNP translation efficiency from the pORF. There are five ADNP uORFs, two pairs of which are adjacent to each other. Therefore, in some embodiments, a combination of three ASOs can be used to block these uORFs.

[0010] Disclosed herein is an antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementarity to a contiguous portion of nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-1014. In some embodiments, the ASO comprises the nucleic acid sequence AUGCACAAUG (SEQ ID NO:2066). In some embodiments, the ASO comprises the nucleic acid sequence AUGAUG. Insome embodiments, the ASO consists of a nucleic add sequence selected from the group consisting of SEQ ID NOs:2-1033.

[0011] In some embodiments, the one or more modified nucleosides is a 2’ sugar modified nucleoside. In some embodiments, the one or more 2' sugar modified nucleoside is independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyi-RNA, 2'- alkoxy-RNA, 2 -O-methcxyethyl-RNA, 2 -amino-DNA, 2 -flucro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides. In some embodiments, the ASO comprises at least one modified internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0012] Also disclosed is a composition comprising: a first ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:2-375; a second ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:376- 704; and a third ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NQs:705- 1002.

[0013] In some embodiments, the first ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-375, the second ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:376-704, and third ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:705- 1002. In some embodiments, the first ASO and the second ASO each comprise nucleic acid sequences complementary to two AUG start sites.

[0014] Also disclosed herein is a composition comprising: a first ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%,98%, 99% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:2- 375; and a second ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 65%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:984- 1033.

[0015] In some embodiments, the first ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-375, and the second ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1003-1033.

[0015] In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0017] Also disclosed is a method for treating or preventing symptoms of ADNP syndrome in a subject comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of an ASO composition disclosed herein.

[0018] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.BRIEF DESCRIPTION OF FIGURES

[0019] FIG. 1 shows the five uORFs in ADNP and a series of staggering ASOs designed to target these uORFs. The sequence shown is a partial view of the ADNP ORF (SEQ ID NO:1).

[0020] FIG. 2 shows ADNP expression in N2a cells after transfection with varying concentrations of ASO1 , ASO2, or ASO3.

[0021] FIG. 3 shows ADNP expression in HEK293T cells after various concentrations of ASO1 , ASO2, ASO3, ASO4, ASO5, ASO6, ASO8, or ASO9.

[0022] FIG. 4 shows ADNP expression in hiPSC-derived neurons after treatment with ASO4, ASO8, ASO9, ASO4+8, or ASO4+9.DETAILED DESCRIPTION

[0023] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary.it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.

[0024] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0026] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.

[0027] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0023] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of chemistry, biology, and the like, which are within the skill of the art.

[0029] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use theprobes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20 °C and 1 atmosphere.

[0030] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible.Definitions

[0031] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

[0032] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide disclosed herein is man-made, e.g., chemically synthesized. The oligonucleotide disclosed herein may also comprise one or more modified nucleosides or nucleotides.

[0033] The term “antisense oligonucleotide” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. In some embodiments, the antisense oligonucleotides disclosed herein are single stranded.

[0034] The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments ail the nucleotides of the oligonucleotide are present in the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may, optionally comprisefurther nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0035] Nucleotides are the building blocks of oligonucleotides and polynucleotides, and can include both naturally occurring and non-natural!y occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

[0036] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In some embodiments, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”.

[0037] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages or natural phosphate linkages that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”, in some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in viva use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide disclosed herein, for example, within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.

[0033] In some embodiments, the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is, for example, more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay [e.g., snake venom phosphodiesterase (SVPD)], both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages.

[0039] In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%,such as at least 70%, such as at least 80% or such as at least 90% cf the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified.

[0040] It will be recognized that, in some embodiments, the internucleoside linkages which link the oligonucleotide to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In some embodiments, the internucleoside linkages which link the oligonucleotide to a non-nucleotide functional group are modified.

[0041] In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.

[0042] Modified internucleoside linkages may, for example, be selected from the group comprising phosphorothioate, diphosphorothioate, and boranophosphate. In some embodiments, the modified internucleoside linkages are compatible with the RNase H recruitment of the oligonucleotide disclosed herein, for example, phosphorothioate, diphosphorothioate, or boranophosphate.

[0043] In some embodiments the internucleoside linkage comprises sulphur (S), such as a phosphorothioate internucleoside linkage.

[0044] A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In preferred embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80%, or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.

[0045] In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester, methyiphosphonate, MMI, amide-3, formacetal or thioformacetal. Further internucleoside linkages are disclosed in W02009 / 124238 (incorporated herein by reference). In an embodiment the internucleoside linkage is selected from linkers disclosed in W02007 / 031091 (incorporated herein by reference).

[0046] Nuclease resistant linkages, such as phosphorothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region ofheadmers and tailmers. Phosphorothioate linkages may, however, also be useful in nonnuclease recruiting regions and / or affinity enhancing regions such as regions F and F’ for gapmers, or the modified nucleoside region of headmers and tailmers,

[0047] Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and / or bio-distribution of an oligonucleotide. W02008 / 113832 is incorporated herein by reference for the teaching of oligonucleotides having phosphodiester linkages.

[0048] In some embodiments, all the internucleoside linkages in the oligonucleotide are phosphorothioate and / or boranophosphate linkages. In some embodiments, all the internucleoside linkages in the oligonucleotide are phosphorothioate linkages.

[0049] The term nucleobase includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. The term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization, in this context “nucleobase” refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants.

[0050] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl- cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo- uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6- diaminopurine, and 2-chloro-6-aminopurine.

[0051] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g., A, T, G, C, or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine (5mC). Combinations of these modifications may also be used. For example, 5mC LNA nucleosides may be used. Likewise, 2 -hydroxymethyl (2'-OMe) 5mC may be used.

[0052] The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine(A)-thymine (T) / uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example, 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between nonmodified and modified nucleobases.

[0053] The term “% complementary” as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g., oligonucleotide) which, at a given position, are complementary to (i.e., form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g., the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch.

[0054] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T m) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions, Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=--RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are 1M, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Hoidgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleicacid target by hybridization, oligonucleotides disclosed herein hybridize to a target nucleic acid with estimated AG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below “25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or ”16 to ~27 kcal such as -18 to -25 kcal.

[0055] In some embodiments, the disclosed oligonucleotide comprises a contiguous nucleotide sequence of at least 8 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule. The contiguous nucleotide sequence (and therefore the target sequence) comprises of at least 8 contiguous nucleotides, such as 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as from 12-25, such as from 14-18 contiguous nucleotides.

[0058] The term “modulation of expression” as used herein is to be understood as an overall term for an oligonucleotide's ability to alter the amount of ADNP protein when compared to the amount of ADNP before administration of the oligonucleotide. Alternatively modulation of expression may be determined by reference to a control experiment where the disclosed oligonucleotide is not administered.

[0057] The disclosed oligonucleotide may comprise one or more nucleosides which have a modified sugar moiety, i.e., a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oiigonucieotides, such as affinity and / or nuclease resistance. Such modifications include those where the ribose ring structure is modified, e.g., by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicie bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g., UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleosides (WO2011 / 017521) or tricyclic nucleosides (WO2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0058] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2 -OH group naturally found inDNA and RNA nucleosides. Substituents may, for example, be introduced at the 2', 3!, 4’ or 5' positions. Nucleosides with modified sugar moieties also include 2’ modified nucleosides, such as 2’ substituted nucleosides. Indeed, much focus has been spent on developing 2’ substituted nucleosides, and numerous 2’ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.

[0059] A 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or — OH at the 2' position (2’ substituted nucleoside) or comprises a 2' linked biradical, and includes 2' substituted nucleosides and LNA (2'-4' biradical bridged) nucleosides. For example, the 2' modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleosides are 2 -0- alkyl-RNA, 2'-O-methy!-RNA (O-Me), 2 -alkoxy-RNA, 2 -O-methoxyethyl-RNA (MOE), 2 -amino- DNA, 2 -Fluoro-RNA, and 2’-fluoro-ANA (F-ANA). For further examples, please see Freier S Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937.

[0060] Locked Nucleic Acid (LNA) nucleosides are modified nucleosides which comprise a linker group (referred to as a biradical or a bridge) between C2' and C4!of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.

[0061] Conjugation of the disclosed oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g., by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. In some embodiments the conjugate moiety modify or enhance the pharmacokinetic properties of the oligonucleotide by improving cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide. In particular the conjugate may target the oligonucleotide to a specific organ, tissue, or cell type and thereby enhance the effectiveness of the oligonucleotide in that organ, tissue, or cell type. At the same time the conjugate may serve to reduce activity of the oligonucleotide in non-target cell types, tissues or organs, e.g., off target activity or activity in non-target cell types, tissues or organs. WO 93 / 07883 and WO 2013 / 033230 provides suitable conjugate moieties, which are hereby incorporated by reference. WO 2012 / 143379 provides a method of delivering a drug across the blood-brain-barrier by conjugation to an antibody fragment with affinity to the transferrin receptor, which are hereby incorporated by reference.

[0062] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids) or combinations thereof. In some embodiments the non- nucleotide moiety an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates delivery across the blood-brain-barrier, in particular an antibody or antibody fragment targeting the transferrin receptor.

[0063] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0064] The term “therapeutically effective" refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.

[0065] The term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0066] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0067] The term “inhibit” refers to a decrease in an activity, response, condition, disease, or other biological parameter, which those skilled in the art will appreciate may be assessed at a particular point in time, such that in some embodiments, inhibition may be or comprise a delayin onset or reduction in frequency, in some embodiments, inhibition can include, but is not limited to, the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.Antisense Oligonucleotides

[0068] Antisense oligonucleotides (ASOs) were designed to target ADNP uORFs, thereby increasing ADNP translation efficiency from the pORF. In some embodiments, human ADNP ORF has the nucleic acid sequence: GCAGCGCUAAGGGGGAUUUUGGCGUCUUCUCAGACACAGCUCCCUCUCUCGGUCCCCG CUGCUGAGGAGCGAGAGGAGCGCGGCCGCCGCCGCCCGCGCCGGUGAAGCCGCCUCU CCCACACCCUCCGUCUCCUCCCUCCGCCCCUCCUUUGUCUGCACCGCUCGACGACGCC GCCGCCGCCCGCCGCUCUGCUGCGCCCGCCGCGCCCCCCGGCAGCACCCGCGGCCGC GGCGCGAGCCGGAGUCCGCCGAGCCGGAGCGCGACGAGGCCCCGGGCGCGCCCUCCC CGCUGCCGCCACCGCCGUGCCGCCGCCAUCCGCCCGCCGCCGCCGCCGCUGUCCGGC CCCCGAGCACGCCGGCCCCGCGCGCGCCUCGAGGCCGAGUCAAGGUGUGAGAUGCACA AUGCGAAACCUAGGCCCCAGCUUUUACACCAUGAUGCGCAGGGUUGUACUUUUUGUAC UGAACUGAUAGGUGGCCUAGUGGUUAUGCCCUGUACUACCAUUUUGAGGAUCUGGACU CCGUUUCCUGCCUUGCUCUUUGGACCACAUUGUCAAUUCACACCGAAACUAUG (SEQ ID NO:1). The target uORFs are underlined and the pORF is in bold. The are referred to herein as uORF1 , uORF2, uORF3, uORF4, and uORF5, respectively from 5' to 3’.

[0069] In some embodiments, the ASO binds to at least a portion of the uORF transcriptional start site. In other embodiments, the ASO binds to a nucleic acid less than 10, 9, 8, 7, 67, 5, 4, 3, 2, or 1 nucleotides 3’ to the transcriptional start site. Therefore, reference to an ASO binding a uORF includes ASOs that bind 10, 9, 8, 7, 67, 5, 4, 3, 2, or 1 nucleotides 3’ to the transcriptional start site.

[0070] Therefore, disclosed herein is an ASO that binds uORF1 , an ASO that binds uORF1 , or preferably an ASO that binds uORF1 and uORF2. Examples include those listed in Table 1. Also disclosed herein is an ASO that binds uORF3, an ASO that binds uORF4, or preferably an ASO that binds uORF3 and uORF4. Examples include those listed in Table 2. Also disclosed herein is an ASO that binds uORF5. Examples include those listed in Table 3. Also disclosed are concatenated ASOs that bind uORF5 with uORF4 and preferably uORF5. Examples include those listed in Table 4.Table 2. uORF Group 2 (uORF3 and / or uORF4)| Table 3. uORF Group 3 (uORF5)

[0071] Target modulation by the disclosed oligonucleotide is triggered by hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the disclosed oligonucleotide comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of ADNP expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and / or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2’ modified nucleosides, including LNA, present within the oligonucleotide sequence.

[0072] The disclosed antisense oligonucleotide can have a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementarity to the target uORFs disclosed herein.

[0073] Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The disclosed antisense oligonucleotide comprises sugar- modified nucleosides and may also comprise DNA, RNA, or arabino nucleic acid (ANA) nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and DNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and RNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and ANA nucleosides.

[0074] In some embodiments, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. In an embodiment the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 9 modified nucleosides, such as from 3 to 8 modified nucleosides, such as from 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides.

[0075] In some embodiments, the oligonucleotide comprises at least one modified internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages.

[0076] In some embodiments, the disclosed antisense oligonucleotide comprises one or more sugar modified nucleosides, such as 2!sugar modified nucleosides. Preferably the disclosed antisense oligonucleotides comprise one or more LNA nucleosides or 2' sugarmodified nucleoside wherein the 2′ position is replaced by a substituent independently selected from the group consisting of, –F; –CF3, –CN, –N3, –NO, –NO2, –O–(C1–C10alkyl), –S–(C1–C10alkyl), –NH–(C1–C10alkyl), or –N(C1–C10alkyl)2; –O–(C2–C10alkenyl), –S–(C2–C10alkenyl), – NH–(C2–C10alkenyl), or –N(C2–C10alkenyl)2; –O–(C2–C10alkynyl), –S–(C2–C10alkynyl), –NH– (C2–C10alkynyl), –N(C2–C10alkynyl)2, –O––(C1–C10alkylene)–O––(C1–C10alkyl), –O–(C1–C10alkylene)–NH–(C1–C10alkyl), –O–(C1–C10alkylene)–NH(C1–C10alkyl)2, –NH–(C1–C10alkylene)– O–(C1–C10alkyl), and –N(C1–C10alkyl)–(C1–C10alkylene)–O–(C1–C10alkyl) .

[0077] In some embodiments, the disclosed oligonucleotides comprises at least one LNA unit, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, such as from 2 to 6 LNA units, such as from 3 to 7 LNA units, 4 to 8 LNA units or 3, 4, 5, 6 or 7 LNA units. In some embodiments, all the modified nucleosides are LNA nucleosides. In some embodiments, LNA comprises a 2′-4′ biradical bridge of −L−, wherein −L− is −O−CH2−, wherein −CH2− is optionally substituted. In some embodiments, LNA comprises a 2′-4′ biradical bridge of −L−, wherein −L− is −O−CH2−. In some embodiments, LNA comprises a 2′-4′ biradical bridge of −L−, wherein −L− is −O−CH(Et)−. In a further embodiment, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, and / or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. In some embodiments, the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA unit at the 5′ end and at least 2 LNA units at the 3′ end of the nucleotide sequence.

[0078] Methods for manufacturing the disclosed oligonucleotides are known. In some cases, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol.154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand).

[0079] In some embodiments, oligonucleotide synthesis methodologies are utilized that provide control of stereochemistry at one or more modified internucleoside linkages that include(s) a chiral atom. See, for example, WO2010 / 064146, WO2014 / 012081, WO2015 / 107425, WO2016 / 079183, WO2016 / 079181, WO2016 / 096938, WO2017 / 194498, and WO2018 / 177825, which are incorporated by reference for these methodologies.

[0080] Those skilled in the art will appreciate that useful nucleic acids provided by the present disclosure include those that store and / or express sequences of oligonucleotides described herein. In some embodiments, such nucleic acids may be or comprise vectors appropriate for delivery into and / or replication and / or expression in a cell (e.g., a microbial cell, for example for production and / or a mammalian cell, for example for treatment). Those skilledin the art are aware of a variety of technologies (e.g., recombinant nucleic acid technologies such as, for instance, that utilize one or more of amplification such as by polymerase chain reaction, cleavage such as by restriction digestion, linkage such as by ligation - whether in vitro oc in vivo e.g , by gap repair, etc.).

[0081] Also disclosed are pharmaceutical compositions comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the diluent is artificial cerebrospinal fluid (aCSF).

[0082] The disclosed oligonucleotides may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0083] Those skilled in the art are aware of a variety of formulation strategies useful for storage and / or administration of nucleic acid therapeutics such as oligonucleotide therapeutics. See, for example, Pushpendra et al “Nucleic Acids as Therapeutics” in From Nucleic Acid Sequences to Molecular Medicines, ed. Erdmann and Barciszewski, Springer-Verlag, 2012; Juliano “The Delivery of Therapeutic Oligonucleotides” Nuc. Acids. Res. 44:6518, 2016; etc.

[0084] In some embodiments, the oligonucleotide is formulated as a prodrug. In particular with respect to oligonucleotide conjugates, the conjugate moiety can be cleaved off the oligonucleotide once the prodrug is delivered to the site of action, e.g., the target cell.Methods of Treatment

[0085] Also disclosed are methods for treating or preventing ADNP syndrome, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition disclosed herein to a subject suffering from or susceptible to the disease.[008S] Also disclosed is use of the disclosed oligonucleotides for the manufacture of a medicament for the treatment of ADNP syndrome.

[0087] The disclosed pharmaceutical compositions may be administered by topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal) administration. In some embodiments, thedisclosed pharmaceutical compositions are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g., intracerebral or intraventricular, administration. In some embodiments, the oligonucleotide is administered by intracerebral or intracerebroventricular injection. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered intrathecally. In some embodiments, the pharmaceutical composition is administered by intracisternae magna injection.In some embodiments, a therapeutic regimen for the treatment of ADNP syndrome with a nucleic acid therapeutic (e.g., an oligonucleotide therapeutic such as an ASO) as described herein is or comprises administration of one or more doses of a pharmaceutical composition that comprises and / or delivers an oligonucleotide as described herein.

[0089] Also disclosed is the use of an oligonucleotide disclosed herein for the manufacture of a medicament wherein the medicament is in a dosage form for intracerebral or intraventricular administration.

[0090] Also disclosed is the use of an oligonucleotide disclosed herein for the manufacture of a medicament wherein the medicament is in a dosage form for intracerebroventricular administration.

[0091] In some embodiments the oligonucleotide disclosed herein is for use in a combination treatment with another therapeutic agent. Such combinations could include: the ASO with one or more other ASOs, with a small molecule drug, with a peptide therapeutic, with a gene therapy, with an epigenetic editor, or a transcriptional activator,

[0092] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.EXAMPLESExample 1:

[0093] FIG. 1 shows the five uORFs in ADNP and a series of staggering ASOs designed to target these uORFs.

[0094] The sequences for these ASOs are as follows:ASO1 : 5 -UCGCAUUGUGCAUCUCACAC-3’ (SEQ ID NO: 139);ASO2: 5’-UUUCGCAUUGUGCAUCUCAC~3;(SEQ ID NO: 161);ASO3: 5’-GGUUUCGCAUUGUGCAUCUC-3’ (SEQ ID NO: 183);ASO4: 5 -GCGCAUCAUGGUGUAAAAGC-3’ (SEQ ID NO:469);ASO5: 5’-CCCUGCGCAUCAUGGUGUAA-3’ (SEQ ID NO:513);ASO6: 5!-ACAACCCUGCGCAUCAUGGU-3’ (SEQ ID NO:557);ASO7: 5 -CAGGGCAUAACCACUAGGCCA-3’ (SEQ ID NO:785);ASO8: 5’-AGUACAGGGCAUAACCACUAG~3:(SEQ ID NO:839); and ASO9: 5 ~UGGUAGUACAGGGCAUAACC-3’ (SEQ ID NO: 884).

[0095] ASOs, at the indicated final concentration, were applied directly to the culture media of HEK293T cell lines or healthy human iPSC-derived neuronal cultures. A control ASO was used that had the same chemical modifications but designed not to bind to any sequence in the human transcriptome. ADNP protein levels were assayed by Western Blot, with each lane normalized for loading using the ponceau stain, and fold increases normalized to the control ASO.

[0096] FIG. 2 shows ADNP expression in N2a cells after transfection with varying concentrations of ASO1 , ASO2, or ASO3.

[0097] FIG. 3 shows ADNP expression in HEK293T cells after various concentrations of ASO1 , ASO2, ASO3, ASO4, ASO5, ASO6, ASO8, or ASO9.

[0098] FIG. 4 shows ADNP expression in hiPSC-derived neurons after treatment with ASO4, ASO8, ASO9, ASO4+8, or ASO4+9.

[0099] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.

[0190] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

CLAIMS1. An antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-1033.

2. The ASO of claim 1 , wherein the one or more modified nucleosides is a 2’ sugar modified nucleoside.

3. The ASO of claim 2. wherein the one or more 2' sugar modified nucleoside is independently selected from the group consisting of 2 -O-alkyl-RNA, 2 -O-methyl-RNA, 2'- alkoxy-RNA, 2 -O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2 -fluoro-ANA and LNA nucleosides.

4. The ASO of any one of claims 1 to 3, wherein the ASO comprises at least one modified internucleoside linkage.

5. The ASO of claim 4, wherein the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

6. The ASO of any one of claims 1 to 5, wherein the ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-1033.

7. The ASO of any one of claims 1 to 6, wherein the ASO comprises the nucleic acid sequence AUGCACAAUG (SEQ ID NO:2066).

8. The ASO of any one of claims 1 to 6, wherein the ASO comprises the nucleic acid sequence AUGAUG.

9. A composition comprising: a first antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:2-375; a second ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:376-704; and a third ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NQs:705-1002.

10. The composition of claim 9, wherein the first ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-375, the second ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:376-704, and third ASOconsists of a nucleic acid sequence selected from the group consisting of SEQ ID NQs:705- 1002.

11. The composition of claim 9 or 10, wherein the first ASO and the second ASO each comprise nucleic acid sequences complementary to two AUG start sites.

12. A composition comprising: a first antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID NOs:2-375; and a second ASO comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 98% complementarity to a contiguous portion of nucleic acid sequence SEQ ID N0s:1003-1033.

13. The composition of claim 12, wherein the first ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs:2-375, and the second ASO consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1003-1033.

14. The composition of any one of claims 9 to 13 further comprising a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

15. A method for treating or preventing symptoms of ADNP syndrome in a subject comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of the composition of claim 14.

Images