Methods of assessing RNA contamination and integrity

Abstract

Disclosed herein are methods for assessing RNA contamination (purity) and integrity. The present disclosure provides methods of detecting defective, unwanted, undesirable, and / or unexceptional ribonucleic acids (RNAs). The present disclosure also provides methods of measuring quantity and / or quality of an RNA. The present disclosure also provides methods validating a personalized therapeutic composition comprising an RNA.

Description

[0001] METHODS OF ASSESSING RNA CONTAMINATION AND INTEGRITY

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 596,017, filed November 3, 2023, which is incorporated by reference herein in its entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under Grant No. RO 1 GM 134042 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] REFERNCE TO SEQUENCE LISTING

[0007] A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via Patent Center encoded as XML in UTF-8 text. The electronic document, created on October 29, 2024, is entitled “11555-007W01_ST26.xml”, and is 11,427 bytes in size.

[0008] BACKGROUND

[0009] There is a growing understanding of the role of ribonucleic acid (RNA) in various diseases, which has led to the promotion of RNA-based therapeutics. However, there are significant challenges to developing RNA-based therapeutics including, but not limited to, distinguishing between purified RNA sequences and defective RNA sequences. Some common problems in RNA manufacturing and / or isolation include the presence of undesirable RNA structures including, but not limited to 1) double stranded RNA (dsRNA) at RNA 3’ end, 2) truncated RNA (from RNA polymerase stopping, or terminating, early), 3) exonucleolytic degradation from the 5’ and 3’ ends of the RNA (shortening the RNA from its ends) and 4) endonucleolytic cleavage in the middle of the RNA. Current assays to distinguish these structures from targeted RNA sequence are difficult and imprecise, and are often required to be performed off-line. Current assays also become increasingly difficult as the length of the RNA increases. Given limitations of developing, manufacturing, and / or preparing RNA-based therapeutics, there is a need to address the aforementioned problems mentioned above by developing new methods to assess the quality and / or quantity of RNA samples of any length. The compounds, compositions, and methods disclosed herein address these and other needs.

[0010] SUMMARY

[0011] The present disclosure provides methods of detecting defective, unwanted, undesirable, and / or unexceptional ribonucleic acids (RNAs). The present disclosure also provides methods of measuring quantity and / or quality of an RNA. The present disclosure also provides methods validating a personalized therapeutic composition comprising an RNA.

[0012] In one aspect, disclosed herein is a method of detecting a defective RNA in a sample, the method comprising isolating or manufacturing an RNA sequence, contacting the RNA sequence with at least two molecular beacons, wherein the at least two molecular beacons comprise a first and a second nucleic acid, wherein the first nucleic acid is covalently linked to a first fluorescent molecule and a first quencher, and wherein the second nucleic acid is covalently linked to a second fluorescent molecule and a second quencher, and detecting decreased fluorescence emitted by a second molecular beacon relative to the fluorescence emitted by a first molecular beacon when the sample comprises the defective RNA.

[0013] In one aspect, disclosed herein is a method of measuring quantity and quality of an RNA sequence in a sample, the method comprising isolating or manufacturing the RNA sequence, binding a first molecular beacon to an end of the RNA sequence and binding a second molecular beacon to an opposite end of the RNA sequence, wherein a full-length RNA sequence binds the first and second molecular beacon and a defective RNA sequence binds the first molecular beacon, detecting an RNA quantity from the first molecular beacon binding the RNA sequence, and detecting an RNA quality from a ratio of the second molecular beacon binding the RNA sequence relative to the first molecular beacon binding the RNA sequence.

[0014] In one aspect, disclosed herein is a method of validating a personalized therapeutic composition, the method comprising isolating or manufacturing an RNA sequence, binding a first, a second, and a third molecular beacon to the RNA sequence, wherein the first molecular beacon binds at an end of the RNA sequence, the second molecular beacon binds at an opposite end of the RNA sequence, and the third molecular beacon binds between the ends of the RNA sequence, detecting a full-length RNA sequence that binds the first, second and third molecular beacons, and incorporating the full-length RNA sequence into the personalized therapeutic composition.

[0015] In some embodiments, the first fluorescent molecule and the first quencher are linked at opposite ends of the first nucleic acid. In some embodiments, the second fluorescent molecule and the second quencher are linked at opposite ends of the second nucleic acid. In some embodiments, the first and second fluorescent molecules are the same. In some embodiments, the first and second fluorescent molecules are different. In some embodiments, the first and second quenchers are the same. In some embodiments, the first and second quenchers are different.

[0016] In some embodiments, the method comprises two, three, four, or more molecular beacons. In some embodiments, the defective RNA comprises a double stranded RNA (dsRNA), a partially double stranded RNA (dsRNA), a truncated RNA, or a degraded RNA. In some embodiments, the first and second nucleic acid comprise a hairpin nucleic acid or a linear nucleic acid. In some embodiments, the hairpin nucleic acid transforms into the linear nucleic acid in the presence of a full-length RNA.

[0017] In some embodiments, the first molecular beacon binds within a first or last 250 base pairs (bps) of the RNA sequence. In some embodiments, the second molecular beacon binds within a first or last 250 bps of the RNA sequence. In some embodiments, the second molecular beacon binds after a polyadenylate (poly A) tail of the RNA sequence.

[0018] In some embodiments, the first molecular beacon emits a fluorescent signal when bound to the RNA sequence. In some embodiments, the second molecular beacon emits a fluorescent signal when bound to the RNA sequence.

[0019] In some embodiments, the method detects the fluorescent signal using a spectroscopy technique, or derivatives thereof. In some embodiments, the method measures quantity and quality of the RNA sequence.

[0020] In some embodiments, the first molecular beacon comprises a first nucleic acid, a first fluorescent molecule, and a first quencher. In some embodiments, the second molecular beacon comprises a second nucleic acid, a second fluorescent molecule, and a second quencher.

[0021] In some embodiments, the ratio comprises the fluorescent signal from the second molecular beacon relative to the fluorescent signal from the first molecular beacon. In some embodiments, the method detects the defective RNA. In some embodiments, the first molecular beacon measures a quantity of the RNA sequence. In some embodiments, the first and second molecular beacons measure a quality of the RNA sequence.

[0022] In some embodiments, the third molecular beacon identifies a subject- specific RNA sequence. In some embodiments, the third molecular beacon comprises a third nucleic acid, a third fluorescent molecule, and a third quencher. In some embodiments, the third nucleic acid is complementary to the subject-specific RNA sequence. In some embodiments, the third molecular beacon comprises a hairpin nucleic acid or a linear nucleic acid.

[0023] In some embodiments, the first, second, and third fluorescent molecules are the same. In some embodiments, the first, second, and third fluorescent molecules are different. In some embodiments, the first, second, and third quenchers are the same. In some embodiments, the first, second, and third quenchers are different.

[0024] In some embodiments, the third molecular beacon emits a fluorescent signal when bound between the ends of the RNA sequence.

[0025] In some embodiments, the personalized therapeutic composition comprises the full- length RNA sequence and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, or a cream. In some embodiments, the personalized therapeutic composition is administered to the subject. In some embodiments, the personalized therapeutic composition is administered with an additional therapeutic composition.

[0026] BRIEF DESCRIPTION OF FIGURES

[0027] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0028] Figures 1A-1B show the structures of the molecular beacon alone (Figure 1 A) and in the presence of a target nucleic acid sequence (Figure IB). Figure 1A shows the unbound molecular beacon, fluorescent molecule F is localized sufficiently near a quencher molecule Q that the fluorophore shows no (or diminished) fluorescence intensity. Figure IB shows the binding on the target RNA, the duplex holding F and Q in proximity is disrupted, such that the increase distance is sufficient to eliminate (or reduce) the quenching of F by Q, leading to an increase fluorescence intensity from F.

[0029] Figure 2 shows the differential beacon responses. The illustration shows 3 classes of RNA. Figure 2 (#1) shows the desired RNA. Figure 2 (#2) shows the RNA containing a self- encoded extension at the 3’ end, resulting in regions of dsRNA. Figure 2 (#3) shows the truncated RNAs. All three classes bind to a beacon targeting a sequence towards the 5’ end of the RNA. Class 1 binds a beacon targeting a sequence near the 3’ end of the RNA.

[0030] Figures 3A-3D show the demonstration of approach. Figure 3A shows the molecular beacon approach, as presented in Figures 1A-1B. Figure 3B shows the gel and BioAnalyzer 2100 characterizations of the 975 base RNA (mRNA encoding nanoluciferase), synthesized under different concentrations of added NaCl, using a gapped promoter that provides salt resistance. Figure 3C shows the fluorescence spectra of four different probes targeting four different regions of the mRNA, for RNA’s generated under the different concentrations of added NaCl; in each spectrum one beacon is added to a particular RNA preparation. Figure 3D shows the map showing the positions targeted by the four different molecular beacons, along with the expected outcomes for each probe, applied to each class of RNA presented in Figure 2.

[0031] Figure 4 shows the swapping of beacon sequences with respect to position. Two different classes of RNAs were prepared: the first is presented in Figures 3A-3D. The second class exchanges the sequence originally at position 961 of the RNA with the sequence originally at position 961. In other words, the sequence originally at position 11 is moved to position 961 and the sequence originally at position 961 is moved to position 11.

[0032] Figure 5 shows an example application of real-time monitoring in a flow reactor. Illustration of a representative flow reactor, comprised of three identical, parallel reactor chambers combined into one outflow. The outflow is then sampled, with that small stream split into two identical streams. To one stream beacon 1 is added and fluorescence intensity is measured. To the second stream beacon 2 is added and fluorescence intensity is measured. The concentration and quality of the product RNA inferred by fluorescence informs reactor parameters (e.g., flow rate) to provide real-time feedback control. At the same time, the metrics can feed back to valves that either direct the product to further processing, or in the case of metrics not meeting expectation, direct the product to waste or alternative collection.

[0033] Figures 6A-6C show the independent quality metrics of RNA produced under varying added concentrations of NaCl. Transcription using a gapped promoter allows the use of increasing concentrations of added NaCl to decrease 3’ extensions during RNA synthesis. Equal amounts of total RNA generated under different conditions (and treated to remove salt and other small molecules) were transformed into HEK293T cells and cells were grown for 48 h. A) Since the mRNA encodes nanoluciferase, luminescence from the cells reports on the translatability of the transfected RNA (dsRNA down-regulates translation in the reporter cells). B-C) RT-qPCR analysis of different genes well-known to be up-regulated by contaminant dsRNA. B: interferon IFN-01. C: cellular pattern recognition receptor MDA5 (Melanoma Differentiation-Associated protein 5). I:C refers to commercial polyLC, which is a commercially available molecule widely used as a standard to mimic dsRNA impurities.

[0034] Figures 7A-7C show the electrophoretic characterizations of RNA pools. Figures 7A- 7C show that the RNA was transcribed under the indicated concentrations of added NaCl was analyzed by polyacrylamide gel electrophoresis (PAGE) and by BioAnalyzer 2100 (Agilent). Figure 7C shows the original data, while Figure 7B shows a gel-like representation of the data in Figure 7B (as provided by the instrument). In both cases, the electropherograms (incorrectly) show the presence of truncated RNA, with more at 300 mM added NaCl and less at 400 mM added NaCl. The results presented in Figures 8A-8B show that, instead, the signal at apparent shorter lengths is likely due to residual structure throughout the RNA, perhaps arising from differences in desalting. This is consistent with a similar agreement in the responses presented in Figures 6A-6C.

[0035] Figures 8A-8B show the expansion of data in Figures 3A-3D. Comparison of results from Figure 8 A show beacon position 11 and Figure 8B show beacon position 961 from Figure 3D. Note that the ratios for RNA synthesized at 300 mM added NaCl are very close to those for RNA synthesized at 400 mM added NaCl.

[0036] DETAILED DESCRIPTION

[0037] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.

[0038] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0039] Terminology

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of’ can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.

[0041] The following definitions are provided for the full understanding of terms used in this specification.

[0042] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non- limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%.

[0043] As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0044] "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of" when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0045] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% or more increase so long as the increase is statistically significant.

[0046] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.

[0047] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0048] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0049] A "probe" when used in the context of nucleic acid detection refers to an oligonucleotide that is provided as a reagent to detect a target present in a sample of interest by hybridizing with the target. Usually, a probe will comprise a label or a means by which a label can be attached, either before or subsequent to the hybridization reaction. Suitable labels include, but are not limited to radioisotopes, fluorochromes, chemiluminescent compounds, dyes, and proteins, including enzymes. The molecular beacons provided herein are considered to be probes for detecting, quantifying, and assessing full-length RNA, defective RNA, and / or RNA contamination in a sample that is isolated or manufactured.

[0050] A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5 -carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule.

[0051] The term “mRNA” refers to messenger ribonucleic acid, or single stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is translated by a ribosome in the process of synthesizing a protein. mRNA is created during the process of transcription, where a gene is converted into a primary transcript mRNA (or pre-mRNA). The primary transcript is further processed through RNA splicing to only contain regions that will encode protein.

[0052] The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403 410), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed above).

[0053] A “variant,” “mutant,” or “fragment” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides over a certain defined length relative to a reference polynucleotide.

[0054] As used herein, “truncated RNA” refers to a type of damaged RNA molecule wherein 5’ and / or 3’ end of the RNA has become degraded over time or the synthesis of the RNA molecule is prematurely terminated leading to the loss of function(s).

[0055] As used herein, “cleaved RNA” refers to another type of damaged RNA molecule wherein an endonuclease or exonuclease enzymes targets and degrades the RNA molecule, leading to the loss of function(s). It should be noted that the endonuclease enzyme begins degrading between the 5’ and 3’ ends of the RNA, while the exonuclease enzyme begins degrading at either the 5’end or the 3’end of the RNA.

[0056] As used herein, “downstream” refers to a direction of transcription, the direction of transcription being from a promoter sequence to an RNA-encoding sequence. For a template strand of a double-stranded DNA molecule, the direction of transcription is 3’ to 5’. For a nontemplate strand of the double-stranded DNA molecule, the direction of transcription is 5’ to 3’. “Upstream” means in a direction opposite the direction of transcription. “Upstream” and “downstream” may be used in reference to either strand of a double-stranded DNA molecule even when relative to a sequence on one strand of a double-stranded DNA molecule.

[0057] The term “interaction” refers to an action that occurs as two or more objects have an effect on one another either with or without physical contact. In terms of biological interactions, cell, proteins, and other macromolecules can have said effects on one another to impact biological functions, such as cell / tumor growth, cell death, and cell signaling pathways. The molecular beacons provided herein contact and interact with RNA sequences to distinguish full-length RNAs from defective RNAs and / or RNA contamination.

[0058] The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra- arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques.

[0059] The term “detect” or “detecting” refers to observing a presence or absence of an output signal released for the purpose of sensing of physical phenomenon. An event or change in environment is sensed and signal output released in the form of light, and the presence of the signal output is observed. Alternatively, an event or change in environment is not sensed and no signal output is released, and the presence of the signal output is not observed.

[0060] A “fluorophore” is a fluorescent molecule that can re-emit light upon light excitation. The chemicals are sometimes used alone as a tracer in fluids, as a dye for staining certain structures, as an enzyme substrate, or as a probe / indicator. More commonly they are covalently bonded to a macromolecule to serve as a marker for bioactive reagents (i.e.: antibodies, peptides, nucleic acids, etc.) Fluorophores are notably used to stain tissues, cells, or materials in a variety of analytical methods such as fluorescent imaging and spectroscopy. It should be understood that throughout this disclosure fluorophore and fluorescent molecule are used interchangeably .

[0061] A ’’quencher” refers to a molecule or compound capable of either exhibiting a dipoledipole interaction or exhibiting electron transfer processes with the fluorophore, and re- emitting the energy in another form of thermal energy such as, for example heat energy or light energy.

[0062] As used herein, “quantity” refers to a measurable finite or total number of a composition, nucleic acid, or compound.

[0063] As used herein, “quality” refers to a measurable characterization, such as for example purity, structural integrity, and / or function(s), of a composition, nucleic acid, or compound.

[0064] "Pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.

[0065] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents.

[0066] As used herein, the term “carrier” encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia, PA, 2005. Examples of physiologically acceptable carriers include saline, glycerol, DMSO, buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEEN™ (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICS™ (BASF; Florham Park, NJ). To provide for the administration of such dosages for the desired therapeutic treatment, compositions disclosed herein can advantageously comprise between about 0.1% and 99% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent. Methods

[0067] Molecular beacons are oligonucleotide dual-labeled probes that quench fluorescence for a stem-loop / hairpin structure in the native state and fluoresce upon hybridization with a target nucleic acid sequence. A typical molecular beacon probe is about 25 nucleotides long with the middle 15 nucleotides being complementary to the target DNA or RNA, and typically do not base pair with one another. The remaining approximately 10 nucleotides at the 5’ and 3’ ends are complementary to each other and form the hairpin structure. Typical molecular beacons can also be divided into 4 segments: (1) a loop, having about 15 bases pairs, complementary to the target DNA or RNA; (2) a stem, formed by the binding of the 5’ end to the 3’ end of the probe (roughly about 5 to 7 base pairs); (3) a 5’ fluorophore covalently attached to the probe; and (4) a 3’ quencher covalently attached to the probe. Alternatively, it may have a (5) a 3’ fluorophore covalently attached to the probe; and (6) a 5’ quencher covalently attached to the probe.

[0068] Since typical applications will need high sensitivity, the molecular beacons disclosed herein can be shorter relative to typical molecular beacons used in the art. The present disclosure provides molecular beacons that are about 15-20 nucleotides in length. Similar to typical molecular beacons, the present disclosure also provides molecular beacons with a loop (about 10 - 15 nucleotide residues), a stem (about 5 nucleotide residues), a 5’ fluorophore, and a 3’ quencher. The molecular beacons disclosed herein can comprise a fluorescent molecule / fluorophore known in the art and can comprise a quencher known in the art.

[0069] Fluorophores are compounds or molecules that luminesce. Typically fluorophores absorb electromagnetic energy at one wavelength and emit electromagnetic energy, in the form of light, at a second wavelength. In some embodiments, the fluorophore is derived from the fluorescein / rhodamine family of fluorophores including, but not limited to Fluorescein (6- FAM); 6-FAM (NHS Ester); Fluorescein deoxy thymine(dT); SUN; Hexachlorofluorescein (HEX); 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein (JOE); MAX (NHS Ester); tetrachlorofluorescein (TET); 5 -Carboxy fluorescein (5-FAM); 5-Carboxynapthofluorescein; 5-Carboxytetramethylrhodamine (5-TAMRA); TAMRA (NHS Ester); Texas Red 615; 5-ROX (carboxy-X-rhodamine); 6-Carboxyrhodamine 6G; Dichlorodihydrofluorescein Diacetate (DCFH); Dihydorhodamine 123 (DHR); Fluorescein Diacetate; Lissamine Rhodamine; Lissamine Rhodamine B; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B; Rhodamine B 200; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine: Phalloidine; Rhodamine Red; Rhodamine WT; X-Rhodamine, or derivatives thereof.

[0070] In some embodiments, the fluorophore is derived from the cyanine 3 / cyanine 5 (Cy3 / Cy5) fluorophores including, but not limited to Cy3 / Cy5, C3, C5, Cy5.5, or derivatives thereof. In some embodiments, the fluorophore is derived from an ATTO dye, a TYE dye, or an Alexa Fluor Dye including, but not limited to ATTO 488, ATTO 532, ATTO 550, ATTO 565, ATTO RholOl, ATTO 590, ATTO 633, ATTO 647N, TYE 563, TYE 665, TYE 705, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 561, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, or derivatives thereof.

[0071] Alternatively, quenchers are molecules capable of absorbing the electromagnetic energy of the electronic excited states of fluorophores. Non-limiting examples of quenchers to be attached to the 3’ end of the molecular beacon includes black hole quenchers (BHQ) (such as, for example BHQ-1, BHQ-2, BHQ-3, 3’-BHQ-2 CPG, BHQ phosphoramidites, BHQ-1- dT, BHQ-2-dT, 3 ’-BHQ-1 CPG, 3 ’-BHQ-3 CPG, and derivatives thereof), Iowa Black quenchers (such as, for example Iowa Black FQ and Iowa Black RQ), blackberry quenchers (such as, for example BBQ-650-CE Phosphoramidite, BBQ-650-dT-CE Phosphoramidite, BBQ-650 CPG, 3’-BBQ-650 CPG, 3’-BBG-650 CPG II, 3’-BBQ-650 CPG III, and derivative thereof), eclipse quenchers (such as, for example eclipse quencher phosphoramidite, MGB eclipse CPG, eclipse quencher CPG, 3’ eclipse dark quencher, and derivatives thereof), dihydropyrroloindole-carboxylate tripeptide major groove binding (CDPI MGB) quenchers (such as, for example CDPI3 MGB CPG, CDPI3 MGB Phosphoramidite, and derivative thereof), and dabcyl quenchers (such as, for example 3’-dabsyl CPG, 3’-dabsyl PS, dabsyl phorphoramidite, and derivatives thereof).

[0072] It should be noted that the any fluorophore and any quencher disclosed herein can be paired together to form a molecular beacon needed to perform the desired effect.

[0073] The present disclosure provides methods of detecting a defective, unwanted, undesirable, and / or unexceptional ribonucleic acids (RNAs). The present disclosure also provides methods of measuring quantity and / or quality of an RNA, even in the presence of large excess of free nucleosides or nucleotides. It should be noted that the present disclosure differs from conventional methods that rely on measuring absorption (including, but not limited to NanoDrop), but cannot distinguish RNA from precursor molecules, such as DNA or substrate ribonucleoside triphosphates (NTP’s). The present disclosure also provides methods validating a personalized therapeutic composition comprising an RNA.

[0074] In one aspect, disclosed herein is a method of detecting or assessing a defective RNA in a sample, the method comprising isolating or manufacturing an RNA sequence, contacting the RNA sequence with at least two molecular beacons, wherein the at least two molecular beacons comprise a first and a second nucleic acid, wherein the first nucleic acid is covalently linked to a first fluorescent molecule and a first quencher, and wherein the second nucleic acid is covalently linked to a second fluorescent molecule and a second quencher, and detecting decreased fluorescence emitted by a second molecular beacon relative to the fluorescence emitted by a first molecular beacon when the sample comprises the defective RNA.

[0075] In one aspect, disclosed herein is a method of measuring quantity and quality of an RNA sequence in a sample, the method comprising isolating or manufacturing the RNA sequence, binding a first molecular beacon to an end of the RNA sequence and binding a second molecular beacon to an opposite end of the RNA sequence, wherein a full-length RNA sequence binds the first and second molecular beacon and a defective RNA sequence binds the first molecular, detecting an RNA quantity from the first molecular beacon binding the RNA sequence, and detecting an RNA quality from a ratio of the second molecular beacon binding the RNA sequence relative to the first molecular beacon binding the RNA sequence. In some embodiments, a sample having a high ratio has higher quality RNA than a sample having a low ratio.

[0076] In one aspect, disclosed herein is a method of validating a personalized therapeutic composition, the method comprising isolating or manufacturing an RNA sequence, binding a first, a second, and a third molecular beacon to the RNA sequence, wherein the first molecular beacon binds at an end of the RNA sequence, the second molecular beacon binds at an opposite end of the RNA sequence, and the third molecular beacon binds between the ends of the RNA sequence, detecting a full-length RNA sequence that binds the first, second and third molecular beacons, and incorporating the full-length RNA sequence into the personalized therapeutic composition.

[0077] It should be noted that the first molecular beacon and the second molecular beacon of any preceding aspect bind at opposite ends of the RNA sequence. For example, when the first molecular beacon binds at or near the 5’ end of the RNA sequence, then the second molecular beacon binds at or near the 3 ’ end of the RNA sequence. The reverse of the preceding example is also true. In one aspect, disclosed herein is a method of any preceding aspect, wherein one or more molecular beacons is a quencher- free (QF) molecular beacon comprising a nucleic acid sequence covalently linked to a fluorescent molecule (fluorophore), wherein the nucleic acid sequence comprises a region of repeated nucleotides near the 5’ end or the 3’ end. In some embodiments, the region of repeated nucleotides serve as an alternative quencher. In some embodiments, the region of repeated nucleotides includes, but is not limited to guanosines repeats (G)n, and CAG repeats (CAG)n.

[0078] It should be noted that that RNA sequence can be isolated from a tissue or cell source, or can be manufactured by manually assembling adenine, guanine, cytosine, and uracil nucleotides into an RNA sequence.

[0079] In some embodiments, the first fluorescent molecule is linked to the 5’ end of the first nucleic acid and the first quencher is linked to the 3’ end of the first nucleic acid. In some embodiments, the second fluorescent molecule is linked to the 5’ end of the second nucleic acid and the second quencher is linked to the 3 ’ end of the second nucleic acid.

[0080] In some embodiments, the first fluorescent molecule is linked to the 3’ end of the first nucleic acid and the first quencher is linked to the 5’ end of the first nucleic acid. In some embodiments, the second fluorescent molecule is linked to the 3’ end of the second nucleic acid and the second quencher is linked to the 5 ’ end of the second nucleic acid.

[0081] In some embodiments, the first and second fluorescent molecules are the same. In some embodiments, the first and second fluorescent molecules are different. In some embodiments, the first and second quenchers are the same. In some embodiments, the first and second quenchers are different.

[0082] In some embodiments, the method comprises two, three, four, or more molecular beacons. In some embodiments, the defective RNA comprises a double stranded RNA (dsRNA), a truncated RNA, or a cleaved RNA. In some embodiments, the defective RNA comprises partially dsRNA, wherein a region of the RNA is single stranded, however a smaller region, usually at the ends, is double stranded (See Figure 2, item 2).

[0083] In some embodiments, the first and second nucleic acid comprise a hairpin nucleic acid or a linear nucleic acid. In some embodiments, the hairpin nucleic acid transforms into the linear nucleic acid in the presence of a full-length RNA.

[0084] In some embodiments, a first molecular beacon targets and binds at or near a 5’ region of the RNA sequence. In some embodiments, the first molecular beacon binds with the first 250bps of the RNA sequence. In some embodiments, the first molecular beacon binds with the first 100bps of the RNA sequence. In some embodiments, the first molecular beacon binds within the first 50 bps of the RNA sequence. In some embodiments, the first molecular beacon binds with the first 25 base pairs (bps) of the RNA sequence. In some embodiments, the first molecular beacon binds with the first 10 base pairs (bps) of the RNA sequence. In some embodiments, the first molecular beacon binds with the first 5 base pairs (bps) of the RNA sequence. In some embodiments, the first molecular beacon binds within the first 5, 6, 7, 8, 9,

[0085] 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,

[0086] 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59,

[0087] 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

[0088] 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,

[0089] 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0090] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0091] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0092] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0093] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202,

[0094] 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221,

[0095] 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240,

[0096] 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, or more bps of the RNA sequence.

[0097] In some embodiments, a second molecular beacon targets and binds at or near a 3’ region of the RNA sequence. In some embodiments, the second molecular beacon binds within the last 250 bps of the RNA sequence. In some embodiments, the second molecular beacon binds within the last 100 bps of the RNA sequence. In some embodiments, the second molecular beacon binds within the last 50 bps of the RNA sequence. In some embodiments, the second molecular beacon binds within the last 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108,

[0098] 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127,

[0099] 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146,

[0100] 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165,

[0101] 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184,

[0102] 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203,

[0103] 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241,

[0104] 242, 243, 244, 245, 246, 247, 248, 249, 250, or more bps of the RNA sequence.

[0105] The present disclosure also allows for one of skill in the art to detect very long dsRNA elements, and can place the molecular beacon 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128,

[0106] 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147,

[0107] 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166,

[0108] 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 , 182, 183, 184, 185,

[0109] 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204,

[0110] 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223,

[0111] 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242,

[0112] 243, 244, 245, 246, 247, 248, 249, 250, or more from the 3’ end of the dsRNA.

[0113] In some embodiments, someone practiced in the art may prefer to detect only very long dsRNA elements and so may choose to place the beacon 100, 150, 200 or more bases from the 3’ end.

[0114] When RNA is being transcribed from DNA, the 3’ end of RNA is the last region to be synthesized. In some embodiments, the poly(A) tail is encoded in the precursor DNA sequence. In some embodiments, following completion of RNA transcription, a poly adenylated tail (poly (A) tail) of adenosine monophosphates is added to the 3’ end of the RNA. The addition of the poly(A) tail occurs by polyadenylation. In some embodiments, the second molecular beacon binds after a polyadenylate (poly A) tail of the RNA sequence. In some embodiments, to promote binding after the poly(A) tail, one of skill in the art can include 5 or more heterogeneous nucleotides following the poly(A) tail, thus providing the molecular beacon a binding site to bind very close to the 3’ end. In some embodiments, characterization would typically precede the enzymatic addition of a poly(A) tail.

[0115] In some embodiments, the second molecular beacon does not bind the RNA sequence in a defective RNA. In some embodiments, the first molecular beacon emits a fluorescent signal when bound to the RNA sequence. In some embodiments, the second molecular beacon emits a fluorescent signal when bound to the RNA sequence. In some embodiments, the second molecular beacon does not emit the fluorescent signal in the presence of the defective RNA.

[0116] Spectroscopy relates to the production, measurement, and interpretation of spectra arising from the interaction of electromagnetic energy with matter. In relation to biological materials, there are various types of spectroscopic methods, including, but not limited to fluorescence spectroscopy, ultraviolet-visible (UV-Vis) spectroscopy, atomic spectroscopy, infrared (IR) spectroscopy, and nuclear magnetic resonance (NMR) spectroscopy, that ultimately allow for the detection, monitoring, quantification, and analyses of biological molecules, such as DNA, RNA, and / or proteins. Thus, the present disclosure provides methods of using spectroscopy, such as, for example fluorescence spectroscopy, in combination with the molecular beacons to distinguish between full-length RNA and defective / contaminating RNA. In some embodiments, the method detects the fluorescent signal using a spectroscopy technique, or derivatives thereof. In some embodiments, the method measures quantity and quality of the RNA sequence. In some embodiments, the ratio comprises the fluorescent signal from the second molecular beacon relative to the fluorescent signal from the first molecular beacon.

[0117] In some embodiments, a research grade spectrometer is replaced by a limited wavelength light source, such as a light emitting diode (LED) with appropriate filter, for excitation of the fluorophore, and a simple sensor, combined with an appropriate filter, to detect fluorescent light. This approach is well-known to those practiced in the art and is applicable to the real-time monitoring as described in Figure 5.

[0118] In some embodiments, the defective RNA sequence does not bind the second molecular beacon. In some embodiments, the first molecular beacon comprises a first nucleic acid, a first fluorescent molecule, and a first quencher. In some embodiments, the second molecular beacon comprises a second nucleic acid, a second fluorescent molecule, and a second quencher. In some embodiments, the third molecular beacon comprises a third nucleic acid, a third fluorescent molecule, and a third quencher. In some embodiments, the first nucleic acid is complementary to the 5 ’end of the RNA sequence. In some embodiments, the second nucleic acid is complementary to the 3’ end of the RNA sequence.

[0119] In some embodiments, the method further comprises detecting a defective RNA sequence that binds the first molecular beacon, but not the second or third molecular beacon. In some embodiments, the first molecular beacon measures a quantity of the RNA sequence. In some embodiments, the first and second molecular beacons measure a quality of the RNA sequence. In some embodiments, the third molecular beacon identifies a subject-specific RNA sequence.

[0120] Personalized medicine, also termed precision medicine, is a relatively new medical practice that utilizes individual patient’s genomic profile to guide decisions made in regard to the prevention, diagnosis, and treatment of a disease and / or disorder. Gathering knowledge of the patient’s genetic profile allows for medical practitioners to select and administer the proper medication and / or therapy in the proper dosing regimen. Herein, the present disclosure provides methods of incorporating molecular beacons into personalized medicine as a means to assess the quantity, quality, and accuracy of RNA therapeutic compositions. Incorporating the molecular beacon into personalized medicine allows for research professionals and / or medical practitioners to confirm that the RNA therapeutic compositions isolated and / or manufactured accurately reflect the RNA sequences identified to treat an individual patient.

[0121] In some embodiments, the personalized therapeutic composition comprises the full- length RNA sequence and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, or a cream. In some embodiments, the personalized therapeutic composition is administered to the subject. In some embodiments, the personalized therapeutic composition is administered with an additional therapeutic composition including, but not limited to an inhibitor, an antibody, an antibiotic, an antiviral, an anti-inflammatory compound, an anesthetic, a sedative, or combinations thereof.

[0122] The method of any preceding aspect can be performed “off-line”, wherein the molecular beacon of any preceding aspect is manually delivered to a target RNA sequence for assessing the quantity, quality, and / or accuracy of the target RNA sequence. The method of any preceding aspect can also be performed “in-line”, wherein the molecular beacon of any preceding aspect is incorporated into an automated process or instrument to allow for more efficient and automatic assessments of quantity, quality, and / or accuracy of the target RNA sequence.

[0123] A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0124] By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below.

[0125] EXAMPLES

[0126] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0127] Example 1 : A method to assess RNA contamination and integrity both off-line and on-line.

[0128] Molecular beacons were invented in the 1990’ s and are widely used to probe for specific nucleic acid sequences. The basic principle is that the beacon normally forms a hairpin structure (Figure 1 A). A fluorescence molecule is covalently attached to the 5’ end of the DNA and quencher is attached to the 3’ end (or vice versa). The quencher, when in close proximity to the fluorophore, “quenches” the fluorescence excited state of the fluorescent molecule, such that beacon is non-fluorescent or “dark” when the adjacent base pairs in the stem form a duplex.

[0129] Molecular beacons are designed so that the sequence (or a part of the sequence) in the loop is complementary to the target sequence being assayed. When the beacon binds to such a sequence, the stem is disrupted, and the fluorescence molecule and the quencher are physically separated; the fluorophore now exhibits its intrinsic fluorescence (Figure IB).

[0130] The present disclosure can distinguish the desired full-length RNA (1) from products 2 and 3 (Figure 2). The invention can also be implemented in-line in a microfluidics environment. The latter allows incorporation of this as a real-time monitor of both quantity and quality of the mRNA being produced.

[0131] The primary application is shown in Figures 3A-3D. Molecular beacons target unique sequences at the very beginning and the very end of the RNA. The beacon at the 5 ’ end will bind to all RNA and so will report on total RNA quantity. Full length / correct length RNA will bind both beacons (Figure 3D, top strands), while partially double stranded RNA (Figure 3D, middle strands) will not bind the beacon. Truncated RNA (Figure 3D, bottom strands) will also not bind the beacon. Thus the ratio of fluorescence intensity from the 3 ’ beacon relative to the 5’ beacon reports on the fraction of correct length I full-length RNA - the quality of the RNA.

[0132] These results confirm this approach. It is known from other assays on a variety of RNAs, that increasing salt in the transcription reaction leads to less partially double stranded RNA. Transcription was carried out at 0 mM to 400 mM added NaCl and the RNAs analyzed with 5’ and 3’ specific beacons, plus two others. In this case, constant amounts of RNA were examined, as reflected in the constant fluorescence intensities from a probe at position 11 (extreme 5’ end). Conversely, for a 3’ probe (position 961), signal maximizes in correlation with the salt concentration used in the original transcription (Figure 4). As known from other approaches, contaminating double stranded RNA is seen to be lowest at 300-400 mM NaCl.

[0133] Results from a probe at position 63 confirm the results at position 11. The probe at position 782 is about 80% of the way along the RNA. The two measurements (preliminary) at OmM and 300 mM NaCl are close in intensity, suggesting that the trend seen at 960 reflects double stranded RNA, rather than (randomly) truncated RNA.

[0134] The present disclosure demonstrates a valuable off-line assay. An in-line approach is also demonstrated (Figure 5). The diagram shows a flow reactor but with the addition of a small sampling stream just beyond the (three in parallel) reactor. In this use, a very small output stream is extracted in real time, flowing to a point that splits the stream into two streams. A 5’- specific beacon is then mixed into one stream and a 3 ’-specific beacon is mixed into the other stream. As above, fluorescence intensity from the 5’ beacon would report on total RNA, while the ratio of intensities from the 3’ compared to the 5’ beacons reports on quality. Each of these could then give feedback to control flow rates to optimize both yield and quality. These values also serve as quality control feedback. If the ratio drops below a threshold or the quantity drops below a threshold, valves redirect the flow away from the production stream until such time as a correction is applied.

[0135] For personalized immunotherapy therapeutics, each oncology patient has a different mutation in their cancer cell DNA. The device described previously can be used to manufacture a large number of different sequences in parallel, one for each patient. One concern in the parallelization is certifying that the final drug substance or drug product is the patient-specific sequence (at the moment, upstream processes, such as template DNA production is done prior to mRNA manufacturing, so there is potential for mix-ups or cross-contamination prior to single-path mRNA manufacturing).

[0136] A molecular beacon specific to the patient-specific mutation is generated at low scale (the supplier already has massive parallel DNA synthesis) and delivered to the platform. A third channel (split from the dual channel path above) contains a patient- specific beacon to confirm, in real time, that the mRNA matches the patient mutation. Since this is near or at the final stage in manufacturing, it provides assurance that the desired product is delivered to the patient.

[0137] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

[0138] SEQUENCES

[0139] 1. SEQ ID NO: 1 - Sequence targeted by molecular beacon (first 11 nucleotides).

[0140] GAGAAAAGAAGAGTA

[0141] 2. SEQ ID NO: 2 - Sequence targeted by molecular beacon (first 63 nucleotides). AAGATTTCGTTGGGG

[0142] 3. SEQ ID NO: 3 - Sequence targeted by molecular beacon (first 782 nucleotides). GCTGTCCAATTTCTA

[0143] 4. SEQ ID NO: 4 - Sequence targeted by molecular beacon (first 961 nucleotides). ATGTGCCTGCTATCT

[0144] 5. SEQ ID NO: 5 - 5’ UTR sequence

[0145] AGAAATAAGAGAGAAAAGAAGAGTAAGAA

[0146] 6. SEQ ID NO: 6 - 3’ UTR sequence

[0147] AACTCGAGCAC(X)nCCTGCTATCT

[0148] 7. SEQ ID NO: 7 - Example sequence with targets of molecular beacons underlined (while the DNA sequence is listed here, the corresponding RNA sequence is also disclosed).

[0149] AGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGTCT

[0150] TCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGG

[0151] ACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTC

[0152] CGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGA

[0153] CATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGAT

[0154] CGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATC

[0155] CTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATT

[0156] TCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAA

[0157] CAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCG

[0158] ACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTG CGAACGCATTCTGGCGGGCGGCGGATCTGAGAATTTATATTTCCAGGGCGCTCGT

[0159] AATGCATACCTGCGTAAAAAAATCGCGCGTTTAAAAAAAGACAACTTGCAACTT GAGCGCGACGAACAAAATTTGGAGAAAATAATCGCCAACCTTCGGGACGAGATC

[0160] GCGCGTCTGGAAAACGAGGTGGCTTCGCATGAGCAACTCGAGCACCACCACCAC

[0161] CACCACTGAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCC

[0162] TAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTC

[0163] TGCCTAATAAAAAACATTTATTTTCATTGCAAAAAAAAAAAAAAAAAAAAAAAA

[0164] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTGCCTGCTATCT

Claims

CLAIMSWhat is claimed is:

1. A method of detecting a defective RNA in a sample, the method comprising: isolating or manufacturing an RNA sequence, contacting the RNA sequence with at least two molecular beacons, wherein the at least two molecular beacons comprise a first and a second nucleic acid, wherein the first nucleic acid is covalently linked to a first fluorescent molecule and a first quencher, and wherein the second nucleic acid is covalently linked to a second fluorescent molecule and a second quencher, and detecting decreased fluorescence emitted by a second molecular beacon relative to the fluorescence emitted by a first molecular beacon when the sample comprises the defective RNA.

2. The method of claim 1, wherein the first fluorescent molecule and the first quencher are placed at opposite ends of the first nucleic acid.

3. The method of claim 1 or 2, wherein the second fluorescent molecule and the second quencher are linked at opposite ends of the second nucleic acid.

4. The method of any one of claims 1-3, wherein the first and second fluorescent molecules are the same.

5. The method of any one of claims 1-4, wherein the first and second fluorescent molecules are different.

6. The method of any one of claims 1-5, wherein the first and second quenchers are the same.

7. The method of any one of claims 1-6, wherein the first and second quenchers are different.

8. The method of any one of claims 1-7, wherein the method comprises two, three, four, or more molecular beacons.

9. The method of any one of claims 1-8, wherein the defective RNA comprises a double stranded RNA (dsRNA), a truncated RNA, or a degraded RNA.

10. The method of any one of claims 1 -9, wherein the first and second nucleic acid comprise a hairpin nucleic acid or a linear nucleic acid.1 1 . The method of any one of claims 1 -10, wherein the hairpin nucleic acid transforms into the linear nucleic acid in the presence of a full-length RNA.

12. The method of any one of claims 1-11, wherein the first molecular beacon binds within a first or last 250 base pairs (bps) of the RNA sequence.

13. The method of any one of claims 1-12, wherein the second molecular beacon binds within a first or last 250 bps of the RNA sequence.

14. The method of any one of claims 1-13, wherein the second molecular beacon binds after a polyadenylate (poly A) tail of the RNA sequence.

15. The method of any one of claims 1-14, wherein the first molecular beacon emits a fluorescent signal when bound to the RNA sequence.

16. The method of any one of claims 1-15, wherein the second molecular beacon emits a fluorescent signal when bound to the RNA sequence.

17. The method of any one of claims 1-16, wherein the method detects the fluorescent signal using a spectroscopy technique, or derivatives thereof.

18. The method of any one of claims 1-17, wherein the method measures quantity and quality of the RNA sequence.

19. A method of measuring quantity and quality of an RNA sequence in a sample, the method comprising:isolating or manufacturing the RNA sequence, binding a first molecular beacon to an end of the RNA sequence and binding a second molecular beacon to an opposite end of the RNA sequence, wherein a full-length RNA sequence binds the first and second molecular beacon and a defective RNA sequence binds the first molecular, detecting an RNA quantity from the first molecular beacon binding the RNA sequence, and detecting an RNA quality from a ratio of the second molecular beacon binding the RNA sequence relative to the first molecular beacon binding the RNA sequence.

20. The method of claim 19, wherein the first molecular beacon comprises a first nucleic acid, a first fluorescent molecule, and a first quencher.

21. The method of claim 19 or 20, wherein the second molecular beacon comprises a second nucleic acid, a second fluorescent molecule, and a second quencher.

22. The method of any one of claims 19-21, wherein the first and second nucleic acid comprise a hairpin nucleic acid or a linear nucleic acid.

23. The method of any one of claims 19-22, wherein the hairpin nucleic acid transforms into the linear nucleic acid in the presence of the full-length RNA.

24. The method of any one of claims 19-23, wherein the first and second fluorescent molecules are the same.

25. The method of any one of claims 19-24, wherein the first and second fluorescent molecules are different.

26. The method of any one of claims 19-25, wherein first and second quenchers are the same.

27. The method of any one of claims 19-26, wherein the first and second quenchers are different.

28. The method of any one of claims 19-27, wherein the defective RNA comprises a double stranded RNA (dsRNA), a truncated RNA, or a degraded RNA.

29. The method of any one of claims 19-28, wherein the first molecular beacon binds within the first or last 250 base pairs (bps) of the RNA sequence.

30. The method of any one of claims 19-29, wherein the second molecular beacon binds within the first or last 250 bps of the RNA sequence.

31. The method of any one of claims 19-30, wherein the second molecular beacon binds after a polyadenylate (poly A) tail of the RNA sequence.

32. The method of any one of claims 19-31, wherein the first molecular beacon emits a fluorescent signal when bound to the RNA sequence.

33. The method of any one of claims 19-32, wherein the second molecular beacon emits a fluorescent signal when bound to the RNA sequence.

34. The method of any one of claims 19-33, wherein the ratio comprises the fluorescent signal from the second molecular beacon relative to the fluorescent signal from the first molecular beacon.

35. The method of any one of claims 19-34, wherein the method detects the fluorescent signal using a spectroscopy technique, or derivatives thereof.

36. The method of any one of claims 19-35, wherein the method detects the defective RNA.

37. A method of validating a personalized therapeutic composition, the method comprising: isolating or manufacturing an RNA sequence, binding a first, a second, and a third molecular beacon to the RNA sequence, wherein the first molecular beacon binds at an end of the RNA sequence, the second molecular beacon binds at an opposite end of the RNA sequence, and the third molecular beacon binds between the ends of the RNA sequence,detecting a full-length RNA sequence that binds the first, second and third molecular beacons, and incorporating the full-length RNA sequence into the personalized therapeutic composition.

38. The method of claim 37, wherein the first molecular beacon measures a quantity of the RNA sequence.

39. The method of claim 37 or 38, wherein the first and second molecular beacons measure a quality of the RNA sequence.

40. The method of any one of claims 37-39, wherein the third molecular beacon identifies a subject-specific RNA sequence.

41. The method of any one of claims 37-40, wherein the first molecular beacon comprises a first nucleic acid, a first fluorescent molecule, and a first quencher.

42. The method of any one of claims 37-41, wherein the second molecular beacon comprises a second nucleic acid, a second fluorescent molecule, and a second quencher.

43. The method of any one of claims 37-42, wherein the third molecular beacon comprises a third nucleic acid, a third fluorescent molecule, and a third quencher.

44. The method of any one of claims 37-43, wherein the first molecular beacon binds within the first or last 250 base pairs (bps) of the RNA sequence.

45. The method of any one of claims 37-44, wherein the second molecular beacon binds within the first or last 250 bps of the RNA sequence.

46. The method of any one of claims 37-45, wherein the second molecular beacon binds after a polyadenylate (poly A) tail of the RNA sequence.

47. The method of any one of claims 37-46, wherein the third nucleic acid is complementary to the subject- specific RNA sequence.

48. The method of any one of claims 37-47, wherein the first, second, and third nucleic acids comprise a hairpin nucleic acid or a linear nucleic acid.

49. The method of any one of claims 37-48, wherein the hairpin nucleic acid transforms into the linear nucleic acid in the presence of the full-length RNA.

50. The method of any one of claims 37-49, wherein the first, second, and third fluorescent molecules are the same.

51. The method of any one of claims 37-50, wherein the first, second, and third fluorescent molecules are different.

52. The method of any one of claims 37-51, wherein first, second, and third quenchers are the same.

53. The method of any one of claims 37-52, wherein the first, second, and third quenchers are different.

54. The method of any one of claims 37-53, wherein the first molecular beacon emits a fluorescent signal when bound to the RNA sequence.

55. The method of any one of claims 37-54, wherein the second molecular beacon emits a fluorescent signal when bound to the RNA sequence.

56. The method of any one of claims 37-55, wherein the third molecular beacon emits a fluorescent signal when bound between the ends of the RNA sequence.

57. The method of any one of claims 37-56, wherein the method detects the fluorescent signal using a spectroscopy technique, or derivatives thereof.

58. The method of any one of claims 37-57, wherein the personalized therapeutic composition comprises the full-length RNA sequence and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, or a cream.

59. The method of any one of claims 37-58, wherein the personalized therapeutic composition is administered to the subject.

60. The method of any one of claims 37-59, wherein the personalized therapeutic composition is administered with an additional therapeutic composition.

Images