Mutation-resistant Anti-viral compositions

Abstract

A therapeutic anti-viral strategy uses a plurality of oligonucleotides directed against multiple target sequences within the transcriptome of a virus to produce a mutation-resistant anti-viral composition that inactivates a target virus. A pool of oligonucleotides is identified, each oligonucleotide between 15 and 30 bases in length, and each complementary to a messenger RNA (mRNA) of the target virus, while not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool. The N oligonucleotides of the pool are combined into a single composition, wherein N is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1,000 years of viral replication to less than 0.01, given the genome length, the mutation rate, and the virus production rate of the target virus.

Description

MUTATION-RESISTANT ANTI-VIRAL COMPOSITIONS

[0001] This application claims benefit of United States provisional patent application number 63 / 596,169, filed November 3, 2023, the entire contents of which are incorporated by reference into this application.REFERENCE TO A SEQUENCE LISTING

[0002] The content of the XML file of the sequence listing named “VNLX001_seq”, which is 9 kb in size, created on October 31 , 2024, and electronically submitted herewith the application, is incorporated herein by reference in its entirety.BACKGROUND

[0003] Viral infections are a growing health and financial problem. The COVID-19 pandemic is estimated to have caused $12.5 trillion U.S. of financial damage to the global economy in addition to the nearly 7 million deaths. The combined financial and human cost of viral illnesses such as Zika, flu, Ebola, COVID-19, HIV, Hepatitis B, over several years is incalculable.

[0004] Drugs have only successfully been developed against a minority of viral diseases and infections. Even then, a significant number of the drugs lose their efficacy as a result of viruses developing mutations, rendering them resistant to the effects of the drugs. In addition, efforts to develop vaccines against many viruses have also been hampered by viruses developing mutations. In some viruses, mutation rates can be as low as 10'8to 10'11per incorporated nucleotide (1 mutation in every 100,000,000 to 100,000,000,000 bases) in their genome; however, in rapidly mutating viruses such as HIV and SARS-CoV-2, the causative virus of COVID-19, this rises to 10'3to 10'4per incorporated nucleotide (1 mutation in every 1 ,000 to 10,000 bases) in their genome. This means that every other hepatitis B virus can have a new mutation, each newly produced HIV virion can contain up to 3 mutations, and each new SARS-CoV-2 virus can contain up to 30 mutations.

[0005] The COVID-19 pandemic has demonstrated that new viruses can arise at any time. Furthermore, the unstable political situation across the globe means that biological warfare can never be discounted. If there's a new pandemic or biological attack with a more deadly virus similar to Ebola, the number of fatalities would be much higher. Although it is possible to develop vaccines against some viruses within a period of a few months, we currently do not have any methods to develop effective antiviral drugs within the same time frame, or indeed at all. Therefore, there is a need for a new method to develop effective therapies against viral infections which are not susceptible to the development of antiviral resistance.SUMMARY

[0006] Described herein is a new strategy for the treatment of viral infections, and for developing compositions for such treatment. The approach is advantageous in that it is directed at the weaknesses of the virus and exploits that weakness. These therapies not only obviate the problem of viruses becoming resistant to the effects of the therapy, but also address virus types that have already become resistant to existing drug therapy, or have mutated to form a new viral strain that may reduce the effectiveness of vaccines or existing drug therapy.

[0007] Each drug is highly specific to its viral target (a viral mRNA nucleotide sequence) with human targets (off target interactions) specifically screened out in the development process. In some cases it may be possible that a single drug can act against more than one virus, or against a family of viruses.

[0008] The unique approach described herein is the utilisation of multiple drug targets within the viral genome in order to build bespoke drug therapies to act against them. This multitarget treatment approach uses more than one and up to 10+ oligonucleotide therapeutic chemicals produced against these multiple target sequences within the transcriptome of the virus. These may be double or single stranded nucleotide species, antisense oligonucleotides, siRNA, or similar forms.

[0009] This technique is applicable to any cell type which is either multiplying uncontrollably, or producing an unwanted protein.

[0010] Described herein is a method of producing a mutation-resistant anti-viral composition that inactivates a target virus. In some embodiments, the method comprises identifying a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to a messenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool. The method further comprises combining / V oligonucleotides of the pool into a single composition, wherein / V is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1,000 years of viral replication to less than 0.01, given the genome length, the mutation rate, and the virus production rate of the target virus.

[0011] In some embodiments, at least two oligonucleotides are complementary to mRNAs of different open reading frames. In some embodiments, / V is two. In some embodiments, / V is between 3 and 12. In some embodiments, / V is greater than 12. / V is calculated using theknown or estimated mutation rate per incorporated base, genome length, virus production per day, disease population, expected suppression rate and the number mutations required to render an oligonucleotide ineffective. In some embodiments, the number of mutations required to render an oligonucleotide ineffective ( / W) is 1. In some embodiments, M is 2. In some embodiments, M is 3.

[0012] First, probability calculations are performed for M=1, M=2 and M=3 from A / =1 up to at least N=20 using the formulae below where O is oligomer length, G is genome length / size, R is mutation rate

[0013] M = 1 in X number of oligomers:

[0014] [(O / G) x (R x G)]x= V1x

[0015] M = 2 in X number of oligomers:

[0016] ([(R x G) x (O / G)] x [(R x G) x ((O-1) / G)])x= V2X

[0017] M = 3 in X number of oligomers:

[0018] ([(R x G) x (O / G)] x [(R x G) x ((O-1 ) / G)] x [(R x G) x ((O-2) / G)])x= V3X

[0019] In the above calculations, Vyxis the calculated probability of the virus developing y number of mutations (i.e., M1 , M2 or M3) in a formulation containing X number of oligonucleotides, and is assigned the value V.

[0020] All results are transformed to logarithmic scale by the formula 1 / -log (V). The results of this logarithmic transformation are called P. The P values are then converted to a population time (in years) to event calculation based on estimated disease population size using the formula below:

[0021] t = [P / (Virus production per person per day x disease population x (1 -predicted suppression rate))] / 365, where t is time in years to mutation event and P is the calculated probability of the virus developing y number of mutations (i.e., M1 , M2 or M3) in a formulation containing X number of oligonucleotides after it has been transformed through the 1 / -log (V) operation.

[0022] The results are then transformed to logarithmic scale by using the formula Log (t + 1) to linearise them. This value is termed delta (5) and the first value of N which gives a 5 value of 3 (i.e., 1000 years) or higher is the minimum N value. This can be visualised when values are plotted on a graph ( / V on X-axis and 5 on Y-axis). This allows a clear visualization of when N is large enough to reduce the probability of the virus developing a mutation within the population within a given time period. Minimum N values will be different depending onwhether M is 1 , 2 or 3. Whether M is 1 , 2 or 3 will be different depending on the virus and virus family.

[0023] In some embodiments, the at least two oligonucleotides are complementary to mRNAs of different open reading frames. In some embodiments, N is two. In some embodiments, N is 3 to 15. In some embodiments, N is 5 to 12. In some embodiments, N is greater than 12. In some embodiments, N is up to 20. Representative examples of how to determine N for a given pathogen are described in the Examples below.

[0024] In some embodiments, the target virus is SARS-CoV-2, hepatitis B virus, smallpox virus, or influenza A virus. In some embodiments, the target virus is SARS-CoV-2 and N is 6- 9. In some embodiments, the target virus is hepatitis B virus and N is 4. In some embodiments, the target virus is influenza A virus and N is 3-4.

[0025] In some embodiments, the target virus has a genome of 1.5 kb to 1300 kb. In some embodiments, the target virus has a genome of 10kb to 30 kb. In some embodiments, the target virus has a genome of 15 kb to 20 kb.

[0026] In some embodiments, the oligonucleotides are single stranded or double stranded. In some embodiments, the oligonucleotides comprise a chemical modification, modified nucleobase, and / or a conjugate. In some embodiments, the chemical modification comprises N-acetylgalactosamine. In some embodiments, the conjugate comprises a cell penetrating peptide moiety. In some embodiments, the modified nucleobase is a morpholino base.

[0027] Also described herein is a composition comprising the oligonucleotides that are complementary to the target virus mRNA. In some embodiments, the composition comprises 2 to 20 oligonucleotides. In some embodiments, the composition comprises 5 to 12 oligonucleotides. In some embodiments, the composition comprises 3 to 6 oligonucleotides. Also contemplated are compositions comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 oligonucleotides.

[0028] Also described herein is a system for producing a mutation-resistant anti-viral composition that inactivates a target virus. In some embodiments, the system comprises a computer processor programmed to identify a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to a messenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool. In some embodiments, the system further comprises an output generator that produces a list of N oligonucleotides of the pool identified by the processor in (a) for use as a single composition, wherein N is the number of oligonucleotides that brings the probability of the target virusdeveloping sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1,000 years of viral replication to less than 0.01, given the genome length, the mutation rate, and the virus production rate of the target virus. The output generator displays or otherwise provides the identified pool of at least two oligonucleotides to a user in a form that permits the user to produce the mutation-resistant anti-viral composition.

[0029] In some embodiments, the at least two oligonucleotides are complementary to mRNAs of different open reading frames. In some embodiments, N is calculated as illustrated in FIG. 10.

[0030] In some embodiments, the oligonucleotides are single stranded or double stranded. In some embodiments, the target virus has a genome of 10kb to 30 kb. In some embodiments, / V is between 5 and 12.BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG. 1 A is a pair of graphs of the probability of the SARS-CoV-2 virus, the causative agent of COVID-19, to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The graph demonstrates that the chances of the virus developing a mutation against an oligonucleotide based drug is very high; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously (upper panel). This is demonstrated in the lower panel by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0032] FIG. 1 B is a pair of graphs of the probability of the SARS-CoV-2 virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0033] FIG. 1C is a pair of graphs of the probability of the SARS-CoV-2 virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0034] FIG. 2A is a pair of graphs of the probability of the hepatitis B virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as adrug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of hepatitis B virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that, although lower than that of SARS-CoV-2, the probability of HBV developing a mutation against an oligonucleotide based drug is still very high; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As with FIGS. 1A-1C, this is demonstrated by plotting the probability on a logarithmic scale as 1 / -logio(probability) . This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0035] FIG. 2B is a pair of graphs of the probability of HBV to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0036] FIG. 20 is a pair of graphs of the probability of HBV to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of hepatitis B virus and its known mutation rate at a molecular level.

[0037] FIG. 3A is a pair of graphs of the probability of the smallpox virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of the smallpox virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that, although lower than that of SARS-CoV-2, the probability of smallpox virus developing a mutation against an oligonucleotide based drug is still very high; considerably higher than that hepatitis B virus. However, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As with the previous Figures, this is demonstrated by plotting the probability on a logarithmic scale as 1 / - logio(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect everysingle one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0038] FIG. 3B is a pair of graphs of the probability of smallpox virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0039] FIG. 30 is a pair of graphs of the probability of smallpox virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0040] FIG. 4A is a pair of graphs of the probability of the influenza A virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of the influenza A virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that the probability of influenza A virus developing a mutation against an oligonucleotide based drug is almost as high as that of SARS-CoV-2. However, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As with the preceding Figures, this is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0041] FIG. 4B is a pair of graphs of the probability of influenza A virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0042] FIG. 4G is a pair of graphs of the probability of influenza A virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation.

[0043] FIGS. 5A-5C show the results for SARS-CoV-2 virus with varying numbers of mutations to inactivate the oligonucleotides. FIG. 5A shows the calculations if the oligonucleotides are inactivated by 1 mutation. FIG. 5B shows the calculations if the oligonucleotides are inactivated by 2 mutations. FIG. 5C shows the calculations if the oligonucleotides are inactivated by 3 mutations.

[0044] FIGS. 6A-6C show the results for hepatitis B virus with varying numbers of mutations to inactivate the oligonucleotides. FIG. 6A shows the calculations if the oligonucleotides are inactivated by 1 mutation. FIG. 6B shows the calculations if the oligonucleotides are inactivated by 2 mutations. FIG. 60 shows the calculations if the oligonucleotides are inactivated by 3 mutations. These demonstrate that for each virus, an optimum number of oligonucleotides can be calculated depending on the parameters set.

[0045] FIGS. 7A-7C show the results for smallpox virus with varying numbers of mutations to inactivate the oligonucleotides. FIG. 7A shows the calculations if the oligonucleotides are inactivated by 1 mutation. FIG. 7B shows the calculations if the oligonucleotides are inactivated by 2 mutations. FIG. 70 shows the calculations if the oligonucleotides are inactivated by 3 mutations. These demonstrate that for each virus, an optimum number of oligonucleotides can be calculated depending on the parameters set.

[0046] FIGS. 8A-8C show the results for influenza A virus with varying numbers of mutations to inactivate the oligonucleotides. FIG. 8A shows the calculations if the oligonucleotides are inactivated by 1 mutation. FIG. 8B shows the calculations if the oligonucleotides are inactivated by 2 mutations. FIG. 80 shows the calculations if the oligonucleotides are inactivated by 3 mutations. These demonstrate that for each virus, an optimum number of oligonucleotides can be calculated depending on the parameters set.

[0047] FIG. 9 is a flow chart depicting the steps for the entire process required to design and generate the necessary antisense oligonucleotide constructs. First, the genome of the virus must be known, or, if not available, such as in an emergency, it may need to be sequenced de novo 90. This genome should ideally be analysed and annotated with stop / start codons, genes and open reading frames identified 91 ; however, this may be limited in aforementioned emergency cases. If constructs will be generated against multiple similar viruses, the sequences can be aligned with computer assistance so that only common sequences are used for further analysis 92. Using the known or estimated variables of mutation rate, viral genome size and virus production per person per day, maximum and minimum numbers of oligonucleotide constructs required to generate a mutation proof antiviral formulation are calculated 93. Computer assistance can be used to identify Nmax number suitable sequences against which antisense oligonucleotide constructs will be generated 94, and to ensure that they will not bind human targets, themselves, or each other, or create unwanted secondary or tertiary structures 95. With the antisense oligonucleotide sequences thus defined, they are further modified to improve their cellular targeting and delivery while minimising plasma and intracellular degradation 96. The design stage is now complete and the oligonucleotides are ready to be tested 97.

[0048] FIG. 10 is a flow chart of the process for calculating the number of oligonucleotides required to create a mutation-proof antiviral formulation ( / V). The beginning inputs are vius genome size 100, virus production per person per day 101 , number of mutations required to inactivate each oligonucleotide entity (e.g., M1, M2, M3) 102, and mutation rate, either known or estimated 103. These inputs 100, 101, 102, and 103 are entered into a formula which is used to perform serial calculations for M1, M2, and M3 104. These results are transformed to 1 / (-Log10), and optionally, one can create graphs of the results of calculations of time to resistance 105. The first value of X, number of oligonucleotides, which gives a Logio(t) value of 3 (i.e. , 1000 years) or higher is determined to be A / , the number of oligonucleotides required to create a mutation-proof antiviral formulation 106. This number can be visualized on a graph when the plot line starts to rise with a change in gradient.DETAILED DESCRIPTION

[0049] Described herein is a method to design direct-acting antiviral drugs against which viruses cannot develop resistance by random mutations. The method comprises combining 2 or more complementary strand oligonucleotide chains, each of them approximately 15 to 30 bases long, directed against the mRNAs of the viral agent. The oligonucleotide chains may be modified to include additional ligands such as N-acetylgalactosamine (GalNAc), modified nucleobases such as morpholino bases, be single- or double-stranded, contain additional atomic and molecular residues or bonds, or be packaged in delivery vehicles such as lipid nanoparticles (LNPs) in order to improve cellular drug targeting and delivery.

[0050] In one embodiment, the method comprises some or all of the steps as set out below: a) Determine the minimum / optimal number of complementary strand oligonucleotides required. b) Identify all appropriate target segments in the viral replicon and screen these against the human genome to eliminate potential off target interactions. Prioritise these identified sequences. c) Design the individual oligonucleotides including modifications and a suitable mechanism of delivery according to the virus and cell target type. d) Determine proportions, concentrations, excipients, packaging and physical delivery methods.

[0051] Determining the number of oligonucleotides required is performed by using a mathematical mutation probability model. This model is based on the genome length and the mutation rate of the specific virus in question. It also takes into account the likely patient population size and virus production rate of an infected individual. For a new virus for whichsome of the parameters are not yet known, figures from the same family of viruses or worst case scenario estimates can be used instead. In the example calculations in this application, viruses which are known to have high mutation rates have been used. These determinations can be made with the use of a system, such as one that incorporates a computer processor. The requisite inputs are entered into the system, and the system outputs a list of two or more identified oligonucleotides to be used together in a composition.

[0052] In some embodiments, each oligonucleotide targets a different open reading frame (ORF) / mRNA construct. In some embodiments, such as when more oligonucleotides are required than there are ORFs / mRNA constructs, the targets can be evenly distributed across all ORFs.

[0053] When designing individual oligonucleotides, care is taken to avoid sequence matches against human mRNAs. The targets of the oligonucleotides are selected to not crossover, and the oligonucleotides themselves are selected to not cross-react to form self-dimers, oligo-oligo dimers, self-loops or other unwanted structures that could diminish the efficacy of the binding of the oligonucleotides to their targets.

[0054] The mode of administration and the selection of the vehicle used to deliver the specifically designed, multiple therapeutic oligonucleotide sequences will be determined by the cell types and specified in the drug development process.Definitions

[0055] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

[0056] As used herein, a “control” or “reference” sample means a sample that is representative of normal measures of the respective marker, such as would be obtained from normal, healthy control subjects, or a baseline amount of marker to be used for comparison. Typically, a baseline will be a measurement taken from the same subject or patient. The sample can be an actual sample used for testing, or a reference level or range, based on known normal measurements of the corresponding marker.

[0057] As used herein, a “significant difference” means a difference that can be detected in a manner that is considered reliable by one skilled in the art, such as a statistically significant difference, or a difference that is of sufficient magnitude that, under the circumstances, can be detected with a reasonable level of reliability. In one example, an increase or decrease of 10% relative to a reference sample is a significant difference. In other examples, an increase or decrease of 20%, 30%, 40%, or 50% relative to the reference sample is considered asignificant difference. In yet another example, an increase of two-fold relative to a reference sample is considered significant.

[0058] “Nucleotide sequence” refers to a heteropolymer of deoxyribonucleotides, ribonucleotides, or peptide-nucleic acid sequences that may be assembled from smaller fragments, isolated from larger fragments, or chemically synthesized de novo or partially synthesized by combining shorter oligonucleotide linkers, or from a series of oligonucleotides, to provide a sequence which is capable of expressing the encoded protein.

[0059] The term "primer," as used herein, means an oligonucleotide designed to flank a region of DNA to be amplified. In a primer pair, one primer is complementary to nucleotides present on the sense strand at one end of a polynucleotide fragment to be amplified and another primer is complementary to nucleotides present on the antisense strand at the other end of the polynucleotide fragment to be amplified. A primer can have at least about 11 nucleotides, and preferably, at least about 16 nucleotides and no more than about 35 nucleotides. Typically, a primer has at least about 80% sequence identity, preferably at least about 90% sequence identity with a target polynucleotide to which the primer hybridizes.

[0060] As used herein, the term “probe” refers to an oligonucleotide, naturally or synthetically produced, via recombinant methods or by PCR amplification, that hybridizes to at least part of another oligonucleotide of interest. A probe can be single-stranded or doublestranded.

[0061] As used herein, the term “active fragment” refers to a substantial portion of an oligonucleotide that is capable of performing the same function of specifically hybridizing to a target polynucleotide.

[0062] As used herein, "hybridizes," "hybridizing," and "hybridization" means that the oligonucleotide forms a noncovalent interaction with the target DNA molecule under standard conditions. Standard hybridizing conditions are those conditions that allow an oligonucleotide probe or primer to hybridize to a target DNA molecule. Such conditions are readily determined for an oligonucleotide probe or primer and the target DNA molecule using techniques well known to those skilled in the art. The nucleotide sequence of a target polynucleotide is generally a sequence complementary to the oligonucleotide primer or probe. The hybridizing oligonucleotide may contain nonhybridizing nucleotides that do not interfere with forming the noncovalent interaction. The nonhybridizing nucleotides of an oligonucleotide primer or probe may be located at an end of the hybridizing oligonucleotide or within the hybridizing oligonucleotide. Thus, an oligonucleotide probe or primer does not have to be complementary to all the nucleotides of the target sequence as long as there is hybridization under standard hybridization conditions.

[0063] The term "complement" and "complementary" as used herein, refers to the ability of two nucleic acid molecules to base pair with each other. For example, in DNA, adenine (A) is complementary to thymine (T). In RNA, adenine (A) is complementary to uracil (II). In some embodiments, complementarity refers to an antisense compound that is capable of base pairing with its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity. Typically, two DNA molecules are complementary if they hybridize under the standard conditions referred to above. Typically, two DNA molecules are complementary if they have at least about 80% sequence identity, preferably at least about 90% sequence identity.

[0064] As used herein, "pharmaceutically acceptable carrier" or “excipient” includes any material which, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers such as a phosphate buffered saline solution, water, emulsions such as oil / water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline.

[0065] Compositions comprising such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, PA, 1990).

[0066] As used herein, the term "subject" includes any vertebrate animal including, but not limited to, a human, non-human primate, mouse, rat, guinea pig, rabbit, cow, dog, cat, horse, goat, bird, reptile, or fish. In some embodiments, the subject is a mammal. In some embodiments, the subject is a reptile. In some embodiments, the subject is a domesticated animal, a wild animal, or an agricultural animal.

[0067] As used herein, “a” or “an” means at least one, unless clearly indicated otherwise.Compositions & Methods

[0068] Described herein is a method of producing a mutation-resistant anti-viral composition that inactivates a target virus. In some embodiments, the method comprises identifying a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to amessenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool. The method further comprises combining / V oligonucleotides of the pool into a single composition, wherein / V is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1 ,000 years of viral replication to less than 0.01 , given the genome length, the mutation rate, and the virus production rate of the target virus. In this context, "ineffective" means the oligonucleotide is no longer sufficiently complementary to bind to and inactivate the target virus mRNA.

[0069] The determination of / V is based on the discovery of a strategy to combine enough oligonucleotides in a composition such that viral mutations cannot render the composition ineffective. In order for the composition to lose its efficacy, every single oligonucleotide of the composition must be rendered ineffective at the same time. If one oligonucleotide is rendered ineffective through multiple mutations, yet another is still active, the composition will still be potent. Therefore, the efficacy of the composition is dependent on multiple simultaneous event probability calculations. These calculations can be used to determine the number of oligonucleotides to be employed in a manner that is tailored to the characteristics of the target viral pathogen. Exemplary calculations for determining the probability of ASO based drugs becoming ineffective are shown in the accompanying Appendix.

[0070] Also provided is a method of inactivating a virus, the method comprising contacting the virus with a mutation-resistant anti-viral composition as described herein. Additionally provided is a method of inhibiting viral replication, the method comprising contacting the virus with a mutation- resista nt anti-viral composition as described herein. In some embodiments, the composition as described herein, or equivalent means for inactivating the target virus, is administered to a subject who is infected, or at risk of being infected, with the target virus.

[0071] In some embodiments, the at least two oligonucleotides are complementary to mRNAs of different open reading frames. In some embodiments, / V is two. In some embodiments, / V is at least 3 and as high as 20. In some embodiments, / V is 3 to 15. In some embodiments, / V is 5 to 12. In some embodiments, / V is greater than 12. In some embodiments, / V is up to 20. Representative examples of how to determine / V for a given pathogen are described in the Examples below.

[0072] In some embodiments, each of the oligonucleotides is between 15 and 25 bases in length. In some embodiments, each of the oligonucleotides is between 15 and 20 bases in length. In some embodiments, each of the oligonucleotides is about 20 bases in length.

[0073] In some embodiments, the oligonucleotides are single stranded or double stranded. In some embodiments, the oligonucleotides comprise a chemical modification, modified nucleobase, and / or a conjugate. In some embodiments, the chemical modification comprises N-acetylgalactosamine. In some embodiments, the conjugate comprises a cell penetrating peptide moiety. In some embodiments, the modified nucleobase is a morpholino base.

[0074] In some embodiments, the target virus has a genome of 1 .5 kb to 1300 kb. In some embodiments, the target virus has a genome of 10kb to 30 kb. In some embodiments, the target virus has a genome of 15 kb to 20 kb.

[0075] In some embodiments, the target virus is SARS-CoV-2, hepatitis B virus, smallpox virus, or influenza A virus. In some embodiments, the target virus is SARS-CoV-2 and / V is 6. In some embodiments, the target virus is SARS-CoV-2 and / V is 9. In some embodiments, the composition directed against SARS-CoV-2 comprises agents targeting at least 6 oligonucleotides selected from SEQ ID NOs: 1-9. In some embodiments, the target virus is hepatitis B virus and / V is 3. In some embodiments, the target virus is small pox and / V is 4. In some embodiments, the target virus is influenza A virus and / V is 3 to 4. In some embodiments, the target virus is HIV and / V is 3 to 4.

[0076] Also described herein is a composition comprising the oligonucleotides that are complementary to the target virus mRNA. In some embodiments, the composition comprises 2 to 20 oligonucleotides. In some embodiments, the composition comprises 5 to 12 oligonucleotides. In some embodiments, the composition comprises 3 to 6 oligonucleotides. Also contemplated are compositions comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 oligonucleotides.

[0077] Embodiments of methods and compositions described herein can be used to treat viral infection in cells and subjects. Molecules, agents, compounds, compositions, and methods described herein may be used to treat a subject having, or at risk of having a viral infection. Contacting a virus particle in a cell, on a cell, and / or in a subject with two or more oligonucleotides as described herein in an amount effective to inhibit infectivity of the virus particle, treats an infection by the virus of the cell and / or subject. Certain embodiments include methods and compositions useful to a treat viral infection in cells and in subjects. A virus that can be inhibited by two or more oligonucleotides as described herein, may be an RNA virus or a DNA virus. One or more virus particles in a cell, on a cell, and / or in a subject indicate infection of the cell and / or subject, respectively, with that virus.Viral infections that may be treated using compositions as described herein include, but are not limited to, RNA and DNA viruses. Examples of virus particles and viruses that may be inhibited and treated, respectively, using compositions and methods as described herein include, but are not limited to: SARS-CoV-2, hepatitis B virus, smallpox virus, and influenza A virus.

[0078] The compositions and methods can be used to inhibit virus particle infectivity and to treat viral infections in human and non-human subjects. For instance, methods and compositions described herein can be used in veterinary applications (for examples in zoos, reserves, farms, in the wild, etc.) as well as in human treatment regimens. In some embodiments, the subject is a human. In some embodiments, the subject is at risk of having, or has a viral infection. In some embodiments, the cell is a cell that contains a virus particle. In certain embodiments, the cell is a cell that is in contact with a virus particle on its external surface. In some aspects, the method of treatment reduces infectivity of a virus particle that is external to a cell that is not infected with the virus of the virus particle. Some embodiments of the method can be used to inhibit infectivity of a virus particle such that it does not enter a cell, does not leave a cell it is in, and / or does not propagate.

[0079] Non-limiting examples of subjects and cells to which the methods and compositions can be applied are subjects and cells that are diagnosed with, suspected of having, or believed to be at risk of having one or more viral infections. The treatment may be applied to a subject who, at the time of treatment, has been diagnosed with a viral infection.

[0080] In some embodiments, a subject is at risk of having or developing a viral infection that may be treated using methods and compositions as described herein. A subject at risk of developing a viral infection has an increased probability of developing the viral infection compared to a control risk of developing the viral infection. In some embodiments, a level of risk may be statistically significant compared to a control level of risk. A subject at risk may include, for instance, a subject who is suspected to or known to have been exposed to a virus reservoir (a non-limiting example of which is rodent that harbors hantavirus); a subject who is suspected to or known to have been exposed to one or more humans or animals believed or known to be infected with the virus; a subject known to have had a previous diagnosis of the virus, who may be at risk for a relapse.Administration

[0081] Treatment can be administered in a single dose or as a series of doses administered over time. Dosage and treatment regimens can be determined by the treating physician, taking into account disease severity, patient condition, and other factors. The duration of treatment depends on the viral response to the treatment.

[0082] Treatment may be administered to a person with the infection or who has been exposed to the infection. Depending on the target virus, treatment duration can vary from a single dose to long term treatment. Depending on target tissue, a variety of tissue delivery mechanisms may be used. The treatment may be given as a single dose, 2 doses or may require further dosages or long term treatment.

[0083] Treatment of a subject comprises administering a therapeutically effective amount of an oligonucleotide composition, to the subject. A therapeutically effective amount is an amount sufficient to ameliorate symptoms of disease. A typical route of administration for oligonucleotides for systemic applications is by parenteral injection, either intravenous (IV) infusion or subcutaneous (SC) injection.Systems

[0084] A system for producing a mutation-resistant anti-viral composition that inactivates a target virus can be set up to facilitate the above-described methods of producing a mutationresistant anti-viral composition that inactivates a target virus. In some embodiments, the system comprises a computer processor programmed to identify a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to a messenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool. In some embodiments, the system further comprises an output generator that produces a list of / V oligonucleotides of the pool identified by the processor in (a) for use as a single composition, wherein / V is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1 ,000 years of viral replication to less than 0.01 , given the genome length, the mutation rate, and the virus production rate of the target virus. The output generator displays or otherwise provides the identified pool of at least two oligonucleotides to a user in a form that permits the user to produce the mutationresistant anti-viral composition. The list can be displayable to a user, for example, on a screen or printed out on paper or otherwise presented on a medium for providing a user with access to the identified oligonucleotides. Such a list can thus be used in the design and preparation of a composition for therapeutic use.

[0085] In some embodiments, the at least two oligonucleotides are complementary to mRNAs of different open reading frames. In some embodiments, N is calculated as described in FIG. 10 and in Example 4 below. / V is the lowest value of X (number of oligonucleotides) that gives a Log (t+1) value of 3 (corresponding to 1 ,000 years or longer).N is thus the number of oligonucleotides to be included in an anti-viral composition that would be sufficient for resistance to mutations. First, probability calculations are performed for M=1, M=2 and M=3 from A / =1 up to at least N=20 using the oligomer length, genome length / size, and mutation rate. The results are then converted to a population time (in years) to event calculation based on estimated disease population size using the formula below:

[0086] t = [P / (Virus production per person per day x disease population x (1 -predicted suppression rate))] / 365, where t is time in years to event calculation and P is the calculated probability of the virus developing y number of mutations (i.e., M1 , M2 or M3) in a formulation containing X number of oligonucleotides after it has been transformed through a 1 / -log (V) operation.

[0087] In some embodiments, the oligonucleotides are single stranded or double stranded. In some embodiments, the target virus has a genome of 10kb to 30 kb. In some embodiments, N is between 5 and 12.EXAMPLES

[0088] The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.

[0089] Example 1 : SARS-CoV-2 virus

[0090] Figure 1 A shows a graph of the probability of the SARS-CoV-2 virus, the causative agent of COVID-19, to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with a mathematical model based on the genome length of SARS-CoV-2, and the known mutation rate of the virus at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that the chances of the virus developing a mutation against an oligonucleotide based drug is very high; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / - logio(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0091] Nucleotide probes of all classes, from simple polymerase chain reaction primers to antisense drugs, retain affinity to bind to a target even if there is a 1 or 2 nucleotide mismatch. This is the reason why target selection requires multiple mismatches against human mRNA targets and 4 is an absolute minimum. Therefore, a virus will need to develop 2 or 3 mutations against every single one of the oligonucleotides being used against it simultaneously in order to be able to develop full resistance. Figure 1 B shows a graph of the probability of the SARS-CoV-2 virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model based on the genome length of SARS-CoV-2, and the known mutation rate of the virus at a molecular level. The graph demonstrates that the probability of the virus developing 2 mutations against an oligonucleotide based drug in a single generation is still very high; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0092] Figure 1 C shows a graph of the probability of the SARS-CoV-2 virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model based on the genome length of SARS-CoV-2, and the known mutation rate of the virus at a molecular level. The graph demonstrates that the probability of the virus developing 3 mutations against an oligonucleotide based drug in a single generation is lower, but still very high compared to the speed of replication of the virus; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph further demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0093] Example 2: Hepatitis B virus, smallpox virus and influenza A virus

[0094] To validate the mathematical model, the same calculations were carried out with other viruses with known and published molecular mutation rates; hepatitis B virus, smallpox virus and influenza A virus.

[0095] Figure 2 A shows the graph of the probability of the hepatitis B virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of hepatitis B virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that, although lower than that of SARS-CoV-2, the probability of HBV developing a mutation against an oligonucleotide based drug is still very high; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As before, this is demonstrated by plotting the probability on a logarithmic scale as 1 / -logi0(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0096] Figure 2 B shows the graph of the probability of HBV to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of hepatitis B virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 2 mutations against an oligonucleotide based drug in a single generation is lower but not insignificant; however, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0097] Figure 2 C shows the graph of the probability of HBV to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis)versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of hepatitis B virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 3 mutations against an oligonucleotide based drug in a single generation is much lower; therefore, a single oligonucleotide might have significant efficacy. However, the model would predict that treatment failure would be likely at some point in the future, especially as hepatitis B is usually a chronic infection which may require long term treatment. The model shows that if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced further in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -logio(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0098] Figure 3 A shows the graph of the probability of the smallpox virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of the smallpox virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that, although lower than that of SARS-CoV-2, the probability of smallpox virus developing a mutation against an oligonucleotide based drug is still very high; considerably higher than that hepatitis B virus. However, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As before, this is demonstrated by plotting the probability on a logarithmic scale as 1 / - logio(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0099] Figure 3 B shows the graph of the probability of smallpox virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of the smallpox virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 2 mutations against an oligonucleotide based drug in a singlegeneration is lower but still very high, and if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion. The probability nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0100] Figure 3 C shows the graph of the probability of smallpox virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of the smallpox virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 3 mutations against an oligonucleotide based drug in a single generation is much lower; therefore, a single oligonucleotide might have significant efficacy. However, the model would predict that treatment failure would be a possibility if large numbers of people are being treated, e.g., following a biological weapon attack. The model shows that if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / - logio(probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0101] Figure 4 A shows the graph of the probability of the influenza A virus to develop a single mutation which falls within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. This was calculated with the mathematical model adjusted for the genome length of the influenza A virus and its known mutation rate at a molecular level. The model assumes the highest known mutation rate in order not to have a bias in favour of higher drug efficacy. The graph demonstrates that the probability of influenza A virus developing a mutation against an oligonucleotide based drug is almost as high as that of SARS-CoV-2. However, if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. As before, this is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship betweenthe reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is a plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0102] Figure 4 B shows the graph of the probability of influenza A virus to develop 2 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of the influenza A virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 2 mutations against an oligonucleotide based drug in a single generation is lower but still very high, and if multiple, non-overlapping oligonucleotide based drugs are used, the probability is reduced dramatically in an exponential fashion. The probability nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0103] Figure 4 C shows the graph of the probability of influenza A virus to develop 3 mutations which fall within the region of the 20-mer oligonucleotide(s) being used as a drug against it (y axis) versus the number of oligonucleotides (x axis) in each generation. The was calculated with the mathematical model adjusted for the genome length of the influenza A virus and its known mutation rate at a molecular level. The graph demonstrates that the probability of the virus developing 3 mutations against an oligonucleotide based drug in a single generation is lower; however, a drug based on a single antisense oligonucleotide would lose its efficacy almost immediately. However, the model shows that if multiple, nonoverlapping oligonucleotide based drugs are used, the probability of the virus developing mutations in all the oligonucleotides, which would be necessary to inactivate the drug completely, is reduced in an exponential fashion and nears 0 when multiple oligonucleotides are used simultaneously. This is demonstrated by plotting the probability on a logarithmic scale as 1 / -log (probability). This graph demonstrates the exponential relationship between the reduction in the probability of the virus’s ability to develop mutations which affect every single one of the oligonucleotides, and that there is the same plateau of the additional benefit provided by the increased number of simultaneously administered oligonucleotides.

[0104] In order to test the validity of the model and the conclusions, further models were developed to calculate how long it would take for viruses to develop mutations against oligonucleotide based drugs under different circumstances. The models developed coverindividual, population and cell culture levels. The models developed thus far have been biased against the drugs to ensure a high degree of rigour in the modelling algorithm. A further model was developed to estimate how long it would take for the SARS-CoV-2 virus to develop resistance against a short chain nucleotide based drug in an experimental cell culture model. In order to achieve a more realistic result, instead of using the maximum mutation rate, an average mutation rate of 5 x 10-4was used in the modelling calculation. Additional input parameters included the number of new virus particles produced by an infected cell per 24 hours, standard number of cells in seeded per well in the cell culture experiments and assays in published literature, possible growth suppression rates of the virus in the presence of the drug, and number of mutations within the target binding sequence(s) required to inactivate the drug.

[0105] Assuming a level of suppression similar to that of licensed drugs in the same class (90%), and that it would require 3 or more mutations to inactivate the drug, this model predicted that it would take 2.34 days for the virus to develop resistance against a drug which is a single short chain oligonucleotide. This was compared to the results published by an independent scientific group which found that SARS-CoV-2 developed resistance against oligonucleotide drugs within 2 to 3 days in a cell culture model. This is the only available hard data point to be able to compare and test the assumptions of the models developed, and the close correlation demonstrates that there is a significant level of scientific legitimacy to the models. Table 1 shows the results produced by this model for SARS-CoV-2 as number of days for resistance to emerge in a cell culture model based on 90% suppression of virus production by the drug. Different columns show the results based on assuming that an individual oligonucleotide is inactivated by 1, 2 or 3 mutations within its target region, different rows show results based on increasing the number of oligonucleotides within the combination. The red highlighted cell denotes the figure which correlates with published literature. This model was subsequently applied to hepatitis B virus, smallpox virus and influenza A virus, and these results are provided in tables 2, 3 and 4 respectively. The results from all 4 viruses demonstrate the exponential increase in the time required for the viruses to develop resistance to the drugs with increasing numbers of oligonucleotides.

[0106] Table 1 SARS-CoV-2

[0108] Table 2 Hepatitis B

[0109] Table 3 Smallpox

[0110] Table 4 Influenza A

[0111] Example 3: Estimation of Time to Resistance

[0112] The input parameters of the resistance time prediction model were adapted to include virus copies produced by an infected person per day and estimated populations in order to derive estimates for how long it would take for a virus to develop resistance against drugs composed of up to 20 oligonucleotides. As the relationship has proven to be exponential, the times in years were converted to log and plotted against the numbers of oligonucleotides in the combination. The calculations were repeated with 1, 2 or 3 mutations within the target region being necessary to inactivate a given oligonucleotide. Figure 5 shows the results for SARS-CoV-2 virus with graph A representing calculations if oligonucleotides are inactivated by 1 mutation, graph B with 2 mutations, and graph C with 3 mutations. Figures 6, 7 and 8 show the same with hepatitis B virus, smallpox virus and influenza A virus respectively. These demonstrate that for each virus, an optimum number of oligonucleotides can be calculated depending on the parameters set.

[0113] All the models have been developed to be very conservative and to underestimate the time to develop resistance. They do not take into account immune function, nonsense mutations which make a virus non-viable, unable to replicate further, or too weak to survive or infect further hosts / host cells. They are purely mathematical models, not biological models. Therefore, it would be expected that in a biological system, time to resistance would be even longer than predicted by the models.

[0114] Example 4: Determination of / V

[0115] For the composition comprising multiple oligonucleotides to become ineffective, every single oligonucleotide must be rendered ineffective at the same time. If one oligonucleotide is rendered ineffective through multiple mutations, yet another is still active, the composition will still be potent. Therefore, the efficacy of the drug is dependent on multiple simultaneous event probability calculations.

[0116] FIG. 9 is a flow chart illustrating a representative process. The genome sequence of the virus to be targeted 90 may be available or known, or a viral sample may need to be sequenced, for example, in the case of an emergent virus or a biological attack. If possible, the genome is annotated to identify start / stop codons, genes, and open reading frames 91. In an emergency situation, this may not be possible, such as when dealing with an emergent disease or a biological weapon. If constructs will be generated against a family, or related group of viruses, then the genomes are aligned to identify common segments 92. The known or estimated mutation rate of the virus, and the formulae provided herein, are then used to calculate the minimum and maximum numbers of oligonucleotides required to render the formulation mutation-proof, Nmin and Nmax 93. When preparing a formulation directedagainst a family or group of viruses, one can use the highest mutation rate within the family or group.

[0117] Upon identifying Nmax, one then identifies that Nmax number of sequences 15-30 bases in length each, within the virus genome, against which oligonucleotides can be designed for targeting 94. This step can be performed with the assistance of a computer or other processor. The assistance of a computer I processor can also be used to check the deisgned oligonucleotides against identified sequences to ensure they would not bind human mRNAs, themselves or each other, form loops or other unwanted secondary / tertiary structures, and have the required physicochemical properties 95. Next, one can optionally design appropriate oligonucleotide modifications to improve cell targeting, for example, by using modified nucleotides to avoid degradation by nucleases, by adding peptide or saccharide moieties for cellular targeting, binding, and uptake, by using lipid nanoparticle delivery systems, and the like 96. At this point, one can devise and / or select a formulation of antisense oligonucleotide(s) to manufacture and test 97. Oligonucleotides are ideally tested individually and in combination. In emergency situations, such as responding to a biological warfare agent, it would be acceptable to test the combination alone.

[0118] N is calculated using the known or estimated mutation rate per incorporated base, genome length, virus production per day, disease population, expected suppression rate and the number mutations required to render an oligonucleotide ineffective. Xis the number of oligonucleotides, and is entered into the calculations at X=1 , X=2, X=3, and so on, for example, up to X=20. N is the lowest value of X (number of oligonucleotides) that gives a Log (t+1) value of 3 (corresponding to 1 ,000 years or longer). N is thus the number of oligonucleotides to be included in an anti-viral composition that would be sufficient for resistance to mutations.

[0119] In some embodiments, the number of mutations required to render an oligonucleotide ineffective ( / W) is 1. In some embodiments, M is 2. In some embodiments, M is 3.

[0120] First, probability calculations are performed for M=1, M=2 and M=3 from A / =1 up to at least N=20 using the formulae below where O is oligomer length, G is genome length / size, R is mutation rate

[0121] M = 1 in X number of oligomers:

[0122] [(O / G) x (R x G)]x= V1x

[0123] M = 2 in X number of oligomers:

[0124] ([(R x G) x (O / G)] x [(R x G) x ((O-1) / G)])x= V2X

[0125] M = 3 in X number of oligomers:

[0126] ([(R x G) x (O / G)] x [(R x G) x ((0-1 ) / G)] x [(R x G) x ((O-2) / G)])x= V3X

[0127] In the above calculations, Vyxis the calculated probability of the virus developing y number of mutations (i.e., M1 , M2 or M3) in a formulation containing X number of oligonucleotides, and is assigned the value V.

[0128] All results are transformed to logarithmic scale by the formula 1 / -log (V). The results of this logarithmic transformation are called P. The P values are then converted to a population time (in years) to event calculation based on estimated disease population size using the formula below:

[0129] t = [P / (Virus production per person per day x disease population x (1 -predicted suppression rate))] / 365, where t is time in years to mutation event and P is the calculated probability of the virus developing y number of mutations (i.e., M1 , M2 or M3) in a formulation containing X number of oligonucleotides after it has been transformed through the 1 / -log (V) operation.

[0130] The results can then be transformed to logarithmic scale by using the formula Log (t + 1) to linearise them. This value is termed delta (5) and the first value of N which gives a 5 value of 3 (i.e., 1000 years) or higher is the minimum N value. This can be visualised when values are plotted on a graph ( / V on X-axis and 5 on Y-axis). This allows a clear visualization of when N is large enough to reduce the probability of the virus developing a mutation within the population within a given time period. Minimum N values will be different depending on whether M is 1 , 2 or 3. Whether M is 1 , 2 or 3 will be different depending on the virus and virus family.

[0131] As can be seen in the flow diagram shown in FIG. 10, in the first step, the primary variables - virus genome size 100, virus production per person per day 101 , virus mutation rate 103 and number of mutations presumed to inactivate an oligonucleotide construct 102 - are entered into the appropriate formula described above for M1 , M2 and M3 104. Virus genome is almost always going to be known precisely. Mutation rate and virus production per person per day may or may not be known. If they are unknown, they can be estimated from similar viruses, or from viruses in the same family. One can use 1 , 2 or 3 mismatches corresponding to 1 mutation, 2 mutations or 3 mutations within the region of the oligonucleotide to define lack of efficacy from a standard biochemical laboratory techniques and accepted practice on nucleotide probe design.

[0132] Each calculation gives the probability for a set number of oligonucleotide constructs; therefore, serial calculations are performed to derive a results table to match number of constructs in the formulations and the probability of mutation. These calculations are repeated from N=1 up to at least N=20 with each of M1 , M2 and M3, deriving 3 tables. In thenext step, the probabilities thus calculated are transformed into logarithmic scale as 1 / (-log ) 105. For each data point in all the tables, time to mutation within the patient population is calculated with the formula as set out in the above formula 106. This gives a further table of results for M1 , M2 and M3 with the number of oligonucleotides in the formulation against the time it would take the virus to develop a mutation against a formulation containing that many constructs.

[0133] These data can be plotted on separate graphs for M1 , M2 and M3, where x-axis is the number of oligonucleotide constructs, and y-axis is log time. When the graphs are plotted, it is seen that at a defined point, there is a sharp change in gradient and thus an increase in time required for that virus to be able to develop resistance to the formulation. The x-axis value corresponding to a minimum y-axis value of 3 (equivalent to 1,000 years) is the appropriate value for the N number at any given M graph.

[0134] N value with M1 is designated Nmax; oligonucleotide constructs are not inactivated with a single mutation falling within the construct, therefore, N values calculated with M1 will be the maximum ever needed. For most viruses, N value at M3 will be sufficient, and can be set as Nmin, since short oligonucleotides continue to bind with significant affinity even with 2 mismatches; however, where multiple viruses are being catered for in a single formulation, or for other biological reasons, it may be prudent to use N number derived with the graph of M2 as Nmin in some circumstances.

[0135] Example 5: Representative Composition for Inactivation of SARS-CoV-2

[0136] The correlation between the mathematical model described herein with the laboratory data from Rosenke et al. suggests that, to render a modified oligonucleotide ineffective against SARS-CoV-2, M=3. Thus, our SARS-CoV-2, M=3 model predicts that a minimum of 6 modified oligonucleotides will be necessary in order to reduce the probability of SARS- CoV-2 virus developing a mutation to inactivate all the modified oligonucleotides within a 1000-year time span to 0.01. With a more conservative M=2 model, the minimum number of modified oligonucleotides to lower probability of mutation to the same threshold would be 9. Examples of sequences within the transcriptome of SARS-CoV-2 which would be suitable targets for these modified oligonucleotides, which also fulfil the criteria described herein are:GAGACATTATACTTAAACC (SEQ ID NO: 1)CAACTCCGCGAACCCATGCTTCAG (SEQ ID NO: 2)GATTGAACGGTTCGTGTCTTTAG (SEQ ID NO: 3)AAGTCTAACATAATAAGAGG (SEQ ID NO: 4)AGGAGTCAAATTACATTACA (SEQ ID NO: 5)CTAGTTACACTAGCCATCC (SEQ ID NO: 6)CATCTCGTTGACTTTCAGG (SEQ ID NO: 7)TGGTATATTAGAGTAGGAGC (SEQ ID NO: 8)GGGCTATATAAACGTTTTCG (SEQ ID NO: 9).

[0137] Throughout this application various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to describe more fully the state of the art to which this invention pertains.

[0138] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention.Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Claims

What is claimed is:

1. A method of producing a mutation-resistant anti-viral composition that inactivates a target virus, the method comprising:(a) identifying a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to a messenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool; and(b) combining / V oligonucleotides of the pool into a single composition, wherein / V is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1,000 years of viral replication to less than 0.01, given the genome length, the mutation rate, and the virus production rate of the target virus.

2. The method of claim 1 , wherein the at least two oligonucleotides are complementary to mRNAs of different open reading frames.

3. The method of claim 1 , wherein / V is two.

4. The method of claim 1, wherein / V is calculated as follows:(a) performing probability calculations for M=1 , M=2 and M=3 from X=1 up to at least X=20, where M is number of mutations to render ineffective an oligonucleotide, O is oligomer length, G is genome length / size, R is mutation rate:M = 1 in X number of oligomers: [(O / G) x (R x G)]x= V1xM = 2 in X number of oligomers: ([(R x G) x (O / G)] x [(R x G) x ((O-1) / G)])x= V2XM = 3 in X number of oligomers: ([(R x G) x (O / G)] x [(R x G) x ((O-1) / G)] x [(R x G) x((O-2) / G)])x= V3Xwherein Vyxis the calculated probability of the target virus developing y number of mutations (M=1, 2, or 3) in a composition containing X number of oligonucleotides;(b) transforming result obtained in (a) to logarithmic scale by the formula 1 / - log (X) where X is the result of the calculation in (a) to obtain P;(c) converting the results obtained in (b) to population time (in years) to event calculation based on estimated disease population size using the formula below:t = [P / (Virus production per person per day x disease population x (1 -predicted suppression rate))] / 365, where t is time in years to event calculation; and(d) transforming the t obtained in (c) to logarithmic scale as log (t+1); wherein N is the lowest value of X that results in a Log (t+1) value of 3.

5. The method of claim 1, wherein the oligonucleotides are single stranded or double stranded.

6. The method of claim 1, wherein the oligonucleotides comprise a chemical modification, modified nucleobase, and / or a conjugate.

7. The method of claim 6, wherein the chemical modification comprises N- acetylgalactosamine.

8. The method of claim 6, wherein the conjugate comprises a cell penetrating peptide moiety.

9. The method of claim 6, wherein the modified nucleobase is a morpholino base.

10. The method of claim 1, wherein the target virus has a genome of 10kb to 30 kb.

11. The method of claim 1 , wherein N is between 5 and 12.

12. The method of claim 1, wherein the target virus is SARS-CoV-2, hepatitis B virus, smallpox virus, or influenza A virus.

13. The method of claim 12, wherein the target virus is SARS-CoV-2 and N is 6.

14. The method of claim 12, wherein the target virus is hepatitis B virus and N is4.

15. The method of claim 12, wherein the target virus is influenza A virus and N is 3.

16. A system for producing a mutation-resistant anti-viral composition that inactivates a target virus, the system comprising:(a) a computer processor programmed to identify a pool of at least two oligonucleotides, wherein each of said oligonucleotides is between 15 and 30 bases in length, wherein each of said oligonucleotides is complementary to a messenger RNA (mRNA) of the target virus, wherein each of said oligonucleotides is not complementary to human mRNA, and wherein no oligonucleotide of the pool binds to another oligonucleotide of the pool; and(b) an output generator that produces a list displayable to a user of / V oligonucleotides of the pool identified by the processor in (a) for use as a single composition, wherein / V is the number of oligonucleotides that brings the probability of the target virus developing sufficient mutations to render ineffective all of the oligonucleotides of the pool within the human population in 1 ,000 years of viral replication to less than 0.01 , given the genome length, the mutation rate, and the virus production rate of the target virus.

17. The system of claim 16, wherein the at least two oligonucleotides are complementary to mRNAs of different open reading frames.

18. The system of claim 16, wherein / V is calculated as in claim 4.

19. The system of claim 16, wherein the oligonucleotides are single stranded or double stranded.

20. The system of claim 16, wherein the target virus has a genome of 10kb to 30 kb.21 . The system of claim 16, wherein / V is between 5 and 12.

Images